>Feature sequence001 156 1262 gene locus_tag LOCUS_00010 156 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1698 2891 gene locus_tag LOCUS_00020 1698 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3041 3454 gene locus_tag LOCUS_00030 3041 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3540 4535 gene locus_tag LOCUS_00040 3540 4535 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_00040 4749 5792 gene locus_tag LOCUS_00050 4749 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6038 6913 gene locus_tag LOCUS_00060 6038 6913 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921962.1 protein_id gnl|my_center|LOCUS_00060 7690 6968 gene locus_tag LOCUS_00070 7690 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7879 7703 gene locus_tag LOCUS_00080 7879 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11765 8400 gene locus_tag LOCUS_00090 11765 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12588 11911 gene locus_tag LOCUS_00100 12588 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14046 12724 gene locus_tag LOCUS_00110 14046 12724 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 protein_id gnl|my_center|LOCUS_00110 14309 14710 gene locus_tag LOCUS_00120 14309 14710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16622 14787 gene locus_tag LOCUS_00130 16622 14787 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812952.1 protein_id gnl|my_center|LOCUS_00130 16846 18084 gene locus_tag LOCUS_00140 16846 18084 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923038.1 protein_id gnl|my_center|LOCUS_00140 19198 18032 gene locus_tag LOCUS_00150 gene ftsW 19198 18032 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_00150 19632 20417 gene locus_tag LOCUS_00160 19632 20417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21028 20591 gene locus_tag LOCUS_00170 gene aroH 21028 20591 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_00170 21862 21059 gene locus_tag LOCUS_00180 21862 21059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23676 21889 gene locus_tag LOCUS_00190 gene lepB 23676 21889 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442624.1 protein_id gnl|my_center|LOCUS_00190 24184 27231 gene locus_tag LOCUS_00200 24184 27231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 27400 30669 gene locus_tag LOCUS_00210 27400 30669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 31810 30956 gene locus_tag LOCUS_00220 gene accD 31810 30956 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327662.1 protein_id gnl|my_center|LOCUS_00220 32532 31951 gene locus_tag LOCUS_00230 32532 31951 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332332.1 protein_id gnl|my_center|LOCUS_00230 33239 32535 gene locus_tag LOCUS_00240 gene rpe 33239 32535 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118429.1 protein_id gnl|my_center|LOCUS_00240 34327 33638 gene locus_tag LOCUS_00250 34327 33638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 34528 35388 gene locus_tag LOCUS_00260 34528 35388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 36382 35435 gene locus_tag LOCUS_00270 36382 35435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 37030 36563 gene locus_tag LOCUS_00280 37030 36563 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 protein_id gnl|my_center|LOCUS_00280 37275 37087 gene locus_tag LOCUS_00290 37275 37087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37840 39279 gene locus_tag LOCUS_00300 37840 39279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 39491 39249 gene locus_tag LOCUS_00310 39491 39249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39629 42388 gene locus_tag LOCUS_00320 39629 42388 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_00320 42511 43554 gene locus_tag LOCUS_00330 42511 43554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 46825 43622 gene locus_tag LOCUS_00340 46825 43622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 47726 47475 gene locus_tag LOCUS_00350 gene csrA 47726 47475 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_00350 48229 47789 gene locus_tag LOCUS_00360 48229 47789 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198267.1 protein_id gnl|my_center|LOCUS_00360 51462 48439 gene locus_tag LOCUS_00370 51462 48439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 53255 51549 gene locus_tag LOCUS_00380 gene flgK 53255 51549 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616092.1 protein_id gnl|my_center|LOCUS_00380 53781 53296 gene locus_tag LOCUS_00390 53781 53296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 54283 53963 gene locus_tag LOCUS_00400 54283 53963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 55362 54331 gene locus_tag LOCUS_00410 55362 54331 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123602.1 protein_id gnl|my_center|LOCUS_00410 56248 55577 gene locus_tag LOCUS_00420 56248 55577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 57419 56238 gene locus_tag LOCUS_00430 57419 56238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 58228 57422 gene locus_tag LOCUS_00440 gene flgG 58228 57422 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329888.1 protein_id gnl|my_center|LOCUS_00440 59024 58272 gene locus_tag LOCUS_00450 59024 58272 CDS product flagellar hook basal-body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671297.1 protein_id gnl|my_center|LOCUS_00450 59448 60029 gene locus_tag LOCUS_00460 59448 60029 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_00460 60273 60040 gene locus_tag LOCUS_00470 60273 60040 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938477.1 protein_id gnl|my_center|LOCUS_00470 60906 60301 gene locus_tag LOCUS_00480 60906 60301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 61233 62108 gene locus_tag LOCUS_00490 61233 62108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 62236 62913 gene locus_tag LOCUS_00500 62236 62913 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_00500 63061 64452 gene locus_tag LOCUS_00510 63061 64452 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447220.1 protein_id gnl|my_center|LOCUS_00510 64449 65477 gene locus_tag LOCUS_00520 gene tsaD 64449 65477 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338414.1 protein_id gnl|my_center|LOCUS_00520 69703 65618 gene locus_tag LOCUS_00530 69703 65618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921939.1 protein_id gnl|my_center|LOCUS_00530 72857 70227 gene locus_tag LOCUS_00540 72857 70227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 73348 74538 gene locus_tag LOCUS_00550 73348 74538 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_00550 76131 74572 gene locus_tag LOCUS_00560 76131 74572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 76794 79274 gene locus_tag LOCUS_00570 76794 79274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_00570 79422 80387 gene locus_tag LOCUS_00580 79422 80387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 80942 83137 gene locus_tag LOCUS_00590 80942 83137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 83124 83531 gene locus_tag LOCUS_00600 83124 83531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 83708 83920 gene locus_tag LOCUS_00610 83708 83920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 84178 84501 gene locus_tag LOCUS_00620 84178 84501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 84847 85260 gene locus_tag LOCUS_00630 84847 85260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 85367 86677 gene locus_tag LOCUS_00640 85367 86677 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938989.1 protein_id gnl|my_center|LOCUS_00640 88044 86725 gene locus_tag LOCUS_00650 88044 86725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 89378 88326 gene locus_tag LOCUS_00660 89378 88326 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258178.1 protein_id gnl|my_center|LOCUS_00660 90505 89384 gene locus_tag LOCUS_00670 90505 89384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 92118 90661 gene locus_tag LOCUS_00680 92118 90661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 93039 92320 gene locus_tag LOCUS_00690 93039 92320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 95339 93423 gene locus_tag LOCUS_00700 95339 93423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 97498 95492 gene locus_tag LOCUS_00710 97498 95492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 98045 97491 gene locus_tag LOCUS_00720 98045 97491 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_00720 100087 98039 gene locus_tag LOCUS_00730 100087 98039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 100809 100540 gene locus_tag LOCUS_00740 100809 100540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 102497 100827 gene locus_tag LOCUS_00750 102497 100827 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326414.1 protein_id gnl|my_center|LOCUS_00750 102829 103443 gene locus_tag LOCUS_00760 102829 103443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 105034 103445 gene locus_tag LOCUS_00770 105034 103445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 105306 106346 gene locus_tag LOCUS_00780 105306 106346 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339548.1 protein_id gnl|my_center|LOCUS_00780 106853 107905 gene locus_tag LOCUS_00790 106853 107905 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_00790 110619 108013 gene locus_tag LOCUS_00800 110619 108013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921695.1 protein_id gnl|my_center|LOCUS_00800 110729 111508 gene locus_tag LOCUS_00810 110729 111508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 112390 111620 gene locus_tag LOCUS_00820 112390 111620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 112954 115032 gene locus_tag LOCUS_00830 112954 115032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 115659 116819 gene locus_tag LOCUS_00840 115659 116819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 117979 116945 gene locus_tag LOCUS_00850 117979 116945 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646211.1 protein_id gnl|my_center|LOCUS_00850 119611 118010 gene locus_tag LOCUS_00860 119611 118010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 120008 119634 gene locus_tag LOCUS_00870 120008 119634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 121931 120393 gene locus_tag LOCUS_00880 121931 120393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 122215 123645 gene locus_tag LOCUS_00890 122215 123645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 124969 123824 gene locus_tag LOCUS_00900 124969 123824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 125264 126274 gene locus_tag LOCUS_00910 125264 126274 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_00910 127393 126302 gene locus_tag LOCUS_00920 127393 126302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 127997 127434 gene locus_tag LOCUS_00930 127997 127434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 128166 128522 gene locus_tag LOCUS_00940 128166 128522 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_00940 130345 128573 gene locus_tag LOCUS_00950 130345 128573 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_00950 130783 130382 gene locus_tag LOCUS_00960 130783 130382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 133979 130845 gene locus_tag LOCUS_00970 133979 130845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 134536 133976 gene locus_tag LOCUS_00980 gene nuoE 134536 133976 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_00980 137668 135023 gene locus_tag LOCUS_00990 137668 135023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 138167 138988 gene locus_tag LOCUS_01000 138167 138988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 139016 140086 gene locus_tag LOCUS_01010 139016 140086 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_01010 140906 140109 gene locus_tag LOCUS_01020 140906 140109 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_01020 141336 142853 gene locus_tag LOCUS_01030 141336 142853 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_01030 143741 142908 gene locus_tag LOCUS_01040 143741 142908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 144042 147086 gene locus_tag LOCUS_01050 144042 147086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 147264 148790 gene locus_tag LOCUS_01060 147264 148790 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260005.1 protein_id gnl|my_center|LOCUS_01060 148887 150014 gene locus_tag LOCUS_01070 gene menC 148887 150014 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_01070 151368 150154 gene locus_tag LOCUS_01080 151368 150154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 152655 151483 gene locus_tag LOCUS_01090 152655 151483 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_01090 152952 152665 gene locus_tag LOCUS_01100 152952 152665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 153208 155025 gene locus_tag LOCUS_01110 153208 155025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 156526 155240 gene locus_tag LOCUS_01120 156526 155240 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_01120 157758 156727 gene locus_tag LOCUS_01130 gene fliM 157758 156727 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334519.1 protein_id gnl|my_center|LOCUS_01130 159089 157761 gene locus_tag LOCUS_01140 159089 157761 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121351.1 protein_id gnl|my_center|LOCUS_01140 159338 159568 gene locus_tag LOCUS_01150 159338 159568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 159584 160414 gene locus_tag LOCUS_01160 159584 160414 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121000.1 protein_id gnl|my_center|LOCUS_01160 160468 163905 gene locus_tag LOCUS_01170 gene ileS 160468 163905 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434976.1 protein_id gnl|my_center|LOCUS_01170 164083 164754 gene locus_tag LOCUS_01180 gene purN 164083 164754 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_01180 165026 165619 gene locus_tag LOCUS_01190 165026 165619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 166826 165681 gene locus_tag LOCUS_01200 gene galK 166826 165681 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816804.1 protein_id gnl|my_center|LOCUS_01200 167674 167144 gene locus_tag LOCUS_01210 167674 167144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 169013 168318 gene locus_tag LOCUS_01220 169013 168318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 169278 171728 gene locus_tag LOCUS_01230 169278 171728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 171749 172540 gene locus_tag LOCUS_01240 171749 172540 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_01240 172530 173330 gene locus_tag LOCUS_01250 172530 173330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 >Feature sequence002 483 223 gene locus_tag LOCUS_01260 483 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 644 501 gene locus_tag LOCUS_01270 644 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 1852 1004 gene locus_tag LOCUS_01280 1852 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 2612 1968 gene locus_tag LOCUS_01290 2612 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 3372 2734 gene locus_tag LOCUS_01300 3372 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 3743 3531 gene locus_tag LOCUS_01310 3743 3531 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_01310 3984 3751 gene locus_tag LOCUS_01320 3984 3751 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_01320 4470 4054 gene locus_tag LOCUS_01330 4470 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 4955 4536 gene locus_tag LOCUS_01340 4955 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 5556 5149 gene locus_tag LOCUS_01350 5556 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 6351 5926 gene locus_tag LOCUS_01360 6351 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 6809 6480 gene locus_tag LOCUS_01370 6809 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 7330 8031 gene locus_tag LOCUS_01380 7330 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 8353 9084 gene locus_tag LOCUS_01390 8353 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 9377 9616 gene locus_tag LOCUS_01400 9377 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 9613 10005 gene locus_tag LOCUS_01410 9613 10005 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_01410 11183 12256 gene locus_tag LOCUS_01420 11183 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 12426 13322 gene locus_tag LOCUS_01430 12426 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 13481 14761 gene locus_tag LOCUS_01440 13481 14761 CDS product aminoacetone oxidase family FAD-binding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120592.1 protein_id gnl|my_center|LOCUS_01440 15523 16584 gene locus_tag LOCUS_01450 15523 16584 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260201.1 protein_id gnl|my_center|LOCUS_01450 16746 17141 gene locus_tag LOCUS_01460 16746 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 17414 18973 gene locus_tag LOCUS_01470 17414 18973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 21329 19194 gene locus_tag LOCUS_01480 21329 19194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 21653 26290 gene locus_tag LOCUS_01490 21653 26290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 25491 25397 gene locus_tag LOCUS_t00010 25491 25397 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26353 28278 gene locus_tag LOCUS_01500 26353 28278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 29082 28369 gene locus_tag LOCUS_01510 29082 28369 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064314.1 protein_id gnl|my_center|LOCUS_01510 29431 30003 gene locus_tag LOCUS_01520 29431 30003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 30083 31096 gene locus_tag LOCUS_01530 30083 31096 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_01530 31093 32127 gene locus_tag LOCUS_01540 31093 32127 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922169.1 protein_id gnl|my_center|LOCUS_01540 33152 32142 gene locus_tag LOCUS_01550 33152 32142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 33897 33451 gene locus_tag LOCUS_01560 33897 33451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 34204 34368 gene locus_tag LOCUS_01570 gene rpmG 34204 34368 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324504.1 protein_id gnl|my_center|LOCUS_01570 34388 36133 gene locus_tag LOCUS_01580 gene recJ 34388 36133 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_01580 36231 36593 gene locus_tag LOCUS_01590 36231 36593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 37054 38184 gene locus_tag LOCUS_01600 37054 38184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 38417 38178 gene locus_tag LOCUS_01610 38417 38178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 39486 38593 gene locus_tag LOCUS_01620 39486 38593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 40455 39988 gene locus_tag LOCUS_01630 40455 39988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 40781 42514 gene locus_tag LOCUS_01640 40781 42514 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_01640 42543 43622 gene locus_tag LOCUS_01650 42543 43622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 43878 44177 gene locus_tag LOCUS_01660 43878 44177 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_01660 45369 44188 gene locus_tag LOCUS_01670 45369 44188 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324978.1 protein_id gnl|my_center|LOCUS_01670 45537 46796 gene locus_tag LOCUS_01680 45537 46796 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776531.1 protein_id gnl|my_center|LOCUS_01680 46889 48148 gene locus_tag LOCUS_01690 46889 48148 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_01690 48268 49452 gene locus_tag LOCUS_01700 48268 49452 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776531.1 protein_id gnl|my_center|LOCUS_01700 49463 50290 gene locus_tag LOCUS_01710 49463 50290 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980434.1 protein_id gnl|my_center|LOCUS_01710 50451 51872 gene locus_tag LOCUS_01720 gene araA 50451 51872 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226247.1 protein_id gnl|my_center|LOCUS_01720 51876 53339 gene locus_tag LOCUS_01730 51876 53339 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537771.1 protein_id gnl|my_center|LOCUS_01730 53495 53713 gene locus_tag LOCUS_01740 53495 53713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 54195 53977 gene locus_tag LOCUS_01750 54195 53977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 54361 55464 gene locus_tag LOCUS_01760 54361 55464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 56649 55483 gene locus_tag LOCUS_01770 56649 55483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 57024 58649 gene locus_tag LOCUS_01780 57024 58649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 60632 58794 gene locus_tag LOCUS_01790 60632 58794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921380.1 protein_id gnl|my_center|LOCUS_01790 60807 61757 gene locus_tag LOCUS_01800 60807 61757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 62640 61705 gene locus_tag LOCUS_01810 62640 61705 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333051.1 protein_id gnl|my_center|LOCUS_01810 63120 62710 gene locus_tag LOCUS_01820 63120 62710 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324235.1 protein_id gnl|my_center|LOCUS_01820 64039 63362 gene locus_tag LOCUS_01830 64039 63362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023853.1 protein_id gnl|my_center|LOCUS_01830 65408 64047 gene locus_tag LOCUS_01840 65408 64047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 67048 65870 gene locus_tag LOCUS_01850 67048 65870 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_01850 67394 68206 gene locus_tag LOCUS_01860 gene fabG 67394 68206 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979123.1 protein_id gnl|my_center|LOCUS_01860 68817 69089 gene locus_tag LOCUS_01870 68817 69089 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119905.1 protein_id gnl|my_center|LOCUS_01870 69173 69670 gene locus_tag LOCUS_01880 69173 69670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797617.1 protein_id gnl|my_center|LOCUS_01880 69692 70579 gene locus_tag LOCUS_01890 69692 70579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920654.1 protein_id gnl|my_center|LOCUS_01890 71167 70721 gene locus_tag LOCUS_01900 gene mscL 71167 70721 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267001.1 protein_id gnl|my_center|LOCUS_01900 72441 71569 gene locus_tag LOCUS_01910 72441 71569 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690802.1 protein_id gnl|my_center|LOCUS_01910 74490 72454 gene locus_tag LOCUS_01920 74490 72454 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_01920 74917 77301 gene locus_tag LOCUS_01930 74917 77301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01930 77298 77732 gene locus_tag LOCUS_01940 77298 77732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01940 77764 78165 gene locus_tag LOCUS_01950 77764 78165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 80050 78176 gene locus_tag LOCUS_01960 80050 78176 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_01960 80599 80195 gene locus_tag LOCUS_01970 80599 80195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 81152 83974 gene locus_tag LOCUS_01980 81152 83974 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922826.1 protein_id gnl|my_center|LOCUS_01980 85815 84403 gene locus_tag LOCUS_01990 85815 84403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 88034 86091 gene locus_tag LOCUS_02000 88034 86091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 88554 88883 gene locus_tag LOCUS_02010 88554 88883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 89052 90761 gene locus_tag LOCUS_02020 89052 90761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 90809 91225 gene locus_tag LOCUS_02030 90809 91225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 91396 92532 gene locus_tag LOCUS_02040 91396 92532 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202847.1 protein_id gnl|my_center|LOCUS_02040 93378 94796 gene locus_tag LOCUS_02050 93378 94796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 94894 95565 gene locus_tag LOCUS_02060 94894 95565 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_02060 96093 95704 gene locus_tag LOCUS_02070 96093 95704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 97792 96332 gene locus_tag LOCUS_02080 97792 96332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 99282 97789 gene locus_tag LOCUS_02090 gene glpK 99282 97789 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_02090 99684 100715 gene locus_tag LOCUS_02100 99684 100715 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177617.1 protein_id gnl|my_center|LOCUS_02100 102012 100720 gene locus_tag LOCUS_02110 102012 100720 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_02110 102477 102298 gene locus_tag LOCUS_02120 102477 102298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 105791 103632 gene locus_tag LOCUS_02130 105791 103632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 106594 107484 gene locus_tag LOCUS_02140 106594 107484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 107602 108339 gene locus_tag LOCUS_02150 107602 108339 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143833.1 protein_id gnl|my_center|LOCUS_02150 108356 109411 gene locus_tag LOCUS_02160 gene rfaE1 108356 109411 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627445.1 protein_id gnl|my_center|LOCUS_02160 110104 109442 gene locus_tag LOCUS_02170 110104 109442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 110524 112668 gene locus_tag LOCUS_02180 110524 112668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 112770 113234 gene locus_tag LOCUS_02190 112770 113234 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941471.1 protein_id gnl|my_center|LOCUS_02190 115452 113320 gene locus_tag LOCUS_02200 115452 113320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 118470 116512 gene locus_tag LOCUS_02210 118470 116512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 119751 118513 gene locus_tag LOCUS_02220 119751 118513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 120365 120063 gene locus_tag LOCUS_02230 120365 120063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 120572 120808 gene locus_tag LOCUS_02240 120572 120808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 124351 120956 gene locus_tag LOCUS_02250 124351 120956 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615508.1 protein_id gnl|my_center|LOCUS_02250 124930 125733 gene locus_tag LOCUS_02260 124930 125733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 126282 125941 gene locus_tag LOCUS_02270 126282 125941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813830.1 protein_id gnl|my_center|LOCUS_02270 126503 126279 gene locus_tag LOCUS_02280 126503 126279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 126490 127242 gene locus_tag LOCUS_02290 126490 127242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 127252 127965 gene locus_tag LOCUS_02300 127252 127965 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922652.1 protein_id gnl|my_center|LOCUS_02300 127994 128881 gene locus_tag LOCUS_02310 gene dapA 127994 128881 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921565.1 protein_id gnl|my_center|LOCUS_02310 128944 130170 gene locus_tag LOCUS_02320 128944 130170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 132069 130201 gene locus_tag LOCUS_02330 132069 130201 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143991.1 protein_id gnl|my_center|LOCUS_02330 132869 132291 gene locus_tag LOCUS_02340 132869 132291 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142953.1 protein_id gnl|my_center|LOCUS_02340 134285 132957 gene locus_tag LOCUS_02350 134285 132957 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_02350 137603 134637 gene locus_tag LOCUS_02360 137603 134637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 139357 138698 gene locus_tag LOCUS_02370 139357 138698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 141048 139486 gene locus_tag LOCUS_02380 141048 139486 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902430.1 protein_id gnl|my_center|LOCUS_02380 141286 141954 gene locus_tag LOCUS_02390 141286 141954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 >Feature sequence003 1419 133 gene locus_tag LOCUS_02400 1419 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 2216 1704 gene locus_tag LOCUS_02410 2216 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 2777 5284 gene locus_tag LOCUS_02420 2777 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 6185 5397 gene locus_tag LOCUS_02430 6185 5397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_02430 9106 6314 gene locus_tag LOCUS_02440 9106 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 9416 10474 gene locus_tag LOCUS_02450 9416 10474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 11638 10637 gene locus_tag LOCUS_02460 11638 10637 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525514.1 protein_id gnl|my_center|LOCUS_02460 12144 13604 gene locus_tag LOCUS_02470 12144 13604 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926050.1 protein_id gnl|my_center|LOCUS_02470 13665 14723 gene locus_tag LOCUS_02480 13665 14723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 14778 15671 gene locus_tag LOCUS_02490 14778 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 15765 16784 gene locus_tag LOCUS_02500 15765 16784 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213192.1 protein_id gnl|my_center|LOCUS_02500 16788 17123 gene locus_tag LOCUS_02510 16788 17123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 17129 18115 gene locus_tag LOCUS_02520 17129 18115 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397776.1 protein_id gnl|my_center|LOCUS_02520 18120 18896 gene locus_tag LOCUS_02530 18120 18896 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083078.1 protein_id gnl|my_center|LOCUS_02530 19065 19538 gene locus_tag LOCUS_02540 19065 19538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 19805 22645 gene locus_tag LOCUS_02550 19805 22645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 22642 23091 gene locus_tag LOCUS_02560 22642 23091 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_02560 23372 24358 gene locus_tag LOCUS_02570 23372 24358 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324413.1 protein_id gnl|my_center|LOCUS_02570 25064 24360 gene locus_tag LOCUS_02580 25064 24360 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333546.1 protein_id gnl|my_center|LOCUS_02580 25504 25698 gene locus_tag LOCUS_02590 25504 25698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 27215 25890 gene locus_tag LOCUS_02600 27215 25890 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 protein_id gnl|my_center|LOCUS_02600 27856 27248 gene locus_tag LOCUS_02610 gene lexA 27856 27248 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 protein_id gnl|my_center|LOCUS_02610 28599 27973 gene locus_tag LOCUS_02620 28599 27973 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992434.1 protein_id gnl|my_center|LOCUS_02620 29595 28642 gene locus_tag LOCUS_02630 29595 28642 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_02630 30394 29621 gene locus_tag LOCUS_02640 30394 29621 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_02640 30741 33026 gene locus_tag LOCUS_02650 30741 33026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 34860 33679 gene locus_tag LOCUS_02660 34860 33679 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122967.1 protein_id gnl|my_center|LOCUS_02660 36158 34887 gene locus_tag LOCUS_02670 36158 34887 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_02670 36724 38973 gene locus_tag LOCUS_02680 36724 38973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 39300 42062 gene locus_tag LOCUS_02690 39300 42062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 42148 42645 gene locus_tag LOCUS_02700 42148 42645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 45023 42675 gene locus_tag LOCUS_02710 45023 42675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 46550 45093 gene locus_tag LOCUS_02720 46550 45093 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_02720 47719 47384 gene locus_tag LOCUS_02730 47719 47384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 48752 48994 gene locus_tag LOCUS_02740 48752 48994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 48906 49370 gene locus_tag LOCUS_02750 48906 49370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 50244 49489 gene locus_tag LOCUS_02760 50244 49489 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930300.1 protein_id gnl|my_center|LOCUS_02760 51863 50241 gene locus_tag LOCUS_02770 51863 50241 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869326.1 protein_id gnl|my_center|LOCUS_02770 53305 51878 gene locus_tag LOCUS_02780 53305 51878 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121117.1 protein_id gnl|my_center|LOCUS_02780 53928 54515 gene locus_tag LOCUS_02790 53928 54515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 54747 56894 gene locus_tag LOCUS_02800 gene shc 54747 56894 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_02800 56984 58003 gene locus_tag LOCUS_02810 gene hpnH 56984 58003 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_02810 58912 58166 gene locus_tag LOCUS_02820 58912 58166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 60058 59093 gene locus_tag LOCUS_02830 60058 59093 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119033.1 protein_id gnl|my_center|LOCUS_02830 60787 60269 gene locus_tag LOCUS_02840 60787 60269 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927006.1 protein_id gnl|my_center|LOCUS_02840 61000 60791 gene locus_tag LOCUS_02850 61000 60791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 61930 61031 gene locus_tag LOCUS_02860 61930 61031 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459306.1 protein_id gnl|my_center|LOCUS_02860 63282 62248 gene locus_tag LOCUS_02870 63282 62248 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121766.1 protein_id gnl|my_center|LOCUS_02870 63405 63332 gene locus_tag LOCUS_t00020 63405 63332 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 63716 63498 gene locus_tag LOCUS_02880 gene csrA 63716 63498 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_02880 64388 64948 gene locus_tag LOCUS_02890 64388 64948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 64929 65438 gene locus_tag LOCUS_02900 64929 65438 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_02900 67066 65594 gene locus_tag LOCUS_02910 67066 65594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 67454 70597 gene locus_tag LOCUS_02920 67454 70597 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_02920 71808 70645 gene locus_tag LOCUS_02930 71808 70645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 72328 72765 gene locus_tag LOCUS_02940 72328 72765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 72949 74052 gene locus_tag LOCUS_02950 gene ribD 72949 74052 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_02950 75118 74069 gene locus_tag LOCUS_02960 75118 74069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 76692 75121 gene locus_tag LOCUS_02970 gene dnaK 76692 75121 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021492.1 protein_id gnl|my_center|LOCUS_02970 77055 76747 gene locus_tag LOCUS_02980 77055 76747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328915.1 protein_id gnl|my_center|LOCUS_02980 77500 77246 gene locus_tag LOCUS_02990 77500 77246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 78756 77500 gene locus_tag LOCUS_03000 78756 77500 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121827.1 protein_id gnl|my_center|LOCUS_03000 79482 78958 gene locus_tag LOCUS_03010 79482 78958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 80067 81419 gene locus_tag LOCUS_03020 80067 81419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 82835 81471 gene locus_tag LOCUS_03030 82835 81471 CDS product DUF4147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922364.1 protein_id gnl|my_center|LOCUS_03030 83468 82845 gene locus_tag LOCUS_03040 83468 82845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 84419 83472 gene locus_tag LOCUS_03050 84419 83472 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392223.1 protein_id gnl|my_center|LOCUS_03050 84949 84563 gene locus_tag LOCUS_03060 84949 84563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 85878 84982 gene locus_tag LOCUS_03070 gene thyX 85878 84982 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228435.1 protein_id gnl|my_center|LOCUS_03070 86165 85908 gene locus_tag LOCUS_03080 86165 85908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333356.1 protein_id gnl|my_center|LOCUS_03080 86482 87966 gene locus_tag LOCUS_03090 gene murJ 86482 87966 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050683.1 protein_id gnl|my_center|LOCUS_03090 88143 88367 gene locus_tag LOCUS_03100 88143 88367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 88364 88765 gene locus_tag LOCUS_03110 88364 88765 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393269.1 protein_id gnl|my_center|LOCUS_03110 88932 91340 gene locus_tag LOCUS_03120 88932 91340 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928735.1 protein_id gnl|my_center|LOCUS_03120 91697 94396 gene locus_tag LOCUS_03130 91697 94396 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524115.1 protein_id gnl|my_center|LOCUS_03130 94934 97006 gene locus_tag LOCUS_03140 94934 97006 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_03140 97056 98063 gene locus_tag LOCUS_03150 97056 98063 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035417.1 protein_id gnl|my_center|LOCUS_03150 98144 98881 gene locus_tag LOCUS_03160 98144 98881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922519.1 protein_id gnl|my_center|LOCUS_03160 98909 99784 gene locus_tag LOCUS_03170 98909 99784 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_03170 99813 100262 gene locus_tag LOCUS_03180 99813 100262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 101374 101123 gene locus_tag LOCUS_03190 101374 101123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 101800 103044 gene locus_tag LOCUS_03200 101800 103044 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399796.1 protein_id gnl|my_center|LOCUS_03200 103376 103948 gene locus_tag LOCUS_03210 103376 103948 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_03210 103945 104841 gene locus_tag LOCUS_03220 103945 104841 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_03220 104909 106945 gene locus_tag LOCUS_03230 104909 106945 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927008.1 protein_id gnl|my_center|LOCUS_03230 106967 107461 gene locus_tag LOCUS_03240 106967 107461 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932916.1 protein_id gnl|my_center|LOCUS_03240 107458 108495 gene locus_tag LOCUS_03250 107458 108495 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_03250 108516 109997 gene locus_tag LOCUS_03260 108516 109997 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_03260 110178 110837 gene locus_tag LOCUS_03270 110178 110837 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_03270 112711 110954 gene locus_tag LOCUS_03280 112711 110954 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_03280 113787 112762 gene locus_tag LOCUS_03290 113787 112762 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_03290 114823 113939 gene locus_tag LOCUS_03300 114823 113939 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_03300 116704 114824 gene locus_tag LOCUS_03310 116704 114824 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_03310 116987 119578 gene locus_tag LOCUS_03320 116987 119578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 119590 120963 gene locus_tag LOCUS_03330 119590 120963 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_03330 121043 122155 gene locus_tag LOCUS_03340 121043 122155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 122139 122483 gene locus_tag LOCUS_03350 122139 122483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 123126 122746 gene locus_tag LOCUS_03360 123126 122746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 123359 123162 gene locus_tag LOCUS_03370 123359 123162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 123890 123462 gene locus_tag LOCUS_03380 gene vapC29 123890 123462 CDS product type II toxin-antitoxin system ribonuclease VapC29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403218.1 protein_id gnl|my_center|LOCUS_03380 124116 123871 gene locus_tag LOCUS_03390 124116 123871 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412749.1 protein_id gnl|my_center|LOCUS_03390 124830 124243 gene locus_tag LOCUS_03400 124830 124243 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022735.1 protein_id gnl|my_center|LOCUS_03400 125818 124844 gene locus_tag LOCUS_03410 125818 124844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 127489 125861 gene locus_tag LOCUS_03420 127489 125861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 127715 130207 gene locus_tag LOCUS_03430 127715 130207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 130817 131164 gene locus_tag LOCUS_03440 130817 131164 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327264.1 protein_id gnl|my_center|LOCUS_03440 132177 131161 gene locus_tag LOCUS_03450 gene tatC 132177 131161 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338730.1 protein_id gnl|my_center|LOCUS_03450 132365 133339 gene locus_tag LOCUS_03460 132365 133339 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_03460 133638 134345 gene locus_tag LOCUS_03470 133638 134345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 134342 135223 gene locus_tag LOCUS_03480 134342 135223 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_03480 135512 135228 gene locus_tag LOCUS_03490 gene rpsT 135512 135228 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326150.1 protein_id gnl|my_center|LOCUS_03490 136940 135558 gene locus_tag LOCUS_03500 136940 135558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 137088 138614 gene locus_tag LOCUS_03510 gene cobA 137088 138614 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121206.1 protein_id gnl|my_center|LOCUS_03510 138968 138786 gene locus_tag LOCUS_03520 138968 138786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122042.1 protein_id gnl|my_center|LOCUS_03520 139145 140314 gene locus_tag LOCUS_03530 139145 140314 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_03530 140307 140804 gene locus_tag LOCUS_03540 gene coaD 140307 140804 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122863.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence004 899 516 gene locus_tag LOCUS_03550 899 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 1090 896 gene locus_tag LOCUS_03560 1090 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1039 2307 gene locus_tag LOCUS_03570 1039 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_03570 4027 2324 gene locus_tag LOCUS_03580 4027 2324 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615945.1 protein_id gnl|my_center|LOCUS_03580 4294 4368 gene locus_tag LOCUS_t00030 4294 4368 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5589 4573 gene locus_tag LOCUS_03590 gene gap 5589 4573 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118955.1 protein_id gnl|my_center|LOCUS_03590 5773 7113 gene locus_tag LOCUS_03600 5773 7113 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152045320.1 protein_id gnl|my_center|LOCUS_03600 8285 7188 gene locus_tag LOCUS_03610 8285 7188 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427756.1 protein_id gnl|my_center|LOCUS_03610 8432 8653 gene locus_tag LOCUS_03620 8432 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 8657 9004 gene locus_tag LOCUS_03630 8657 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 10755 9055 gene locus_tag LOCUS_03640 10755 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 11169 10789 gene locus_tag LOCUS_03650 11169 10789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 12820 12134 gene locus_tag LOCUS_03660 12820 12134 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206063.1 protein_id gnl|my_center|LOCUS_03660 13134 14129 gene locus_tag LOCUS_03670 13134 14129 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_03670 14255 15598 gene locus_tag LOCUS_03680 14255 15598 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_03680 15748 16398 gene locus_tag LOCUS_03690 gene fsa 15748 16398 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_03690 16402 17754 gene locus_tag LOCUS_03700 16402 17754 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 protein_id gnl|my_center|LOCUS_03700 17763 18557 gene locus_tag LOCUS_03710 gene iolB 17763 18557 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640197.1 protein_id gnl|my_center|LOCUS_03710 18559 20088 gene locus_tag LOCUS_03720 gene xylB 18559 20088 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_03720 20107 21159 gene locus_tag LOCUS_03730 20107 21159 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024326.1 protein_id gnl|my_center|LOCUS_03730 21149 21991 gene locus_tag LOCUS_03740 21149 21991 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_03740 21988 23178 gene locus_tag LOCUS_03750 21988 23178 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_03750 23182 23976 gene locus_tag LOCUS_03760 gene nagB 23182 23976 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118913.1 protein_id gnl|my_center|LOCUS_03760 24192 25058 gene locus_tag LOCUS_03770 24192 25058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 25082 26527 gene locus_tag LOCUS_03780 25082 26527 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_03780 26647 27762 gene locus_tag LOCUS_03790 26647 27762 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066036.1 protein_id gnl|my_center|LOCUS_03790 29960 27903 gene locus_tag LOCUS_03800 29960 27903 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327900.1 protein_id gnl|my_center|LOCUS_03800 30633 33227 gene locus_tag LOCUS_03810 30633 33227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 34943 33471 gene locus_tag LOCUS_03820 34943 33471 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170181187.1 protein_id gnl|my_center|LOCUS_03820 35353 36636 gene locus_tag LOCUS_03830 35353 36636 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615779.1 protein_id gnl|my_center|LOCUS_03830 38629 36827 gene locus_tag LOCUS_03840 38629 36827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 38865 43250 gene locus_tag LOCUS_03850 38865 43250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 43841 43404 gene locus_tag LOCUS_03860 43841 43404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 44245 43856 gene locus_tag LOCUS_03870 44245 43856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 44881 45213 gene locus_tag LOCUS_03880 44881 45213 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_03880 45248 45715 gene locus_tag LOCUS_03890 45248 45715 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387043.1 protein_id gnl|my_center|LOCUS_03890 45864 46832 gene locus_tag LOCUS_03900 45864 46832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 46888 48951 gene locus_tag LOCUS_03910 46888 48951 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188470974.1 protein_id gnl|my_center|LOCUS_03910 48994 50223 gene locus_tag LOCUS_03920 48994 50223 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_03920 50328 51047 gene locus_tag LOCUS_03930 50328 51047 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_03930 51038 51976 gene locus_tag LOCUS_03940 51038 51976 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_03940 51973 52974 gene locus_tag LOCUS_03950 51973 52974 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_03950 53150 53407 gene locus_tag LOCUS_03960 53150 53407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 53404 53790 gene locus_tag LOCUS_03970 53404 53790 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_03970 55130 53919 gene locus_tag LOCUS_03980 55130 53919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 55461 56633 gene locus_tag LOCUS_03990 55461 56633 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_03990 56841 58868 gene locus_tag LOCUS_04000 56841 58868 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_04000 59000 59383 gene locus_tag LOCUS_04010 59000 59383 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325564.1 protein_id gnl|my_center|LOCUS_04010 60622 59426 gene locus_tag LOCUS_04020 60622 59426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 60934 60725 gene locus_tag LOCUS_04030 60934 60725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 61233 62183 gene locus_tag LOCUS_04040 61233 62183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 62649 62185 gene locus_tag LOCUS_04050 gene rpiB 62649 62185 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122948.1 protein_id gnl|my_center|LOCUS_04050 63111 63863 gene locus_tag LOCUS_04060 63111 63863 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340410.1 protein_id gnl|my_center|LOCUS_04060 65377 63992 gene locus_tag LOCUS_04070 65377 63992 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921752.1 protein_id gnl|my_center|LOCUS_04070 66080 69070 gene locus_tag LOCUS_04080 66080 69070 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_04080 70538 69504 gene locus_tag LOCUS_04090 70538 69504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 71051 70653 gene locus_tag LOCUS_04100 71051 70653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 71388 72839 gene locus_tag LOCUS_04110 71388 72839 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_04110 72905 74266 gene locus_tag LOCUS_04120 72905 74266 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669087.1 protein_id gnl|my_center|LOCUS_04120 74324 75454 gene locus_tag LOCUS_04130 74324 75454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 75515 76822 gene locus_tag LOCUS_04140 75515 76822 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_04140 77071 78129 gene locus_tag LOCUS_04150 77071 78129 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442722.1 protein_id gnl|my_center|LOCUS_04150 78129 79400 gene locus_tag LOCUS_04160 78129 79400 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_04160 79843 79640 gene locus_tag LOCUS_04170 79843 79640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04170 81168 79831 gene locus_tag LOCUS_04180 81168 79831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04180 81578 81240 gene locus_tag LOCUS_04190 81578 81240 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325418.1 protein_id gnl|my_center|LOCUS_04190 82399 83718 gene locus_tag LOCUS_04200 82399 83718 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121818.1 protein_id gnl|my_center|LOCUS_04200 85349 83994 gene locus_tag LOCUS_04210 85349 83994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_04210 86010 85435 gene locus_tag LOCUS_04220 86010 85435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 86345 86896 gene locus_tag LOCUS_04230 gene cyaB 86345 86896 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120856.1 protein_id gnl|my_center|LOCUS_04230 87108 87317 gene locus_tag LOCUS_04240 87108 87317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 87589 87347 gene locus_tag LOCUS_04250 87589 87347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 88931 88080 gene locus_tag LOCUS_04260 88931 88080 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_04260 89182 89919 gene locus_tag LOCUS_04270 89182 89919 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427759.1 protein_id gnl|my_center|LOCUS_04270 89931 91070 gene locus_tag LOCUS_04280 gene wecB 89931 91070 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942883.1 protein_id gnl|my_center|LOCUS_04280 92754 91468 gene locus_tag LOCUS_04290 92754 91468 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_04290 92949 95789 gene locus_tag LOCUS_04300 92949 95789 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615777.1 protein_id gnl|my_center|LOCUS_04300 96092 97984 gene locus_tag LOCUS_04310 gene ftsH 96092 97984 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325413.1 protein_id gnl|my_center|LOCUS_04310 98017 99435 gene locus_tag LOCUS_04320 98017 99435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 99664 101019 gene locus_tag LOCUS_04330 gene hisD 99664 101019 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118440.1 protein_id gnl|my_center|LOCUS_04330 101105 102160 gene locus_tag LOCUS_04340 gene hisC 101105 102160 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_04340 102343 102942 gene locus_tag LOCUS_04350 gene hisB 102343 102942 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325657.1 protein_id gnl|my_center|LOCUS_04350 103911 102970 gene locus_tag LOCUS_04360 gene xerD 103911 102970 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921953.1 protein_id gnl|my_center|LOCUS_04360 104416 105837 gene locus_tag LOCUS_04370 104416 105837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 106389 106243 gene locus_tag LOCUS_04380 106389 106243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 106360 107142 gene locus_tag LOCUS_04390 106360 107142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 108428 107106 gene locus_tag LOCUS_04400 gene murA 108428 107106 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927222.1 protein_id gnl|my_center|LOCUS_04400 109323 108442 gene locus_tag LOCUS_04410 gene prmC 109323 108442 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_04410 110492 109419 gene locus_tag LOCUS_04420 gene prfA 110492 109419 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328933.1 protein_id gnl|my_center|LOCUS_04420 110915 110586 gene locus_tag LOCUS_04430 110915 110586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 111032 111253 gene locus_tag LOCUS_04440 111032 111253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 113039 111411 gene locus_tag LOCUS_04450 113039 111411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664385.1 protein_id gnl|my_center|LOCUS_04450 113866 113036 gene locus_tag LOCUS_04460 gene kdsA 113866 113036 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 protein_id gnl|my_center|LOCUS_04460 114759 113881 gene locus_tag LOCUS_04470 114759 113881 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324520.1 protein_id gnl|my_center|LOCUS_04470 117578 115518 gene locus_tag LOCUS_04480 117578 115518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 117677 119155 gene locus_tag LOCUS_04490 117677 119155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 119253 119326 gene locus_tag LOCUS_t00040 119253 119326 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 120683 122269 gene locus_tag LOCUS_04500 120683 122269 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226064.1 protein_id gnl|my_center|LOCUS_04500 122328 123200 gene locus_tag LOCUS_04510 122328 123200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 123355 125016 gene locus_tag LOCUS_04520 123355 125016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 125056 125466 gene locus_tag LOCUS_04530 125056 125466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 125613 126080 gene locus_tag LOCUS_04540 125613 126080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 127166 126093 gene locus_tag LOCUS_04550 127166 126093 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_04550 128139 127156 gene locus_tag LOCUS_04560 128139 127156 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_04560 <128768 128220 gene locus_tag LOCUS_04570 <128768 128220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545272.1:ABC transporter permease >Feature sequence005 1310 1756 gene locus_tag LOCUS_04580 1310 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 1793 2488 gene locus_tag LOCUS_04590 1793 2488 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920654.1 protein_id gnl|my_center|LOCUS_04590 2528 6511 gene locus_tag LOCUS_04600 2528 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 6552 9473 gene locus_tag LOCUS_04610 6552 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 11871 9700 gene locus_tag LOCUS_04620 11871 9700 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922751.1 protein_id gnl|my_center|LOCUS_04620 12339 11962 gene locus_tag LOCUS_04630 12339 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 13339 12572 gene locus_tag LOCUS_04640 13339 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 14193 13345 gene locus_tag LOCUS_04650 14193 13345 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 protein_id gnl|my_center|LOCUS_04650 14910 14257 gene locus_tag LOCUS_04660 14910 14257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328057.1 protein_id gnl|my_center|LOCUS_04660 16081 14915 gene locus_tag LOCUS_04670 16081 14915 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_04670 17175 16111 gene locus_tag LOCUS_04680 17175 16111 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_04680 18476 17208 gene locus_tag LOCUS_04690 18476 17208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_04690 18687 19847 gene locus_tag LOCUS_04700 18687 19847 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921425.1 protein_id gnl|my_center|LOCUS_04700 20613 21539 gene locus_tag LOCUS_04710 20613 21539 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_04710 21829 23502 gene locus_tag LOCUS_04720 21829 23502 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_04720 23611 24780 gene locus_tag LOCUS_04730 23611 24780 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764572.1 protein_id gnl|my_center|LOCUS_04730 25041 24814 gene locus_tag LOCUS_04740 25041 24814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 25267 25034 gene locus_tag LOCUS_04750 25267 25034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 25853 25530 gene locus_tag LOCUS_04760 25853 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 27093 26080 gene locus_tag LOCUS_04770 27093 26080 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_04770 28347 27331 gene locus_tag LOCUS_04780 28347 27331 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_04780 29906 28515 gene locus_tag LOCUS_04790 29906 28515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 30356 31840 gene locus_tag LOCUS_04800 30356 31840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 31860 32777 gene locus_tag LOCUS_04810 31860 32777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 32873 33547 gene locus_tag LOCUS_04820 32873 33547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 34985 33561 gene locus_tag LOCUS_04830 34985 33561 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143713.1 protein_id gnl|my_center|LOCUS_04830 35126 36394 gene locus_tag LOCUS_04840 35126 36394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 36546 37214 gene locus_tag LOCUS_04850 36546 37214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 38196 37228 gene locus_tag LOCUS_04860 38196 37228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 38538 40172 gene locus_tag LOCUS_04870 gene nadB 38538 40172 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_04870 40289 41746 gene locus_tag LOCUS_04880 40289 41746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 41931 44354 gene locus_tag LOCUS_04890 41931 44354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 44524 45939 gene locus_tag LOCUS_04900 44524 45939 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_04900 46047 46394 gene locus_tag LOCUS_04910 46047 46394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 47463 46456 gene locus_tag LOCUS_04920 47463 46456 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_04920 51068 47460 gene locus_tag LOCUS_04930 gene nifJ 51068 47460 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_04930 51496 53892 gene locus_tag LOCUS_04940 51496 53892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 55014 53932 gene locus_tag LOCUS_04950 55014 53932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 55622 57445 gene locus_tag LOCUS_04960 55622 57445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 57478 59835 gene locus_tag LOCUS_04970 57478 59835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 60058 60465 gene locus_tag LOCUS_04980 60058 60465 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968539.1 protein_id gnl|my_center|LOCUS_04980 60587 61174 gene locus_tag LOCUS_04990 60587 61174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 61171 61563 gene locus_tag LOCUS_05000 61171 61563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 63360 61807 gene locus_tag LOCUS_05010 63360 61807 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767327.1 protein_id gnl|my_center|LOCUS_05010 64685 63357 gene locus_tag LOCUS_05020 64685 63357 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_05020 66134 65094 gene locus_tag LOCUS_05030 gene asnA 66134 65094 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_05030 67929 66361 gene locus_tag LOCUS_05040 67929 66361 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_05040 68308 68796 gene locus_tag LOCUS_05050 68308 68796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 68908 70860 gene locus_tag LOCUS_05060 68908 70860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 70879 73062 gene locus_tag LOCUS_05070 70879 73062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 protein_id gnl|my_center|LOCUS_05070 73187 73810 gene locus_tag LOCUS_05080 73187 73810 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_05080 74028 74216 gene locus_tag LOCUS_05090 74028 74216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 74311 75822 gene locus_tag LOCUS_05100 74311 75822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 75946 78729 gene locus_tag LOCUS_05110 75946 78729 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_05110 79249 82527 gene locus_tag LOCUS_05120 79249 82527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 82823 84088 gene locus_tag LOCUS_05130 82823 84088 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118020.1 protein_id gnl|my_center|LOCUS_05130 84135 85718 gene locus_tag LOCUS_05140 84135 85718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921337.1 protein_id gnl|my_center|LOCUS_05140 85724 85912 gene locus_tag LOCUS_05150 85724 85912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 86074 86886 gene locus_tag LOCUS_05160 gene proC 86074 86886 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_05160 86915 87145 gene locus_tag LOCUS_05170 86915 87145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 87182 87670 gene locus_tag LOCUS_05180 87182 87670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 87699 88262 gene locus_tag LOCUS_05190 87699 88262 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340258.1 protein_id gnl|my_center|LOCUS_05190 88363 89562 gene locus_tag LOCUS_05200 88363 89562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 90821 89532 gene locus_tag LOCUS_05210 90821 89532 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258899.1 protein_id gnl|my_center|LOCUS_05210 91761 90895 gene locus_tag LOCUS_05220 gene panC 91761 90895 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_05220 92826 91786 gene locus_tag LOCUS_05230 92826 91786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 96537 93799 gene locus_tag LOCUS_05240 gene gyrA 96537 93799 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922184.1 protein_id gnl|my_center|LOCUS_05240 97869 96913 gene locus_tag LOCUS_05250 gene miaA 97869 96913 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118401.1 protein_id gnl|my_center|LOCUS_05250 98627 97920 gene locus_tag LOCUS_05260 98627 97920 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327343.1 protein_id gnl|my_center|LOCUS_05260 99119 98718 gene locus_tag LOCUS_05270 99119 98718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 99303 99956 gene locus_tag LOCUS_05280 gene nth 99303 99956 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_05280 100014 100592 gene locus_tag LOCUS_05290 gene dcd 100014 100592 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_05290 101435 101680 gene locus_tag LOCUS_05300 101435 101680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 102226 103152 gene locus_tag LOCUS_05310 102226 103152 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393577.1 protein_id gnl|my_center|LOCUS_05310 104750 103167 gene locus_tag LOCUS_05320 104750 103167 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615865.1 protein_id gnl|my_center|LOCUS_05320 105291 106559 gene locus_tag LOCUS_05330 105291 106559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 106568 109780 gene locus_tag LOCUS_05340 106568 109780 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120847.1 protein_id gnl|my_center|LOCUS_05340 109807 110133 gene locus_tag LOCUS_05350 109807 110133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 110226 111176 gene locus_tag LOCUS_05360 gene dapF 110226 111176 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_05360 111250 112020 gene locus_tag LOCUS_05370 111250 112020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 113269 112178 gene locus_tag LOCUS_05380 113269 112178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 113463 114467 gene locus_tag LOCUS_05390 113463 114467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 114477 115481 gene locus_tag LOCUS_05400 114477 115481 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615365.1 protein_id gnl|my_center|LOCUS_05400 115478 117007 gene locus_tag LOCUS_05410 115478 117007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 118490 117132 gene locus_tag LOCUS_05420 118490 117132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 118821 119363 gene locus_tag LOCUS_05430 118821 119363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05430 119388 120248 gene locus_tag LOCUS_05440 119388 120248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05440 120799 120350 gene locus_tag LOCUS_05450 120799 120350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 121759 120887 gene locus_tag LOCUS_05460 121759 120887 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922020.1 protein_id gnl|my_center|LOCUS_05460 122050 123258 gene locus_tag LOCUS_05470 122050 123258 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383637.1 protein_id gnl|my_center|LOCUS_05470 123255 124799 gene locus_tag LOCUS_05480 123255 124799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 124807 125607 gene locus_tag LOCUS_05490 124807 125607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 126479 125589 gene locus_tag LOCUS_05500 126479 125589 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919889.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence006 2544 442 gene locus_tag LOCUS_05510 2544 442 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_05510 3314 2997 gene locus_tag LOCUS_05520 3314 2997 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_05520 5637 3376 gene locus_tag LOCUS_05530 5637 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 5742 6632 gene locus_tag LOCUS_05540 5742 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 6871 7404 gene locus_tag LOCUS_05550 6871 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 7338 7649 gene locus_tag LOCUS_05560 7338 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 8585 9874 gene locus_tag LOCUS_05570 8585 9874 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_05570 9946 10812 gene locus_tag LOCUS_05580 9946 10812 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_05580 10868 12313 gene locus_tag LOCUS_05590 gene gnd 10868 12313 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119037.1 protein_id gnl|my_center|LOCUS_05590 12376 13161 gene locus_tag LOCUS_05600 12376 13161 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_05600 13513 13196 gene locus_tag LOCUS_05610 13513 13196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 13909 15360 gene locus_tag LOCUS_05620 gene zwf 13909 15360 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335201.1 protein_id gnl|my_center|LOCUS_05620 15373 16383 gene locus_tag LOCUS_05630 15373 16383 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118292.1 protein_id gnl|my_center|LOCUS_05630 17025 16591 gene locus_tag LOCUS_05640 17025 16591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 18632 17022 gene locus_tag LOCUS_05650 18632 17022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 19892 18837 gene locus_tag LOCUS_05660 19892 18837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 22608 19873 gene locus_tag LOCUS_05670 22608 19873 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_05670 24092 22647 gene locus_tag LOCUS_05680 24092 22647 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682416.1 protein_id gnl|my_center|LOCUS_05680 24410 25336 gene locus_tag LOCUS_05690 24410 25336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 26078 25383 gene locus_tag LOCUS_05700 gene pgmB 26078 25383 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257887.1 protein_id gnl|my_center|LOCUS_05700 30255 26062 gene locus_tag LOCUS_05710 30255 26062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 30705 32486 gene locus_tag LOCUS_05720 30705 32486 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_05720 32530 33072 gene locus_tag LOCUS_05730 32530 33072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 34496 33123 gene locus_tag LOCUS_05740 34496 33123 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_05740 34609 37482 gene locus_tag LOCUS_05750 34609 37482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 38569 37664 gene locus_tag LOCUS_05760 38569 37664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 38735 39835 gene locus_tag LOCUS_05770 38735 39835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 41495 39972 gene locus_tag LOCUS_05780 41495 39972 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080375.1 protein_id gnl|my_center|LOCUS_05780 42170 41508 gene locus_tag LOCUS_05790 42170 41508 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393295.1 protein_id gnl|my_center|LOCUS_05790 42595 42167 gene locus_tag LOCUS_05800 42595 42167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 43266 42601 gene locus_tag LOCUS_05810 43266 42601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 45122 43263 gene locus_tag LOCUS_05820 45122 43263 CDS product KinB sensor domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114120.1 protein_id gnl|my_center|LOCUS_05820 46729 45356 gene locus_tag LOCUS_05830 gene algB 46729 45356 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102840.1 protein_id gnl|my_center|LOCUS_05830 46960 48507 gene locus_tag LOCUS_05840 46960 48507 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427734.1 protein_id gnl|my_center|LOCUS_05840 51770 48504 gene locus_tag LOCUS_05850 51770 48504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 53644 51767 gene locus_tag LOCUS_05860 gene treZ 53644 51767 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942994.1 protein_id gnl|my_center|LOCUS_05860 55940 53811 gene locus_tag LOCUS_05870 gene malQ 55940 53811 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542051.1 protein_id gnl|my_center|LOCUS_05870 57904 55937 gene locus_tag LOCUS_05880 gene treZ 57904 55937 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_05880 59823 57919 gene locus_tag LOCUS_05890 gene glgB 59823 57919 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_05890 63355 59945 gene locus_tag LOCUS_05900 gene treS 63355 59945 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_05900 65656 63452 gene locus_tag LOCUS_05910 gene glgX 65656 63452 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 protein_id gnl|my_center|LOCUS_05910 65921 67207 gene locus_tag LOCUS_05920 65921 67207 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615779.1 protein_id gnl|my_center|LOCUS_05920 67395 68126 gene locus_tag LOCUS_05930 67395 68126 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340751.1 protein_id gnl|my_center|LOCUS_05930 68198 69481 gene locus_tag LOCUS_05940 68198 69481 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812397.1 protein_id gnl|my_center|LOCUS_05940 69813 70934 gene locus_tag LOCUS_05950 gene carA 69813 70934 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921837.1 protein_id gnl|my_center|LOCUS_05950 70946 71308 gene locus_tag LOCUS_05960 70946 71308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 72104 71391 gene locus_tag LOCUS_05970 gene rsmG 72104 71391 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334161.1 protein_id gnl|my_center|LOCUS_05970 72271 72522 gene locus_tag LOCUS_05980 72271 72522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 72519 73331 gene locus_tag LOCUS_05990 72519 73331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329547.1 protein_id gnl|my_center|LOCUS_05990 73527 75437 gene locus_tag LOCUS_06000 73527 75437 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_06000 75440 76474 gene locus_tag LOCUS_06010 75440 76474 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_06010 77264 78121 gene locus_tag LOCUS_06020 77264 78121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 78130 79152 gene locus_tag LOCUS_06030 78130 79152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 80146 79259 gene locus_tag LOCUS_06040 gene sucD 80146 79259 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_06040 81364 80180 gene locus_tag LOCUS_06050 gene sucC 81364 80180 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327386.1 protein_id gnl|my_center|LOCUS_06050 83091 81373 gene locus_tag LOCUS_06060 gene polX 83091 81373 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615613.1 protein_id gnl|my_center|LOCUS_06060 84088 83096 gene locus_tag LOCUS_06070 84088 83096 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_06070 84408 85631 gene locus_tag LOCUS_06080 84408 85631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 85668 86444 gene locus_tag LOCUS_06090 85668 86444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 86554 87642 gene locus_tag LOCUS_06100 86554 87642 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_06100 87795 88235 gene locus_tag LOCUS_06110 87795 88235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 89129 90754 gene locus_tag LOCUS_06120 89129 90754 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001969726.1 protein_id gnl|my_center|LOCUS_06120 90751 90906 gene locus_tag LOCUS_06130 90751 90906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 90974 91393 gene locus_tag LOCUS_06140 90974 91393 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_06140 91390 93024 gene locus_tag LOCUS_06150 gene iorA 91390 93024 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_06150 93021 93518 gene locus_tag LOCUS_06160 93021 93518 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_06160 93581 94888 gene locus_tag LOCUS_06170 93581 94888 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_06170 94921 95358 gene locus_tag LOCUS_06180 94921 95358 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_06180 95480 96787 gene locus_tag LOCUS_06190 95480 96787 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_06190 97584 96796 gene locus_tag LOCUS_06200 gene map 97584 96796 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_06200 98162 97602 gene locus_tag LOCUS_06210 98162 97602 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055741.1 protein_id gnl|my_center|LOCUS_06210 99579 98218 gene locus_tag LOCUS_06220 gene secY 99579 98218 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326816.1 protein_id gnl|my_center|LOCUS_06220 100203 99715 gene locus_tag LOCUS_06230 gene rplO 100203 99715 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326814.1 protein_id gnl|my_center|LOCUS_06230 100688 100200 gene locus_tag LOCUS_06240 gene rpsE 100688 100200 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326813.1 protein_id gnl|my_center|LOCUS_06240 101112 100723 gene locus_tag LOCUS_06250 gene rplR 101112 100723 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603036.1 protein_id gnl|my_center|LOCUS_06250 101723 101178 gene locus_tag LOCUS_06260 gene rplF 101723 101178 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121609.1 protein_id gnl|my_center|LOCUS_06260 102166 101771 gene locus_tag LOCUS_06270 gene rpsH 102166 101771 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326810.1 protein_id gnl|my_center|LOCUS_06270 102368 102183 gene locus_tag LOCUS_06280 102368 102183 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326809.1 protein_id gnl|my_center|LOCUS_06280 102956 102387 gene locus_tag LOCUS_06290 gene rplE 102956 102387 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173391575.1 protein_id gnl|my_center|LOCUS_06290 103313 102966 gene locus_tag LOCUS_06300 gene rplX 103313 102966 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326807.1 protein_id gnl|my_center|LOCUS_06300 103681 103313 gene locus_tag LOCUS_06310 gene rplN 103681 103313 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326806.1 protein_id gnl|my_center|LOCUS_06310 104046 103741 gene locus_tag LOCUS_06320 gene rpsQ 104046 103741 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812390.1 protein_id gnl|my_center|LOCUS_06320 104338 104105 gene locus_tag LOCUS_06330 gene rpmC 104338 104105 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326804.1 protein_id gnl|my_center|LOCUS_06330 104804 104388 gene locus_tag LOCUS_06340 gene rplP 104804 104388 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_06340 105459 104743 gene locus_tag LOCUS_06350 gene rpsC 105459 104743 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326802.1 protein_id gnl|my_center|LOCUS_06350 105858 105532 gene locus_tag LOCUS_06360 gene rplV 105858 105532 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121604.1 protein_id gnl|my_center|LOCUS_06360 106193 105924 gene locus_tag LOCUS_06370 gene rpsS 106193 105924 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326800.1 protein_id gnl|my_center|LOCUS_06370 107081 106227 gene locus_tag LOCUS_06380 gene rplB 107081 106227 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121603.1 protein_id gnl|my_center|LOCUS_06380 107412 107101 gene locus_tag LOCUS_06390 gene rplW 107412 107101 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326798.1 protein_id gnl|my_center|LOCUS_06390 108074 107430 gene locus_tag LOCUS_06400 gene rplD 108074 107430 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326797.1 protein_id gnl|my_center|LOCUS_06400 108330 108160 gene locus_tag LOCUS_06410 108330 108160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 108385 108717 gene locus_tag LOCUS_06420 108385 108717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 109320 108991 gene locus_tag LOCUS_06430 gene rpsJ 109320 108991 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_06430 110638 109517 gene locus_tag LOCUS_06440 110638 109517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667978.1 protein_id gnl|my_center|LOCUS_06440 111209 110820 gene locus_tag LOCUS_06450 111209 110820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 111604 111302 gene locus_tag LOCUS_06460 111604 111302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 111882 113957 gene locus_tag LOCUS_06470 111882 113957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 113967 115118 gene locus_tag LOCUS_06480 113967 115118 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249749.1 protein_id gnl|my_center|LOCUS_06480 115133 116326 gene locus_tag LOCUS_06490 115133 116326 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120906.1 protein_id gnl|my_center|LOCUS_06490 116946 116377 gene locus_tag LOCUS_06500 116946 116377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06500 117169 116837 gene locus_tag LOCUS_06510 117169 116837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 117564 119015 gene locus_tag LOCUS_06520 gene hemG 117564 119015 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122777.1 protein_id gnl|my_center|LOCUS_06520 120694 120308 gene locus_tag LOCUS_06530 120694 120308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 121215 120709 gene locus_tag LOCUS_06540 121215 120709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 121492 121208 gene locus_tag LOCUS_06550 121492 121208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 121596 121802 gene locus_tag LOCUS_06560 121596 121802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 122868 122086 gene locus_tag LOCUS_06570 122868 122086 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258579.1 protein_id gnl|my_center|LOCUS_06570 123134 123811 gene locus_tag LOCUS_06580 123134 123811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 124710 124054 gene locus_tag LOCUS_06590 124710 124054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence007 2024 2221 gene locus_tag LOCUS_06600 2024 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2329 2258 gene locus_tag LOCUS_t00050 2329 2258 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3256 2405 gene locus_tag LOCUS_06610 3256 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 4628 3462 gene locus_tag LOCUS_06620 4628 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5530 4625 gene locus_tag LOCUS_06630 5530 4625 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921637.1 protein_id gnl|my_center|LOCUS_06630 6874 5924 gene locus_tag LOCUS_06640 6874 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 8810 7242 gene locus_tag LOCUS_06650 8810 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 10310 8940 gene locus_tag LOCUS_06660 10310 8940 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841307.1 protein_id gnl|my_center|LOCUS_06660 11504 10467 gene locus_tag LOCUS_06670 11504 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 12050 11565 gene locus_tag LOCUS_06680 12050 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326145.1 protein_id gnl|my_center|LOCUS_06680 13529 12678 gene locus_tag LOCUS_06690 13529 12678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339871.1 protein_id gnl|my_center|LOCUS_06690 14329 13553 gene locus_tag LOCUS_06700 14329 13553 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327962.1 protein_id gnl|my_center|LOCUS_06700 15210 14350 gene locus_tag LOCUS_06710 gene larE 15210 14350 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_06710 15960 16580 gene locus_tag LOCUS_06720 15960 16580 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_06720 16676 20422 gene locus_tag LOCUS_06730 16676 20422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 20419 21150 gene locus_tag LOCUS_06740 20419 21150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 21078 22382 gene locus_tag LOCUS_06750 21078 22382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 22835 22416 gene locus_tag LOCUS_06760 22835 22416 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 protein_id gnl|my_center|LOCUS_06760 23755 22865 gene locus_tag LOCUS_06770 23755 22865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 24546 23764 gene locus_tag LOCUS_06780 gene larB 24546 23764 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335257.1 protein_id gnl|my_center|LOCUS_06780 25104 24775 gene locus_tag LOCUS_06790 25104 24775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 27154 25157 gene locus_tag LOCUS_06800 27154 25157 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260488.1 protein_id gnl|my_center|LOCUS_06800 28034 27189 gene locus_tag LOCUS_06810 28034 27189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 29751 28024 gene locus_tag LOCUS_06820 29751 28024 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_06820 30971 29781 gene locus_tag LOCUS_06830 30971 29781 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339900.1 protein_id gnl|my_center|LOCUS_06830 32275 31046 gene locus_tag LOCUS_06840 32275 31046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 33401 32283 gene locus_tag LOCUS_06850 33401 32283 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_06850 33853 33413 gene locus_tag LOCUS_06860 33853 33413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 34296 34634 gene locus_tag LOCUS_06870 34296 34634 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809935.1 protein_id gnl|my_center|LOCUS_06870 34722 37187 gene locus_tag LOCUS_06880 34722 37187 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053568.1 protein_id gnl|my_center|LOCUS_06880 38623 37313 gene locus_tag LOCUS_06890 gene ripA 38623 37313 CDS product itaconate CoA-transferase RipA/Ict inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212070.1 protein_id gnl|my_center|LOCUS_06890 39033 40205 gene locus_tag LOCUS_06900 gene gcvT 39033 40205 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121468.1 protein_id gnl|my_center|LOCUS_06900 40202 40612 gene locus_tag LOCUS_06910 gene gcvH 40202 40612 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121467.1 protein_id gnl|my_center|LOCUS_06910 40660 41997 gene locus_tag LOCUS_06920 gene gcvPA 40660 41997 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331407.1 protein_id gnl|my_center|LOCUS_06920 42018 43481 gene locus_tag LOCUS_06930 gene gcvPB 42018 43481 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121465.1 protein_id gnl|my_center|LOCUS_06930 43478 44251 gene locus_tag LOCUS_06940 43478 44251 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121464.1 protein_id gnl|my_center|LOCUS_06940 44428 45087 gene locus_tag LOCUS_06950 44428 45087 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325534.1 protein_id gnl|my_center|LOCUS_06950 45190 45480 gene locus_tag LOCUS_06960 45190 45480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 45643 46128 gene locus_tag LOCUS_06970 45643 46128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201511.1 protein_id gnl|my_center|LOCUS_06970 46500 47579 gene locus_tag LOCUS_06980 46500 47579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 49997 47847 gene locus_tag LOCUS_06990 49997 47847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 50449 50667 gene locus_tag LOCUS_07000 50449 50667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 50853 51200 gene locus_tag LOCUS_07010 50853 51200 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327264.1 protein_id gnl|my_center|LOCUS_07010 52627 51344 gene locus_tag LOCUS_07020 52627 51344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 53582 52743 gene locus_tag LOCUS_07030 53582 52743 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086979.1 protein_id gnl|my_center|LOCUS_07030 54147 53854 gene locus_tag LOCUS_07040 54147 53854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 54820 54194 gene locus_tag LOCUS_07050 54820 54194 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337437.1 protein_id gnl|my_center|LOCUS_07050 56061 54904 gene locus_tag LOCUS_07060 gene dnaJ 56061 54904 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122091.1 protein_id gnl|my_center|LOCUS_07060 57847 56228 gene locus_tag LOCUS_07070 gene groL 57847 56228 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330146.1 protein_id gnl|my_center|LOCUS_07070 58202 57903 gene locus_tag LOCUS_07080 gene groES 58202 57903 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330007.1 protein_id gnl|my_center|LOCUS_07080 59979 58291 gene locus_tag LOCUS_07090 gene groL 59979 58291 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615436.1 protein_id gnl|my_center|LOCUS_07090 62188 60260 gene locus_tag LOCUS_07100 62188 60260 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090696.1 protein_id gnl|my_center|LOCUS_07100 62474 63520 gene locus_tag LOCUS_07110 62474 63520 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615530.1 protein_id gnl|my_center|LOCUS_07110 63818 63636 gene locus_tag LOCUS_07120 63818 63636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 63865 64188 gene locus_tag LOCUS_07130 63865 64188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 66028 64370 gene locus_tag LOCUS_07140 66028 64370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 66109 67842 gene locus_tag LOCUS_07150 66109 67842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 69610 68171 gene locus_tag LOCUS_07160 69610 68171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 71713 69782 gene locus_tag LOCUS_07170 71713 69782 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_07170 71940 72488 gene locus_tag LOCUS_07180 71940 72488 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121758.1 protein_id gnl|my_center|LOCUS_07180 72485 73639 gene locus_tag LOCUS_07190 72485 73639 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121149.1 protein_id gnl|my_center|LOCUS_07190 73731 75929 gene locus_tag LOCUS_07200 73731 75929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 75933 77156 gene locus_tag LOCUS_07210 75933 77156 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121147.1 protein_id gnl|my_center|LOCUS_07210 77177 79153 gene locus_tag LOCUS_07220 77177 79153 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616191.1 protein_id gnl|my_center|LOCUS_07220 79920 79168 gene locus_tag LOCUS_07230 79920 79168 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340094.1 protein_id gnl|my_center|LOCUS_07230 82248 79975 gene locus_tag LOCUS_07240 82248 79975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 83315 82254 gene locus_tag LOCUS_07250 83315 82254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120482.1 protein_id gnl|my_center|LOCUS_07250 83759 83406 gene locus_tag LOCUS_07260 gene rbfA 83759 83406 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325039.1 protein_id gnl|my_center|LOCUS_07260 86704 83849 gene locus_tag LOCUS_07270 86704 83849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 88312 86921 gene locus_tag LOCUS_07280 88312 86921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 89889 88606 gene locus_tag LOCUS_07290 89889 88606 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_07290 91371 90136 gene locus_tag LOCUS_07300 91371 90136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329429.1 protein_id gnl|my_center|LOCUS_07300 91574 92008 gene locus_tag LOCUS_07310 91574 92008 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084560.1 protein_id gnl|my_center|LOCUS_07310 92440 92051 gene locus_tag LOCUS_07320 92440 92051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 94366 92543 gene locus_tag LOCUS_07330 94366 92543 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_07330 94483 95829 gene locus_tag LOCUS_07340 gene glmM 94483 95829 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922275.1 protein_id gnl|my_center|LOCUS_07340 97598 96021 gene locus_tag LOCUS_07350 97598 96021 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922522.1 protein_id gnl|my_center|LOCUS_07350 99065 97707 gene locus_tag LOCUS_07360 99065 97707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 101494 99314 gene locus_tag LOCUS_07370 101494 99314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 103425 101506 gene locus_tag LOCUS_07380 103425 101506 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_07380 105489 103621 gene locus_tag LOCUS_07390 105489 103621 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_07390 105903 105637 gene locus_tag LOCUS_07400 105903 105637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 106661 106080 gene locus_tag LOCUS_07410 106661 106080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 106962 107300 gene locus_tag LOCUS_07420 106962 107300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 107380 107712 gene locus_tag LOCUS_07430 107380 107712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 108299 109381 gene locus_tag LOCUS_07440 108299 109381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 109507 110577 gene locus_tag LOCUS_07450 109507 110577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 110615 110803 gene locus_tag LOCUS_07460 110615 110803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 110837 112456 gene locus_tag LOCUS_07470 110837 112456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 112464 114521 gene locus_tag LOCUS_07480 112464 114521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 114575 115966 gene locus_tag LOCUS_07490 114575 115966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 116974 117384 gene locus_tag LOCUS_07500 116974 117384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 117702 119261 gene locus_tag LOCUS_07510 117702 119261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 119356 121698 gene locus_tag LOCUS_07520 119356 121698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence008 13753 2735 gene locus_tag LOCUS_07530 13753 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 15152 14508 gene locus_tag LOCUS_07540 15152 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 15796 17433 gene locus_tag LOCUS_07550 15796 17433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 17558 18130 gene locus_tag LOCUS_07560 17558 18130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 18332 19384 gene locus_tag LOCUS_07570 18332 19384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 20170 19559 gene locus_tag LOCUS_07580 20170 19559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 20303 21301 gene locus_tag LOCUS_07590 20303 21301 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_07590 23171 21441 gene locus_tag LOCUS_07600 23171 21441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 24326 23256 gene locus_tag LOCUS_07610 24326 23256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 24639 25898 gene locus_tag LOCUS_07620 24639 25898 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_07620 26067 27392 gene locus_tag LOCUS_07630 26067 27392 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_07630 27478 29370 gene locus_tag LOCUS_07640 27478 29370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 29607 30224 gene locus_tag LOCUS_07650 29607 30224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615937.1 protein_id gnl|my_center|LOCUS_07650 30856 31467 gene locus_tag LOCUS_07660 30856 31467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 31830 33659 gene locus_tag LOCUS_07670 31830 33659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 33835 35562 gene locus_tag LOCUS_07680 33835 35562 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435082.1 protein_id gnl|my_center|LOCUS_07680 35724 38138 gene locus_tag LOCUS_07690 35724 38138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 38239 40698 gene locus_tag LOCUS_07700 38239 40698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 43616 40866 gene locus_tag LOCUS_07710 43616 40866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 45875 43686 gene locus_tag LOCUS_07720 45875 43686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 48837 45907 gene locus_tag LOCUS_07730 48837 45907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 49193 48975 gene locus_tag LOCUS_07740 49193 48975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 49626 49357 gene locus_tag LOCUS_07750 49626 49357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 49703 50191 gene locus_tag LOCUS_07760 49703 50191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 52303 50960 gene locus_tag LOCUS_07770 52303 50960 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_07770 53018 52945 gene locus_tag LOCUS_t00060 53018 52945 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 54328 53513 gene locus_tag LOCUS_07780 54328 53513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 55464 54346 gene locus_tag LOCUS_07790 55464 54346 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192197.1 protein_id gnl|my_center|LOCUS_07790 56827 55478 gene locus_tag LOCUS_07800 56827 55478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 57492 57016 gene locus_tag LOCUS_07810 57492 57016 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943903.1 protein_id gnl|my_center|LOCUS_07810 57854 58297 gene locus_tag LOCUS_07820 57854 58297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 58360 59454 gene locus_tag LOCUS_07830 58360 59454 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_07830 60350 60547 gene locus_tag LOCUS_07840 60350 60547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 61518 60604 gene locus_tag LOCUS_07850 61518 60604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 65834 61680 gene locus_tag LOCUS_07860 gene cobN 65834 61680 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020441.1 protein_id gnl|my_center|LOCUS_07860 66156 65818 gene locus_tag LOCUS_07870 66156 65818 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765016.1 protein_id gnl|my_center|LOCUS_07870 66857 66153 gene locus_tag LOCUS_07880 66857 66153 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812433.1 protein_id gnl|my_center|LOCUS_07880 67045 68010 gene locus_tag LOCUS_07890 67045 68010 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123049.1 protein_id gnl|my_center|LOCUS_07890 68468 68076 gene locus_tag LOCUS_07900 68468 68076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 68788 69948 gene locus_tag LOCUS_07910 68788 69948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 70003 70944 gene locus_tag LOCUS_07920 70003 70944 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_07920 71083 71508 gene locus_tag LOCUS_07930 71083 71508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 72599 71571 gene locus_tag LOCUS_07940 72599 71571 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339548.1 protein_id gnl|my_center|LOCUS_07940 73645 72596 gene locus_tag LOCUS_07950 73645 72596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 73759 74001 gene locus_tag LOCUS_07960 73759 74001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 74242 75291 gene locus_tag LOCUS_07970 74242 75291 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123049.1 protein_id gnl|my_center|LOCUS_07970 75312 76493 gene locus_tag LOCUS_07980 75312 76493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 76944 76588 gene locus_tag LOCUS_07990 76944 76588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 77949 76981 gene locus_tag LOCUS_08000 77949 76981 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922391.1 protein_id gnl|my_center|LOCUS_08000 78200 78508 gene locus_tag LOCUS_08010 78200 78508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 79537 78599 gene locus_tag LOCUS_08020 79537 78599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 79842 79579 gene locus_tag LOCUS_08030 79842 79579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 80226 81230 gene locus_tag LOCUS_08040 80226 81230 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123049.1 protein_id gnl|my_center|LOCUS_08040 81249 81938 gene locus_tag LOCUS_08050 81249 81938 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123055.1 protein_id gnl|my_center|LOCUS_08050 82080 85205 gene locus_tag LOCUS_08060 82080 85205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 85398 86168 gene locus_tag LOCUS_08070 85398 86168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123055.1 protein_id gnl|my_center|LOCUS_08070 86165 89014 gene locus_tag LOCUS_08080 86165 89014 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123054.1 protein_id gnl|my_center|LOCUS_08080 90268 89195 gene locus_tag LOCUS_08090 gene modC 90268 89195 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836198.1 protein_id gnl|my_center|LOCUS_08090 90959 90255 gene locus_tag LOCUS_08100 gene modB 90959 90255 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388461.1 protein_id gnl|my_center|LOCUS_08100 91822 90962 gene locus_tag LOCUS_08110 gene modA 91822 90962 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206718.1 protein_id gnl|my_center|LOCUS_08110 94893 91819 gene locus_tag LOCUS_08120 94893 91819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 97526 94941 gene locus_tag LOCUS_08130 97526 94941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 99398 98187 gene locus_tag LOCUS_08140 99398 98187 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_08140 101395 99599 gene locus_tag LOCUS_08150 101395 99599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 102596 101742 gene locus_tag LOCUS_08160 102596 101742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 104496 103042 gene locus_tag LOCUS_08170 104496 103042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 105202 104642 gene locus_tag LOCUS_08180 105202 104642 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_08180 105627 108728 gene locus_tag LOCUS_08190 105627 108728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 108735 109355 gene locus_tag LOCUS_08200 gene pncA 108735 109355 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_08200 112185 109516 gene locus_tag LOCUS_08210 112185 109516 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_08210 112478 112807 gene locus_tag LOCUS_08220 112478 112807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 113181 112852 gene locus_tag LOCUS_08230 113181 112852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 114236 113181 gene locus_tag LOCUS_08240 114236 113181 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_08240 114592 114365 gene locus_tag LOCUS_08250 114592 114365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08250 116297 114498 gene locus_tag LOCUS_08260 116297 114498 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085096.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08260 >Feature sequence009 8845 119 gene locus_tag LOCUS_08270 8845 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 8990 9538 gene locus_tag LOCUS_08280 8990 9538 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_08280 9535 9975 gene locus_tag LOCUS_08290 9535 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 12808 10595 gene locus_tag LOCUS_08300 12808 10595 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921493.1 protein_id gnl|my_center|LOCUS_08300 13428 12994 gene locus_tag LOCUS_08310 13428 12994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 14590 13583 gene locus_tag LOCUS_08320 14590 13583 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_08320 15295 14852 gene locus_tag LOCUS_08330 15295 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 16353 15364 gene locus_tag LOCUS_08340 16353 15364 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_08340 16725 17222 gene locus_tag LOCUS_08350 16725 17222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 17348 17512 gene locus_tag LOCUS_08360 17348 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 18585 20177 gene locus_tag LOCUS_08370 18585 20177 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132123697.1 protein_id gnl|my_center|LOCUS_08370 20195 21322 gene locus_tag LOCUS_08380 20195 21322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 24906 21334 gene locus_tag LOCUS_08390 24906 21334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 25192 26688 gene locus_tag LOCUS_08400 25192 26688 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_08400 26729 28009 gene locus_tag LOCUS_08410 26729 28009 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004348078.1 protein_id gnl|my_center|LOCUS_08410 28027 29013 gene locus_tag LOCUS_08420 28027 29013 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338915.1 protein_id gnl|my_center|LOCUS_08420 29874 29113 gene locus_tag LOCUS_08430 29874 29113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 30577 30155 gene locus_tag LOCUS_08440 30577 30155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 31693 30692 gene locus_tag LOCUS_08450 31693 30692 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_08450 32464 32024 gene locus_tag LOCUS_08460 32464 32024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 33552 32539 gene locus_tag LOCUS_08470 33552 32539 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_08470 35040 33826 gene locus_tag LOCUS_08480 35040 33826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 36055 35213 gene locus_tag LOCUS_08490 36055 35213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 37791 36298 gene locus_tag LOCUS_08500 37791 36298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324244.1 protein_id gnl|my_center|LOCUS_08500 38297 39442 gene locus_tag LOCUS_08510 38297 39442 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533209.1 protein_id gnl|my_center|LOCUS_08510 39460 40350 gene locus_tag LOCUS_08520 39460 40350 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336262.1 protein_id gnl|my_center|LOCUS_08520 40347 41927 gene locus_tag LOCUS_08530 40347 41927 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667931.1 protein_id gnl|my_center|LOCUS_08530 41934 43169 gene locus_tag LOCUS_08540 41934 43169 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_08540 43229 43867 gene locus_tag LOCUS_08550 43229 43867 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332043.1 protein_id gnl|my_center|LOCUS_08550 43892 44860 gene locus_tag LOCUS_08560 43892 44860 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437216.1 protein_id gnl|my_center|LOCUS_08560 45954 44911 gene locus_tag LOCUS_08570 45954 44911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 47799 46387 gene locus_tag LOCUS_08580 47799 46387 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869048.1 protein_id gnl|my_center|LOCUS_08580 48158 49525 gene locus_tag LOCUS_08590 gene der 48158 49525 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_08590 49526 50332 gene locus_tag LOCUS_08600 49526 50332 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_08600 50360 50806 gene locus_tag LOCUS_08610 50360 50806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329468.1 protein_id gnl|my_center|LOCUS_08610 51562 51786 gene locus_tag LOCUS_08620 51562 51786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 52273 51941 gene locus_tag LOCUS_08630 52273 51941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 52630 53742 gene locus_tag LOCUS_08640 52630 53742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 53842 54462 gene locus_tag LOCUS_08650 53842 54462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 55862 54861 gene locus_tag LOCUS_08660 55862 54861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 56523 59351 gene locus_tag LOCUS_08670 gene polA 56523 59351 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922564.1 protein_id gnl|my_center|LOCUS_08670 59348 59977 gene locus_tag LOCUS_08680 gene coaE 59348 59977 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_08680 60154 61617 gene locus_tag LOCUS_08690 gene rho 60154 61617 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813585.1 protein_id gnl|my_center|LOCUS_08690 61708 62211 gene locus_tag LOCUS_08700 gene ribE 61708 62211 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258065.1 protein_id gnl|my_center|LOCUS_08700 62221 62631 gene locus_tag LOCUS_08710 gene nusB 62221 62631 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326965.1 protein_id gnl|my_center|LOCUS_08710 62633 63553 gene locus_tag LOCUS_08720 gene ftsY 62633 63553 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331084.1 protein_id gnl|my_center|LOCUS_08720 63744 63669 gene locus_tag LOCUS_t00070 63744 63669 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 64232 64849 gene locus_tag LOCUS_08730 64232 64849 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_08730 64886 66370 gene locus_tag LOCUS_08740 64886 66370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 67505 66411 gene locus_tag LOCUS_08750 67505 66411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 68011 67694 gene locus_tag LOCUS_08760 68011 67694 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_08760 69366 68008 gene locus_tag LOCUS_08770 69366 68008 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461881.1 protein_id gnl|my_center|LOCUS_08770 70136 69363 gene locus_tag LOCUS_08780 70136 69363 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461882.1 protein_id gnl|my_center|LOCUS_08780 70135 70305 gene locus_tag LOCUS_08790 70135 70305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 71377 70316 gene locus_tag LOCUS_08800 gene dsrB 71377 70316 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810503.1 protein_id gnl|my_center|LOCUS_08800 72560 71370 gene locus_tag LOCUS_08810 gene dsrA 72560 71370 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810505.1 protein_id gnl|my_center|LOCUS_08810 72751 72563 gene locus_tag LOCUS_08820 72751 72563 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_08820 74507 75649 gene locus_tag LOCUS_08830 74507 75649 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327172.1 protein_id gnl|my_center|LOCUS_08830 75842 75615 gene locus_tag LOCUS_08840 75842 75615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 75819 76610 gene locus_tag LOCUS_08850 75819 76610 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121793.1 protein_id gnl|my_center|LOCUS_08850 77314 76724 gene locus_tag LOCUS_08860 77314 76724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328467.1 protein_id gnl|my_center|LOCUS_08860 78103 77732 gene locus_tag LOCUS_08870 78103 77732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 78857 78123 gene locus_tag LOCUS_08880 78857 78123 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_08880 80525 78873 gene locus_tag LOCUS_08890 80525 78873 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_08890 81600 80650 gene locus_tag LOCUS_08900 gene coxB 81600 80650 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404828.1 protein_id gnl|my_center|LOCUS_08900 82567 81602 gene locus_tag LOCUS_08910 82567 81602 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922554.1 protein_id gnl|my_center|LOCUS_08910 82872 82564 gene locus_tag LOCUS_08920 82872 82564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 84127 82895 gene locus_tag LOCUS_08930 84127 82895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922553.1 protein_id gnl|my_center|LOCUS_08930 85364 84141 gene locus_tag LOCUS_08940 85364 84141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 86801 85374 gene locus_tag LOCUS_08950 gene nrfD 86801 85374 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_08950 89862 86776 gene locus_tag LOCUS_08960 89862 86776 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_08960 90509 89859 gene locus_tag LOCUS_08970 90509 89859 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123848.1 protein_id gnl|my_center|LOCUS_08970 91685 90846 gene locus_tag LOCUS_08980 91685 90846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 92465 91689 gene locus_tag LOCUS_08990 92465 91689 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120970.1 protein_id gnl|my_center|LOCUS_08990 92647 93156 gene locus_tag LOCUS_09000 92647 93156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 93283 94038 gene locus_tag LOCUS_09010 93283 94038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 94771 94091 gene locus_tag LOCUS_09020 94771 94091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 96101 94818 gene locus_tag LOCUS_09030 gene tyrS 96101 94818 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_09030 96859 96119 gene locus_tag LOCUS_09040 gene ispD 96859 96119 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122160.1 protein_id gnl|my_center|LOCUS_09040 98289 97054 gene locus_tag LOCUS_09050 98289 97054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 100409 98382 gene locus_tag LOCUS_09060 100409 98382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 101935 100406 gene locus_tag LOCUS_09070 101935 100406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 102265 103224 gene locus_tag LOCUS_09080 102265 103224 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_09080 104340 103288 gene locus_tag LOCUS_09090 104340 103288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 104487 105626 gene locus_tag LOCUS_09100 104487 105626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 105826 106122 gene locus_tag LOCUS_09110 105826 106122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 106216 106395 gene locus_tag LOCUS_09120 106216 106395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 106850 106635 gene locus_tag LOCUS_09130 106850 106635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 107365 107162 gene locus_tag LOCUS_09140 107365 107162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 107824 108246 gene locus_tag LOCUS_09150 107824 108246 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 protein_id gnl|my_center|LOCUS_09150 108983 108333 gene locus_tag LOCUS_09160 108983 108333 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334179.1 protein_id gnl|my_center|LOCUS_09160 109153 110274 gene locus_tag LOCUS_09170 109153 110274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 110959 110399 gene locus_tag LOCUS_09180 gene frr 110959 110399 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_09180 111756 110995 gene locus_tag LOCUS_09190 gene pyrH 111756 110995 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261659.1 protein_id gnl|my_center|LOCUS_09190 112591 111761 gene locus_tag LOCUS_09200 gene tsf 112591 111761 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705094.1 protein_id gnl|my_center|LOCUS_09200 113380 112643 gene locus_tag LOCUS_09210 gene rpsB 113380 112643 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 protein_id gnl|my_center|LOCUS_09210 113612 113541 gene locus_tag LOCUS_t00080 113612 113541 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 114347 113886 gene locus_tag LOCUS_09220 114347 113886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence010 3193 2456 gene locus_tag LOCUS_09230 3193 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 8163 3190 gene locus_tag LOCUS_09240 8163 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 8783 8160 gene locus_tag LOCUS_09250 8783 8160 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922279.1 protein_id gnl|my_center|LOCUS_09250 9018 8863 gene locus_tag LOCUS_09260 9018 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 9352 9146 gene locus_tag LOCUS_09270 9352 9146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 9643 10188 gene locus_tag LOCUS_09280 9643 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 10448 13201 gene locus_tag LOCUS_09290 10448 13201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 13229 14620 gene locus_tag LOCUS_09300 13229 14620 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_09300 14644 15711 gene locus_tag LOCUS_09310 14644 15711 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_09310 16119 15844 gene locus_tag LOCUS_09320 16119 15844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 16501 17613 gene locus_tag LOCUS_09330 16501 17613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 18265 17750 gene locus_tag LOCUS_09340 18265 17750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 19035 18370 gene locus_tag LOCUS_09350 19035 18370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 19990 20595 gene locus_tag LOCUS_09360 19990 20595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 23669 20838 gene locus_tag LOCUS_09370 gene uvrA 23669 20838 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_09370 25778 23775 gene locus_tag LOCUS_09380 gene ligA 25778 23775 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122894.1 protein_id gnl|my_center|LOCUS_09380 26203 25820 gene locus_tag LOCUS_09390 26203 25820 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081748.1 protein_id gnl|my_center|LOCUS_09390 27622 26399 gene locus_tag LOCUS_09400 gene murD 27622 26399 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256652.1 protein_id gnl|my_center|LOCUS_09400 28798 27872 gene locus_tag LOCUS_09410 28798 27872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 29520 28912 gene locus_tag LOCUS_09420 29520 28912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 30822 29539 gene locus_tag LOCUS_09430 gene rimO 30822 29539 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922374.1 protein_id gnl|my_center|LOCUS_09430 31952 31023 gene locus_tag LOCUS_09440 31952 31023 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_09440 33145 32078 gene locus_tag LOCUS_09450 33145 32078 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329631.1 protein_id gnl|my_center|LOCUS_09450 33994 33188 gene locus_tag LOCUS_09460 33994 33188 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332783.1 protein_id gnl|my_center|LOCUS_09460 34290 34024 gene locus_tag LOCUS_09470 gene fliQ 34290 34024 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329633.1 protein_id gnl|my_center|LOCUS_09470 35237 34404 gene locus_tag LOCUS_09480 35237 34404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 36066 35230 gene locus_tag LOCUS_09490 36066 35230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 36893 36144 gene locus_tag LOCUS_09500 36893 36144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 37484 36990 gene locus_tag LOCUS_09510 37484 36990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 37995 38810 gene locus_tag LOCUS_09520 37995 38810 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391248.1 protein_id gnl|my_center|LOCUS_09520 38829 39482 gene locus_tag LOCUS_09530 gene cbiM 38829 39482 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_09530 39655 40236 gene locus_tag LOCUS_09540 39655 40236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 40354 41097 gene locus_tag LOCUS_09550 40354 41097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 41094 41768 gene locus_tag LOCUS_09560 41094 41768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626425.1 protein_id gnl|my_center|LOCUS_09560 41857 43527 gene locus_tag LOCUS_09570 41857 43527 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_09570 44479 43682 gene locus_tag LOCUS_09580 gene hisN 44479 43682 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921412.1 protein_id gnl|my_center|LOCUS_09580 44723 46132 gene locus_tag LOCUS_09590 44723 46132 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_09590 46138 46908 gene locus_tag LOCUS_09600 46138 46908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_09600 46908 48080 gene locus_tag LOCUS_09610 46908 48080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_09610 48077 49255 gene locus_tag LOCUS_09620 48077 49255 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_09620 49587 51095 gene locus_tag LOCUS_09630 49587 51095 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118026.1 protein_id gnl|my_center|LOCUS_09630 51309 52733 gene locus_tag LOCUS_09640 51309 52733 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_09640 52773 54311 gene locus_tag LOCUS_09650 52773 54311 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_09650 55694 54507 gene locus_tag LOCUS_09660 55694 54507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 56008 57471 gene locus_tag LOCUS_09670 56008 57471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 57480 59423 gene locus_tag LOCUS_09680 57480 59423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 59428 60117 gene locus_tag LOCUS_09690 59428 60117 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_09690 60526 60690 gene locus_tag LOCUS_09700 60526 60690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 61022 61786 gene locus_tag LOCUS_09710 61022 61786 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 protein_id gnl|my_center|LOCUS_09710 61841 64522 gene locus_tag LOCUS_09720 61841 64522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616081.1 protein_id gnl|my_center|LOCUS_09720 64593 66662 gene locus_tag LOCUS_09730 64593 66662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 66705 67292 gene locus_tag LOCUS_09740 66705 67292 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938294.1 protein_id gnl|my_center|LOCUS_09740 67379 69835 gene locus_tag LOCUS_09750 67379 69835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 71399 70077 gene locus_tag LOCUS_09760 71399 70077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_09760 72146 71424 gene locus_tag LOCUS_09770 72146 71424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_09770 74044 72143 gene locus_tag LOCUS_09780 74044 72143 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922030.1 protein_id gnl|my_center|LOCUS_09780 74550 78989 gene locus_tag LOCUS_09790 74550 78989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 79547 79134 gene locus_tag LOCUS_09800 79547 79134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616149.1 protein_id gnl|my_center|LOCUS_09800 80606 79671 gene locus_tag LOCUS_09810 80606 79671 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_09810 82141 80819 gene locus_tag LOCUS_09820 82141 80819 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922322.1 protein_id gnl|my_center|LOCUS_09820 83182 82376 gene locus_tag LOCUS_09830 83182 82376 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922156.1 protein_id gnl|my_center|LOCUS_09830 83402 83190 gene locus_tag LOCUS_09840 83402 83190 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065065.1 protein_id gnl|my_center|LOCUS_09840 83644 84555 gene locus_tag LOCUS_09850 83644 84555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 84770 86953 gene locus_tag LOCUS_09860 gene nuoF 84770 86953 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082447.1 protein_id gnl|my_center|LOCUS_09860 86973 88730 gene locus_tag LOCUS_09870 86973 88730 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_09870 88727 89266 gene locus_tag LOCUS_09880 88727 89266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 89394 91025 gene locus_tag LOCUS_09890 89394 91025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 91082 91813 gene locus_tag LOCUS_09900 91082 91813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 91882 93207 gene locus_tag LOCUS_09910 91882 93207 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_09910 93329 93144 gene locus_tag LOCUS_09920 93329 93144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 97396 93395 gene locus_tag LOCUS_09930 97396 93395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 99563 97449 gene locus_tag LOCUS_09940 99563 97449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 99502 99717 gene locus_tag LOCUS_09950 99502 99717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 99921 100688 gene locus_tag LOCUS_09960 99921 100688 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_09960 100704 101219 gene locus_tag LOCUS_09970 100704 101219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 101209 102309 gene locus_tag LOCUS_09980 101209 102309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 103544 102453 gene locus_tag LOCUS_09990 103544 102453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence011 733 371 gene locus_tag LOCUS_10000 gene cheY 733 371 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211091957.1 protein_id gnl|my_center|LOCUS_10000 983 1498 gene locus_tag LOCUS_10010 983 1498 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545419.1 protein_id gnl|my_center|LOCUS_10010 1534 2400 gene locus_tag LOCUS_10020 1534 2400 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545471.1 protein_id gnl|my_center|LOCUS_10020 2488 5445 gene locus_tag LOCUS_10030 2488 5445 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671244.1 protein_id gnl|my_center|LOCUS_10030 5455 6072 gene locus_tag LOCUS_10040 5455 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 6114 6605 gene locus_tag LOCUS_10050 6114 6605 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080666.1 protein_id gnl|my_center|LOCUS_10050 6628 6987 gene locus_tag LOCUS_10060 gene cheY 6628 6987 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081049.1 protein_id gnl|my_center|LOCUS_10060 8254 7073 gene locus_tag LOCUS_10070 8254 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 9035 10240 gene locus_tag LOCUS_10080 9035 10240 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878430.1 protein_id gnl|my_center|LOCUS_10080 10422 12080 gene locus_tag LOCUS_10090 10422 12080 CDS product DUF4173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921447.1 protein_id gnl|my_center|LOCUS_10090 12125 13612 gene locus_tag LOCUS_10100 12125 13612 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015922925.1 protein_id gnl|my_center|LOCUS_10100 13861 15210 gene locus_tag LOCUS_10110 13861 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 15231 16583 gene locus_tag LOCUS_10120 15231 16583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 17538 16570 gene locus_tag LOCUS_10130 17538 16570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 18829 17615 gene locus_tag LOCUS_10140 gene nifS 18829 17615 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_10140 19798 18836 gene locus_tag LOCUS_10150 gene nifU 19798 18836 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_10150 21779 19932 gene locus_tag LOCUS_10160 21779 19932 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_10160 22091 22954 gene locus_tag LOCUS_10170 gene trxA 22091 22954 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522640.1 protein_id gnl|my_center|LOCUS_10170 23841 23044 gene locus_tag LOCUS_10180 23841 23044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 24842 23817 gene locus_tag LOCUS_10190 gene obgE 24842 23817 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324342.1 protein_id gnl|my_center|LOCUS_10190 25214 24966 gene locus_tag LOCUS_10200 gene rpmA 25214 24966 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_10200 26225 25329 gene locus_tag LOCUS_10210 26225 25329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 27418 26495 gene locus_tag LOCUS_10220 27418 26495 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_10220 28622 27420 gene locus_tag LOCUS_10230 28622 27420 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613583.1 protein_id gnl|my_center|LOCUS_10230 29359 28619 gene locus_tag LOCUS_10240 29359 28619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 30308 29373 gene locus_tag LOCUS_10250 30308 29373 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_10250 31285 30305 gene locus_tag LOCUS_10260 31285 30305 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_10260 32010 31282 gene locus_tag LOCUS_10270 32010 31282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 33607 31988 gene locus_tag LOCUS_10280 33607 31988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 34227 33676 gene locus_tag LOCUS_10290 34227 33676 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391311.1 protein_id gnl|my_center|LOCUS_10290 34527 36182 gene locus_tag LOCUS_10300 34527 36182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122878.1 protein_id gnl|my_center|LOCUS_10300 36254 37807 gene locus_tag LOCUS_10310 36254 37807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 39461 37776 gene locus_tag LOCUS_10320 39461 37776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 40610 39564 gene locus_tag LOCUS_10330 40610 39564 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_10330 40810 42483 gene locus_tag LOCUS_10340 40810 42483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 42480 44222 gene locus_tag LOCUS_10350 42480 44222 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_10350 44535 45731 gene locus_tag LOCUS_10360 gene vpsB 44535 45731 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase VpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482531.1 protein_id gnl|my_center|LOCUS_10360 46827 45784 gene locus_tag LOCUS_10370 46827 45784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 47903 46854 gene locus_tag LOCUS_10380 47903 46854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 49484 47979 gene locus_tag LOCUS_10390 49484 47979 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_10390 49464 49649 gene locus_tag LOCUS_10400 49464 49649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 50089 49805 gene locus_tag LOCUS_10410 50089 49805 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398761.1 protein_id gnl|my_center|LOCUS_10410 50282 50091 gene locus_tag LOCUS_10420 50282 50091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 51330 50296 gene locus_tag LOCUS_10430 gene ychF 51330 50296 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393954.1 protein_id gnl|my_center|LOCUS_10430 53667 51349 gene locus_tag LOCUS_10440 53667 51349 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922339.1 protein_id gnl|my_center|LOCUS_10440 54872 53670 gene locus_tag LOCUS_10450 54872 53670 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122798.1 protein_id gnl|my_center|LOCUS_10450 55832 54891 gene locus_tag LOCUS_10460 55832 54891 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_10460 56076 58511 gene locus_tag LOCUS_10470 56076 58511 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972694.1 protein_id gnl|my_center|LOCUS_10470 58634 58990 gene locus_tag LOCUS_10480 58634 58990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 59148 60791 gene locus_tag LOCUS_10490 59148 60791 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921786.1 protein_id gnl|my_center|LOCUS_10490 60995 60810 gene locus_tag LOCUS_10500 60995 60810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 61489 61686 gene locus_tag LOCUS_10510 gene rpsU 61489 61686 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338941.1 protein_id gnl|my_center|LOCUS_10510 62115 63191 gene locus_tag LOCUS_10520 62115 63191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 63239 64603 gene locus_tag LOCUS_10530 63239 64603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_10530 67144 64673 gene locus_tag LOCUS_10540 67144 64673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 67138 67341 gene locus_tag LOCUS_10550 67138 67341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 69486 67444 gene locus_tag LOCUS_10560 69486 67444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 70520 69483 gene locus_tag LOCUS_10570 70520 69483 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_10570 71017 70517 gene locus_tag LOCUS_10580 71017 70517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 72079 71189 gene locus_tag LOCUS_10590 72079 71189 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_10590 73055 72060 gene locus_tag LOCUS_10600 73055 72060 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_10600 76945 73064 gene locus_tag LOCUS_10610 76945 73064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 77472 80867 gene locus_tag LOCUS_10620 77472 80867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 80867 81655 gene locus_tag LOCUS_10630 80867 81655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 81754 82122 gene locus_tag LOCUS_10640 81754 82122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 82122 82703 gene locus_tag LOCUS_10650 82122 82703 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970715.1 protein_id gnl|my_center|LOCUS_10650 84118 82814 gene locus_tag LOCUS_10660 84118 82814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 85460 84246 gene locus_tag LOCUS_10670 85460 84246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 86643 85450 gene locus_tag LOCUS_10680 86643 85450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 89726 86640 gene locus_tag LOCUS_10690 89726 86640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 92137 90266 gene locus_tag LOCUS_10700 92137 90266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 94219 92276 gene locus_tag LOCUS_10710 94219 92276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 95288 94296 gene locus_tag LOCUS_10720 95288 94296 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975555.1 protein_id gnl|my_center|LOCUS_10720 96597 95623 gene locus_tag LOCUS_10730 96597 95623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 98331 96970 gene locus_tag LOCUS_10740 98331 96970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 100460 98496 gene locus_tag LOCUS_10750 100460 98496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence012 37 405 gene locus_tag LOCUS_10760 37 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 396 608 gene locus_tag LOCUS_10770 396 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 920 1108 gene locus_tag LOCUS_10780 920 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1112 1441 gene locus_tag LOCUS_10790 1112 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1512 2279 gene locus_tag LOCUS_10800 1512 2279 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404012.1 protein_id gnl|my_center|LOCUS_10800 2380 3273 gene locus_tag LOCUS_10810 2380 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3284 3469 gene locus_tag LOCUS_10820 3284 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3466 4440 gene locus_tag LOCUS_10830 3466 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4912 4622 gene locus_tag LOCUS_10840 4912 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 5027 9121 gene locus_tag LOCUS_10850 5027 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 9410 12790 gene locus_tag LOCUS_10860 9410 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 13290 14354 gene locus_tag LOCUS_10870 13290 14354 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144043581.1 protein_id gnl|my_center|LOCUS_10870 14475 14930 gene locus_tag LOCUS_10880 14475 14930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 16479 15295 gene locus_tag LOCUS_10890 16479 15295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 19088 16467 gene locus_tag LOCUS_10900 19088 16467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 20866 19334 gene locus_tag LOCUS_10910 20866 19334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 22343 20940 gene locus_tag LOCUS_10920 22343 20940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_10920 23828 22947 gene locus_tag LOCUS_10930 gene folP 23828 22947 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120943.1 protein_id gnl|my_center|LOCUS_10930 24393 23839 gene locus_tag LOCUS_10940 gene lptE 24393 23839 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119987.1 protein_id gnl|my_center|LOCUS_10940 25685 24390 gene locus_tag LOCUS_10950 25685 24390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 26661 25906 gene locus_tag LOCUS_10960 gene recO 26661 25906 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119985.1 protein_id gnl|my_center|LOCUS_10960 27958 26651 gene locus_tag LOCUS_10970 27958 26651 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119979.1 protein_id gnl|my_center|LOCUS_10970 28488 27955 gene locus_tag LOCUS_10980 28488 27955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 30764 28485 gene locus_tag LOCUS_10990 30764 28485 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330940.1 protein_id gnl|my_center|LOCUS_10990 31707 30757 gene locus_tag LOCUS_11000 31707 30757 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_11000 32096 31755 gene locus_tag LOCUS_11010 32096 31755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 33213 32443 gene locus_tag LOCUS_11020 33213 32443 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 protein_id gnl|my_center|LOCUS_11020 34659 33223 gene locus_tag LOCUS_11030 34659 33223 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127254.1 protein_id gnl|my_center|LOCUS_11030 35003 34722 gene locus_tag LOCUS_11040 35003 34722 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_11040 36127 35003 gene locus_tag LOCUS_11050 36127 35003 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_11050 36453 36920 gene locus_tag LOCUS_11060 gene rplM 36453 36920 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_11060 36934 37356 gene locus_tag LOCUS_11070 gene rpsI 36934 37356 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122781.1 protein_id gnl|my_center|LOCUS_11070 37424 37849 gene locus_tag LOCUS_11080 37424 37849 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_11080 37919 38242 gene locus_tag LOCUS_11090 37919 38242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 38341 39669 gene locus_tag LOCUS_11100 38341 39669 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_11100 39718 39951 gene locus_tag LOCUS_11110 39718 39951 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080561.1 protein_id gnl|my_center|LOCUS_11110 40017 40415 gene locus_tag LOCUS_11120 40017 40415 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_11120 40429 40914 gene locus_tag LOCUS_11130 40429 40914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 40942 41400 gene locus_tag LOCUS_11140 40942 41400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 41400 42089 gene locus_tag LOCUS_11150 41400 42089 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_11150 42192 42632 gene locus_tag LOCUS_11160 42192 42632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 43096 44253 gene locus_tag LOCUS_11170 43096 44253 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140350.1 protein_id gnl|my_center|LOCUS_11170 44250 45464 gene locus_tag LOCUS_11180 44250 45464 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_11180 45472 46185 gene locus_tag LOCUS_11190 45472 46185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_11190 47169 46201 gene locus_tag LOCUS_11200 47169 46201 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121674.1 protein_id gnl|my_center|LOCUS_11200 48878 47166 gene locus_tag LOCUS_11210 48878 47166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 50343 48883 gene locus_tag LOCUS_11220 50343 48883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 51171 52022 gene locus_tag LOCUS_11230 51171 52022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 52417 53220 gene locus_tag LOCUS_11240 52417 53220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 53247 54464 gene locus_tag LOCUS_11250 53247 54464 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941337.1 protein_id gnl|my_center|LOCUS_11250 54468 55163 gene locus_tag LOCUS_11260 54468 55163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_11260 55251 55634 gene locus_tag LOCUS_11270 55251 55634 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461621.1 protein_id gnl|my_center|LOCUS_11270 55740 56063 gene locus_tag LOCUS_11280 55740 56063 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140006.1 protein_id gnl|my_center|LOCUS_11280 56157 57233 gene locus_tag LOCUS_11290 gene arsB 56157 57233 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943585.1 protein_id gnl|my_center|LOCUS_11290 57243 58037 gene locus_tag LOCUS_11300 57243 58037 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_11300 59143 59379 gene locus_tag LOCUS_11310 59143 59379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 61756 59825 gene locus_tag LOCUS_11320 61756 59825 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_11320 63074 61881 gene locus_tag LOCUS_11330 63074 61881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 63592 63077 gene locus_tag LOCUS_11340 gene nuoE 63592 63077 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967798.1 protein_id gnl|my_center|LOCUS_11340 63618 63932 gene locus_tag LOCUS_11350 63618 63932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 64210 63929 gene locus_tag LOCUS_11360 64210 63929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 64647 65855 gene locus_tag LOCUS_11370 64647 65855 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_11370 65852 66982 gene locus_tag LOCUS_11380 65852 66982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 67203 67012 gene locus_tag LOCUS_11390 67203 67012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 67504 67142 gene locus_tag LOCUS_11400 67504 67142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 67690 68607 gene locus_tag LOCUS_11410 67690 68607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760094.1 protein_id gnl|my_center|LOCUS_11410 69240 68677 gene locus_tag LOCUS_11420 69240 68677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 70431 69244 gene locus_tag LOCUS_11430 70431 69244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 72216 70573 gene locus_tag LOCUS_11440 72216 70573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 73139 72219 gene locus_tag LOCUS_11450 73139 72219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 73361 74089 gene locus_tag LOCUS_11460 73361 74089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 74683 74159 gene locus_tag LOCUS_11470 74683 74159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 76194 74701 gene locus_tag LOCUS_11480 76194 74701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 76776 79280 gene locus_tag LOCUS_11490 76776 79280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 79588 79926 gene locus_tag LOCUS_11500 79588 79926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 79989 81245 gene locus_tag LOCUS_11510 79989 81245 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140777.1 protein_id gnl|my_center|LOCUS_11510 81250 84366 gene locus_tag LOCUS_11520 gene vmeI 81250 84366 CDS product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 protein_id gnl|my_center|LOCUS_11520 84491 85363 gene locus_tag LOCUS_11530 84491 85363 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651842.1 protein_id gnl|my_center|LOCUS_11530 85605 85811 gene locus_tag LOCUS_11540 85605 85811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 85828 88593 gene locus_tag LOCUS_11550 85828 88593 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_11550 88702 90183 gene locus_tag LOCUS_11560 88702 90183 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926839.1 protein_id gnl|my_center|LOCUS_11560 90198 92291 gene locus_tag LOCUS_11570 gene glgX 90198 92291 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_11570 92363 93172 gene locus_tag LOCUS_11580 gene ppk2 92363 93172 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086264.1 protein_id gnl|my_center|LOCUS_11580 93194 93622 gene locus_tag LOCUS_11590 93194 93622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 93615 94697 gene locus_tag LOCUS_11600 93615 94697 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_11600 94754 95413 gene locus_tag LOCUS_11610 94754 95413 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105540.1 protein_id gnl|my_center|LOCUS_11610 95583 95921 gene locus_tag LOCUS_11620 95583 95921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 96023 96868 gene locus_tag LOCUS_11630 96023 96868 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615873.1 protein_id gnl|my_center|LOCUS_11630 97219 97031 gene locus_tag LOCUS_11640 97219 97031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence013 6529 7170 gene locus_tag LOCUS_11650 6529 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 7253 8911 gene locus_tag LOCUS_11660 7253 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 8927 9586 gene locus_tag LOCUS_11670 8927 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 10472 9612 gene locus_tag LOCUS_11680 10472 9612 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088051.1 protein_id gnl|my_center|LOCUS_11680 11424 10486 gene locus_tag LOCUS_11690 11424 10486 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120930.1 protein_id gnl|my_center|LOCUS_11690 11650 13203 gene locus_tag LOCUS_11700 11650 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 13216 15159 gene locus_tag LOCUS_11710 13216 15159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 15313 17880 gene locus_tag LOCUS_11720 15313 17880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 19768 18764 gene locus_tag LOCUS_11730 19768 18764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 21447 19813 gene locus_tag LOCUS_11740 21447 19813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 21812 22063 gene locus_tag LOCUS_11750 21812 22063 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_11750 22161 22541 gene locus_tag LOCUS_11760 22161 22541 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11760 22759 25275 gene locus_tag LOCUS_11770 22759 25275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 25377 26693 gene locus_tag LOCUS_11780 25377 26693 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_11780 27473 28795 gene locus_tag LOCUS_11790 27473 28795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 30417 29650 gene locus_tag LOCUS_11800 30417 29650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922325.1 protein_id gnl|my_center|LOCUS_11800 31166 30438 gene locus_tag LOCUS_11810 31166 30438 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326094.1 protein_id gnl|my_center|LOCUS_11810 32952 31282 gene locus_tag LOCUS_11820 32952 31282 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_11820 34937 33063 gene locus_tag LOCUS_11830 34937 33063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 36429 35215 gene locus_tag LOCUS_11840 36429 35215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 36637 37650 gene locus_tag LOCUS_11850 36637 37650 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_11850 37749 38708 gene locus_tag LOCUS_11860 37749 38708 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401898.1 protein_id gnl|my_center|LOCUS_11860 39922 38747 gene locus_tag LOCUS_11870 39922 38747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 40223 41125 gene locus_tag LOCUS_11880 40223 41125 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_11880 42604 41132 gene locus_tag LOCUS_11890 42604 41132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 43414 42635 gene locus_tag LOCUS_11900 43414 42635 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160148236.1 protein_id gnl|my_center|LOCUS_11900 45444 43747 gene locus_tag LOCUS_11910 45444 43747 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_11910 47667 45697 gene locus_tag LOCUS_11920 gene asnB 47667 45697 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_11920 49135 47897 gene locus_tag LOCUS_11930 49135 47897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 56584 49136 gene locus_tag LOCUS_11940 56584 49136 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123515.1 protein_id gnl|my_center|LOCUS_11940 59005 56708 gene locus_tag LOCUS_11950 59005 56708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 60367 59408 gene locus_tag LOCUS_11960 60367 59408 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_11960 60713 60471 gene locus_tag LOCUS_11970 60713 60471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 61683 61336 gene locus_tag LOCUS_11980 61683 61336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 62616 61876 gene locus_tag LOCUS_11990 62616 61876 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329167.1 protein_id gnl|my_center|LOCUS_11990 63111 62692 gene locus_tag LOCUS_12000 gene arfB 63111 62692 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329166.1 protein_id gnl|my_center|LOCUS_12000 63229 65181 gene locus_tag LOCUS_12010 63229 65181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 66684 65395 gene locus_tag LOCUS_12020 66684 65395 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921346.1 protein_id gnl|my_center|LOCUS_12020 67331 66771 gene locus_tag LOCUS_12030 67331 66771 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336247.1 protein_id gnl|my_center|LOCUS_12030 68870 67539 gene locus_tag LOCUS_12040 68870 67539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 69635 71080 gene locus_tag LOCUS_12050 69635 71080 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121117.1 protein_id gnl|my_center|LOCUS_12050 72219 71140 gene locus_tag LOCUS_12060 72219 71140 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122217.1 protein_id gnl|my_center|LOCUS_12060 72871 73656 gene locus_tag LOCUS_12070 72871 73656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 73694 76930 gene locus_tag LOCUS_12080 gene mfd 73694 76930 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_12080 77011 78381 gene locus_tag LOCUS_12090 77011 78381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 81524 78480 gene locus_tag LOCUS_12100 81524 78480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 82683 81784 gene locus_tag LOCUS_12110 82683 81784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 82911 83342 gene locus_tag LOCUS_12120 82911 83342 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876949.1 protein_id gnl|my_center|LOCUS_12120 83342 85891 gene locus_tag LOCUS_12130 83342 85891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 90508 86102 gene locus_tag LOCUS_12140 90508 86102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 91435 90974 gene locus_tag LOCUS_12150 91435 90974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 92412 91552 gene locus_tag LOCUS_12160 92412 91552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 93062 92412 gene locus_tag LOCUS_12170 93062 92412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 93738 93169 gene locus_tag LOCUS_12180 93738 93169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence014 46 3051 gene locus_tag LOCUS_12190 46 3051 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_12190 3048 4481 gene locus_tag LOCUS_12200 3048 4481 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922918.1 protein_id gnl|my_center|LOCUS_12200 4677 5891 gene locus_tag LOCUS_12210 4677 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 7290 6025 gene locus_tag LOCUS_12220 7290 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 8068 7247 gene locus_tag LOCUS_12230 8068 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 8338 8126 gene locus_tag LOCUS_12240 8338 8126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 8720 9430 gene locus_tag LOCUS_12250 8720 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 9727 10599 gene locus_tag LOCUS_12260 9727 10599 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816586.1 protein_id gnl|my_center|LOCUS_12260 12314 10803 gene locus_tag LOCUS_12270 12314 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120360.1 protein_id gnl|my_center|LOCUS_12270 15275 12660 gene locus_tag LOCUS_12280 15275 12660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 17549 15333 gene locus_tag LOCUS_12290 gene rhgW 17549 15333 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_12290 19071 17650 gene locus_tag LOCUS_12300 19071 17650 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392787.1 protein_id gnl|my_center|LOCUS_12300 20516 19086 gene locus_tag LOCUS_12310 gene hydG 20516 19086 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079985.1 protein_id gnl|my_center|LOCUS_12310 21714 20524 gene locus_tag LOCUS_12320 gene hydE 21714 20524 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_12320 22118 23173 gene locus_tag LOCUS_12330 22118 23173 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 protein_id gnl|my_center|LOCUS_12330 24670 23321 gene locus_tag LOCUS_12340 24670 23321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_12340 25216 25686 gene locus_tag LOCUS_12350 25216 25686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 26088 27182 gene locus_tag LOCUS_12360 26088 27182 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121913.1 protein_id gnl|my_center|LOCUS_12360 27284 27763 gene locus_tag LOCUS_12370 gene accB 27284 27763 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328900.1 protein_id gnl|my_center|LOCUS_12370 27763 29106 gene locus_tag LOCUS_12380 gene accC 27763 29106 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_12380 29155 30516 gene locus_tag LOCUS_12390 29155 30516 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198907.1 protein_id gnl|my_center|LOCUS_12390 30552 31562 gene locus_tag LOCUS_12400 30552 31562 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_12400 31717 33063 gene locus_tag LOCUS_12410 31717 33063 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902277.1 protein_id gnl|my_center|LOCUS_12410 33144 35939 gene locus_tag LOCUS_12420 33144 35939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 35990 37777 gene locus_tag LOCUS_12430 35990 37777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 38099 38371 gene locus_tag LOCUS_12440 38099 38371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 38691 40238 gene locus_tag LOCUS_12450 38691 40238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 40390 41796 gene locus_tag LOCUS_12460 40390 41796 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_12460 41930 42817 gene locus_tag LOCUS_12470 41930 42817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 42888 44174 gene locus_tag LOCUS_12480 42888 44174 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_12480 44214 45362 gene locus_tag LOCUS_12490 44214 45362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 46021 45512 gene locus_tag LOCUS_12500 46021 45512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 46301 46666 gene locus_tag LOCUS_12510 46301 46666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 46919 48565 gene locus_tag LOCUS_12520 46919 48565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_12520 49277 48966 gene locus_tag LOCUS_12530 49277 48966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 49252 50682 gene locus_tag LOCUS_12540 49252 50682 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_12540 50771 52252 gene locus_tag LOCUS_12550 50771 52252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 52499 53644 gene locus_tag LOCUS_12560 gene nadA 52499 53644 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_12560 53780 54397 gene locus_tag LOCUS_12570 53780 54397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 55423 54683 gene locus_tag LOCUS_12580 55423 54683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870576.1 protein_id gnl|my_center|LOCUS_12580 56888 55614 gene locus_tag LOCUS_12590 56888 55614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 57424 56885 gene locus_tag LOCUS_12600 57424 56885 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119378.1 protein_id gnl|my_center|LOCUS_12600 58921 57428 gene locus_tag LOCUS_12610 gene aroE 58921 57428 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_12610 61309 59117 gene locus_tag LOCUS_12620 61309 59117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 61699 62733 gene locus_tag LOCUS_12630 61699 62733 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121174.1 protein_id gnl|my_center|LOCUS_12630 63065 62844 gene locus_tag LOCUS_12640 63065 62844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 62958 63974 gene locus_tag LOCUS_12650 62958 63974 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922668.1 protein_id gnl|my_center|LOCUS_12650 64155 65516 gene locus_tag LOCUS_12660 64155 65516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 66762 65542 gene locus_tag LOCUS_12670 66762 65542 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615527.1 protein_id gnl|my_center|LOCUS_12670 66913 67422 gene locus_tag LOCUS_12680 66913 67422 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 protein_id gnl|my_center|LOCUS_12680 68186 67425 gene locus_tag LOCUS_12690 68186 67425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 68822 68193 gene locus_tag LOCUS_12700 68822 68193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 70688 68859 gene locus_tag LOCUS_12710 70688 68859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 71857 70688 gene locus_tag LOCUS_12720 71857 70688 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_12720 72641 71874 gene locus_tag LOCUS_12730 gene hisF 72641 71874 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325161.1 protein_id gnl|my_center|LOCUS_12730 73375 72779 gene locus_tag LOCUS_12740 73375 72779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 74199 73501 gene locus_tag LOCUS_12750 74199 73501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 74598 74272 gene locus_tag LOCUS_12760 74598 74272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 76160 74598 gene locus_tag LOCUS_12770 76160 74598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12770 76555 76280 gene locus_tag LOCUS_12780 76555 76280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 77068 78114 gene locus_tag LOCUS_12790 77068 78114 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_12790 78567 78178 gene locus_tag LOCUS_12800 78567 78178 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329333.1 protein_id gnl|my_center|LOCUS_12800 78837 78625 gene locus_tag LOCUS_12810 78837 78625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 79789 78908 gene locus_tag LOCUS_12820 79789 78908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 80126 81289 gene locus_tag LOCUS_12830 gene larC 80126 81289 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122655.1 protein_id gnl|my_center|LOCUS_12830 81286 81891 gene locus_tag LOCUS_12840 81286 81891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 82373 83734 gene locus_tag LOCUS_12850 82373 83734 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921382.1 protein_id gnl|my_center|LOCUS_12850 85114 83807 gene locus_tag LOCUS_12860 85114 83807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 85655 85290 gene locus_tag LOCUS_12870 gene rplT 85655 85290 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332030.1 protein_id gnl|my_center|LOCUS_12870 85943 85740 gene locus_tag LOCUS_12880 gene rpmI 85943 85740 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332031.1 protein_id gnl|my_center|LOCUS_12880 86701 86177 gene locus_tag LOCUS_12890 gene infC 86701 86177 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329878.1 protein_id gnl|my_center|LOCUS_12890 88844 86886 gene locus_tag LOCUS_12900 gene thrS 88844 86886 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence015 154 1539 gene locus_tag LOCUS_12910 154 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1749 2102 gene locus_tag LOCUS_12920 1749 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4183 2765 gene locus_tag LOCUS_12930 4183 2765 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839714.1 protein_id gnl|my_center|LOCUS_12930 5588 4398 gene locus_tag LOCUS_12940 5588 4398 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970647.1 protein_id gnl|my_center|LOCUS_12940 7180 5816 gene locus_tag LOCUS_12950 7180 5816 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_12950 8616 7207 gene locus_tag LOCUS_12960 8616 7207 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_12960 9365 8613 gene locus_tag LOCUS_12970 gene fabG 9365 8613 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_12970 10645 9362 gene locus_tag LOCUS_12980 10645 9362 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368950.1 protein_id gnl|my_center|LOCUS_12980 11467 10760 gene locus_tag LOCUS_12990 11467 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 11810 12985 gene locus_tag LOCUS_13000 11810 12985 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124078.1 protein_id gnl|my_center|LOCUS_13000 13800 13471 gene locus_tag LOCUS_13010 13800 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 14672 13791 gene locus_tag LOCUS_13020 14672 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 14797 15549 gene locus_tag LOCUS_13030 14797 15549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 17228 15843 gene locus_tag LOCUS_13040 gene orpR 17228 15843 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_13040 17609 18697 gene locus_tag LOCUS_13050 gene gspF 17609 18697 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918064.1 protein_id gnl|my_center|LOCUS_13050 18694 19764 gene locus_tag LOCUS_13060 gene pilG 18694 19764 CDS product type 4 pilus assembly protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216405.1 protein_id gnl|my_center|LOCUS_13060 19769 21031 gene locus_tag LOCUS_13070 19769 21031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 21032 21445 gene locus_tag LOCUS_13080 21032 21445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 21616 22110 gene locus_tag LOCUS_13090 21616 22110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 22296 22679 gene locus_tag LOCUS_13100 22296 22679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 22676 23554 gene locus_tag LOCUS_13110 22676 23554 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_13110 23578 24528 gene locus_tag LOCUS_13120 23578 24528 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_13120 24525 24908 gene locus_tag LOCUS_13130 24525 24908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 25742 25485 gene locus_tag LOCUS_13140 25742 25485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 26287 27756 gene locus_tag LOCUS_13150 26287 27756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 28408 27725 gene locus_tag LOCUS_13160 28408 27725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 30361 29672 gene locus_tag LOCUS_13170 30361 29672 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_13170 33319 30551 gene locus_tag LOCUS_13180 33319 30551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 33877 35742 gene locus_tag LOCUS_13190 gene glmS 33877 35742 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 protein_id gnl|my_center|LOCUS_13190 37751 35775 gene locus_tag LOCUS_13200 37751 35775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 37974 39548 gene locus_tag LOCUS_13210 37974 39548 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921354.1 protein_id gnl|my_center|LOCUS_13210 39565 41565 gene locus_tag LOCUS_13220 39565 41565 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_13220 41655 41945 gene locus_tag LOCUS_13230 41655 41945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 41961 42128 gene locus_tag LOCUS_13240 41961 42128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 42762 42385 gene locus_tag LOCUS_13250 42762 42385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 44044 42767 gene locus_tag LOCUS_13260 44044 42767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 45894 44077 gene locus_tag LOCUS_13270 45894 44077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 46510 46040 gene locus_tag LOCUS_13280 46510 46040 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266690.1 protein_id gnl|my_center|LOCUS_13280 46863 46507 gene locus_tag LOCUS_13290 46863 46507 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095512524.1 protein_id gnl|my_center|LOCUS_13290 47313 48800 gene locus_tag LOCUS_13300 47313 48800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 48998 49417 gene locus_tag LOCUS_13310 48998 49417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 49389 49715 gene locus_tag LOCUS_13320 49389 49715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 49728 51443 gene locus_tag LOCUS_13330 gene pilB 49728 51443 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_13330 51455 52645 gene locus_tag LOCUS_13340 51455 52645 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_13340 54259 52697 gene locus_tag LOCUS_13350 54259 52697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 54447 55211 gene locus_tag LOCUS_13360 54447 55211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 55927 56943 gene locus_tag LOCUS_13370 55927 56943 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_13370 56992 57396 gene locus_tag LOCUS_13380 56992 57396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 57449 59890 gene locus_tag LOCUS_13390 57449 59890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 62083 60269 gene locus_tag LOCUS_13400 gene typA 62083 60269 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324768.1 protein_id gnl|my_center|LOCUS_13400 63941 62394 gene locus_tag LOCUS_13410 63941 62394 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_13410 64099 65016 gene locus_tag LOCUS_13420 64099 65016 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_13420 65262 66248 gene locus_tag LOCUS_13430 65262 66248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 66148 67791 gene locus_tag LOCUS_13440 66148 67791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 68122 68847 gene locus_tag LOCUS_13450 68122 68847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 70333 68927 gene locus_tag LOCUS_13460 70333 68927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122399.1 protein_id gnl|my_center|LOCUS_13460 74009 70806 gene locus_tag LOCUS_13470 gene carB 74009 70806 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_13470 75018 74086 gene locus_tag LOCUS_13480 gene guaA 75018 74086 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877764.1 protein_id gnl|my_center|LOCUS_13480 75447 77876 gene locus_tag LOCUS_13490 75447 77876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 77993 78574 gene locus_tag LOCUS_13500 gene def 77993 78574 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324462.1 protein_id gnl|my_center|LOCUS_13500 80150 78699 gene locus_tag LOCUS_13510 80150 78699 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_13510 80331 81293 gene locus_tag LOCUS_13520 gene fmt 80331 81293 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123937.1 protein_id gnl|my_center|LOCUS_13520 81529 82743 gene locus_tag LOCUS_13530 81529 82743 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_13530 83182 82769 gene locus_tag LOCUS_13540 gene nikR 83182 82769 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 protein_id gnl|my_center|LOCUS_13540 83437 84342 gene locus_tag LOCUS_13550 83437 84342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 85028 84354 gene locus_tag LOCUS_13560 85028 84354 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_13560 85090 86673 gene locus_tag LOCUS_13570 85090 86673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 86690 87739 gene locus_tag LOCUS_13580 86690 87739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 87980 88594 gene locus_tag LOCUS_13590 87980 88594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence016 1320 673 gene locus_tag LOCUS_13600 1320 673 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123567.1 protein_id gnl|my_center|LOCUS_13600 2519 1335 gene locus_tag LOCUS_13610 2519 1335 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089188.1 protein_id gnl|my_center|LOCUS_13610 3757 2732 gene locus_tag LOCUS_13620 3757 2732 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391963.1 protein_id gnl|my_center|LOCUS_13620 4464 3958 gene locus_tag LOCUS_13630 gene mntR 4464 3958 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327586.1 protein_id gnl|my_center|LOCUS_13630 4835 4515 gene locus_tag LOCUS_13640 4835 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4720 5655 gene locus_tag LOCUS_13650 4720 5655 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 protein_id gnl|my_center|LOCUS_13650 5652 6491 gene locus_tag LOCUS_13660 5652 6491 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_13660 6488 8074 gene locus_tag LOCUS_13670 6488 8074 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_13670 8077 9429 gene locus_tag LOCUS_13680 8077 9429 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_13680 9846 11372 gene locus_tag LOCUS_13690 9846 11372 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261223.1 protein_id gnl|my_center|LOCUS_13690 11768 11535 gene locus_tag LOCUS_13700 11768 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 13121 11811 gene locus_tag LOCUS_13710 13121 11811 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_13710 14677 13232 gene locus_tag LOCUS_13720 14677 13232 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_13720 15687 14764 gene locus_tag LOCUS_13730 15687 14764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 16255 15680 gene locus_tag LOCUS_13740 16255 15680 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_13740 17415 16273 gene locus_tag LOCUS_13750 17415 16273 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226897.1 protein_id gnl|my_center|LOCUS_13750 17839 17549 gene locus_tag LOCUS_13760 17839 17549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 19896 18250 gene locus_tag LOCUS_13770 19896 18250 CDS product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813984.1 protein_id gnl|my_center|LOCUS_13770 20558 20220 gene locus_tag LOCUS_13780 20558 20220 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325418.1 protein_id gnl|my_center|LOCUS_13780 21986 20607 gene locus_tag LOCUS_13790 21986 20607 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921286.1 protein_id gnl|my_center|LOCUS_13790 22871 22284 gene locus_tag LOCUS_13800 22871 22284 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_13800 23802 22954 gene locus_tag LOCUS_13810 23802 22954 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_13810 27972 24637 gene locus_tag LOCUS_13820 27972 24637 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_13820 29312 28215 gene locus_tag LOCUS_13830 29312 28215 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_13830 30761 29553 gene locus_tag LOCUS_13840 30761 29553 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942829.1 protein_id gnl|my_center|LOCUS_13840 33081 30958 gene locus_tag LOCUS_13850 33081 30958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 33671 33078 gene locus_tag LOCUS_13860 33671 33078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 36364 34127 gene locus_tag LOCUS_13870 36364 34127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 37580 36663 gene locus_tag LOCUS_13880 37580 36663 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_13880 39065 37797 gene locus_tag LOCUS_13890 39065 37797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 40623 39217 gene locus_tag LOCUS_13900 40623 39217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 40896 41297 gene locus_tag LOCUS_13910 40896 41297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 42336 41317 gene locus_tag LOCUS_13920 gene hemC 42336 41317 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_13920 42953 42333 gene locus_tag LOCUS_13930 42953 42333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 44468 43254 gene locus_tag LOCUS_13940 gene hydF 44468 43254 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_13940 44599 44733 gene locus_tag LOCUS_13950 44599 44733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 44947 46221 gene locus_tag LOCUS_13960 44947 46221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 46288 46968 gene locus_tag LOCUS_13970 46288 46968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 47940 46981 gene locus_tag LOCUS_13980 47940 46981 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120218.1 protein_id gnl|my_center|LOCUS_13980 48174 48620 gene locus_tag LOCUS_13990 48174 48620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 48741 49271 gene locus_tag LOCUS_14000 48741 49271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 49669 50049 gene locus_tag LOCUS_14010 49669 50049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 50411 51502 gene locus_tag LOCUS_14020 50411 51502 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529567.1 protein_id gnl|my_center|LOCUS_14020 51683 52288 gene locus_tag LOCUS_14030 51683 52288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 52325 53620 gene locus_tag LOCUS_14040 52325 53620 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_14040 53787 57221 gene locus_tag LOCUS_14050 53787 57221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 58052 57222 gene locus_tag LOCUS_14060 58052 57222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 59614 58220 gene locus_tag LOCUS_14070 59614 58220 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_14070 59960 60313 gene locus_tag LOCUS_14080 59960 60313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 60759 60684 gene locus_tag LOCUS_t00090 60759 60684 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 61065 62972 gene locus_tag LOCUS_14090 61065 62972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 62986 63897 gene locus_tag LOCUS_14100 62986 63897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 64778 63918 gene locus_tag LOCUS_14110 64778 63918 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_14110 65083 64850 gene locus_tag LOCUS_14120 65083 64850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 65318 66208 gene locus_tag LOCUS_14130 65318 66208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 66493 66134 gene locus_tag LOCUS_14140 66493 66134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 66555 67568 gene locus_tag LOCUS_14150 66555 67568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 69039 67639 gene locus_tag LOCUS_14160 69039 67639 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_14160 69580 69179 gene locus_tag LOCUS_14170 69580 69179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 69987 69742 gene locus_tag LOCUS_14180 69987 69742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 71492 70053 gene locus_tag LOCUS_14190 71492 70053 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921646.1 protein_id gnl|my_center|LOCUS_14190 72002 71499 gene locus_tag LOCUS_14200 72002 71499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 72463 72014 gene locus_tag LOCUS_14210 72463 72014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 73352 72498 gene locus_tag LOCUS_14220 gene surE 73352 72498 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201557.1 protein_id gnl|my_center|LOCUS_14220 73512 75062 gene locus_tag LOCUS_14230 gene guaA 73512 75062 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_14230 75070 75450 gene locus_tag LOCUS_14240 75070 75450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 75460 76380 gene locus_tag LOCUS_14250 75460 76380 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118683.1 protein_id gnl|my_center|LOCUS_14250 76380 78296 gene locus_tag LOCUS_14260 gene dxs 76380 78296 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325559.1 protein_id gnl|my_center|LOCUS_14260 78503 78850 gene locus_tag LOCUS_14270 78503 78850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 79295 79630 gene locus_tag LOCUS_14280 79295 79630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14280 79602 79748 gene locus_tag LOCUS_14290 79602 79748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 79745 80074 gene locus_tag LOCUS_14300 79745 80074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 80917 80207 gene locus_tag LOCUS_14310 80917 80207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 81043 81342 gene locus_tag LOCUS_14320 81043 81342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 81342 84161 gene locus_tag LOCUS_14330 81342 84161 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073740.1 protein_id gnl|my_center|LOCUS_14330 84430 84167 gene locus_tag LOCUS_14340 84430 84167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082814.1 protein_id gnl|my_center|LOCUS_14340 84562 86097 gene locus_tag LOCUS_14350 84562 86097 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_14350 86097 86333 gene locus_tag LOCUS_14360 86097 86333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 86349 87521 gene locus_tag LOCUS_14370 86349 87521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence017 393 2114 gene locus_tag LOCUS_14380 393 2114 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_14380 2257 4242 gene locus_tag LOCUS_14390 2257 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 4268 4702 gene locus_tag LOCUS_14400 4268 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 4707 5831 gene locus_tag LOCUS_14410 4707 5831 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_14410 6179 6814 gene locus_tag LOCUS_14420 6179 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_14420 6828 7676 gene locus_tag LOCUS_14430 6828 7676 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_14430 7902 8852 gene locus_tag LOCUS_14440 7902 8852 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119887.1 protein_id gnl|my_center|LOCUS_14440 11067 8974 gene locus_tag LOCUS_14450 11067 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 12471 11137 gene locus_tag LOCUS_14460 12471 11137 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_14460 12660 12475 gene locus_tag LOCUS_14470 12660 12475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 13052 14752 gene locus_tag LOCUS_14480 13052 14752 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_14480 16177 14927 gene locus_tag LOCUS_14490 gene fabF 16177 14927 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_14490 16431 16183 gene locus_tag LOCUS_14500 16431 16183 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 protein_id gnl|my_center|LOCUS_14500 17371 16616 gene locus_tag LOCUS_14510 gene fabG 17371 16616 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_14510 18246 17389 gene locus_tag LOCUS_14520 gene fabD 18246 17389 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117846.1 protein_id gnl|my_center|LOCUS_14520 18495 18316 gene locus_tag LOCUS_14530 gene rpmF 18495 18316 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_14530 21378 18760 gene locus_tag LOCUS_14540 gene alaS 21378 18760 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121911.1 protein_id gnl|my_center|LOCUS_14540 23019 21526 gene locus_tag LOCUS_14550 23019 21526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 24274 23171 gene locus_tag LOCUS_14560 gene recA 24274 23171 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813294.1 protein_id gnl|my_center|LOCUS_14560 25193 24597 gene locus_tag LOCUS_14570 gene thpR 25193 24597 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332599.1 protein_id gnl|my_center|LOCUS_14570 26099 25197 gene locus_tag LOCUS_14580 26099 25197 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_14580 26465 26650 gene locus_tag LOCUS_14590 26465 26650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 27863 26793 gene locus_tag LOCUS_14600 27863 26793 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122947.1 protein_id gnl|my_center|LOCUS_14600 28483 27860 gene locus_tag LOCUS_14610 gene tmk 28483 27860 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666320.1 protein_id gnl|my_center|LOCUS_14610 30862 28649 gene locus_tag LOCUS_14620 gene glgB 30862 28649 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324338.1 protein_id gnl|my_center|LOCUS_14620 31498 30893 gene locus_tag LOCUS_14630 31498 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 33027 31870 gene locus_tag LOCUS_14640 33027 31870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 34009 33263 gene locus_tag LOCUS_14650 34009 33263 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_14650 35070 34504 gene locus_tag LOCUS_14660 gene pyrE 35070 34504 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846080.1 protein_id gnl|my_center|LOCUS_14660 36348 35308 gene locus_tag LOCUS_14670 gene aroF 36348 35308 CDS product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168032.1 protein_id gnl|my_center|LOCUS_14670 36636 37991 gene locus_tag LOCUS_14680 36636 37991 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 protein_id gnl|my_center|LOCUS_14680 37995 39476 gene locus_tag LOCUS_14690 gene xylB 37995 39476 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_14690 39609 40790 gene locus_tag LOCUS_14700 39609 40790 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_14700 41567 40872 gene locus_tag LOCUS_14710 41567 40872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 42894 41734 gene locus_tag LOCUS_14720 42894 41734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 46797 43396 gene locus_tag LOCUS_14730 46797 43396 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_14730 47622 46933 gene locus_tag LOCUS_14740 47622 46933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_14740 49552 47933 gene locus_tag LOCUS_14750 gene groL 49552 47933 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325911.1 protein_id gnl|my_center|LOCUS_14750 49985 49647 gene locus_tag LOCUS_14760 49985 49647 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325910.1 protein_id gnl|my_center|LOCUS_14760 50518 51555 gene locus_tag LOCUS_14770 50518 51555 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339548.1 protein_id gnl|my_center|LOCUS_14770 51803 54649 gene locus_tag LOCUS_14780 51803 54649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 55633 54662 gene locus_tag LOCUS_14790 gene trpD 55633 54662 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117897.1 protein_id gnl|my_center|LOCUS_14790 55869 56813 gene locus_tag LOCUS_14800 55869 56813 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324951.1 protein_id gnl|my_center|LOCUS_14800 58067 56877 gene locus_tag LOCUS_14810 58067 56877 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615740.1 protein_id gnl|my_center|LOCUS_14810 58594 58145 gene locus_tag LOCUS_14820 58594 58145 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324538.1 protein_id gnl|my_center|LOCUS_14820 59322 61286 gene locus_tag LOCUS_14830 59322 61286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 62300 61287 gene locus_tag LOCUS_14840 62300 61287 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922725.1 protein_id gnl|my_center|LOCUS_14840 62618 63235 gene locus_tag LOCUS_14850 62618 63235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 63954 67151 gene locus_tag LOCUS_14860 63954 67151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 68018 67152 gene locus_tag LOCUS_14870 68018 67152 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_14870 68663 68166 gene locus_tag LOCUS_14880 gene fae 68663 68166 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326305.1 protein_id gnl|my_center|LOCUS_14880 69024 69440 gene locus_tag LOCUS_14890 69024 69440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 69445 70584 gene locus_tag LOCUS_14900 69445 70584 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296134.1 protein_id gnl|my_center|LOCUS_14900 70614 71102 gene locus_tag LOCUS_14910 70614 71102 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_14910 71701 71183 gene locus_tag LOCUS_14920 gene rimI 71701 71183 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017535.1 protein_id gnl|my_center|LOCUS_14920 73901 72216 gene locus_tag LOCUS_14930 73901 72216 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922005.1 protein_id gnl|my_center|LOCUS_14930 74152 74424 gene locus_tag LOCUS_14940 74152 74424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 74651 77269 gene locus_tag LOCUS_14950 gene mutS 74651 77269 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121304.1 protein_id gnl|my_center|LOCUS_14950 78663 77365 gene locus_tag LOCUS_14960 78663 77365 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_14960 81538 78956 gene locus_tag LOCUS_14970 81538 78956 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_14970 82659 81724 gene locus_tag LOCUS_14980 82659 81724 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122363.1 protein_id gnl|my_center|LOCUS_14980 83299 82754 gene locus_tag LOCUS_14990 83299 82754 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_14990 83542 84600 gene locus_tag LOCUS_15000 83542 84600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 85972 84620 gene locus_tag LOCUS_15010 85972 84620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence018 1732 3717 gene locus_tag LOCUS_15020 1732 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 3727 5088 gene locus_tag LOCUS_15030 3727 5088 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_15030 5215 6111 gene locus_tag LOCUS_15040 5215 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 7026 6139 gene locus_tag LOCUS_15050 7026 6139 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258579.1 protein_id gnl|my_center|LOCUS_15050 7160 7942 gene locus_tag LOCUS_15060 7160 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 8085 8687 gene locus_tag LOCUS_15070 8085 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 8834 10711 gene locus_tag LOCUS_15080 8834 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 11080 14007 gene locus_tag LOCUS_15090 11080 14007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 14206 14961 gene locus_tag LOCUS_15100 14206 14961 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_15100 15018 16463 gene locus_tag LOCUS_15110 15018 16463 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615932.1 protein_id gnl|my_center|LOCUS_15110 16998 16729 gene locus_tag LOCUS_15120 16998 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 17192 17118 gene locus_tag LOCUS_t00100 17192 17118 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18533 18246 gene locus_tag LOCUS_15130 18533 18246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 19609 18845 gene locus_tag LOCUS_15140 19609 18845 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337436.1 protein_id gnl|my_center|LOCUS_15140 20222 20503 gene locus_tag LOCUS_15150 20222 20503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 20803 21705 gene locus_tag LOCUS_15160 20803 21705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 21766 22503 gene locus_tag LOCUS_15170 21766 22503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 22575 24725 gene locus_tag LOCUS_15180 22575 24725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 24782 25669 gene locus_tag LOCUS_15190 gene truB 24782 25669 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_15190 26017 25691 gene locus_tag LOCUS_15200 gene trxA 26017 25691 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_15200 27697 26198 gene locus_tag LOCUS_15210 27697 26198 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119613.1 protein_id gnl|my_center|LOCUS_15210 28208 27918 gene locus_tag LOCUS_15220 28208 27918 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329447.1 protein_id gnl|my_center|LOCUS_15220 28487 31207 gene locus_tag LOCUS_15230 28487 31207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 31519 31728 gene locus_tag LOCUS_15240 31519 31728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 31955 33043 gene locus_tag LOCUS_15250 31955 33043 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007610940.1 protein_id gnl|my_center|LOCUS_15250 33048 34553 gene locus_tag LOCUS_15260 33048 34553 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087652.1 protein_id gnl|my_center|LOCUS_15260 34791 36038 gene locus_tag LOCUS_15270 34791 36038 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_15270 36141 39344 gene locus_tag LOCUS_15280 36141 39344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 39495 42671 gene locus_tag LOCUS_15290 39495 42671 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_15290 42668 44122 gene locus_tag LOCUS_15300 42668 44122 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_15300 44246 44782 gene locus_tag LOCUS_15310 44246 44782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 44901 45428 gene locus_tag LOCUS_15320 44901 45428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 45425 45676 gene locus_tag LOCUS_15330 45425 45676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 45843 45586 gene locus_tag LOCUS_15340 45843 45586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 46346 47113 gene locus_tag LOCUS_15350 46346 47113 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416945.1 protein_id gnl|my_center|LOCUS_15350 49091 47700 gene locus_tag LOCUS_15360 49091 47700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 49996 49088 gene locus_tag LOCUS_15370 49996 49088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 51225 49993 gene locus_tag LOCUS_15380 51225 49993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 52049 51279 gene locus_tag LOCUS_15390 52049 51279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 52425 53291 gene locus_tag LOCUS_15400 52425 53291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 54873 53326 gene locus_tag LOCUS_15410 54873 53326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 56158 55190 gene locus_tag LOCUS_15420 56158 55190 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_15420 57667 56186 gene locus_tag LOCUS_15430 57667 56186 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_15430 60641 57693 gene locus_tag LOCUS_15440 60641 57693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 61429 60656 gene locus_tag LOCUS_15450 61429 60656 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_15450 62128 61562 gene locus_tag LOCUS_15460 62128 61562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 65227 62270 gene locus_tag LOCUS_15470 65227 62270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 66348 65293 gene locus_tag LOCUS_15480 66348 65293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 67120 66437 gene locus_tag LOCUS_15490 67120 66437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 67287 68984 gene locus_tag LOCUS_15500 67287 68984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 70140 69202 gene locus_tag LOCUS_15510 70140 69202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 70269 70817 gene locus_tag LOCUS_15520 70269 70817 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888916.1 protein_id gnl|my_center|LOCUS_15520 70891 71670 gene locus_tag LOCUS_15530 70891 71670 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118949.1 protein_id gnl|my_center|LOCUS_15530 73006 71672 gene locus_tag LOCUS_15540 73006 71672 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_15540 73951 73169 gene locus_tag LOCUS_15550 73951 73169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 74495 74019 gene locus_tag LOCUS_15560 gene tsaE 74495 74019 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_15560 75421 74495 gene locus_tag LOCUS_15570 gene thiL 75421 74495 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121111.1 protein_id gnl|my_center|LOCUS_15570 76722 75445 gene locus_tag LOCUS_15580 76722 75445 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_15580 76938 77963 gene locus_tag LOCUS_15590 76938 77963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 78184 78945 gene locus_tag LOCUS_15600 78184 78945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 79307 79056 gene locus_tag LOCUS_15610 79307 79056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 79446 80783 gene locus_tag LOCUS_15620 79446 80783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 81143 81334 gene locus_tag LOCUS_15630 81143 81334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 81346 81810 gene locus_tag LOCUS_15640 81346 81810 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877784.1 protein_id gnl|my_center|LOCUS_15640 81814 82383 gene locus_tag LOCUS_15650 81814 82383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 82504 82851 gene locus_tag LOCUS_15660 82504 82851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 82937 83167 gene locus_tag LOCUS_15670 82937 83167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 84175 83918 gene locus_tag LOCUS_15680 84175 83918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15680 >Feature sequence019 1292 468 gene locus_tag LOCUS_15690 1292 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2822 1971 gene locus_tag LOCUS_15700 2822 1971 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_15700 3441 4856 gene locus_tag LOCUS_15710 3441 4856 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_15710 5712 6701 gene locus_tag LOCUS_15720 5712 6701 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530826.1 protein_id gnl|my_center|LOCUS_15720 6782 8416 gene locus_tag LOCUS_15730 6782 8416 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_15730 8477 9808 gene locus_tag LOCUS_15740 8477 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 11159 10095 gene locus_tag LOCUS_15750 11159 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 12771 11170 gene locus_tag LOCUS_15760 12771 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 14287 12935 gene locus_tag LOCUS_15770 14287 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 14614 15444 gene locus_tag LOCUS_15780 14614 15444 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 protein_id gnl|my_center|LOCUS_15780 15482 16168 gene locus_tag LOCUS_15790 15482 16168 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_15790 16304 17725 gene locus_tag LOCUS_15800 gene ahcY 16304 17725 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781763.1 protein_id gnl|my_center|LOCUS_15800 17815 19116 gene locus_tag LOCUS_15810 17815 19116 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_15810 19486 20229 gene locus_tag LOCUS_15820 19486 20229 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118760.1 protein_id gnl|my_center|LOCUS_15820 20222 21250 gene locus_tag LOCUS_15830 20222 21250 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118761.1 protein_id gnl|my_center|LOCUS_15830 21389 21464 gene locus_tag LOCUS_t00110 21389 21464 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23035 21680 gene locus_tag LOCUS_15840 23035 21680 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_15840 24137 23187 gene locus_tag LOCUS_15850 24137 23187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 24355 24134 gene locus_tag LOCUS_15860 24355 24134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 27140 24555 gene locus_tag LOCUS_15870 27140 24555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 29310 27727 gene locus_tag LOCUS_15880 29310 27727 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224279.1 protein_id gnl|my_center|LOCUS_15880 30249 29380 gene locus_tag LOCUS_15890 30249 29380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 30621 30872 gene locus_tag LOCUS_15900 30621 30872 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_15900 30865 30996 gene locus_tag LOCUS_15910 30865 30996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 31039 31353 gene locus_tag LOCUS_15920 31039 31353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 33646 31532 gene locus_tag LOCUS_15930 33646 31532 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_15930 34410 33781 gene locus_tag LOCUS_15940 34410 33781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 36046 34736 gene locus_tag LOCUS_15950 36046 34736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 37279 36101 gene locus_tag LOCUS_15960 37279 36101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 37677 37375 gene locus_tag LOCUS_15970 37677 37375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 39573 37777 gene locus_tag LOCUS_15980 39573 37777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 40946 40473 gene locus_tag LOCUS_15990 40946 40473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 41518 41069 gene locus_tag LOCUS_16000 41518 41069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 41429 41653 gene locus_tag LOCUS_16010 41429 41653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 44086 41855 gene locus_tag LOCUS_16020 44086 41855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 44504 45037 gene locus_tag LOCUS_16030 44504 45037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 45351 46442 gene locus_tag LOCUS_16040 45351 46442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 46795 46445 gene locus_tag LOCUS_16050 46795 46445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 47567 46827 gene locus_tag LOCUS_16060 gene lmtA 47567 46827 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_16060 47935 47666 gene locus_tag LOCUS_16070 47935 47666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 48259 47948 gene locus_tag LOCUS_16080 48259 47948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 49080 48256 gene locus_tag LOCUS_16090 49080 48256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 49289 49630 gene locus_tag LOCUS_16100 49289 49630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 49685 49912 gene locus_tag LOCUS_16110 49685 49912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 50439 49981 gene locus_tag LOCUS_16120 50439 49981 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_16120 51471 52952 gene locus_tag LOCUS_16130 51471 52952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 53554 52994 gene locus_tag LOCUS_16140 53554 52994 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_16140 54010 54810 gene locus_tag LOCUS_16150 54010 54810 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 protein_id gnl|my_center|LOCUS_16150 54819 55316 gene locus_tag LOCUS_16160 54819 55316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 55754 55467 gene locus_tag LOCUS_16170 55754 55467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 56567 55761 gene locus_tag LOCUS_16180 56567 55761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 60526 57191 gene locus_tag LOCUS_16190 60526 57191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 61356 60673 gene locus_tag LOCUS_16200 61356 60673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 61887 61408 gene locus_tag LOCUS_16210 61887 61408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 62581 65100 gene locus_tag LOCUS_16220 62581 65100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 66631 65489 gene locus_tag LOCUS_16230 66631 65489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 66867 68279 gene locus_tag LOCUS_16240 66867 68279 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_16240 68293 69822 gene locus_tag LOCUS_16250 68293 69822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 72531 69832 gene locus_tag LOCUS_16260 72531 69832 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_16260 72841 74271 gene locus_tag LOCUS_16270 72841 74271 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 protein_id gnl|my_center|LOCUS_16270 74431 75213 gene locus_tag LOCUS_16280 74431 75213 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615678.1 protein_id gnl|my_center|LOCUS_16280 75286 76842 gene locus_tag LOCUS_16290 75286 76842 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_16290 76889 78052 gene locus_tag LOCUS_16300 76889 78052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 79603 78068 gene locus_tag LOCUS_16310 79603 78068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 79508 79723 gene locus_tag LOCUS_16320 79508 79723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence020 1090 872 gene locus_tag LOCUS_16330 1090 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2091 1096 gene locus_tag LOCUS_16340 2091 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2349 2116 gene locus_tag LOCUS_16350 2349 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2750 4393 gene locus_tag LOCUS_16360 gene thiC 2750 4393 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 protein_id gnl|my_center|LOCUS_16360 4400 6073 gene locus_tag LOCUS_16370 4400 6073 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_16370 6118 6453 gene locus_tag LOCUS_16380 6118 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 6647 8731 gene locus_tag LOCUS_16390 6647 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 8728 9894 gene locus_tag LOCUS_16400 8728 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 9934 10953 gene locus_tag LOCUS_16410 9934 10953 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_16410 10961 11731 gene locus_tag LOCUS_16420 gene kduD 10961 11731 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_16420 14790 11794 gene locus_tag LOCUS_16430 14790 11794 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057920.1 protein_id gnl|my_center|LOCUS_16430 16868 14808 gene locus_tag LOCUS_16440 16868 14808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 17139 17738 gene locus_tag LOCUS_16450 17139 17738 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_16450 18188 17763 gene locus_tag LOCUS_16460 18188 17763 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_16460 22530 18850 gene locus_tag LOCUS_16470 22530 18850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 22870 22580 gene locus_tag LOCUS_16480 22870 22580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 23099 22863 gene locus_tag LOCUS_16490 23099 22863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 24174 23287 gene locus_tag LOCUS_16500 24174 23287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 25796 24408 gene locus_tag LOCUS_16510 25796 24408 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_16510 28737 25864 gene locus_tag LOCUS_16520 gene leuS 28737 25864 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122073.1 protein_id gnl|my_center|LOCUS_16520 29091 30455 gene locus_tag LOCUS_16530 29091 30455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 30732 30466 gene locus_tag LOCUS_16540 30732 30466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 31676 31038 gene locus_tag LOCUS_16550 31676 31038 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140140.1 protein_id gnl|my_center|LOCUS_16550 35206 31766 gene locus_tag LOCUS_16560 35206 31766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 36484 35231 gene locus_tag LOCUS_16570 36484 35231 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_16570 36656 38026 gene locus_tag LOCUS_16580 36656 38026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 38449 39192 gene locus_tag LOCUS_16590 38449 39192 CDS product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_16590 41235 39193 gene locus_tag LOCUS_16600 gene metG 41235 39193 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120499.1 protein_id gnl|my_center|LOCUS_16600 42882 41470 gene locus_tag LOCUS_16610 gene glnA 42882 41470 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_16610 43719 43270 gene locus_tag LOCUS_16620 43719 43270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 44230 43856 gene locus_tag LOCUS_16630 44230 43856 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883172.1 protein_id gnl|my_center|LOCUS_16630 44730 46028 gene locus_tag LOCUS_16640 gene thrC 44730 46028 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_16640 46078 46827 gene locus_tag LOCUS_16650 gene dapB 46078 46827 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123511.1 protein_id gnl|my_center|LOCUS_16650 48165 46843 gene locus_tag LOCUS_16660 48165 46843 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 protein_id gnl|my_center|LOCUS_16660 48426 48351 gene locus_tag LOCUS_t00120 48426 48351 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 48578 49633 gene locus_tag LOCUS_16670 gene lpxK 48578 49633 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_16670 49687 50742 gene locus_tag LOCUS_16680 gene waaF 49687 50742 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_16680 50783 51673 gene locus_tag LOCUS_16690 50783 51673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 51670 52866 gene locus_tag LOCUS_16700 51670 52866 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_16700 52863 53858 gene locus_tag LOCUS_16710 52863 53858 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_16710 53867 54826 gene locus_tag LOCUS_16720 53867 54826 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_16720 54899 55600 gene locus_tag LOCUS_16730 gene queC 54899 55600 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_16730 56049 55660 gene locus_tag LOCUS_16740 56049 55660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 56217 57482 gene locus_tag LOCUS_16750 gene lysA 56217 57482 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209846.1 protein_id gnl|my_center|LOCUS_16750 58205 57498 gene locus_tag LOCUS_16760 58205 57498 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037422.1 protein_id gnl|my_center|LOCUS_16760 58672 59634 gene locus_tag LOCUS_16770 58672 59634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921925.1 protein_id gnl|my_center|LOCUS_16770 59691 59936 gene locus_tag LOCUS_16780 59691 59936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 59947 60864 gene locus_tag LOCUS_16790 gene xerC 59947 60864 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_16790 61719 61087 gene locus_tag LOCUS_16800 61719 61087 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_16800 62062 65796 gene locus_tag LOCUS_16810 gene metH 62062 65796 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922281.1 protein_id gnl|my_center|LOCUS_16810 66178 66561 gene locus_tag LOCUS_16820 gene rpsM 66178 66561 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123828.1 protein_id gnl|my_center|LOCUS_16820 66619 67014 gene locus_tag LOCUS_16830 gene rpsK 66619 67014 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 protein_id gnl|my_center|LOCUS_16830 67059 67685 gene locus_tag LOCUS_16840 gene rpsD 67059 67685 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_16840 67737 68732 gene locus_tag LOCUS_16850 67737 68732 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_16850 68874 69440 gene locus_tag LOCUS_16860 68874 69440 CDS product L17 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123829.1 protein_id gnl|my_center|LOCUS_16860 69462 70040 gene locus_tag LOCUS_16870 69462 70040 CDS product putative metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943559.1 protein_id gnl|my_center|LOCUS_16870 70536 71300 gene locus_tag LOCUS_16880 70536 71300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 71771 73864 gene locus_tag LOCUS_16890 71771 73864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 74059 75069 gene locus_tag LOCUS_16900 74059 75069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 75827 75111 gene locus_tag LOCUS_16910 75827 75111 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172835.1 protein_id gnl|my_center|LOCUS_16910 76413 76613 gene locus_tag LOCUS_16920 76413 76613 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_16920 76651 76860 gene locus_tag LOCUS_16930 76651 76860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 78141 76915 gene locus_tag LOCUS_16940 78141 76915 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence021 691 2112 gene locus_tag LOCUS_16950 gene mtgB 691 2112 CDS product glycine betaine--corrinoid protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816521.1 protein_id gnl|my_center|LOCUS_16950 3457 3029 gene locus_tag LOCUS_16960 3457 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 3678 3454 gene locus_tag LOCUS_16970 3678 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 4217 4384 gene locus_tag LOCUS_16980 4217 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 4903 6831 gene locus_tag LOCUS_16990 4903 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 6930 10871 gene locus_tag LOCUS_17000 6930 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 10906 11976 gene locus_tag LOCUS_17010 10906 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 14909 12105 gene locus_tag LOCUS_17020 14909 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 15239 16615 gene locus_tag LOCUS_17030 15239 16615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 18073 16619 gene locus_tag LOCUS_17040 18073 16619 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895440.1 protein_id gnl|my_center|LOCUS_17040 21508 18155 gene locus_tag LOCUS_17050 21508 18155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 25034 21543 gene locus_tag LOCUS_17060 25034 21543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 25276 25031 gene locus_tag LOCUS_17070 25276 25031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 26801 25359 gene locus_tag LOCUS_17080 26801 25359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 27171 27893 gene locus_tag LOCUS_17090 27171 27893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 27942 29786 gene locus_tag LOCUS_17100 27942 29786 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533474.1 protein_id gnl|my_center|LOCUS_17100 29990 30418 gene locus_tag LOCUS_17110 29990 30418 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_17110 30537 31319 gene locus_tag LOCUS_17120 30537 31319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 31536 31844 gene locus_tag LOCUS_17130 31536 31844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 32983 32300 gene locus_tag LOCUS_17140 32983 32300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17140 34036 34209 gene locus_tag LOCUS_17150 34036 34209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 34672 34340 gene locus_tag LOCUS_17160 34672 34340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 37720 34772 gene locus_tag LOCUS_17170 37720 34772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 38719 37769 gene locus_tag LOCUS_17180 38719 37769 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721810.1 protein_id gnl|my_center|LOCUS_17180 39957 39220 gene locus_tag LOCUS_17190 39957 39220 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122308.1 protein_id gnl|my_center|LOCUS_17190 41226 39967 gene locus_tag LOCUS_17200 gene sat 41226 39967 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_17200 41865 41413 gene locus_tag LOCUS_17210 41865 41413 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326136.1 protein_id gnl|my_center|LOCUS_17210 42554 41862 gene locus_tag LOCUS_17220 42554 41862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 42973 44469 gene locus_tag LOCUS_17230 42973 44469 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921863.1 protein_id gnl|my_center|LOCUS_17230 44491 45513 gene locus_tag LOCUS_17240 44491 45513 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_17240 45913 47565 gene locus_tag LOCUS_17250 45913 47565 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921618.1 protein_id gnl|my_center|LOCUS_17250 47880 48854 gene locus_tag LOCUS_17260 47880 48854 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921666.1 protein_id gnl|my_center|LOCUS_17260 49276 50778 gene locus_tag LOCUS_17270 gene glgA 49276 50778 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121026.1 protein_id gnl|my_center|LOCUS_17270 50844 53039 gene locus_tag LOCUS_17280 50844 53039 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545008.1 protein_id gnl|my_center|LOCUS_17280 53066 54109 gene locus_tag LOCUS_17290 gene galT 53066 54109 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_17290 54215 56383 gene locus_tag LOCUS_17300 54215 56383 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_17300 56505 56771 gene locus_tag LOCUS_17310 56505 56771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 56974 58284 gene locus_tag LOCUS_17320 56974 58284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 60585 58378 gene locus_tag LOCUS_17330 60585 58378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 62073 60778 gene locus_tag LOCUS_17340 62073 60778 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_17340 64005 62251 gene locus_tag LOCUS_17350 64005 62251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 65601 64258 gene locus_tag LOCUS_17360 65601 64258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 66997 65639 gene locus_tag LOCUS_17370 66997 65639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 67713 67117 gene locus_tag LOCUS_17380 67713 67117 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185693707.1 protein_id gnl|my_center|LOCUS_17380 68328 69698 gene locus_tag LOCUS_17390 68328 69698 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_17390 70411 69764 gene locus_tag LOCUS_17400 gene trmB 70411 69764 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334207.1 protein_id gnl|my_center|LOCUS_17400 71263 70469 gene locus_tag LOCUS_17410 71263 70469 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324393.1 protein_id gnl|my_center|LOCUS_17410 71826 71317 gene locus_tag LOCUS_17420 71826 71317 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_17420 73008 72130 gene locus_tag LOCUS_17430 73008 72130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 73189 73764 gene locus_tag LOCUS_17440 73189 73764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 74301 75062 gene locus_tag LOCUS_17450 74301 75062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 75507 75773 gene locus_tag LOCUS_17460 75507 75773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence022 1898 84 gene locus_tag LOCUS_17470 gene pepF 1898 84 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122658.1 protein_id gnl|my_center|LOCUS_17470 2763 1957 gene locus_tag LOCUS_17480 2763 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3286 4980 gene locus_tag LOCUS_17490 3286 4980 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_17490 5078 6295 gene locus_tag LOCUS_17500 5078 6295 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_17500 6366 6944 gene locus_tag LOCUS_17510 gene gspG 6366 6944 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_17510 6981 7607 gene locus_tag LOCUS_17520 6981 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 7793 8284 gene locus_tag LOCUS_17530 7793 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 8503 9666 gene locus_tag LOCUS_17540 8503 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 9873 11408 gene locus_tag LOCUS_17550 9873 11408 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921874.1 protein_id gnl|my_center|LOCUS_17550 11712 13262 gene locus_tag LOCUS_17560 11712 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120490.1 protein_id gnl|my_center|LOCUS_17560 13259 14149 gene locus_tag LOCUS_17570 13259 14149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 15057 14290 gene locus_tag LOCUS_17580 15057 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 16184 15231 gene locus_tag LOCUS_17590 16184 15231 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_17590 16338 17735 gene locus_tag LOCUS_17600 16338 17735 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_17600 18300 17974 gene locus_tag LOCUS_17610 18300 17974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 18533 18297 gene locus_tag LOCUS_17620 18533 18297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 20723 18666 gene locus_tag LOCUS_17630 20723 18666 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_17630 22227 20884 gene locus_tag LOCUS_17640 22227 20884 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_17640 22981 22235 gene locus_tag LOCUS_17650 22981 22235 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393069.1 protein_id gnl|my_center|LOCUS_17650 23003 23779 gene locus_tag LOCUS_17660 23003 23779 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837919.1 protein_id gnl|my_center|LOCUS_17660 24053 24658 gene locus_tag LOCUS_17670 24053 24658 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169876.1 protein_id gnl|my_center|LOCUS_17670 25439 24618 gene locus_tag LOCUS_17680 25439 24618 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_17680 27253 25655 gene locus_tag LOCUS_17690 27253 25655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 27372 27947 gene locus_tag LOCUS_17700 27372 27947 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870448.1 protein_id gnl|my_center|LOCUS_17700 27962 29095 gene locus_tag LOCUS_17710 gene dgt 27962 29095 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817450.1 protein_id gnl|my_center|LOCUS_17710 29257 30309 gene locus_tag LOCUS_17720 29257 30309 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_17720 31410 30400 gene locus_tag LOCUS_17730 gene floA 31410 30400 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327752.1 protein_id gnl|my_center|LOCUS_17730 31864 33534 gene locus_tag LOCUS_17740 31864 33534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 33706 34215 gene locus_tag LOCUS_17750 33706 34215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 34347 35021 gene locus_tag LOCUS_17760 34347 35021 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327679.1 protein_id gnl|my_center|LOCUS_17760 35164 38727 gene locus_tag LOCUS_17770 gene dnaE 35164 38727 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119187.1 protein_id gnl|my_center|LOCUS_17770 39623 38814 gene locus_tag LOCUS_17780 39623 38814 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333052.1 protein_id gnl|my_center|LOCUS_17780 40802 39867 gene locus_tag LOCUS_17790 40802 39867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923059.1 protein_id gnl|my_center|LOCUS_17790 41267 42397 gene locus_tag LOCUS_17800 41267 42397 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141502.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence023 701 2401 gene locus_tag LOCUS_17810 701 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3658 3296 gene locus_tag LOCUS_17820 3658 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4511 3846 gene locus_tag LOCUS_17830 4511 3846 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131748.1 protein_id gnl|my_center|LOCUS_17830 4754 5656 gene locus_tag LOCUS_17840 4754 5656 CDS product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_17840 5763 7529 gene locus_tag LOCUS_17850 gene aspS 5763 7529 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121776.1 protein_id gnl|my_center|LOCUS_17850 7607 8335 gene locus_tag LOCUS_17860 7607 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 9667 8336 gene locus_tag LOCUS_17870 9667 8336 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921544.1 protein_id gnl|my_center|LOCUS_17870 9976 9749 gene locus_tag LOCUS_17880 9976 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 10327 10617 gene locus_tag LOCUS_17890 10327 10617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 11441 10782 gene locus_tag LOCUS_17900 11441 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 13565 11556 gene locus_tag LOCUS_17910 13565 11556 CDS product YXWGXW repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052031742.1 protein_id gnl|my_center|LOCUS_17910 15076 13844 gene locus_tag LOCUS_17920 15076 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 15950 15363 gene locus_tag LOCUS_17930 15950 15363 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_17930 18263 16440 gene locus_tag LOCUS_17940 gene mnmG 18263 16440 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427787.1 protein_id gnl|my_center|LOCUS_17940 18756 18286 gene locus_tag LOCUS_17950 18756 18286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 21475 18734 gene locus_tag LOCUS_17960 21475 18734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 21803 24013 gene locus_tag LOCUS_17970 21803 24013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_17970 24760 24017 gene locus_tag LOCUS_17980 24760 24017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_17980 25370 24840 gene locus_tag LOCUS_17990 25370 24840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 25568 25750 gene locus_tag LOCUS_18000 25568 25750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 26935 25790 gene locus_tag LOCUS_18010 26935 25790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 27210 28802 gene locus_tag LOCUS_18020 27210 28802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 28880 29884 gene locus_tag LOCUS_18030 28880 29884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 30942 31931 gene locus_tag LOCUS_18040 30942 31931 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_18040 32258 31938 gene locus_tag LOCUS_18050 32258 31938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 34413 32491 gene locus_tag LOCUS_18060 34413 32491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 34638 34423 gene locus_tag LOCUS_18070 34638 34423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 36014 34746 gene locus_tag LOCUS_18080 gene waaF 36014 34746 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_18080 37037 36015 gene locus_tag LOCUS_18090 37037 36015 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808446.1 protein_id gnl|my_center|LOCUS_18090 38576 37122 gene locus_tag LOCUS_18100 38576 37122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 39423 38587 gene locus_tag LOCUS_18110 39423 38587 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258938.1 protein_id gnl|my_center|LOCUS_18110 40166 39420 gene locus_tag LOCUS_18120 40166 39420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 41239 40163 gene locus_tag LOCUS_18130 41239 40163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 41512 41844 gene locus_tag LOCUS_18140 41512 41844 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_18140 43770 41920 gene locus_tag LOCUS_18150 43770 41920 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460547.1 protein_id gnl|my_center|LOCUS_18150 44687 43770 gene locus_tag LOCUS_18160 44687 43770 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_18160 45534 44842 gene locus_tag LOCUS_18170 45534 44842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921543.1 protein_id gnl|my_center|LOCUS_18170 46116 45625 gene locus_tag LOCUS_18180 46116 45625 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327088.1 protein_id gnl|my_center|LOCUS_18180 49230 46378 gene locus_tag LOCUS_18190 49230 46378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 51264 50152 gene locus_tag LOCUS_18200 51264 50152 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112812.1 protein_id gnl|my_center|LOCUS_18200 51943 51871 gene locus_tag LOCUS_t00130 51943 51871 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 53424 52045 gene locus_tag LOCUS_18210 53424 52045 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760980.1 protein_id gnl|my_center|LOCUS_18210 53661 55880 gene locus_tag LOCUS_18220 53661 55880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 56895 55963 gene locus_tag LOCUS_18230 56895 55963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 58093 57218 gene locus_tag LOCUS_18240 58093 57218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 58599 58216 gene locus_tag LOCUS_18250 58599 58216 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191031.1 protein_id gnl|my_center|LOCUS_18250 60324 58615 gene locus_tag LOCUS_18260 60324 58615 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_18260 61622 60345 gene locus_tag LOCUS_18270 61622 60345 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_18270 62538 61648 gene locus_tag LOCUS_18280 62538 61648 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339817.1 protein_id gnl|my_center|LOCUS_18280 64148 62583 gene locus_tag LOCUS_18290 64148 62583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427771.1 protein_id gnl|my_center|LOCUS_18290 65147 64152 gene locus_tag LOCUS_18300 65147 64152 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_18300 66306 65137 gene locus_tag LOCUS_18310 66306 65137 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_18310 66505 67287 gene locus_tag LOCUS_18320 66505 67287 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_18320 69142 67487 gene locus_tag LOCUS_18330 69142 67487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 69950 69426 gene locus_tag LOCUS_18340 69950 69426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 70379 69975 gene locus_tag LOCUS_18350 70379 69975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 <73206 70485 gene locus_tag LOCUS_18360 <73206 70485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141852.1:chemotaxis protein CheB >Feature sequence024 949 2115 gene locus_tag LOCUS_18370 949 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3986 2250 gene locus_tag LOCUS_18380 3986 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 5162 4173 gene locus_tag LOCUS_18390 gene galE 5162 4173 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615363.1 protein_id gnl|my_center|LOCUS_18390 5363 6190 gene locus_tag LOCUS_18400 5363 6190 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335847.1 protein_id gnl|my_center|LOCUS_18400 7029 6439 gene locus_tag LOCUS_18410 7029 6439 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327091.1 protein_id gnl|my_center|LOCUS_18410 9648 7438 gene locus_tag LOCUS_18420 9648 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 12120 9697 gene locus_tag LOCUS_18430 12120 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 13590 12211 gene locus_tag LOCUS_18440 13590 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 17129 13929 gene locus_tag LOCUS_18450 17129 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 20654 17418 gene locus_tag LOCUS_18460 gene secD 20654 17418 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921767.1 protein_id gnl|my_center|LOCUS_18460 21033 20674 gene locus_tag LOCUS_18470 21033 20674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 22354 21368 gene locus_tag LOCUS_18480 gene tgt 22354 21368 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778950.1 protein_id gnl|my_center|LOCUS_18480 22235 22510 gene locus_tag LOCUS_18490 22235 22510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 23798 22476 gene locus_tag LOCUS_18500 23798 22476 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332711.1 protein_id gnl|my_center|LOCUS_18500 23917 23844 gene locus_tag LOCUS_t00140 23917 23844 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24454 24122 gene locus_tag LOCUS_18510 24454 24122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 24772 24845 gene locus_tag LOCUS_t00150 24772 24845 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 25342 24965 gene locus_tag LOCUS_18520 25342 24965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 26234 25602 gene locus_tag LOCUS_18530 26234 25602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 26659 26910 gene locus_tag LOCUS_18540 26659 26910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 27475 26885 gene locus_tag LOCUS_18550 gene clpP 27475 26885 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327157.1 protein_id gnl|my_center|LOCUS_18550 28141 27518 gene locus_tag LOCUS_18560 28141 27518 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327156.1 protein_id gnl|my_center|LOCUS_18560 29822 28245 gene locus_tag LOCUS_18570 gene tig 29822 28245 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330527.1 protein_id gnl|my_center|LOCUS_18570 29931 29858 gene locus_tag LOCUS_t00160 29931 29858 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 30516 30923 gene locus_tag LOCUS_18580 30516 30923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 31520 34555 gene locus_tag LOCUS_18590 31520 34555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 35730 34735 gene locus_tag LOCUS_18600 35730 34735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_18600 36491 35754 gene locus_tag LOCUS_18610 gene rnc 36491 35754 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120177.1 protein_id gnl|my_center|LOCUS_18610 36681 38144 gene locus_tag LOCUS_18620 36681 38144 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_18620 38407 39756 gene locus_tag LOCUS_18630 38407 39756 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_18630 39977 41323 gene locus_tag LOCUS_18640 gene mgtE 39977 41323 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118267.1 protein_id gnl|my_center|LOCUS_18640 42522 41425 gene locus_tag LOCUS_18650 42522 41425 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_18650 42790 46491 gene locus_tag LOCUS_18660 42790 46491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 46766 48424 gene locus_tag LOCUS_18670 46766 48424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 49490 48444 gene locus_tag LOCUS_18680 49490 48444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 50746 49634 gene locus_tag LOCUS_18690 50746 49634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 51047 51514 gene locus_tag LOCUS_18700 51047 51514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 51511 51954 gene locus_tag LOCUS_18710 51511 51954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 53983 51929 gene locus_tag LOCUS_18720 53983 51929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 54324 56360 gene locus_tag LOCUS_18730 54324 56360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921796.1 protein_id gnl|my_center|LOCUS_18730 56425 57027 gene locus_tag LOCUS_18740 56425 57027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 59831 57180 gene locus_tag LOCUS_18750 59831 57180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 60756 60001 gene locus_tag LOCUS_18760 60756 60001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 60940 62877 gene locus_tag LOCUS_18770 60940 62877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 64253 63138 gene locus_tag LOCUS_18780 64253 63138 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_18780 65241 64279 gene locus_tag LOCUS_18790 65241 64279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 66035 65250 gene locus_tag LOCUS_18800 66035 65250 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211232185.1 protein_id gnl|my_center|LOCUS_18800 66816 66037 gene locus_tag LOCUS_18810 66816 66037 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_18810 67839 66820 gene locus_tag LOCUS_18820 67839 66820 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776118.1 protein_id gnl|my_center|LOCUS_18820 68679 67882 gene locus_tag LOCUS_18830 68679 67882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 69050 70006 gene locus_tag LOCUS_18840 69050 70006 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505124.1 protein_id gnl|my_center|LOCUS_18840 70003 71091 gene locus_tag LOCUS_18850 70003 71091 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_18850 71241 72272 gene locus_tag LOCUS_18860 71241 72272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence025 463 1224 gene locus_tag LOCUS_18870 463 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1226 2302 gene locus_tag LOCUS_18880 1226 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2778 2335 gene locus_tag LOCUS_18890 2778 2335 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413460.1 protein_id gnl|my_center|LOCUS_18890 2980 2759 gene locus_tag LOCUS_18900 2980 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 4052 3045 gene locus_tag LOCUS_18910 4052 3045 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_18910 4407 5546 gene locus_tag LOCUS_18920 gene aroC 4407 5546 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_18920 5567 6865 gene locus_tag LOCUS_18930 5567 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 8372 6915 gene locus_tag LOCUS_18940 8372 6915 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_18940 8572 9237 gene locus_tag LOCUS_18950 8572 9237 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142340.1 protein_id gnl|my_center|LOCUS_18950 10218 9244 gene locus_tag LOCUS_18960 10218 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 11504 10338 gene locus_tag LOCUS_18970 11504 10338 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962872.1 protein_id gnl|my_center|LOCUS_18970 13699 11531 gene locus_tag LOCUS_18980 13699 11531 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767243.1 protein_id gnl|my_center|LOCUS_18980 14649 13717 gene locus_tag LOCUS_18990 14649 13717 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767244.1 protein_id gnl|my_center|LOCUS_18990 15735 14668 gene locus_tag LOCUS_19000 15735 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 17131 15728 gene locus_tag LOCUS_19010 17131 15728 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_19010 18379 17135 gene locus_tag LOCUS_19020 18379 17135 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046800989.1 protein_id gnl|my_center|LOCUS_19020 19729 18404 gene locus_tag LOCUS_19030 19729 18404 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_19030 20024 21214 gene locus_tag LOCUS_19040 20024 21214 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_19040 21567 23297 gene locus_tag LOCUS_19050 21567 23297 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327691.1 protein_id gnl|my_center|LOCUS_19050 23836 23465 gene locus_tag LOCUS_19060 23836 23465 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819377.1 protein_id gnl|my_center|LOCUS_19060 24101 24958 gene locus_tag LOCUS_19070 24101 24958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 26302 24986 gene locus_tag LOCUS_19080 26302 24986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 26715 28148 gene locus_tag LOCUS_19090 26715 28148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 29086 28538 gene locus_tag LOCUS_19100 29086 28538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 29316 29047 gene locus_tag LOCUS_19110 29316 29047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 29658 29338 gene locus_tag LOCUS_19120 29658 29338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 31572 30703 gene locus_tag LOCUS_19130 31572 30703 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927154.1 protein_id gnl|my_center|LOCUS_19130 32445 31594 gene locus_tag LOCUS_19140 32445 31594 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_19140 33368 32442 gene locus_tag LOCUS_19150 33368 32442 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_19150 33584 34441 gene locus_tag LOCUS_19160 33584 34441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 34438 36447 gene locus_tag LOCUS_19170 34438 36447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 36447 36710 gene locus_tag LOCUS_19180 36447 36710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 37779 36973 gene locus_tag LOCUS_19190 37779 36973 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_19190 38233 37805 gene locus_tag LOCUS_19200 38233 37805 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922123.1 protein_id gnl|my_center|LOCUS_19200 39690 38242 gene locus_tag LOCUS_19210 39690 38242 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 protein_id gnl|my_center|LOCUS_19210 41067 39694 gene locus_tag LOCUS_19220 41067 39694 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_19220 41448 41191 gene locus_tag LOCUS_19230 41448 41191 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_19230 42716 41472 gene locus_tag LOCUS_19240 42716 41472 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325817.1 protein_id gnl|my_center|LOCUS_19240 43811 42819 gene locus_tag LOCUS_19250 43811 42819 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331126.1 protein_id gnl|my_center|LOCUS_19250 44983 44450 gene locus_tag LOCUS_19260 44983 44450 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_19260 45964 45125 gene locus_tag LOCUS_19270 45964 45125 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328629.1 protein_id gnl|my_center|LOCUS_19270 47991 46183 gene locus_tag LOCUS_19280 47991 46183 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_19280 49092 48346 gene locus_tag LOCUS_19290 49092 48346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 49761 49099 gene locus_tag LOCUS_19300 gene cmk 49761 49099 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122796.1 protein_id gnl|my_center|LOCUS_19300 52651 49772 gene locus_tag LOCUS_19310 52651 49772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921577.1 protein_id gnl|my_center|LOCUS_19310 52829 53500 gene locus_tag LOCUS_19320 52829 53500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 53897 55306 gene locus_tag LOCUS_19330 53897 55306 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922914.1 protein_id gnl|my_center|LOCUS_19330 55359 55640 gene locus_tag LOCUS_19340 55359 55640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 55680 56228 gene locus_tag LOCUS_19350 55680 56228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 58690 56300 gene locus_tag LOCUS_19360 58690 56300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 58885 59502 gene locus_tag LOCUS_19370 58885 59502 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258578.1 protein_id gnl|my_center|LOCUS_19370 59507 61735 gene locus_tag LOCUS_19380 59507 61735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 63468 62179 gene locus_tag LOCUS_19390 63468 62179 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615621.1 protein_id gnl|my_center|LOCUS_19390 63686 64615 gene locus_tag LOCUS_19400 63686 64615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 64667 65896 gene locus_tag LOCUS_19410 64667 65896 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390206.1 protein_id gnl|my_center|LOCUS_19410 66993 65965 gene locus_tag LOCUS_19420 66993 65965 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122968.1 protein_id gnl|my_center|LOCUS_19420 67462 68466 gene locus_tag LOCUS_19430 67462 68466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 68560 70665 gene locus_tag LOCUS_19440 68560 70665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence026 108 875 gene locus_tag LOCUS_19450 108 875 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_19450 1181 2155 gene locus_tag LOCUS_19460 1181 2155 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_19460 2340 6605 gene locus_tag LOCUS_19470 2340 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 7341 6577 gene locus_tag LOCUS_19480 7341 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 9520 7694 gene locus_tag LOCUS_19490 9520 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 10901 9540 gene locus_tag LOCUS_19500 10901 9540 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_19500 11424 12941 gene locus_tag LOCUS_19510 11424 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 12965 14653 gene locus_tag LOCUS_19520 gene ggt 12965 14653 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805086.1 protein_id gnl|my_center|LOCUS_19520 17288 15003 gene locus_tag LOCUS_19530 gene priA 17288 15003 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922147.1 protein_id gnl|my_center|LOCUS_19530 17384 17989 gene locus_tag LOCUS_19540 gene nadD 17384 17989 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_19540 26462 18213 gene locus_tag LOCUS_19550 26462 18213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 29841 26449 gene locus_tag LOCUS_19560 29841 26449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 31217 30243 gene locus_tag LOCUS_19570 31217 30243 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947351.1 protein_id gnl|my_center|LOCUS_19570 31813 31214 gene locus_tag LOCUS_19580 31813 31214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 32581 33282 gene locus_tag LOCUS_19590 32581 33282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 34796 36115 gene locus_tag LOCUS_19600 34796 36115 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328879.1 protein_id gnl|my_center|LOCUS_19600 36112 37326 gene locus_tag LOCUS_19610 36112 37326 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122076.1 protein_id gnl|my_center|LOCUS_19610 37527 39320 gene locus_tag LOCUS_19620 37527 39320 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_19620 39725 39321 gene locus_tag LOCUS_19630 39725 39321 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_19630 39889 40431 gene locus_tag LOCUS_19640 39889 40431 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_19640 41599 40511 gene locus_tag LOCUS_19650 41599 40511 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_19650 41868 43523 gene locus_tag LOCUS_19660 41868 43523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 44877 43552 gene locus_tag LOCUS_19670 44877 43552 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_19670 46299 44989 gene locus_tag LOCUS_19680 46299 44989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 47790 46504 gene locus_tag LOCUS_19690 gene clpX 47790 46504 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324828.1 protein_id gnl|my_center|LOCUS_19690 48304 48041 gene locus_tag LOCUS_19700 48304 48041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 48489 49139 gene locus_tag LOCUS_19710 gene eda 48489 49139 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_19710 49189 50073 gene locus_tag LOCUS_19720 49189 50073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 50263 51066 gene locus_tag LOCUS_19730 50263 51066 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921509.1 protein_id gnl|my_center|LOCUS_19730 51213 52529 gene locus_tag LOCUS_19740 gene xylA 51213 52529 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_19740 53236 52610 gene locus_tag LOCUS_19750 53236 52610 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922484.1 protein_id gnl|my_center|LOCUS_19750 53380 55278 gene locus_tag LOCUS_19760 gene ilvD 53380 55278 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339020.1 protein_id gnl|my_center|LOCUS_19760 55599 56273 gene locus_tag LOCUS_19770 55599 56273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 56328 56708 gene locus_tag LOCUS_19780 56328 56708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 57328 58245 gene locus_tag LOCUS_19790 57328 58245 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260201.1 protein_id gnl|my_center|LOCUS_19790 58620 60041 gene locus_tag LOCUS_19800 58620 60041 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247553.1 protein_id gnl|my_center|LOCUS_19800 60028 61737 gene locus_tag LOCUS_19810 60028 61737 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_19810 62004 63437 gene locus_tag LOCUS_19820 62004 63437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 63460 65724 gene locus_tag LOCUS_19830 63460 65724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence027 689 1675 gene locus_tag LOCUS_19840 689 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1740 2075 gene locus_tag LOCUS_19850 1740 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2139 2753 gene locus_tag LOCUS_19860 2139 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3142 4530 gene locus_tag LOCUS_19870 3142 4530 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_19870 4924 4664 gene locus_tag LOCUS_19880 4924 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 5708 4929 gene locus_tag LOCUS_19890 5708 4929 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545472.1 protein_id gnl|my_center|LOCUS_19890 5979 7172 gene locus_tag LOCUS_19900 5979 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 8493 7174 gene locus_tag LOCUS_19910 8493 7174 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228658.1 protein_id gnl|my_center|LOCUS_19910 10138 8543 gene locus_tag LOCUS_19920 10138 8543 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921563.1 protein_id gnl|my_center|LOCUS_19920 12829 10292 gene locus_tag LOCUS_19930 12829 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146579418.1 protein_id gnl|my_center|LOCUS_19930 13260 15947 gene locus_tag LOCUS_19940 gene topA 13260 15947 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812879.1 protein_id gnl|my_center|LOCUS_19940 16414 16013 gene locus_tag LOCUS_19950 gene acpS 16414 16013 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324752.1 protein_id gnl|my_center|LOCUS_19950 17333 16443 gene locus_tag LOCUS_19960 17333 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 19104 18250 gene locus_tag LOCUS_19970 19104 18250 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921963.1 protein_id gnl|my_center|LOCUS_19970 20369 19350 gene locus_tag LOCUS_19980 20369 19350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 20672 21208 gene locus_tag LOCUS_19990 20672 21208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 21205 23655 gene locus_tag LOCUS_20000 21205 23655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922069.1 protein_id gnl|my_center|LOCUS_20000 24200 23709 gene locus_tag LOCUS_20010 24200 23709 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329720.1 protein_id gnl|my_center|LOCUS_20010 25581 24289 gene locus_tag LOCUS_20020 25581 24289 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813557.1 protein_id gnl|my_center|LOCUS_20020 25878 27311 gene locus_tag LOCUS_20030 25878 27311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 27559 28023 gene locus_tag LOCUS_20040 27559 28023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 28627 30186 gene locus_tag LOCUS_20050 28627 30186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 32231 30198 gene locus_tag LOCUS_20060 32231 30198 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921710.1 protein_id gnl|my_center|LOCUS_20060 32629 34026 gene locus_tag LOCUS_20070 32629 34026 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119759.1 protein_id gnl|my_center|LOCUS_20070 34471 34965 gene locus_tag LOCUS_20080 34471 34965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 36115 34949 gene locus_tag LOCUS_20090 36115 34949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 36340 38268 gene locus_tag LOCUS_20100 36340 38268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 38284 39516 gene locus_tag LOCUS_20110 38284 39516 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_20110 39503 40162 gene locus_tag LOCUS_20120 39503 40162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 40184 41230 gene locus_tag LOCUS_20130 gene gutB 40184 41230 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_20130 41241 42458 gene locus_tag LOCUS_20140 41241 42458 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801343.1 protein_id gnl|my_center|LOCUS_20140 42480 43361 gene locus_tag LOCUS_20150 42480 43361 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921649.1 protein_id gnl|my_center|LOCUS_20150 43452 43976 gene locus_tag LOCUS_20160 gene purE 43452 43976 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222903.1 protein_id gnl|my_center|LOCUS_20160 43973 45118 gene locus_tag LOCUS_20170 gene mtnA 43973 45118 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_20170 46864 45053 gene locus_tag LOCUS_20180 46864 45053 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_20180 47665 48300 gene locus_tag LOCUS_20190 47665 48300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 48297 49637 gene locus_tag LOCUS_20200 48297 49637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 49643 52870 gene locus_tag LOCUS_20210 49643 52870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 53153 52941 gene locus_tag LOCUS_20220 53153 52941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 53385 54899 gene locus_tag LOCUS_20230 53385 54899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 54906 55616 gene locus_tag LOCUS_20240 54906 55616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 57010 55598 gene locus_tag LOCUS_20250 57010 55598 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921576.1 protein_id gnl|my_center|LOCUS_20250 58450 57362 gene locus_tag LOCUS_20260 gene mnmA 58450 57362 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120981.1 protein_id gnl|my_center|LOCUS_20260 58813 58463 gene locus_tag LOCUS_20270 58813 58463 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_20270 59983 61137 gene locus_tag LOCUS_20280 59983 61137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 61116 62933 gene locus_tag LOCUS_20290 61116 62933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 62964 63779 gene locus_tag LOCUS_20300 62964 63779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 63782 64180 gene locus_tag LOCUS_20310 63782 64180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 64245 67232 gene locus_tag LOCUS_20320 64245 67232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 67233 67634 gene locus_tag LOCUS_20330 67233 67634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 67854 67651 gene locus_tag LOCUS_20340 67854 67651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence028 367 1725 gene locus_tag LOCUS_20350 367 1725 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_20350 1963 3234 gene locus_tag LOCUS_20360 1963 3234 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_20360 3285 4478 gene locus_tag LOCUS_20370 3285 4478 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_20370 5241 12233 gene locus_tag LOCUS_20380 gene uvrA 5241 12233 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121648.1 protein_id gnl|my_center|LOCUS_20380 12230 12898 gene locus_tag LOCUS_20390 12230 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615698.1 protein_id gnl|my_center|LOCUS_20390 13263 14708 gene locus_tag LOCUS_20400 13263 14708 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435082.1 protein_id gnl|my_center|LOCUS_20400 15963 14911 gene locus_tag LOCUS_20410 15963 14911 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969966.1 protein_id gnl|my_center|LOCUS_20410 16829 16071 gene locus_tag LOCUS_20420 16829 16071 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_20420 18317 16902 gene locus_tag LOCUS_20430 18317 16902 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_20430 19402 18356 gene locus_tag LOCUS_20440 19402 18356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 20746 19427 gene locus_tag LOCUS_20450 20746 19427 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_20450 21795 20761 gene locus_tag LOCUS_20460 21795 20761 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_20460 22124 21792 gene locus_tag LOCUS_20470 22124 21792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 22278 22517 gene locus_tag LOCUS_20480 22278 22517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 22524 22943 gene locus_tag LOCUS_20490 22524 22943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 23164 23898 gene locus_tag LOCUS_20500 23164 23898 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_20500 23914 26319 gene locus_tag LOCUS_20510 23914 26319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 26516 27511 gene locus_tag LOCUS_20520 26516 27511 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930890.1 protein_id gnl|my_center|LOCUS_20520 27519 28013 gene locus_tag LOCUS_20530 27519 28013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 28015 29289 gene locus_tag LOCUS_20540 gene dctM 28015 29289 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_20540 29538 31271 gene locus_tag LOCUS_20550 29538 31271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 31556 33274 gene locus_tag LOCUS_20560 31556 33274 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869365.1 protein_id gnl|my_center|LOCUS_20560 33537 34457 gene locus_tag LOCUS_20570 33537 34457 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_20570 34538 35599 gene locus_tag LOCUS_20580 34538 35599 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822181.1 protein_id gnl|my_center|LOCUS_20580 35802 36140 gene locus_tag LOCUS_20590 35802 36140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 36388 36576 gene locus_tag LOCUS_20600 36388 36576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 37071 39353 gene locus_tag LOCUS_20610 37071 39353 CDS product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_20610 39350 39775 gene locus_tag LOCUS_20620 39350 39775 CDS product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_20620 39772 40116 gene locus_tag LOCUS_20630 39772 40116 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_20630 40113 41612 gene locus_tag LOCUS_20640 40113 41612 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404437.1 protein_id gnl|my_center|LOCUS_20640 41609 42082 gene locus_tag LOCUS_20650 41609 42082 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_20650 42079 42351 gene locus_tag LOCUS_20660 42079 42351 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942975.1 protein_id gnl|my_center|LOCUS_20660 42348 42731 gene locus_tag LOCUS_20670 gene mnhG 42348 42731 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958313.1 protein_id gnl|my_center|LOCUS_20670 42889 42734 gene locus_tag LOCUS_20680 42889 42734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 43194 42850 gene locus_tag LOCUS_20690 43194 42850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 43553 43173 gene locus_tag LOCUS_20700 43553 43173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20700 43944 43696 gene locus_tag LOCUS_20710 43944 43696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 44592 44281 gene locus_tag LOCUS_20720 44592 44281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 45680 44994 gene locus_tag LOCUS_20730 45680 44994 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_20730 47239 45872 gene locus_tag LOCUS_20740 47239 45872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_20740 48869 47529 gene locus_tag LOCUS_20750 48869 47529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 49023 48802 gene locus_tag LOCUS_20760 49023 48802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 49621 52143 gene locus_tag LOCUS_20770 49621 52143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 52410 52105 gene locus_tag LOCUS_20780 52410 52105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 53026 53448 gene locus_tag LOCUS_20790 53026 53448 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933077.1 protein_id gnl|my_center|LOCUS_20790 54085 53435 gene locus_tag LOCUS_20800 54085 53435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 54631 55275 gene locus_tag LOCUS_20810 54631 55275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 55286 56032 gene locus_tag LOCUS_20820 55286 56032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 56029 57756 gene locus_tag LOCUS_20830 56029 57756 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_20830 57753 59051 gene locus_tag LOCUS_20840 57753 59051 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556695.1 protein_id gnl|my_center|LOCUS_20840 59055 59696 gene locus_tag LOCUS_20850 59055 59696 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_20850 59712 61490 gene locus_tag LOCUS_20860 59712 61490 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_20860 61493 62044 gene locus_tag LOCUS_20870 61493 62044 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669353.1 protein_id gnl|my_center|LOCUS_20870 62094 63272 gene locus_tag LOCUS_20880 62094 63272 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665238.1 protein_id gnl|my_center|LOCUS_20880 64425 63295 gene locus_tag LOCUS_20890 gene hemW 64425 63295 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_20890 64855 64625 gene locus_tag LOCUS_20900 64855 64625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 65308 64922 gene locus_tag LOCUS_20910 65308 64922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 65862 65431 gene locus_tag LOCUS_20920 65862 65431 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_20920 66076 65840 gene locus_tag LOCUS_20930 66076 65840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence029 981 301 gene locus_tag LOCUS_20940 gene aat 981 301 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_20940 1145 1990 gene locus_tag LOCUS_20950 1145 1990 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_20950 1974 5012 gene locus_tag LOCUS_20960 gene purL 1974 5012 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_20960 5096 5890 gene locus_tag LOCUS_20970 5096 5890 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_20970 6474 5902 gene locus_tag LOCUS_20980 6474 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 7410 6502 gene locus_tag LOCUS_20990 gene ispE 7410 6502 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772094.1 protein_id gnl|my_center|LOCUS_20990 8384 7620 gene locus_tag LOCUS_21000 8384 7620 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098139.1 protein_id gnl|my_center|LOCUS_21000 9255 8389 gene locus_tag LOCUS_21010 gene ilvE 9255 8389 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_21010 10066 9281 gene locus_tag LOCUS_21020 10066 9281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331945.1 protein_id gnl|my_center|LOCUS_21020 11615 10059 gene locus_tag LOCUS_21030 11615 10059 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121144.1 protein_id gnl|my_center|LOCUS_21030 13136 11649 gene locus_tag LOCUS_21040 gene lysS 13136 11649 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672011.1 protein_id gnl|my_center|LOCUS_21040 14330 13407 gene locus_tag LOCUS_21050 14330 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 14567 16051 gene locus_tag LOCUS_21060 14567 16051 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382881.1 protein_id gnl|my_center|LOCUS_21060 16942 16163 gene locus_tag LOCUS_21070 16942 16163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 23097 16924 gene locus_tag LOCUS_21080 23097 16924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 23464 24732 gene locus_tag LOCUS_21090 23464 24732 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_21090 25368 25637 gene locus_tag LOCUS_21100 25368 25637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 26105 26800 gene locus_tag LOCUS_21110 26105 26800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 26801 28912 gene locus_tag LOCUS_21120 26801 28912 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_21120 28916 34240 gene locus_tag LOCUS_21130 28916 34240 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_21130 34539 35858 gene locus_tag LOCUS_21140 34539 35858 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324232.1 protein_id gnl|my_center|LOCUS_21140 35868 36839 gene locus_tag LOCUS_21150 35868 36839 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324233.1 protein_id gnl|my_center|LOCUS_21150 36847 37818 gene locus_tag LOCUS_21160 36847 37818 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335393.1 protein_id gnl|my_center|LOCUS_21160 37891 38517 gene locus_tag LOCUS_21170 37891 38517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008670858.1 protein_id gnl|my_center|LOCUS_21170 38898 40115 gene locus_tag LOCUS_21180 38898 40115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 40931 42796 gene locus_tag LOCUS_21190 40931 42796 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_21190 43218 42775 gene locus_tag LOCUS_21200 43218 42775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123450.1 protein_id gnl|my_center|LOCUS_21200 44038 43292 gene locus_tag LOCUS_21210 44038 43292 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_21210 44670 44353 gene locus_tag LOCUS_21220 44670 44353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 45517 44867 gene locus_tag LOCUS_21230 45517 44867 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495802.1 protein_id gnl|my_center|LOCUS_21230 46805 45534 gene locus_tag LOCUS_21240 46805 45534 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616082.1 protein_id gnl|my_center|LOCUS_21240 47010 47870 gene locus_tag LOCUS_21250 47010 47870 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121375.1 protein_id gnl|my_center|LOCUS_21250 47946 50042 gene locus_tag LOCUS_21260 47946 50042 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_21260 51639 50239 gene locus_tag LOCUS_21270 51639 50239 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_21270 53123 52476 gene locus_tag LOCUS_21280 53123 52476 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037422.1 protein_id gnl|my_center|LOCUS_21280 55588 53330 gene locus_tag LOCUS_21290 55588 53330 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921918.1 protein_id gnl|my_center|LOCUS_21290 57174 55816 gene locus_tag LOCUS_21300 57174 55816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 58904 57171 gene locus_tag LOCUS_21310 58904 57171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 59453 60508 gene locus_tag LOCUS_21320 59453 60508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 60692 62140 gene locus_tag LOCUS_21330 gene gltX 60692 62140 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922083.1 protein_id gnl|my_center|LOCUS_21330 62192 63892 gene locus_tag LOCUS_21340 62192 63892 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence030 273 1205 gene locus_tag LOCUS_21350 273 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 1535 2176 gene locus_tag LOCUS_21360 1535 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2482 2904 gene locus_tag LOCUS_21370 2482 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2949 3761 gene locus_tag LOCUS_21380 2949 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 4226 3999 gene locus_tag LOCUS_21390 4226 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 5046 4642 gene locus_tag LOCUS_21400 5046 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 5336 5046 gene locus_tag LOCUS_21410 5336 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 6141 5617 gene locus_tag LOCUS_21420 6141 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 6224 6634 gene locus_tag LOCUS_21430 6224 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 7041 6703 gene locus_tag LOCUS_21440 7041 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 7620 8531 gene locus_tag LOCUS_21450 7620 8531 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_21450 8564 9187 gene locus_tag LOCUS_21460 8564 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 9587 13750 gene locus_tag LOCUS_21470 9587 13750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 14512 13787 gene locus_tag LOCUS_21480 14512 13787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 16252 14747 gene locus_tag LOCUS_21490 16252 14747 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_21490 16689 17027 gene locus_tag LOCUS_21500 16689 17027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 17043 17336 gene locus_tag LOCUS_21510 gene gatC 17043 17336 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_21510 17358 18899 gene locus_tag LOCUS_21520 gene gatA 17358 18899 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119740.1 protein_id gnl|my_center|LOCUS_21520 19103 19354 gene locus_tag LOCUS_21530 19103 19354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 19374 19808 gene locus_tag LOCUS_21540 19374 19808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 19837 21327 gene locus_tag LOCUS_21550 gene gatB 19837 21327 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122965.1 protein_id gnl|my_center|LOCUS_21550 21324 22115 gene locus_tag LOCUS_21560 21324 22115 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_21560 22447 23496 gene locus_tag LOCUS_21570 22447 23496 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922050.1 protein_id gnl|my_center|LOCUS_21570 23559 24026 gene locus_tag LOCUS_21580 23559 24026 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921283.1 protein_id gnl|my_center|LOCUS_21580 26504 24099 gene locus_tag LOCUS_21590 26504 24099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 28462 26528 gene locus_tag LOCUS_21600 28462 26528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 28719 30344 gene locus_tag LOCUS_21610 28719 30344 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921354.1 protein_id gnl|my_center|LOCUS_21610 33508 30377 gene locus_tag LOCUS_21620 33508 30377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 33974 35164 gene locus_tag LOCUS_21630 33974 35164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 35161 37005 gene locus_tag LOCUS_21640 35161 37005 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922881.1 protein_id gnl|my_center|LOCUS_21640 37509 38426 gene locus_tag LOCUS_21650 37509 38426 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922058.1 protein_id gnl|my_center|LOCUS_21650 38423 40441 gene locus_tag LOCUS_21660 38423 40441 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260110.1 protein_id gnl|my_center|LOCUS_21660 40463 40765 gene locus_tag LOCUS_21670 40463 40765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 41458 42414 gene locus_tag LOCUS_21680 41458 42414 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_21680 42540 42983 gene locus_tag LOCUS_21690 42540 42983 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324147.1 protein_id gnl|my_center|LOCUS_21690 43130 43501 gene locus_tag LOCUS_21700 43130 43501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 44547 43693 gene locus_tag LOCUS_21710 44547 43693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 46801 44753 gene locus_tag LOCUS_21720 46801 44753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 48381 46801 gene locus_tag LOCUS_21730 48381 46801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 50011 48566 gene locus_tag LOCUS_21740 50011 48566 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144052.1 protein_id gnl|my_center|LOCUS_21740 52467 50509 gene locus_tag LOCUS_21750 52467 50509 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328238.1 protein_id gnl|my_center|LOCUS_21750 53659 52601 gene locus_tag LOCUS_21760 53659 52601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 55204 53984 gene locus_tag LOCUS_21770 55204 53984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 56044 55208 gene locus_tag LOCUS_21780 56044 55208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_21780 56941 56117 gene locus_tag LOCUS_21790 56941 56117 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_21790 57695 59182 gene locus_tag LOCUS_21800 57695 59182 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_21800 59179 61179 gene locus_tag LOCUS_21810 59179 61179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 61253 62248 gene locus_tag LOCUS_21820 61253 62248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 62315 63577 gene locus_tag LOCUS_21830 62315 63577 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence031 2847 826 gene locus_tag LOCUS_21840 2847 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 3124 5394 gene locus_tag LOCUS_21850 3124 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 5676 7358 gene locus_tag LOCUS_21860 5676 7358 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262483.1 protein_id gnl|my_center|LOCUS_21860 7915 7508 gene locus_tag LOCUS_21870 7915 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 9760 7919 gene locus_tag LOCUS_21880 9760 7919 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_21880 11401 9941 gene locus_tag LOCUS_21890 11401 9941 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121030.1 protein_id gnl|my_center|LOCUS_21890 11934 13244 gene locus_tag LOCUS_21900 gene ablA 11934 13244 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_21900 13291 13869 gene locus_tag LOCUS_21910 13291 13869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 13835 14863 gene locus_tag LOCUS_21920 13835 14863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 14863 15873 gene locus_tag LOCUS_21930 14863 15873 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140301.1 protein_id gnl|my_center|LOCUS_21930 15877 17619 gene locus_tag LOCUS_21940 15877 17619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 17619 18215 gene locus_tag LOCUS_21950 17619 18215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 20887 18254 gene locus_tag LOCUS_21960 20887 18254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 21312 20914 gene locus_tag LOCUS_21970 21312 20914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 21390 22322 gene locus_tag LOCUS_21980 gene nadC 21390 22322 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921990.1 protein_id gnl|my_center|LOCUS_21980 22329 23081 gene locus_tag LOCUS_21990 22329 23081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 23008 23997 gene locus_tag LOCUS_22000 23008 23997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 24042 25514 gene locus_tag LOCUS_22010 24042 25514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 25538 25801 gene locus_tag LOCUS_22020 25538 25801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 26229 26774 gene locus_tag LOCUS_22030 26229 26774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 26900 27943 gene locus_tag LOCUS_22040 gene pilM 26900 27943 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181416674.1 protein_id gnl|my_center|LOCUS_22040 27965 28696 gene locus_tag LOCUS_22050 27965 28696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 28708 29274 gene locus_tag LOCUS_22060 28708 29274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 29300 29998 gene locus_tag LOCUS_22070 29300 29998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 30017 32275 gene locus_tag LOCUS_22080 30017 32275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 32272 32889 gene locus_tag LOCUS_22090 32272 32889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 32932 33486 gene locus_tag LOCUS_22100 32932 33486 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_22100 33741 33526 gene locus_tag LOCUS_22110 33741 33526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 34142 34390 gene locus_tag LOCUS_22120 34142 34390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 35330 34398 gene locus_tag LOCUS_22130 35330 34398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 36132 35362 gene locus_tag LOCUS_22140 36132 35362 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 protein_id gnl|my_center|LOCUS_22140 36545 37570 gene locus_tag LOCUS_22150 36545 37570 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_22150 37583 38635 gene locus_tag LOCUS_22160 37583 38635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 38703 38903 gene locus_tag LOCUS_22170 38703 38903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 39539 39369 gene locus_tag LOCUS_22180 39539 39369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 41101 39536 gene locus_tag LOCUS_22190 41101 39536 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_22190 42717 41347 gene locus_tag LOCUS_22200 42717 41347 CDS product galactokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776792.1 protein_id gnl|my_center|LOCUS_22200 43538 42714 gene locus_tag LOCUS_22210 43538 42714 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776793.1 protein_id gnl|my_center|LOCUS_22210 44881 43556 gene locus_tag LOCUS_22220 44881 43556 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_22220 45404 46207 gene locus_tag LOCUS_22230 45404 46207 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_22230 46324 47292 gene locus_tag LOCUS_22240 46324 47292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 47569 48576 gene locus_tag LOCUS_22250 47569 48576 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_22250 49862 48597 gene locus_tag LOCUS_22260 49862 48597 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801343.1 protein_id gnl|my_center|LOCUS_22260 50207 52330 gene locus_tag LOCUS_22270 50207 52330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 52952 52770 gene locus_tag LOCUS_22280 52952 52770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 52951 54609 gene locus_tag LOCUS_22290 52951 54609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 55179 55493 gene locus_tag LOCUS_22300 55179 55493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 55583 55831 gene locus_tag LOCUS_22310 55583 55831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 55831 56241 gene locus_tag LOCUS_22320 55831 56241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 56282 56947 gene locus_tag LOCUS_22330 56282 56947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 57182 57009 gene locus_tag LOCUS_22340 57182 57009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 57320 57667 gene locus_tag LOCUS_22350 57320 57667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 57696 58325 gene locus_tag LOCUS_22360 57696 58325 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974802.1 protein_id gnl|my_center|LOCUS_22360 58318 59352 gene locus_tag LOCUS_22370 58318 59352 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_22370 59665 59967 gene locus_tag LOCUS_22380 59665 59967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 60426 60983 gene locus_tag LOCUS_22390 60426 60983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 61069 61359 gene locus_tag LOCUS_22400 61069 61359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 61590 63146 gene locus_tag LOCUS_22410 61590 63146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence032 211 597 gene locus_tag LOCUS_22420 211 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 937 719 gene locus_tag LOCUS_22430 937 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 1803 1438 gene locus_tag LOCUS_22440 1803 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2082 2549 gene locus_tag LOCUS_22450 2082 2549 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123244.1 protein_id gnl|my_center|LOCUS_22450 2557 4029 gene locus_tag LOCUS_22460 2557 4029 CDS product deoxyribodipyrimidine photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_22460 4530 4249 gene locus_tag LOCUS_22470 4530 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 4734 5522 gene locus_tag LOCUS_22480 4734 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22480 5789 5598 gene locus_tag LOCUS_22490 5789 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 6366 8489 gene locus_tag LOCUS_22500 gene ovoA 6366 8489 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704222.1 protein_id gnl|my_center|LOCUS_22500 9417 8647 gene locus_tag LOCUS_22510 9417 8647 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877167.1 protein_id gnl|my_center|LOCUS_22510 9632 10828 gene locus_tag LOCUS_22520 9632 10828 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_22520 11002 11421 gene locus_tag LOCUS_22530 11002 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 12615 11311 gene locus_tag LOCUS_22540 12615 11311 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_22540 13391 15550 gene locus_tag LOCUS_22550 13391 15550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 15949 17283 gene locus_tag LOCUS_22560 15949 17283 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533373.1 protein_id gnl|my_center|LOCUS_22560 17368 17880 gene locus_tag LOCUS_22570 17368 17880 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326614.1 protein_id gnl|my_center|LOCUS_22570 18198 19481 gene locus_tag LOCUS_22580 18198 19481 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941947.1 protein_id gnl|my_center|LOCUS_22580 19580 20590 gene locus_tag LOCUS_22590 19580 20590 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118637.1 protein_id gnl|my_center|LOCUS_22590 20704 22050 gene locus_tag LOCUS_22600 20704 22050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 27496 22322 gene locus_tag LOCUS_22610 27496 22322 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463281.1 protein_id gnl|my_center|LOCUS_22610 28918 27692 gene locus_tag LOCUS_22620 28918 27692 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763971.1 protein_id gnl|my_center|LOCUS_22620 29325 29110 gene locus_tag LOCUS_22630 29325 29110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 29531 31720 gene locus_tag LOCUS_22640 29531 31720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 33884 33657 gene locus_tag LOCUS_22650 33884 33657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 35643 33895 gene locus_tag LOCUS_22660 35643 33895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 35947 35750 gene locus_tag LOCUS_22670 35947 35750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 37350 38696 gene locus_tag LOCUS_22680 37350 38696 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_22680 38671 39297 gene locus_tag LOCUS_22690 38671 39297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 40060 40290 gene locus_tag LOCUS_22700 40060 40290 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_22700 40287 40577 gene locus_tag LOCUS_22710 40287 40577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 40642 41787 gene locus_tag LOCUS_22720 40642 41787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 43325 41895 gene locus_tag LOCUS_22730 43325 41895 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_22730 44743 43382 gene locus_tag LOCUS_22740 44743 43382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 45203 45424 gene locus_tag LOCUS_22750 45203 45424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 47091 45574 gene locus_tag LOCUS_22760 47091 45574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 47117 47449 gene locus_tag LOCUS_22770 47117 47449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 47465 47677 gene locus_tag LOCUS_22780 47465 47677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 49801 48176 gene locus_tag LOCUS_22790 49801 48176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 50418 49801 gene locus_tag LOCUS_22800 50418 49801 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921328.1 protein_id gnl|my_center|LOCUS_22800 51600 50533 gene locus_tag LOCUS_22810 gene ykfB 51600 50533 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 protein_id gnl|my_center|LOCUS_22810 51733 52662 gene locus_tag LOCUS_22820 51733 52662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 52713 53699 gene locus_tag LOCUS_22830 52713 53699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 53766 54821 gene locus_tag LOCUS_22840 53766 54821 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082991.1 protein_id gnl|my_center|LOCUS_22840 54840 55541 gene locus_tag LOCUS_22850 54840 55541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 55545 56993 gene locus_tag LOCUS_22860 55545 56993 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_22860 57211 58407 gene locus_tag LOCUS_22870 57211 58407 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615395.1 protein_id gnl|my_center|LOCUS_22870 59613 58462 gene locus_tag LOCUS_22880 59613 58462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 61332 59626 gene locus_tag LOCUS_22890 61332 59626 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331356.1 protein_id gnl|my_center|LOCUS_22890 61736 61984 gene locus_tag LOCUS_22900 61736 61984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328183.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence033 1852 476 gene locus_tag LOCUS_22910 1852 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2883 1870 gene locus_tag LOCUS_22920 2883 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 3928 4149 gene locus_tag LOCUS_22930 3928 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 4816 4442 gene locus_tag LOCUS_22940 4816 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 6734 4890 gene locus_tag LOCUS_22950 6734 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 6982 6731 gene locus_tag LOCUS_22960 6982 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 9555 7294 gene locus_tag LOCUS_22970 9555 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 11132 9708 gene locus_tag LOCUS_22980 11132 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 11877 11263 gene locus_tag LOCUS_22990 11877 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 12130 11912 gene locus_tag LOCUS_23000 12130 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 12891 12475 gene locus_tag LOCUS_23010 12891 12475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 14108 13095 gene locus_tag LOCUS_23020 14108 13095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 14600 14289 gene locus_tag LOCUS_23030 14600 14289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 15767 14688 gene locus_tag LOCUS_23040 15767 14688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 17163 15892 gene locus_tag LOCUS_23050 17163 15892 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922445.1 protein_id gnl|my_center|LOCUS_23050 17354 17280 gene locus_tag LOCUS_t00170 17354 17280 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 17579 19540 gene locus_tag LOCUS_23060 17579 19540 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325434.1 protein_id gnl|my_center|LOCUS_23060 19908 19633 gene locus_tag LOCUS_23070 19908 19633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 20645 21679 gene locus_tag LOCUS_23080 20645 21679 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329274.1 protein_id gnl|my_center|LOCUS_23080 22433 21771 gene locus_tag LOCUS_23090 22433 21771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 22631 23641 gene locus_tag LOCUS_23100 22631 23641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 24745 23705 gene locus_tag LOCUS_23110 24745 23705 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921437.1 protein_id gnl|my_center|LOCUS_23110 25994 24795 gene locus_tag LOCUS_23120 25994 24795 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_23120 26891 26139 gene locus_tag LOCUS_23130 26891 26139 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114439.1 protein_id gnl|my_center|LOCUS_23130 27738 26917 gene locus_tag LOCUS_23140 27738 26917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 27862 28074 gene locus_tag LOCUS_23150 27862 28074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 28230 29246 gene locus_tag LOCUS_23160 28230 29246 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968913.1 protein_id gnl|my_center|LOCUS_23160 29514 31532 gene locus_tag LOCUS_23170 29514 31532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 31688 32734 gene locus_tag LOCUS_23180 31688 32734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 33600 32710 gene locus_tag LOCUS_23190 33600 32710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 34053 33667 gene locus_tag LOCUS_23200 34053 33667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 34301 35584 gene locus_tag LOCUS_23210 34301 35584 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727834.1 protein_id gnl|my_center|LOCUS_23210 35816 36853 gene locus_tag LOCUS_23220 35816 36853 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245431.1 protein_id gnl|my_center|LOCUS_23220 36864 40835 gene locus_tag LOCUS_23230 36864 40835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 40832 41281 gene locus_tag LOCUS_23240 40832 41281 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_23240 41678 42022 gene locus_tag LOCUS_23250 41678 42022 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641840.1 protein_id gnl|my_center|LOCUS_23250 42000 42896 gene locus_tag LOCUS_23260 42000 42896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 43619 43852 gene locus_tag LOCUS_23270 43619 43852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 44000 44185 gene locus_tag LOCUS_23280 44000 44185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 44276 44599 gene locus_tag LOCUS_23290 44276 44599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 44666 45238 gene locus_tag LOCUS_23300 44666 45238 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326626.1 protein_id gnl|my_center|LOCUS_23300 45385 45753 gene locus_tag LOCUS_23310 45385 45753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 45818 46987 gene locus_tag LOCUS_23320 45818 46987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 47111 48820 gene locus_tag LOCUS_23330 47111 48820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 48879 50096 gene locus_tag LOCUS_23340 48879 50096 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_23340 51229 54375 gene locus_tag LOCUS_23350 51229 54375 CDS product secretin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118422.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23350 54553 55086 gene locus_tag LOCUS_23360 54553 55086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 55487 55933 gene locus_tag LOCUS_23370 55487 55933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 56132 57238 gene locus_tag LOCUS_23380 56132 57238 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_23380 58093 57233 gene locus_tag LOCUS_23390 58093 57233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 61402 58517 gene locus_tag LOCUS_23400 61402 58517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence034 818 252 gene locus_tag LOCUS_23410 818 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 1857 895 gene locus_tag LOCUS_23420 1857 895 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_23420 5450 1938 gene locus_tag LOCUS_23430 5450 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 6134 5544 gene locus_tag LOCUS_23440 6134 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 6303 6575 gene locus_tag LOCUS_23450 6303 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 7003 7278 gene locus_tag LOCUS_23460 7003 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 7282 7773 gene locus_tag LOCUS_23470 7282 7773 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 protein_id gnl|my_center|LOCUS_23470 8528 7875 gene locus_tag LOCUS_23480 8528 7875 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_23480 8709 9014 gene locus_tag LOCUS_23490 8709 9014 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_23490 9018 9413 gene locus_tag LOCUS_23500 9018 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 10989 9559 gene locus_tag LOCUS_23510 10989 9559 CDS product PhoPQ-activated protein PqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038065.1 protein_id gnl|my_center|LOCUS_23510 12242 11214 gene locus_tag LOCUS_23520 12242 11214 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_23520 12604 13209 gene locus_tag LOCUS_23530 12604 13209 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037770.1 protein_id gnl|my_center|LOCUS_23530 13515 13222 gene locus_tag LOCUS_23540 13515 13222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 15282 13624 gene locus_tag LOCUS_23550 15282 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 17139 15322 gene locus_tag LOCUS_23560 17139 15322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 18469 17519 gene locus_tag LOCUS_23570 18469 17519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 18668 20350 gene locus_tag LOCUS_23580 18668 20350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 20631 21908 gene locus_tag LOCUS_23590 20631 21908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 21928 24855 gene locus_tag LOCUS_23600 21928 24855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 25276 26475 gene locus_tag LOCUS_23610 25276 26475 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 protein_id gnl|my_center|LOCUS_23610 26482 26694 gene locus_tag LOCUS_23620 26482 26694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 26953 27981 gene locus_tag LOCUS_23630 26953 27981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327241.1 protein_id gnl|my_center|LOCUS_23630 27989 28819 gene locus_tag LOCUS_23640 27989 28819 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333288.1 protein_id gnl|my_center|LOCUS_23640 28824 29660 gene locus_tag LOCUS_23650 28824 29660 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333289.1 protein_id gnl|my_center|LOCUS_23650 29750 30064 gene locus_tag LOCUS_23660 29750 30064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 30061 30528 gene locus_tag LOCUS_23670 30061 30528 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229164.1 protein_id gnl|my_center|LOCUS_23670 30928 30575 gene locus_tag LOCUS_23680 30928 30575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 34624 31184 gene locus_tag LOCUS_23690 34624 31184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 35846 34671 gene locus_tag LOCUS_23700 35846 34671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 36617 35985 gene locus_tag LOCUS_23710 36617 35985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 37769 36678 gene locus_tag LOCUS_23720 37769 36678 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090843.1 protein_id gnl|my_center|LOCUS_23720 38744 37788 gene locus_tag LOCUS_23730 gene ispH 38744 37788 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_23730 38743 39777 gene locus_tag LOCUS_23740 gene hpnC 38743 39777 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061007.1 protein_id gnl|my_center|LOCUS_23740 39774 40661 gene locus_tag LOCUS_23750 39774 40661 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333441.1 protein_id gnl|my_center|LOCUS_23750 40677 42110 gene locus_tag LOCUS_23760 gene hpnE 40677 42110 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 protein_id gnl|my_center|LOCUS_23760 42329 42928 gene locus_tag LOCUS_23770 42329 42928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 43372 43010 gene locus_tag LOCUS_23780 43372 43010 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119951.1 protein_id gnl|my_center|LOCUS_23780 43642 43884 gene locus_tag LOCUS_23790 43642 43884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 44327 43887 gene locus_tag LOCUS_23800 44327 43887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 44593 46161 gene locus_tag LOCUS_23810 gene purH 44593 46161 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122619.1 protein_id gnl|my_center|LOCUS_23810 46311 47093 gene locus_tag LOCUS_23820 gene trpC 46311 47093 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 protein_id gnl|my_center|LOCUS_23820 47121 47951 gene locus_tag LOCUS_23830 47121 47951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 49011 47965 gene locus_tag LOCUS_23840 gene rhaT 49011 47965 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_23840 49321 49602 gene locus_tag LOCUS_23850 49321 49602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 49811 51202 gene locus_tag LOCUS_23860 49811 51202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 53137 51209 gene locus_tag LOCUS_23870 53137 51209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 53717 54442 gene locus_tag LOCUS_23880 53717 54442 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_23880 54673 55701 gene locus_tag LOCUS_23890 54673 55701 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122477.1 protein_id gnl|my_center|LOCUS_23890 55703 56449 gene locus_tag LOCUS_23900 gene truA 55703 56449 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_23900 56562 57713 gene locus_tag LOCUS_23910 56562 57713 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_23910 58136 59014 gene locus_tag LOCUS_23920 58136 59014 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338658.1 protein_id gnl|my_center|LOCUS_23920 59286 60347 gene locus_tag LOCUS_23930 59286 60347 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338657.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence035 878 1084 gene locus_tag LOCUS_23940 878 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 1183 1584 gene locus_tag LOCUS_23950 1183 1584 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971103.1 protein_id gnl|my_center|LOCUS_23950 3532 1589 gene locus_tag LOCUS_23960 3532 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 4990 3647 gene locus_tag LOCUS_23970 4990 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 5978 5031 gene locus_tag LOCUS_23980 5978 5031 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 protein_id gnl|my_center|LOCUS_23980 6298 6612 gene locus_tag LOCUS_23990 6298 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 6652 8334 gene locus_tag LOCUS_24000 gene ettA 6652 8334 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_24000 9902 8637 gene locus_tag LOCUS_24010 9902 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 12877 10343 gene locus_tag LOCUS_24020 12877 10343 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965877.1 protein_id gnl|my_center|LOCUS_24020 13993 13085 gene locus_tag LOCUS_24030 13993 13085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 14186 14716 gene locus_tag LOCUS_24040 14186 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 15696 14770 gene locus_tag LOCUS_24050 15696 14770 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122336.1 protein_id gnl|my_center|LOCUS_24050 16462 15689 gene locus_tag LOCUS_24060 16462 15689 CDS product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816911.1 protein_id gnl|my_center|LOCUS_24060 17018 17299 gene locus_tag LOCUS_24070 17018 17299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 18095 17367 gene locus_tag LOCUS_24080 18095 17367 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105540.1 protein_id gnl|my_center|LOCUS_24080 19436 18099 gene locus_tag LOCUS_24090 19436 18099 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_24090 19933 19439 gene locus_tag LOCUS_24100 19933 19439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 20791 21495 gene locus_tag LOCUS_24110 20791 21495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 22032 23009 gene locus_tag LOCUS_24120 22032 23009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 23187 26279 gene locus_tag LOCUS_24130 23187 26279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 27698 26895 gene locus_tag LOCUS_24140 27698 26895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 27819 29057 gene locus_tag LOCUS_24150 27819 29057 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921696.1 protein_id gnl|my_center|LOCUS_24150 29227 30498 gene locus_tag LOCUS_24160 29227 30498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 31604 30675 gene locus_tag LOCUS_24170 31604 30675 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326889.1 protein_id gnl|my_center|LOCUS_24170 32011 32313 gene locus_tag LOCUS_24180 32011 32313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 32333 34609 gene locus_tag LOCUS_24190 32333 34609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 34966 35328 gene locus_tag LOCUS_24200 gene raiA 34966 35328 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328917.1 protein_id gnl|my_center|LOCUS_24200 35410 35886 gene locus_tag LOCUS_24210 35410 35886 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_24210 35933 36196 gene locus_tag LOCUS_24220 35933 36196 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094362.1 protein_id gnl|my_center|LOCUS_24220 36289 38031 gene locus_tag LOCUS_24230 gene ptsP 36289 38031 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_24230 38214 38840 gene locus_tag LOCUS_24240 38214 38840 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121928.1 protein_id gnl|my_center|LOCUS_24240 38928 40544 gene locus_tag LOCUS_24250 38928 40544 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_24250 40691 41014 gene locus_tag LOCUS_24260 gene rplU 40691 41014 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325148.1 protein_id gnl|my_center|LOCUS_24260 41001 42395 gene locus_tag LOCUS_24270 41001 42395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 43488 42481 gene locus_tag LOCUS_24280 43488 42481 CDS product bile acid:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881394.1 protein_id gnl|my_center|LOCUS_24280 43659 44981 gene locus_tag LOCUS_24290 gene lpxB 43659 44981 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921562.1 protein_id gnl|my_center|LOCUS_24290 45101 45868 gene locus_tag LOCUS_24300 45101 45868 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_24300 46152 46319 gene locus_tag LOCUS_24310 46152 46319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 47389 46568 gene locus_tag LOCUS_24320 47389 46568 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119258.1 protein_id gnl|my_center|LOCUS_24320 48403 47399 gene locus_tag LOCUS_24330 48403 47399 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_24330 51487 48473 gene locus_tag LOCUS_24340 51487 48473 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922518.1 protein_id gnl|my_center|LOCUS_24340 51835 52254 gene locus_tag LOCUS_24350 51835 52254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 53869 52676 gene locus_tag LOCUS_24360 gene bioF 53869 52676 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_24360 54082 55098 gene locus_tag LOCUS_24370 54082 55098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 55816 55157 gene locus_tag LOCUS_24380 gene fixJ 55816 55157 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_24380 57883 56123 gene locus_tag LOCUS_24390 57883 56123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 58874 58116 gene locus_tag LOCUS_24400 58874 58116 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence036 11054 5691 gene locus_tag LOCUS_24410 11054 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 11779 11555 gene locus_tag LOCUS_24420 11779 11555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 12385 11816 gene locus_tag LOCUS_24430 12385 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 13633 12497 gene locus_tag LOCUS_24440 13633 12497 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120614.1 protein_id gnl|my_center|LOCUS_24440 15240 14074 gene locus_tag LOCUS_24450 15240 14074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 15830 15492 gene locus_tag LOCUS_24460 15830 15492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 15909 17174 gene locus_tag LOCUS_24470 15909 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 17439 17236 gene locus_tag LOCUS_24480 17439 17236 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_24480 17744 17911 gene locus_tag LOCUS_24490 17744 17911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 20021 18396 gene locus_tag LOCUS_24500 20021 18396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 22037 20325 gene locus_tag LOCUS_24510 22037 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 22464 22126 gene locus_tag LOCUS_24520 22464 22126 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_24520 22985 22464 gene locus_tag LOCUS_24530 22985 22464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 23374 24597 gene locus_tag LOCUS_24540 23374 24597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 26100 25054 gene locus_tag LOCUS_24550 26100 25054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 26565 26185 gene locus_tag LOCUS_24560 26565 26185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 27224 26562 gene locus_tag LOCUS_24570 27224 26562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 27622 27221 gene locus_tag LOCUS_24580 27622 27221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 28926 27619 gene locus_tag LOCUS_24590 28926 27619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 29318 29028 gene locus_tag LOCUS_24600 29318 29028 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326741.1 protein_id gnl|my_center|LOCUS_24600 29714 31981 gene locus_tag LOCUS_24610 29714 31981 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123700.1 protein_id gnl|my_center|LOCUS_24610 32136 34508 gene locus_tag LOCUS_24620 32136 34508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 34881 34549 gene locus_tag LOCUS_24630 34881 34549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 35780 35274 gene locus_tag LOCUS_24640 35780 35274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 37038 35986 gene locus_tag LOCUS_24650 37038 35986 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_24650 37585 37902 gene locus_tag LOCUS_24660 37585 37902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24660 37967 38191 gene locus_tag LOCUS_24670 37967 38191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 39792 38302 gene locus_tag LOCUS_24680 39792 38302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 40232 40453 gene locus_tag LOCUS_24690 40232 40453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 40583 42943 gene locus_tag LOCUS_24700 40583 42943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 43057 46329 gene locus_tag LOCUS_24710 43057 46329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 46726 47448 gene locus_tag LOCUS_24720 46726 47448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 48052 47759 gene locus_tag LOCUS_24730 48052 47759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 47961 48851 gene locus_tag LOCUS_24740 47961 48851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 48931 50814 gene locus_tag LOCUS_24750 48931 50814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 50899 51666 gene locus_tag LOCUS_24760 50899 51666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 51702 52826 gene locus_tag LOCUS_24770 51702 52826 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_24770 53642 53424 gene locus_tag LOCUS_24780 53642 53424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 53913 54272 gene locus_tag LOCUS_24790 53913 54272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 54405 55742 gene locus_tag LOCUS_24800 54405 55742 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922914.1 protein_id gnl|my_center|LOCUS_24800 56599 55952 gene locus_tag LOCUS_24810 56599 55952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 57517 56876 gene locus_tag LOCUS_24820 57517 56876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence037 919 188 gene locus_tag LOCUS_24830 919 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 1967 1002 gene locus_tag LOCUS_24840 1967 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2378 3742 gene locus_tag LOCUS_24850 2378 3742 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_24850 4098 4310 gene locus_tag LOCUS_24860 4098 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 4586 5326 gene locus_tag LOCUS_24870 4586 5326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546252.1 protein_id gnl|my_center|LOCUS_24870 5323 7839 gene locus_tag LOCUS_24880 5323 7839 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_24880 8338 9621 gene locus_tag LOCUS_24890 8338 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 9754 11007 gene locus_tag LOCUS_24900 gene glgC 9754 11007 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_24900 11320 11042 gene locus_tag LOCUS_24910 11320 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 11683 12174 gene locus_tag LOCUS_24920 11683 12174 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141597.1 protein_id gnl|my_center|LOCUS_24920 12245 12940 gene locus_tag LOCUS_24930 gene aqpZ 12245 12940 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816768.1 protein_id gnl|my_center|LOCUS_24930 13112 13960 gene locus_tag LOCUS_24940 13112 13960 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_24940 13957 14499 gene locus_tag LOCUS_24950 13957 14499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 14541 15293 gene locus_tag LOCUS_24960 14541 15293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 15357 15653 gene locus_tag LOCUS_24970 15357 15653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24970 17389 15674 gene locus_tag LOCUS_24980 17389 15674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 18001 18771 gene locus_tag LOCUS_24990 18001 18771 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_24990 18776 20572 gene locus_tag LOCUS_25000 18776 20572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 20857 22854 gene locus_tag LOCUS_25010 20857 22854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25010 23206 24462 gene locus_tag LOCUS_25020 23206 24462 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_25020 24474 27464 gene locus_tag LOCUS_25030 24474 27464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 27820 27509 gene locus_tag LOCUS_25040 27820 27509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 28259 27981 gene locus_tag LOCUS_25050 28259 27981 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_25050 28718 29293 gene locus_tag LOCUS_25060 28718 29293 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335404.1 protein_id gnl|my_center|LOCUS_25060 32172 29356 gene locus_tag LOCUS_25070 32172 29356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 34267 32225 gene locus_tag LOCUS_25080 34267 32225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 34430 34209 gene locus_tag LOCUS_25090 34430 34209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 35381 34563 gene locus_tag LOCUS_25100 35381 34563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 36646 35480 gene locus_tag LOCUS_25110 36646 35480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 37065 36727 gene locus_tag LOCUS_25120 37065 36727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 37604 38236 gene locus_tag LOCUS_25130 37604 38236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 38249 38659 gene locus_tag LOCUS_25140 38249 38659 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004595914.1 protein_id gnl|my_center|LOCUS_25140 38861 39520 gene locus_tag LOCUS_25150 38861 39520 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037712.1 protein_id gnl|my_center|LOCUS_25150 40165 41472 gene locus_tag LOCUS_25160 40165 41472 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118102.1 protein_id gnl|my_center|LOCUS_25160 41469 43148 gene locus_tag LOCUS_25170 41469 43148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 43167 44180 gene locus_tag LOCUS_25180 43167 44180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324693.1 protein_id gnl|my_center|LOCUS_25180 45803 44202 gene locus_tag LOCUS_25190 45803 44202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 46032 46955 gene locus_tag LOCUS_25200 46032 46955 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459817.1 protein_id gnl|my_center|LOCUS_25200 47062 47961 gene locus_tag LOCUS_25210 47062 47961 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120934.1 protein_id gnl|my_center|LOCUS_25210 49712 48078 gene locus_tag LOCUS_25220 49712 48078 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_25220 51370 49823 gene locus_tag LOCUS_25230 51370 49823 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922090.1 protein_id gnl|my_center|LOCUS_25230 53888 51381 gene locus_tag LOCUS_25240 53888 51381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109257.1 protein_id gnl|my_center|LOCUS_25240 55543 54221 gene locus_tag LOCUS_25250 55543 54221 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence038 352 951 gene locus_tag LOCUS_25260 352 951 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312796.1 protein_id gnl|my_center|LOCUS_25260 885 1274 gene locus_tag LOCUS_25270 885 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1395 1243 gene locus_tag LOCUS_25280 1395 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 2421 2134 gene locus_tag LOCUS_25290 2421 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 6841 2744 gene locus_tag LOCUS_25300 6841 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 7434 6925 gene locus_tag LOCUS_25310 7434 6925 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337215.1 protein_id gnl|my_center|LOCUS_25310 7670 8989 gene locus_tag LOCUS_25320 7670 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 9068 10096 gene locus_tag LOCUS_25330 9068 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 10373 10119 gene locus_tag LOCUS_25340 10373 10119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 11689 10727 gene locus_tag LOCUS_25350 11689 10727 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_25350 11814 11731 gene locus_tag LOCUS_t00180 11814 11731 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13093 11927 gene locus_tag LOCUS_25360 gene cax 13093 11927 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_25360 13367 14437 gene locus_tag LOCUS_25370 13367 14437 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_25370 16768 15158 gene locus_tag LOCUS_25380 16768 15158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 18150 16765 gene locus_tag LOCUS_25390 18150 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 19305 18424 gene locus_tag LOCUS_25400 19305 18424 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_25400 20368 19481 gene locus_tag LOCUS_25410 gene cysK 20368 19481 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_25410 20890 23322 gene locus_tag LOCUS_25420 20890 23322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 25017 23545 gene locus_tag LOCUS_25430 25017 23545 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_25430 25425 26636 gene locus_tag LOCUS_25440 25425 26636 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_25440 26858 27040 gene locus_tag LOCUS_25450 26858 27040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251833.1 protein_id gnl|my_center|LOCUS_25450 27744 27139 gene locus_tag LOCUS_25460 27744 27139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 28751 27741 gene locus_tag LOCUS_25470 28751 27741 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_25470 29901 28891 gene locus_tag LOCUS_25480 29901 28891 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123514.1 protein_id gnl|my_center|LOCUS_25480 31966 29945 gene locus_tag LOCUS_25490 gene ast 31966 29945 CDS product thermostable cytotonic enterotoxin Ast inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704753.1 protein_id gnl|my_center|LOCUS_25490 32276 32671 gene locus_tag LOCUS_25500 32276 32671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 32728 33483 gene locus_tag LOCUS_25510 32728 33483 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151672826.1 protein_id gnl|my_center|LOCUS_25510 33932 34237 gene locus_tag LOCUS_25520 33932 34237 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_25520 34234 35175 gene locus_tag LOCUS_25530 34234 35175 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_25530 35175 37151 gene locus_tag LOCUS_25540 35175 37151 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615739.1 protein_id gnl|my_center|LOCUS_25540 37145 37960 gene locus_tag LOCUS_25550 37145 37960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 40543 38012 gene locus_tag LOCUS_25560 40543 38012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 41002 40556 gene locus_tag LOCUS_25570 41002 40556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 41444 41013 gene locus_tag LOCUS_25580 41444 41013 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119077.1 protein_id gnl|my_center|LOCUS_25580 42292 41444 gene locus_tag LOCUS_25590 42292 41444 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120828.1 protein_id gnl|my_center|LOCUS_25590 43317 42310 gene locus_tag LOCUS_25600 43317 42310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 44499 43480 gene locus_tag LOCUS_25610 44499 43480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 44628 45140 gene locus_tag LOCUS_25620 44628 45140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 46826 45468 gene locus_tag LOCUS_25630 46826 45468 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_25630 47176 49377 gene locus_tag LOCUS_25640 47176 49377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 51272 49443 gene locus_tag LOCUS_25650 51272 49443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 52949 51771 gene locus_tag LOCUS_25660 52949 51771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 53473 54183 gene locus_tag LOCUS_25670 53473 54183 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384382.1 protein_id gnl|my_center|LOCUS_25670 54176 55342 gene locus_tag LOCUS_25680 54176 55342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence039 1704 409 gene locus_tag LOCUS_25690 1704 409 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164830003.1 protein_id gnl|my_center|LOCUS_25690 3026 1893 gene locus_tag LOCUS_25700 3026 1893 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 protein_id gnl|my_center|LOCUS_25700 4175 3033 gene locus_tag LOCUS_25710 4175 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 5508 4180 gene locus_tag LOCUS_25720 5508 4180 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_25720 6005 5505 gene locus_tag LOCUS_25730 6005 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 7555 6140 gene locus_tag LOCUS_25740 7555 6140 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867854.1 protein_id gnl|my_center|LOCUS_25740 8611 7808 gene locus_tag LOCUS_25750 8611 7808 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_25750 8914 9150 gene locus_tag LOCUS_25760 8914 9150 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_25760 9639 12101 gene locus_tag LOCUS_25770 9639 12101 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985413.1 protein_id gnl|my_center|LOCUS_25770 12098 13246 gene locus_tag LOCUS_25780 12098 13246 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_25780 13478 13627 gene locus_tag LOCUS_25790 13478 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 13675 15510 gene locus_tag LOCUS_25800 13675 15510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 15525 15935 gene locus_tag LOCUS_25810 15525 15935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 15932 16105 gene locus_tag LOCUS_25820 15932 16105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 16137 16373 gene locus_tag LOCUS_25830 16137 16373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 17755 16457 gene locus_tag LOCUS_25840 17755 16457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 19342 17810 gene locus_tag LOCUS_25850 19342 17810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 20137 22287 gene locus_tag LOCUS_25860 20137 22287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 23004 22522 gene locus_tag LOCUS_25870 23004 22522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 23282 23004 gene locus_tag LOCUS_25880 23282 23004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 24742 23414 gene locus_tag LOCUS_25890 24742 23414 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_25890 25092 27770 gene locus_tag LOCUS_25900 25092 27770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 27927 28556 gene locus_tag LOCUS_25910 27927 28556 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_25910 28572 31412 gene locus_tag LOCUS_25920 28572 31412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 31950 31432 gene locus_tag LOCUS_25930 31950 31432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 32116 33060 gene locus_tag LOCUS_25940 32116 33060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 34360 33083 gene locus_tag LOCUS_25950 gene serS 34360 33083 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118185.1 protein_id gnl|my_center|LOCUS_25950 35905 34535 gene locus_tag LOCUS_25960 35905 34535 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_25960 36125 36493 gene locus_tag LOCUS_25970 36125 36493 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329331.1 protein_id gnl|my_center|LOCUS_25970 36503 37771 gene locus_tag LOCUS_25980 gene mtaB 36503 37771 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123590.1 protein_id gnl|my_center|LOCUS_25980 38006 38917 gene locus_tag LOCUS_25990 38006 38917 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434699.1 protein_id gnl|my_center|LOCUS_25990 38939 39328 gene locus_tag LOCUS_26000 38939 39328 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331759.1 protein_id gnl|my_center|LOCUS_26000 39325 40485 gene locus_tag LOCUS_26010 39325 40485 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124103.1 protein_id gnl|my_center|LOCUS_26010 40529 41221 gene locus_tag LOCUS_26020 40529 41221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 41262 41996 gene locus_tag LOCUS_26030 gene lmtA 41262 41996 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_26030 42140 42733 gene locus_tag LOCUS_26040 42140 42733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 44517 42904 gene locus_tag LOCUS_26050 44517 42904 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_26050 45205 44825 gene locus_tag LOCUS_26060 45205 44825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 46205 45252 gene locus_tag LOCUS_26070 46205 45252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 47194 46304 gene locus_tag LOCUS_26080 47194 46304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 48297 47302 gene locus_tag LOCUS_26090 48297 47302 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_26090 49734 49048 gene locus_tag LOCUS_26100 49734 49048 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_26100 51312 49903 gene locus_tag LOCUS_26110 51312 49903 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_26110 52053 53483 gene locus_tag LOCUS_26120 52053 53483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 53480 54622 gene locus_tag LOCUS_26130 53480 54622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 54586 54487 gene locus_tag LOCUS_t00190 54586 54487 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 54822 55475 gene locus_tag LOCUS_26140 54822 55475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence040 178 375 gene locus_tag LOCUS_26150 178 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 461 835 gene locus_tag LOCUS_26160 461 835 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_26160 924 2651 gene locus_tag LOCUS_26170 924 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 2961 3833 gene locus_tag LOCUS_26180 2961 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26180 3837 5735 gene locus_tag LOCUS_26190 3837 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26190 5702 8179 gene locus_tag LOCUS_26200 gene pglZ 5702 8179 CDS product BREX-2 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031062.1 protein_id gnl|my_center|LOCUS_26200 8195 9517 gene locus_tag LOCUS_26210 gene brxD 8195 9517 CDS product BREX system ATP-binding protein BrxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031065.1 protein_id gnl|my_center|LOCUS_26210 9514 11124 gene locus_tag LOCUS_26220 9514 11124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 12141 11173 gene locus_tag LOCUS_26230 gene hemB 12141 11173 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258455.1 protein_id gnl|my_center|LOCUS_26230 14039 12168 gene locus_tag LOCUS_26240 14039 12168 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921424.1 protein_id gnl|my_center|LOCUS_26240 15241 14072 gene locus_tag LOCUS_26250 15241 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 15357 16175 gene locus_tag LOCUS_26260 15357 16175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334335.1 protein_id gnl|my_center|LOCUS_26260 16327 16911 gene locus_tag LOCUS_26270 16327 16911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 17066 19093 gene locus_tag LOCUS_26280 17066 19093 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667550.1 protein_id gnl|my_center|LOCUS_26280 19095 20090 gene locus_tag LOCUS_26290 19095 20090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 20186 20824 gene locus_tag LOCUS_26300 20186 20824 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921755.1 protein_id gnl|my_center|LOCUS_26300 20848 21258 gene locus_tag LOCUS_26310 20848 21258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615996.1 protein_id gnl|my_center|LOCUS_26310 21386 22732 gene locus_tag LOCUS_26320 21386 22732 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_26320 24707 22812 gene locus_tag LOCUS_26330 24707 22812 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_26330 25260 26618 gene locus_tag LOCUS_26340 25260 26618 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_26340 26643 28646 gene locus_tag LOCUS_26350 26643 28646 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_26350 28840 32670 gene locus_tag LOCUS_26360 28840 32670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 32674 33378 gene locus_tag LOCUS_26370 32674 33378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 34023 33466 gene locus_tag LOCUS_26380 34023 33466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 34353 34093 gene locus_tag LOCUS_26390 34353 34093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 34794 34633 gene locus_tag LOCUS_26400 34794 34633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 35012 36085 gene locus_tag LOCUS_26410 gene aguB 35012 36085 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_26410 37614 36151 gene locus_tag LOCUS_26420 37614 36151 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_26420 37979 37611 gene locus_tag LOCUS_26430 37979 37611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 38373 37984 gene locus_tag LOCUS_26440 38373 37984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 39698 38370 gene locus_tag LOCUS_26450 39698 38370 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615609.1 protein_id gnl|my_center|LOCUS_26450 40093 39695 gene locus_tag LOCUS_26460 40093 39695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 40437 41564 gene locus_tag LOCUS_26470 40437 41564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 42104 43717 gene locus_tag LOCUS_26480 42104 43717 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120612.1 protein_id gnl|my_center|LOCUS_26480 43825 44508 gene locus_tag LOCUS_26490 43825 44508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 45766 44525 gene locus_tag LOCUS_26500 45766 44525 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122283.1 protein_id gnl|my_center|LOCUS_26500 46997 45753 gene locus_tag LOCUS_26510 46997 45753 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_26510 47867 47307 gene locus_tag LOCUS_26520 47867 47307 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008654974.1 protein_id gnl|my_center|LOCUS_26520 48978 48013 gene locus_tag LOCUS_26530 48978 48013 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329841.1 protein_id gnl|my_center|LOCUS_26530 49848 49189 gene locus_tag LOCUS_26540 49848 49189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 50389 50003 gene locus_tag LOCUS_26550 50389 50003 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615711.1 protein_id gnl|my_center|LOCUS_26550 51464 50646 gene locus_tag LOCUS_26560 51464 50646 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118627.1 protein_id gnl|my_center|LOCUS_26560 52913 51600 gene locus_tag LOCUS_26570 52913 51600 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_26570 54407 53118 gene locus_tag LOCUS_26580 54407 53118 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_26580 54923 55087 gene locus_tag LOCUS_26590 54923 55087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence041 222 893 gene locus_tag LOCUS_26600 222 893 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814050.1 protein_id gnl|my_center|LOCUS_26600 1179 1448 gene locus_tag LOCUS_26610 1179 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258117.1 protein_id gnl|my_center|LOCUS_26610 2917 1823 gene locus_tag LOCUS_26620 2917 1823 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_26620 5403 2953 gene locus_tag LOCUS_26630 5403 2953 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118530.1 protein_id gnl|my_center|LOCUS_26630 5525 5770 gene locus_tag LOCUS_26640 5525 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 5968 6870 gene locus_tag LOCUS_26650 5968 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 8249 7221 gene locus_tag LOCUS_26660 8249 7221 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_26660 9640 8288 gene locus_tag LOCUS_26670 9640 8288 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_26670 11095 9809 gene locus_tag LOCUS_26680 11095 9809 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_26680 11503 11943 gene locus_tag LOCUS_26690 11503 11943 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729927.1 protein_id gnl|my_center|LOCUS_26690 12389 13249 gene locus_tag LOCUS_26700 12389 13249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 13393 13578 gene locus_tag LOCUS_26710 13393 13578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 14186 13650 gene locus_tag LOCUS_26720 14186 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 17051 14400 gene locus_tag LOCUS_26730 gene clpB 17051 14400 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922205.1 protein_id gnl|my_center|LOCUS_26730 18976 17054 gene locus_tag LOCUS_26740 gene dnaK 18976 17054 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326035.1 protein_id gnl|my_center|LOCUS_26740 19566 20696 gene locus_tag LOCUS_26750 gene pheA 19566 20696 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122147.1 protein_id gnl|my_center|LOCUS_26750 20800 21558 gene locus_tag LOCUS_26760 gene tpiA 20800 21558 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_26760 21590 22000 gene locus_tag LOCUS_26770 21590 22000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 22049 22933 gene locus_tag LOCUS_26780 22049 22933 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615387.1 protein_id gnl|my_center|LOCUS_26780 22930 23529 gene locus_tag LOCUS_26790 gene gmk 22930 23529 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326728.1 protein_id gnl|my_center|LOCUS_26790 23522 23785 gene locus_tag LOCUS_26800 23522 23785 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326729.1 protein_id gnl|my_center|LOCUS_26800 23782 24321 gene locus_tag LOCUS_26810 23782 24321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 24536 25183 gene locus_tag LOCUS_26820 24536 25183 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121990.1 protein_id gnl|my_center|LOCUS_26820 25496 25164 gene locus_tag LOCUS_26830 25496 25164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 25766 26719 gene locus_tag LOCUS_26840 25766 26719 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140504.1 protein_id gnl|my_center|LOCUS_26840 26750 27739 gene locus_tag LOCUS_26850 gene pfkA 26750 27739 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_26850 28485 27925 gene locus_tag LOCUS_26860 gene pduT 28485 27925 CDS product propanediol utilization microcompartment protein PduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030725.1 protein_id gnl|my_center|LOCUS_26860 29838 28507 gene locus_tag LOCUS_26870 29838 28507 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100245.1 protein_id gnl|my_center|LOCUS_26870 31679 30234 gene locus_tag LOCUS_26880 31679 30234 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804122.1 protein_id gnl|my_center|LOCUS_26880 32026 34032 gene locus_tag LOCUS_26890 32026 34032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 34029 35597 gene locus_tag LOCUS_26900 34029 35597 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_26900 38242 35591 gene locus_tag LOCUS_26910 38242 35591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 38468 39106 gene locus_tag LOCUS_26920 38468 39106 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_26920 39325 39528 gene locus_tag LOCUS_26930 39325 39528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 39476 39922 gene locus_tag LOCUS_26940 39476 39922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 41446 39953 gene locus_tag LOCUS_26950 41446 39953 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615986.1 protein_id gnl|my_center|LOCUS_26950 43013 41448 gene locus_tag LOCUS_26960 43013 41448 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 protein_id gnl|my_center|LOCUS_26960 44162 43020 gene locus_tag LOCUS_26970 44162 43020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939755.1 protein_id gnl|my_center|LOCUS_26970 45550 44162 gene locus_tag LOCUS_26980 45550 44162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 46416 46165 gene locus_tag LOCUS_26990 46416 46165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 46630 47862 gene locus_tag LOCUS_27000 46630 47862 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922545.1 protein_id gnl|my_center|LOCUS_27000 48502 47837 gene locus_tag LOCUS_27010 48502 47837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 49999 48554 gene locus_tag LOCUS_27020 49999 48554 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_27020 52333 50027 gene locus_tag LOCUS_27030 52333 50027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 <53805 52474 gene locus_tag LOCUS_27040 <53805 52474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335517.1:DUF1501 domain-containing protein >Feature sequence042 711 235 gene locus_tag LOCUS_27050 711 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1835 813 gene locus_tag LOCUS_27060 1835 813 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_27060 2156 2578 gene locus_tag LOCUS_27070 2156 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27070 2852 3223 gene locus_tag LOCUS_27080 2852 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 5775 3859 gene locus_tag LOCUS_27090 5775 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 6227 7099 gene locus_tag LOCUS_27100 6227 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 7341 7183 gene locus_tag LOCUS_27110 7341 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 7870 7673 gene locus_tag LOCUS_27120 gene csrA 7870 7673 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_27120 8477 8941 gene locus_tag LOCUS_27130 8477 8941 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_27130 9471 8980 gene locus_tag LOCUS_27140 9471 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 9845 11773 gene locus_tag LOCUS_27150 9845 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 12793 12065 gene locus_tag LOCUS_27160 12793 12065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 13481 14881 gene locus_tag LOCUS_27170 13481 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 15737 14868 gene locus_tag LOCUS_27180 15737 14868 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_27180 17311 15776 gene locus_tag LOCUS_27190 17311 15776 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727913.1 protein_id gnl|my_center|LOCUS_27190 18467 17313 gene locus_tag LOCUS_27200 18467 17313 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_27200 18873 21056 gene locus_tag LOCUS_27210 18873 21056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 23551 21521 gene locus_tag LOCUS_27220 23551 21521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 23829 23560 gene locus_tag LOCUS_27230 23829 23560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 24296 26131 gene locus_tag LOCUS_27240 24296 26131 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260568.1 protein_id gnl|my_center|LOCUS_27240 26517 27671 gene locus_tag LOCUS_27250 26517 27671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 29038 27740 gene locus_tag LOCUS_27260 29038 27740 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_27260 30461 29424 gene locus_tag LOCUS_27270 30461 29424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 30680 31378 gene locus_tag LOCUS_27280 30680 31378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 31394 32590 gene locus_tag LOCUS_27290 31394 32590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 35506 33338 gene locus_tag LOCUS_27300 35506 33338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 36775 35537 gene locus_tag LOCUS_27310 36775 35537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 37215 40841 gene locus_tag LOCUS_27320 37215 40841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 41313 40996 gene locus_tag LOCUS_27330 41313 40996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 42149 43555 gene locus_tag LOCUS_27340 42149 43555 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_27340 43687 44907 gene locus_tag LOCUS_27350 43687 44907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 46768 44840 gene locus_tag LOCUS_27360 46768 44840 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_27360 49584 46795 gene locus_tag LOCUS_27370 49584 46795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 51960 49621 gene locus_tag LOCUS_27380 51960 49621 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_27380 53250 51988 gene locus_tag LOCUS_27390 53250 51988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 >Feature sequence043 1858 470 gene locus_tag LOCUS_27400 gene leuC 1858 470 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_27400 3656 2016 gene locus_tag LOCUS_27410 3656 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 4261 4482 gene locus_tag LOCUS_27420 4261 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 5140 4691 gene locus_tag LOCUS_27430 5140 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 6798 5551 gene locus_tag LOCUS_27440 6798 5551 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_27440 7084 7443 gene locus_tag LOCUS_27450 7084 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 7968 7471 gene locus_tag LOCUS_27460 7968 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 8272 8096 gene locus_tag LOCUS_27470 8272 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 8564 9544 gene locus_tag LOCUS_27480 gene queG 8564 9544 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_27480 10755 9649 gene locus_tag LOCUS_27490 10755 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 11417 10848 gene locus_tag LOCUS_27500 11417 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 15388 11942 gene locus_tag LOCUS_27510 15388 11942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109257.1 protein_id gnl|my_center|LOCUS_27510 16965 15430 gene locus_tag LOCUS_27520 16965 15430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_27520 19350 17269 gene locus_tag LOCUS_27530 19350 17269 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_27530 21503 19515 gene locus_tag LOCUS_27540 21503 19515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 23893 21632 gene locus_tag LOCUS_27550 23893 21632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 28162 24071 gene locus_tag LOCUS_27560 28162 24071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 28435 28220 gene locus_tag LOCUS_27570 28435 28220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 28664 31075 gene locus_tag LOCUS_27580 28664 31075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 31767 31468 gene locus_tag LOCUS_27590 31767 31468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 33115 32813 gene locus_tag LOCUS_27600 33115 32813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 33334 33615 gene locus_tag LOCUS_27610 33334 33615 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_27610 33625 33930 gene locus_tag LOCUS_27620 33625 33930 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_27620 35223 34105 gene locus_tag LOCUS_27630 35223 34105 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005392234.1 protein_id gnl|my_center|LOCUS_27630 36437 35388 gene locus_tag LOCUS_27640 36437 35388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 37306 36434 gene locus_tag LOCUS_27650 gene fba 37306 36434 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_27650 38161 37400 gene locus_tag LOCUS_27660 gene fabG 38161 37400 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_27660 38603 39364 gene locus_tag LOCUS_27670 gene fabG 38603 39364 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881113.1 protein_id gnl|my_center|LOCUS_27670 39398 40945 gene locus_tag LOCUS_27680 gene xylB 39398 40945 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_27680 40942 41961 gene locus_tag LOCUS_27690 40942 41961 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_27690 42040 43845 gene locus_tag LOCUS_27700 42040 43845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 43742 45355 gene locus_tag LOCUS_27710 43742 45355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 45577 47208 gene locus_tag LOCUS_27720 45577 47208 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_27720 47404 48678 gene locus_tag LOCUS_27730 47404 48678 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_27730 48697 50178 gene locus_tag LOCUS_27740 48697 50178 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_27740 50317 51624 gene locus_tag LOCUS_27750 50317 51624 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_27750 52039 51716 gene locus_tag LOCUS_27760 52039 51716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 52379 53416 gene locus_tag LOCUS_27770 52379 53416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 >Feature sequence044 75 431 gene locus_tag LOCUS_27780 75 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 1008 1499 gene locus_tag LOCUS_27790 1008 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 1528 2400 gene locus_tag LOCUS_27800 1528 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2410 2796 gene locus_tag LOCUS_27810 2410 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2805 4265 gene locus_tag LOCUS_27820 2805 4265 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261223.1 protein_id gnl|my_center|LOCUS_27820 4456 6399 gene locus_tag LOCUS_27830 4456 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 9189 6490 gene locus_tag LOCUS_27840 9189 6490 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057097.1 protein_id gnl|my_center|LOCUS_27840 9558 12245 gene locus_tag LOCUS_27850 9558 12245 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_27850 12473 13576 gene locus_tag LOCUS_27860 12473 13576 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922549.1 protein_id gnl|my_center|LOCUS_27860 14149 15180 gene locus_tag LOCUS_27870 14149 15180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 15464 16006 gene locus_tag LOCUS_27880 15464 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 16785 16123 gene locus_tag LOCUS_27890 16785 16123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 17327 16761 gene locus_tag LOCUS_27900 17327 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 17570 17385 gene locus_tag LOCUS_27910 17570 17385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 19629 17695 gene locus_tag LOCUS_27920 19629 17695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 21136 20054 gene locus_tag LOCUS_27930 21136 20054 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921437.1 protein_id gnl|my_center|LOCUS_27930 21453 21268 gene locus_tag LOCUS_27940 21453 21268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 21890 22681 gene locus_tag LOCUS_27950 21890 22681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 23501 22743 gene locus_tag LOCUS_27960 23501 22743 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326459.1 protein_id gnl|my_center|LOCUS_27960 24280 23504 gene locus_tag LOCUS_27970 24280 23504 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326458.1 protein_id gnl|my_center|LOCUS_27970 24613 24284 gene locus_tag LOCUS_27980 24613 24284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 27104 24633 gene locus_tag LOCUS_27990 27104 24633 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324400.1 protein_id gnl|my_center|LOCUS_27990 27582 27148 gene locus_tag LOCUS_28000 27582 27148 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324399.1 protein_id gnl|my_center|LOCUS_28000 29276 27615 gene locus_tag LOCUS_28010 29276 27615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 29981 29286 gene locus_tag LOCUS_28020 29981 29286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 30430 29978 gene locus_tag LOCUS_28030 30430 29978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 31809 30448 gene locus_tag LOCUS_28040 gene fliI 31809 30448 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_28040 32668 32015 gene locus_tag LOCUS_28050 32668 32015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 33732 32701 gene locus_tag LOCUS_28060 gene fliG 33732 32701 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326344.1 protein_id gnl|my_center|LOCUS_28060 35394 33739 gene locus_tag LOCUS_28070 gene fliF 35394 33739 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140005.1 protein_id gnl|my_center|LOCUS_28070 35744 35442 gene locus_tag LOCUS_28080 35744 35442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 36163 35744 gene locus_tag LOCUS_28090 gene flgC 36163 35744 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442696.1 protein_id gnl|my_center|LOCUS_28090 36632 36219 gene locus_tag LOCUS_28100 36632 36219 CDS product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922066.1 protein_id gnl|my_center|LOCUS_28100 38408 36987 gene locus_tag LOCUS_28110 gene zraR 38408 36987 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368806.1 protein_id gnl|my_center|LOCUS_28110 39250 38405 gene locus_tag LOCUS_28120 39250 38405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 39706 39254 gene locus_tag LOCUS_28130 39706 39254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 42223 39758 gene locus_tag LOCUS_28140 42223 39758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120034.1 protein_id gnl|my_center|LOCUS_28140 43198 42560 gene locus_tag LOCUS_28150 43198 42560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 44538 43588 gene locus_tag LOCUS_28160 gene mdh 44538 43588 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_28160 45959 44643 gene locus_tag LOCUS_28170 45959 44643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 46975 46013 gene locus_tag LOCUS_28180 46975 46013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 47232 48446 gene locus_tag LOCUS_28190 47232 48446 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326489.1 protein_id gnl|my_center|LOCUS_28190 48726 49181 gene locus_tag LOCUS_28200 48726 49181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence045 692 429 gene locus_tag LOCUS_28210 692 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 2197 908 gene locus_tag LOCUS_28220 2197 908 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119461.1 protein_id gnl|my_center|LOCUS_28220 2458 5259 gene locus_tag LOCUS_28230 2458 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 5272 6267 gene locus_tag LOCUS_28240 5272 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 6309 8273 gene locus_tag LOCUS_28250 6309 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 8987 8280 gene locus_tag LOCUS_28260 8987 8280 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120859.1 protein_id gnl|my_center|LOCUS_28260 9675 9067 gene locus_tag LOCUS_28270 9675 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 12115 10040 gene locus_tag LOCUS_28280 gene tkt 12115 10040 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_28280 12946 12359 gene locus_tag LOCUS_28290 12946 12359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 13347 16772 gene locus_tag LOCUS_28300 13347 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 16804 17703 gene locus_tag LOCUS_28310 16804 17703 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816586.1 protein_id gnl|my_center|LOCUS_28310 17960 18976 gene locus_tag LOCUS_28320 17960 18976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 19041 19343 gene locus_tag LOCUS_28330 19041 19343 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080895.1 protein_id gnl|my_center|LOCUS_28330 19526 20923 gene locus_tag LOCUS_28340 19526 20923 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_28340 20920 21534 gene locus_tag LOCUS_28350 20920 21534 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_28350 21656 22690 gene locus_tag LOCUS_28360 21656 22690 CDS product bifunctional ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258219.1 protein_id gnl|my_center|LOCUS_28360 25102 22799 gene locus_tag LOCUS_28370 25102 22799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227787.1 protein_id gnl|my_center|LOCUS_28370 25694 25233 gene locus_tag LOCUS_28380 gene ndk 25694 25233 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123449.1 protein_id gnl|my_center|LOCUS_28380 26083 27054 gene locus_tag LOCUS_28390 26083 27054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 29194 27107 gene locus_tag LOCUS_28400 gene recG 29194 27107 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921377.1 protein_id gnl|my_center|LOCUS_28400 29672 29199 gene locus_tag LOCUS_28410 gene rnhA 29672 29199 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326294.1 protein_id gnl|my_center|LOCUS_28410 30122 29772 gene locus_tag LOCUS_28420 30122 29772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 30469 30119 gene locus_tag LOCUS_28430 30469 30119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 33311 30579 gene locus_tag LOCUS_28440 33311 30579 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_28440 34783 33869 gene locus_tag LOCUS_28450 34783 33869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 37083 35023 gene locus_tag LOCUS_28460 37083 35023 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_28460 37311 38405 gene locus_tag LOCUS_28470 37311 38405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 40249 38432 gene locus_tag LOCUS_28480 40249 38432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 41239 40262 gene locus_tag LOCUS_28490 41239 40262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 43200 41617 gene locus_tag LOCUS_28500 43200 41617 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_28500 44091 43216 gene locus_tag LOCUS_28510 44091 43216 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_28510 47093 44142 gene locus_tag LOCUS_28520 47093 44142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 47968 47090 gene locus_tag LOCUS_28530 47968 47090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 48915 52004 gene locus_tag LOCUS_28540 48915 52004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence046 142 546 gene locus_tag LOCUS_28550 142 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 555 875 gene locus_tag LOCUS_28560 555 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 1602 1889 gene locus_tag LOCUS_28570 1602 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2412 2729 gene locus_tag LOCUS_28580 2412 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 2797 4131 gene locus_tag LOCUS_28590 gene zraS 2797 4131 CDS product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704019.1 protein_id gnl|my_center|LOCUS_28590 4124 5449 gene locus_tag LOCUS_28600 4124 5449 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146518596.1 protein_id gnl|my_center|LOCUS_28600 5612 6658 gene locus_tag LOCUS_28610 5612 6658 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120566.1 protein_id gnl|my_center|LOCUS_28610 6864 8807 gene locus_tag LOCUS_28620 6864 8807 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122938.1 protein_id gnl|my_center|LOCUS_28620 9092 12448 gene locus_tag LOCUS_28630 9092 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 13096 12506 gene locus_tag LOCUS_28640 13096 12506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 14602 14177 gene locus_tag LOCUS_28650 14602 14177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 15889 14801 gene locus_tag LOCUS_28660 15889 14801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 17104 15932 gene locus_tag LOCUS_28670 17104 15932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 17307 20027 gene locus_tag LOCUS_28680 17307 20027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 20154 23675 gene locus_tag LOCUS_28690 20154 23675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 23947 23606 gene locus_tag LOCUS_28700 23947 23606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 25594 24119 gene locus_tag LOCUS_28710 25594 24119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 26192 25596 gene locus_tag LOCUS_28720 26192 25596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 26892 26275 gene locus_tag LOCUS_28730 26892 26275 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_28730 27278 27907 gene locus_tag LOCUS_28740 27278 27907 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532428.1 protein_id gnl|my_center|LOCUS_28740 27969 29618 gene locus_tag LOCUS_28750 27969 29618 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941861.1 protein_id gnl|my_center|LOCUS_28750 29811 30080 gene locus_tag LOCUS_28760 29811 30080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 32705 30087 gene locus_tag LOCUS_28770 32705 30087 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921616.1 protein_id gnl|my_center|LOCUS_28770 33438 32917 gene locus_tag LOCUS_28780 33438 32917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 33943 33668 gene locus_tag LOCUS_28790 33943 33668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 34465 34262 gene locus_tag LOCUS_28800 34465 34262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 35379 34513 gene locus_tag LOCUS_28810 35379 34513 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921844.1 protein_id gnl|my_center|LOCUS_28810 35685 35476 gene locus_tag LOCUS_28820 35685 35476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 35575 35805 gene locus_tag LOCUS_28830 35575 35805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 38507 36102 gene locus_tag LOCUS_28840 38507 36102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 38674 41361 gene locus_tag LOCUS_28850 38674 41361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 41571 42635 gene locus_tag LOCUS_28860 41571 42635 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212337777.1 protein_id gnl|my_center|LOCUS_28860 42777 43022 gene locus_tag LOCUS_28870 42777 43022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 45941 43083 gene locus_tag LOCUS_28880 45941 43083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 46328 48055 gene locus_tag LOCUS_28890 46328 48055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 48179 48796 gene locus_tag LOCUS_28900 48179 48796 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_28900 49107 52541 gene locus_tag LOCUS_28910 49107 52541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence047 361 618 gene locus_tag LOCUS_28920 361 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 673 930 gene locus_tag LOCUS_28930 673 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 978 1400 gene locus_tag LOCUS_28940 978 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 2829 1468 gene locus_tag LOCUS_28950 2829 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 3389 2877 gene locus_tag LOCUS_28960 3389 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761769.1 protein_id gnl|my_center|LOCUS_28960 3770 4477 gene locus_tag LOCUS_28970 3770 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 4505 5395 gene locus_tag LOCUS_28980 4505 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 5613 6602 gene locus_tag LOCUS_28990 5613 6602 CDS product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615923.1 protein_id gnl|my_center|LOCUS_28990 7276 6614 gene locus_tag LOCUS_29000 7276 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 7563 8771 gene locus_tag LOCUS_29010 7563 8771 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_29010 8851 9558 gene locus_tag LOCUS_29020 8851 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 9566 9985 gene locus_tag LOCUS_29030 9566 9985 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771057.1 protein_id gnl|my_center|LOCUS_29030 9966 11870 gene locus_tag LOCUS_29040 9966 11870 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_29040 12276 13286 gene locus_tag LOCUS_29050 12276 13286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 13287 14630 gene locus_tag LOCUS_29060 13287 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 15115 14849 gene locus_tag LOCUS_29070 15115 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 15671 15231 gene locus_tag LOCUS_29080 15671 15231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 17261 15681 gene locus_tag LOCUS_29090 gene nuoN 17261 15681 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531102.1 protein_id gnl|my_center|LOCUS_29090 19069 17258 gene locus_tag LOCUS_29100 19069 17258 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_29100 21497 19083 gene locus_tag LOCUS_29110 gene nuoL 21497 19083 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531100.1 protein_id gnl|my_center|LOCUS_29110 21847 21497 gene locus_tag LOCUS_29120 gene nuoK 21847 21497 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_29120 22498 21851 gene locus_tag LOCUS_29130 22498 21851 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785044.1 protein_id gnl|my_center|LOCUS_29130 23676 22501 gene locus_tag LOCUS_29140 gene nuoH 23676 22501 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_29140 24932 23724 gene locus_tag LOCUS_29150 24932 23724 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_29150 25467 24937 gene locus_tag LOCUS_29160 25467 24937 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_29160 26111 25467 gene locus_tag LOCUS_29170 26111 25467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 26467 27762 gene locus_tag LOCUS_29180 26467 27762 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_29180 27764 28720 gene locus_tag LOCUS_29190 gene hpnK 27764 28720 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_29190 29816 29391 gene locus_tag LOCUS_29200 29816 29391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 30965 29904 gene locus_tag LOCUS_29210 30965 29904 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_29210 31511 32116 gene locus_tag LOCUS_29220 31511 32116 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_29220 32938 32324 gene locus_tag LOCUS_29230 32938 32324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 38265 33241 gene locus_tag LOCUS_29240 38265 33241 CDS product SdrD B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922226.1 protein_id gnl|my_center|LOCUS_29240 39448 38426 gene locus_tag LOCUS_29250 39448 38426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 39737 40354 gene locus_tag LOCUS_29260 39737 40354 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329801.1 protein_id gnl|my_center|LOCUS_29260 40559 41197 gene locus_tag LOCUS_29270 40559 41197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 41194 42024 gene locus_tag LOCUS_29280 gene sufC 41194 42024 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329802.1 protein_id gnl|my_center|LOCUS_29280 42055 43473 gene locus_tag LOCUS_29290 gene sufB 42055 43473 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_29290 43553 44866 gene locus_tag LOCUS_29300 gene sufD 43553 44866 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_29300 44868 45185 gene locus_tag LOCUS_29310 44868 45185 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173865.1 protein_id gnl|my_center|LOCUS_29310 45297 45614 gene locus_tag LOCUS_29320 45297 45614 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326213.1 protein_id gnl|my_center|LOCUS_29320 45865 45707 gene locus_tag LOCUS_29330 45865 45707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 48021 46144 gene locus_tag LOCUS_29340 gene mutL 48021 46144 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121618.1 protein_id gnl|my_center|LOCUS_29340 49429 48023 gene locus_tag LOCUS_29350 49429 48023 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_29350 49751 50242 gene locus_tag LOCUS_29360 49751 50242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 50361 51602 gene locus_tag LOCUS_29370 50361 51602 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436698.1 protein_id gnl|my_center|LOCUS_29370 >Feature sequence048 3998 1743 gene locus_tag LOCUS_29380 3998 1743 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922366.1 protein_id gnl|my_center|LOCUS_29380 4191 5039 gene locus_tag LOCUS_29390 gene lpxA 4191 5039 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565963.1 protein_id gnl|my_center|LOCUS_29390 6608 5151 gene locus_tag LOCUS_29400 6608 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 8201 6897 gene locus_tag LOCUS_29410 8201 6897 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118167.1 protein_id gnl|my_center|LOCUS_29410 9432 8398 gene locus_tag LOCUS_29420 gene epmB 9432 8398 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118269.1 protein_id gnl|my_center|LOCUS_29420 9498 10067 gene locus_tag LOCUS_29430 gene efp 9498 10067 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814655.1 protein_id gnl|my_center|LOCUS_29430 10203 11195 gene locus_tag LOCUS_29440 gene epmA 10203 11195 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175550.1 protein_id gnl|my_center|LOCUS_29440 11230 11691 gene locus_tag LOCUS_29450 gene tadA 11230 11691 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325362.1 protein_id gnl|my_center|LOCUS_29450 11825 13189 gene locus_tag LOCUS_29460 11825 13189 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_29460 14530 13298 gene locus_tag LOCUS_29470 14530 13298 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121115.1 protein_id gnl|my_center|LOCUS_29470 14701 16551 gene locus_tag LOCUS_29480 14701 16551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 16641 18047 gene locus_tag LOCUS_29490 16641 18047 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_29490 19277 18054 gene locus_tag LOCUS_29500 19277 18054 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_29500 19583 19834 gene locus_tag LOCUS_29510 19583 19834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 22457 20187 gene locus_tag LOCUS_29520 22457 20187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 23343 22474 gene locus_tag LOCUS_29530 23343 22474 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799517.1 protein_id gnl|my_center|LOCUS_29530 23756 24790 gene locus_tag LOCUS_29540 23756 24790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 24825 26195 gene locus_tag LOCUS_29550 gene xylE 24825 26195 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_29550 27107 27502 gene locus_tag LOCUS_29560 27107 27502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 28526 27705 gene locus_tag LOCUS_29570 28526 27705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 29216 28800 gene locus_tag LOCUS_29580 29216 28800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 29434 29213 gene locus_tag LOCUS_29590 29434 29213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 29924 30820 gene locus_tag LOCUS_29600 29924 30820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 32035 30842 gene locus_tag LOCUS_29610 32035 30842 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200876.1 protein_id gnl|my_center|LOCUS_29610 32496 32170 gene locus_tag LOCUS_29620 32496 32170 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266256.1 protein_id gnl|my_center|LOCUS_29620 32923 32528 gene locus_tag LOCUS_29630 32923 32528 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813571.1 protein_id gnl|my_center|LOCUS_29630 33398 35764 gene locus_tag LOCUS_29640 33398 35764 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_29640 37571 36210 gene locus_tag LOCUS_29650 37571 36210 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337813.1 protein_id gnl|my_center|LOCUS_29650 39726 37639 gene locus_tag LOCUS_29660 39726 37639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 40539 39736 gene locus_tag LOCUS_29670 40539 39736 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_29670 41749 42558 gene locus_tag LOCUS_29680 41749 42558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 42835 43026 gene locus_tag LOCUS_29690 42835 43026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 43048 44586 gene locus_tag LOCUS_29700 43048 44586 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261775.1 protein_id gnl|my_center|LOCUS_29700 44862 47513 gene locus_tag LOCUS_29710 44862 47513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 47510 49867 gene locus_tag LOCUS_29720 47510 49867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 49879 50109 gene locus_tag LOCUS_29730 49879 50109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 50794 50315 gene locus_tag LOCUS_29740 50794 50315 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 protein_id gnl|my_center|LOCUS_29740 <51589 50799 gene locus_tag LOCUS_29750 <51589 50799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004079927.1:aldo/keto reductase >Feature sequence049 173 3163 gene locus_tag LOCUS_29760 173 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 3193 4500 gene locus_tag LOCUS_29770 3193 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 5422 4487 gene locus_tag LOCUS_29780 5422 4487 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816586.1 protein_id gnl|my_center|LOCUS_29780 5815 6843 gene locus_tag LOCUS_29790 gene pheS 5815 6843 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_29790 6901 9303 gene locus_tag LOCUS_29800 gene pheT 6901 9303 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475969.1 protein_id gnl|my_center|LOCUS_29800 10301 9411 gene locus_tag LOCUS_29810 10301 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 12917 10827 gene locus_tag LOCUS_29820 12917 10827 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669835.1 protein_id gnl|my_center|LOCUS_29820 13590 13162 gene locus_tag LOCUS_29830 13590 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 13860 14801 gene locus_tag LOCUS_29840 13860 14801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 14817 16331 gene locus_tag LOCUS_29850 14817 16331 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615426.1 protein_id gnl|my_center|LOCUS_29850 16608 17762 gene locus_tag LOCUS_29860 16608 17762 CDS product DUF1570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665225.1 protein_id gnl|my_center|LOCUS_29860 17960 19270 gene locus_tag LOCUS_29870 17960 19270 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_29870 22733 19557 gene locus_tag LOCUS_29880 22733 19557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 26698 23276 gene locus_tag LOCUS_29890 26698 23276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 28242 26869 gene locus_tag LOCUS_29900 28242 26869 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_29900 28711 29997 gene locus_tag LOCUS_29910 28711 29997 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_29910 30105 30854 gene locus_tag LOCUS_29920 30105 30854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 31275 31616 gene locus_tag LOCUS_29930 31275 31616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 31771 32073 gene locus_tag LOCUS_29940 31771 32073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 34064 32451 gene locus_tag LOCUS_29950 34064 32451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615582.1 protein_id gnl|my_center|LOCUS_29950 34190 35173 gene locus_tag LOCUS_29960 34190 35173 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833899.1 protein_id gnl|my_center|LOCUS_29960 35178 35540 gene locus_tag LOCUS_29970 35178 35540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 35537 35785 gene locus_tag LOCUS_29980 gene yidD 35537 35785 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112905182.1 protein_id gnl|my_center|LOCUS_29980 36219 36416 gene locus_tag LOCUS_29990 36219 36416 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_29990 36917 36615 gene locus_tag LOCUS_30000 36917 36615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 37161 38912 gene locus_tag LOCUS_30010 37161 38912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 40819 39029 gene locus_tag LOCUS_30020 gene ilvB 40819 39029 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_30020 42078 41059 gene locus_tag LOCUS_30030 42078 41059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 43725 42358 gene locus_tag LOCUS_30040 43725 42358 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_30040 44151 46295 gene locus_tag LOCUS_30050 44151 46295 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839420.1 protein_id gnl|my_center|LOCUS_30050 46292 47608 gene locus_tag LOCUS_30060 46292 47608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 47805 49853 gene locus_tag LOCUS_30070 47805 49853 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532458.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence050 2400 85 gene locus_tag LOCUS_30080 2400 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 6051 2404 gene locus_tag LOCUS_30090 gene brxC 6051 2404 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942753.1 protein_id gnl|my_center|LOCUS_30090 6648 6067 gene locus_tag LOCUS_30100 6648 6067 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930436.1 protein_id gnl|my_center|LOCUS_30100 7450 6623 gene locus_tag LOCUS_30110 7450 6623 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858941.1 protein_id gnl|my_center|LOCUS_30110 7655 7443 gene locus_tag LOCUS_30120 7655 7443 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_30120 9110 7947 gene locus_tag LOCUS_30130 9110 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 9555 9124 gene locus_tag LOCUS_30140 9555 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 10383 9565 gene locus_tag LOCUS_30150 10383 9565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 11199 10387 gene locus_tag LOCUS_30160 11199 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 13256 11208 gene locus_tag LOCUS_30170 13256 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 14741 14346 gene locus_tag LOCUS_30180 14741 14346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 14980 14741 gene locus_tag LOCUS_30190 14980 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 15480 15001 gene locus_tag LOCUS_30200 15480 15001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 16094 15483 gene locus_tag LOCUS_30210 16094 15483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 16527 16096 gene locus_tag LOCUS_30220 16527 16096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 16981 16541 gene locus_tag LOCUS_30230 16981 16541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 17403 16978 gene locus_tag LOCUS_30240 17403 16978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 17750 17403 gene locus_tag LOCUS_30250 17750 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 18601 17759 gene locus_tag LOCUS_30260 18601 17759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 18984 18610 gene locus_tag LOCUS_30270 18984 18610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 19210 18974 gene locus_tag LOCUS_30280 19210 18974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 19590 19207 gene locus_tag LOCUS_30290 19590 19207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 19938 19594 gene locus_tag LOCUS_30300 19938 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 22101 19966 gene locus_tag LOCUS_30310 22101 19966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 23569 22073 gene locus_tag LOCUS_30320 23569 22073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 23955 23656 gene locus_tag LOCUS_30330 23955 23656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 24254 24060 gene locus_tag LOCUS_30340 24254 24060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 24387 24316 gene locus_tag LOCUS_t00200 24387 24316 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 25544 24621 gene locus_tag LOCUS_30350 25544 24621 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_30350 26110 25541 gene locus_tag LOCUS_30360 26110 25541 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312796.1 protein_id gnl|my_center|LOCUS_30360 26402 26217 gene locus_tag LOCUS_30370 26402 26217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 28675 26399 gene locus_tag LOCUS_30380 28675 26399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 28892 28665 gene locus_tag LOCUS_30390 28892 28665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 29130 30077 gene locus_tag LOCUS_30400 29130 30077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 30077 30265 gene locus_tag LOCUS_30410 30077 30265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 30240 30617 gene locus_tag LOCUS_30420 30240 30617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 32125 30620 gene locus_tag LOCUS_30430 32125 30620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 34476 32617 gene locus_tag LOCUS_30440 34476 32617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 36146 34473 gene locus_tag LOCUS_30450 36146 34473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 36506 36147 gene locus_tag LOCUS_30460 36506 36147 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904112.1 protein_id gnl|my_center|LOCUS_30460 36967 36512 gene locus_tag LOCUS_30470 36967 36512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 37765 36971 gene locus_tag LOCUS_30480 37765 36971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 38829 37882 gene locus_tag LOCUS_30490 38829 37882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 39122 38811 gene locus_tag LOCUS_30500 39122 38811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 39748 39194 gene locus_tag LOCUS_30510 39748 39194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 40278 39946 gene locus_tag LOCUS_30520 40278 39946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 40676 41332 gene locus_tag LOCUS_30530 gene lexA 40676 41332 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_30530 41333 42529 gene locus_tag LOCUS_30540 41333 42529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 42498 43544 gene locus_tag LOCUS_30550 42498 43544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 44655 44212 gene locus_tag LOCUS_30560 44655 44212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 45091 47004 gene locus_tag LOCUS_30570 45091 47004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 47425 46946 gene locus_tag LOCUS_30580 47425 46946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 49014 47410 gene locus_tag LOCUS_30590 49014 47410 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186602.1 protein_id gnl|my_center|LOCUS_30590 49514 49011 gene locus_tag LOCUS_30600 49514 49011 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870236.1 protein_id gnl|my_center|LOCUS_30600 50015 49515 gene locus_tag LOCUS_30610 50015 49515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 50221 50150 gene locus_tag LOCUS_t00210 50221 50150 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence051 1680 328 gene locus_tag LOCUS_30620 1680 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3322 1730 gene locus_tag LOCUS_30630 3322 1730 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_30630 3557 3327 gene locus_tag LOCUS_30640 3557 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 5043 3607 gene locus_tag LOCUS_30650 5043 3607 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_30650 6149 5043 gene locus_tag LOCUS_30660 6149 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_30660 7633 6146 gene locus_tag LOCUS_30670 7633 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 9810 7630 gene locus_tag LOCUS_30680 9810 7630 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615857.1 protein_id gnl|my_center|LOCUS_30680 11422 10124 gene locus_tag LOCUS_30690 11422 10124 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_30690 11961 11419 gene locus_tag LOCUS_30700 11961 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 12377 11958 gene locus_tag LOCUS_30710 12377 11958 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_30710 13756 12482 gene locus_tag LOCUS_30720 13756 12482 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_30720 14355 13774 gene locus_tag LOCUS_30730 14355 13774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 15704 14367 gene locus_tag LOCUS_30740 15704 14367 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_30740 16535 15717 gene locus_tag LOCUS_30750 16535 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 16623 16868 gene locus_tag LOCUS_30760 16623 16868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 18020 17634 gene locus_tag LOCUS_30770 18020 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 18269 19573 gene locus_tag LOCUS_30780 18269 19573 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922459.1 protein_id gnl|my_center|LOCUS_30780 21618 19585 gene locus_tag LOCUS_30790 21618 19585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 22455 21625 gene locus_tag LOCUS_30800 22455 21625 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120018.1 protein_id gnl|my_center|LOCUS_30800 22660 22460 gene locus_tag LOCUS_30810 gene thiS 22660 22460 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_30810 24216 22747 gene locus_tag LOCUS_30820 24216 22747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 24592 26925 gene locus_tag LOCUS_30830 24592 26925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 27229 26948 gene locus_tag LOCUS_30840 27229 26948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 27670 27353 gene locus_tag LOCUS_30850 27670 27353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 28922 27942 gene locus_tag LOCUS_30860 gene fba 28922 27942 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_30860 29330 31408 gene locus_tag LOCUS_30870 29330 31408 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334672.1 protein_id gnl|my_center|LOCUS_30870 31476 31958 gene locus_tag LOCUS_30880 gene ybaK 31476 31958 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868926.1 protein_id gnl|my_center|LOCUS_30880 32287 33564 gene locus_tag LOCUS_30890 32287 33564 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_30890 33614 35599 gene locus_tag LOCUS_30900 33614 35599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 38592 35878 gene locus_tag LOCUS_30910 gene ppdK 38592 35878 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_30910 40645 38765 gene locus_tag LOCUS_30920 40645 38765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 41493 41245 gene locus_tag LOCUS_30930 41493 41245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 41392 42885 gene locus_tag LOCUS_30940 41392 42885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 44412 43033 gene locus_tag LOCUS_30950 44412 43033 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_30950 44744 45763 gene locus_tag LOCUS_30960 44744 45763 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 protein_id gnl|my_center|LOCUS_30960 45847 46317 gene locus_tag LOCUS_30970 45847 46317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 46430 49021 gene locus_tag LOCUS_30980 46430 49021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 49303 49055 gene locus_tag LOCUS_30990 49303 49055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 49875 49342 gene locus_tag LOCUS_31000 49875 49342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence052 147 716 gene locus_tag LOCUS_31010 147 716 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336247.1 protein_id gnl|my_center|LOCUS_31010 742 1305 gene locus_tag LOCUS_31020 742 1305 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336247.1 protein_id gnl|my_center|LOCUS_31020 3997 1394 gene locus_tag LOCUS_31030 3997 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 6433 4115 gene locus_tag LOCUS_31040 6433 4115 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122749.1 protein_id gnl|my_center|LOCUS_31040 7551 6451 gene locus_tag LOCUS_31050 7551 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 8598 7897 gene locus_tag LOCUS_31060 8598 7897 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122508.1 protein_id gnl|my_center|LOCUS_31060 8768 9592 gene locus_tag LOCUS_31070 8768 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 9604 10644 gene locus_tag LOCUS_31080 9604 10644 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665997.1 protein_id gnl|my_center|LOCUS_31080 10659 11114 gene locus_tag LOCUS_31090 10659 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 11138 11788 gene locus_tag LOCUS_31100 11138 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338171.1 protein_id gnl|my_center|LOCUS_31100 12049 13512 gene locus_tag LOCUS_31110 12049 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 13515 14825 gene locus_tag LOCUS_31120 13515 14825 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329639.1 protein_id gnl|my_center|LOCUS_31120 15960 15187 gene locus_tag LOCUS_31130 15960 15187 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_31130 19140 15988 gene locus_tag LOCUS_31140 19140 15988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 19470 20870 gene locus_tag LOCUS_31150 19470 20870 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_31150 21549 23900 gene locus_tag LOCUS_31160 21549 23900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 24899 23946 gene locus_tag LOCUS_31170 24899 23946 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064836.1 protein_id gnl|my_center|LOCUS_31170 28027 24899 gene locus_tag LOCUS_31180 28027 24899 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020247.1 protein_id gnl|my_center|LOCUS_31180 28609 28124 gene locus_tag LOCUS_31190 28609 28124 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327445.1 protein_id gnl|my_center|LOCUS_31190 29135 28683 gene locus_tag LOCUS_31200 29135 28683 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327446.1 protein_id gnl|my_center|LOCUS_31200 30078 29170 gene locus_tag LOCUS_31210 30078 29170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 31283 30273 gene locus_tag LOCUS_31220 31283 30273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122118.1 protein_id gnl|my_center|LOCUS_31220 34438 31367 gene locus_tag LOCUS_31230 34438 31367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922202.1 protein_id gnl|my_center|LOCUS_31230 37463 34836 gene locus_tag LOCUS_31240 gene glnD 37463 34836 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325417.1 protein_id gnl|my_center|LOCUS_31240 37879 38511 gene locus_tag LOCUS_31250 37879 38511 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921987.1 protein_id gnl|my_center|LOCUS_31250 38508 38942 gene locus_tag LOCUS_31260 38508 38942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 38939 39391 gene locus_tag LOCUS_31270 38939 39391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 39494 39781 gene locus_tag LOCUS_31280 39494 39781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 39902 40150 gene locus_tag LOCUS_31290 39902 40150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 43646 40224 gene locus_tag LOCUS_31300 43646 40224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 44316 43945 gene locus_tag LOCUS_31310 44316 43945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 44589 48599 gene locus_tag LOCUS_31320 44589 48599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 48752 48652 gene locus_tag LOCUS_r00010 48752 48652 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence053 114 536 gene locus_tag LOCUS_31330 114 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 931 1458 gene locus_tag LOCUS_31340 931 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 1880 1686 gene locus_tag LOCUS_31350 1880 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 2820 1888 gene locus_tag LOCUS_31360 2820 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 2993 3469 gene locus_tag LOCUS_31370 2993 3469 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327289.1 protein_id gnl|my_center|LOCUS_31370 3477 4622 gene locus_tag LOCUS_31380 gene rsgA 3477 4622 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119119.1 protein_id gnl|my_center|LOCUS_31380 4702 6042 gene locus_tag LOCUS_31390 gene hflX 4702 6042 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_31390 6046 6831 gene locus_tag LOCUS_31400 6046 6831 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121199.1 protein_id gnl|my_center|LOCUS_31400 7112 6834 gene locus_tag LOCUS_31410 7112 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 9110 7740 gene locus_tag LOCUS_31420 9110 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_31420 9424 9209 gene locus_tag LOCUS_31430 9424 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 9671 10819 gene locus_tag LOCUS_31440 9671 10819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 11208 11888 gene locus_tag LOCUS_31450 11208 11888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 11907 13520 gene locus_tag LOCUS_31460 11907 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 14086 15666 gene locus_tag LOCUS_31470 14086 15666 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_31470 15841 16284 gene locus_tag LOCUS_31480 15841 16284 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_31480 19285 16331 gene locus_tag LOCUS_31490 19285 16331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 22072 19343 gene locus_tag LOCUS_31500 22072 19343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 25233 22249 gene locus_tag LOCUS_31510 25233 22249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 25443 25994 gene locus_tag LOCUS_31520 25443 25994 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336247.1 protein_id gnl|my_center|LOCUS_31520 27252 26137 gene locus_tag LOCUS_31530 27252 26137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 28780 27326 gene locus_tag LOCUS_31540 28780 27326 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_31540 29435 29043 gene locus_tag LOCUS_31550 29435 29043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 29643 29401 gene locus_tag LOCUS_31560 29643 29401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 30075 31199 gene locus_tag LOCUS_31570 30075 31199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 31620 31366 gene locus_tag LOCUS_31580 31620 31366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 31736 31897 gene locus_tag LOCUS_31590 31736 31897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 31986 33107 gene locus_tag LOCUS_31600 31986 33107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 33763 33359 gene locus_tag LOCUS_31610 33763 33359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 34781 33963 gene locus_tag LOCUS_31620 34781 33963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 35334 34786 gene locus_tag LOCUS_31630 gene sigE 35334 34786 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314132.1 protein_id gnl|my_center|LOCUS_31630 37644 35569 gene locus_tag LOCUS_31640 gene uvrB 37644 35569 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 protein_id gnl|my_center|LOCUS_31640 37947 40166 gene locus_tag LOCUS_31650 37947 40166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 40316 40837 gene locus_tag LOCUS_31660 40316 40837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 40929 42482 gene locus_tag LOCUS_31670 40929 42482 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198738.1 protein_id gnl|my_center|LOCUS_31670 43362 42592 gene locus_tag LOCUS_31680 43362 42592 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_31680 43463 44929 gene locus_tag LOCUS_31690 43463 44929 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_31690 45040 45756 gene locus_tag LOCUS_31700 gene ubiE 45040 45756 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_31700 45753 46439 gene locus_tag LOCUS_31710 45753 46439 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119018.1 protein_id gnl|my_center|LOCUS_31710 46444 47328 gene locus_tag LOCUS_31720 gene ubiA 46444 47328 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_31720 47355 48476 gene locus_tag LOCUS_31730 gene mqnE 47355 48476 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339462.1 protein_id gnl|my_center|LOCUS_31730 >Feature sequence054 850 452 gene locus_tag LOCUS_31740 850 452 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878522.1 protein_id gnl|my_center|LOCUS_31740 1983 862 gene locus_tag LOCUS_31750 1983 862 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121284.1 protein_id gnl|my_center|LOCUS_31750 2745 2122 gene locus_tag LOCUS_31760 2745 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 3121 4080 gene locus_tag LOCUS_31770 3121 4080 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666219.1 protein_id gnl|my_center|LOCUS_31770 4114 5442 gene locus_tag LOCUS_31780 4114 5442 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_31780 6669 5374 gene locus_tag LOCUS_31790 6669 5374 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533110.1 protein_id gnl|my_center|LOCUS_31790 7088 7945 gene locus_tag LOCUS_31800 7088 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 7949 8686 gene locus_tag LOCUS_31810 7949 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 9605 8694 gene locus_tag LOCUS_31820 9605 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 12198 9754 gene locus_tag LOCUS_31830 12198 9754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 13603 12260 gene locus_tag LOCUS_31840 13603 12260 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_31840 14622 13600 gene locus_tag LOCUS_31850 14622 13600 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 protein_id gnl|my_center|LOCUS_31850 15174 14665 gene locus_tag LOCUS_31860 15174 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 16791 15283 gene locus_tag LOCUS_31870 16791 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 16911 17444 gene locus_tag LOCUS_31880 16911 17444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 17594 19204 gene locus_tag LOCUS_31890 17594 19204 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663661.1 protein_id gnl|my_center|LOCUS_31890 19204 20211 gene locus_tag LOCUS_31900 19204 20211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 20317 22590 gene locus_tag LOCUS_31910 20317 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 23038 23889 gene locus_tag LOCUS_31920 23038 23889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 23938 24183 gene locus_tag LOCUS_31930 23938 24183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 24217 25266 gene locus_tag LOCUS_31940 24217 25266 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_31940 25259 26221 gene locus_tag LOCUS_31950 25259 26221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 26282 26797 gene locus_tag LOCUS_31960 26282 26797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 26805 28997 gene locus_tag LOCUS_31970 26805 28997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 29938 29087 gene locus_tag LOCUS_31980 29938 29087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 30531 33260 gene locus_tag LOCUS_31990 30531 33260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 33587 34354 gene locus_tag LOCUS_32000 33587 34354 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_32000 34649 34909 gene locus_tag LOCUS_32010 34649 34909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 35323 36636 gene locus_tag LOCUS_32020 35323 36636 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_32020 36771 37037 gene locus_tag LOCUS_32030 36771 37037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 37873 37241 gene locus_tag LOCUS_32040 37873 37241 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_32040 39322 38123 gene locus_tag LOCUS_32050 39322 38123 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_32050 39634 40017 gene locus_tag LOCUS_32060 39634 40017 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_32060 40956 40057 gene locus_tag LOCUS_32070 40956 40057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 41068 42396 gene locus_tag LOCUS_32080 41068 42396 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_32080 44000 42561 gene locus_tag LOCUS_32090 44000 42561 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_32090 45916 43997 gene locus_tag LOCUS_32100 45916 43997 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941439.1 protein_id gnl|my_center|LOCUS_32100 46382 46864 gene locus_tag LOCUS_32110 gene nuoE 46382 46864 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_32110 >Feature sequence055 2056 980 gene locus_tag LOCUS_32120 2056 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 2298 3317 gene locus_tag LOCUS_32130 2298 3317 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860718.1 protein_id gnl|my_center|LOCUS_32130 3247 4158 gene locus_tag LOCUS_32140 3247 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 4323 6071 gene locus_tag LOCUS_32150 4323 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 6255 7640 gene locus_tag LOCUS_32160 6255 7640 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_32160 7657 8913 gene locus_tag LOCUS_32170 7657 8913 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_32170 9559 11283 gene locus_tag LOCUS_32180 9559 11283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 11852 11316 gene locus_tag LOCUS_32190 11852 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 12378 13481 gene locus_tag LOCUS_32200 12378 13481 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_32200 15991 13700 gene locus_tag LOCUS_32210 15991 13700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 16799 20152 gene locus_tag LOCUS_32220 16799 20152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 20149 26790 gene locus_tag LOCUS_32230 20149 26790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 27099 28100 gene locus_tag LOCUS_32240 27099 28100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 28146 28607 gene locus_tag LOCUS_32250 28146 28607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 28768 29217 gene locus_tag LOCUS_32260 28768 29217 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 protein_id gnl|my_center|LOCUS_32260 29214 30215 gene locus_tag LOCUS_32270 gene moaA 29214 30215 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119704.1 protein_id gnl|my_center|LOCUS_32270 31840 30311 gene locus_tag LOCUS_32280 31840 30311 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328020.1 protein_id gnl|my_center|LOCUS_32280 34952 31890 gene locus_tag LOCUS_32290 34952 31890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 35633 36688 gene locus_tag LOCUS_32300 35633 36688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 36736 36993 gene locus_tag LOCUS_32310 36736 36993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 37813 37487 gene locus_tag LOCUS_32320 37813 37487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 38832 37969 gene locus_tag LOCUS_32330 38832 37969 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921488.1 protein_id gnl|my_center|LOCUS_32330 39308 38832 gene locus_tag LOCUS_32340 gene ruvX 39308 38832 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331673.1 protein_id gnl|my_center|LOCUS_32340 40168 39305 gene locus_tag LOCUS_32350 40168 39305 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121358.1 protein_id gnl|my_center|LOCUS_32350 40614 41918 gene locus_tag LOCUS_32360 40614 41918 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_32360 41966 43066 gene locus_tag LOCUS_32370 41966 43066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 43081 44538 gene locus_tag LOCUS_32380 43081 44538 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence056 486 1037 gene locus_tag LOCUS_32390 486 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32390 1377 1090 gene locus_tag LOCUS_32400 1377 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 3025 1532 gene locus_tag LOCUS_32410 3025 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 4195 3314 gene locus_tag LOCUS_32420 4195 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 4669 4472 gene locus_tag LOCUS_32430 4669 4472 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_32430 5162 4956 gene locus_tag LOCUS_32440 5162 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 5119 7428 gene locus_tag LOCUS_32450 5119 7428 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_32450 7841 9826 gene locus_tag LOCUS_32460 7841 9826 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518851.1 protein_id gnl|my_center|LOCUS_32460 9839 11038 gene locus_tag LOCUS_32470 gene yhbH 9839 11038 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963900.1 protein_id gnl|my_center|LOCUS_32470 11025 12560 gene locus_tag LOCUS_32480 11025 12560 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518852.1 protein_id gnl|my_center|LOCUS_32480 13894 12731 gene locus_tag LOCUS_32490 13894 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 13966 14100 gene locus_tag LOCUS_32500 13966 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 16325 14187 gene locus_tag LOCUS_32510 16325 14187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 17763 16477 gene locus_tag LOCUS_32520 17763 16477 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_32520 18765 17800 gene locus_tag LOCUS_32530 18765 17800 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922107.1 protein_id gnl|my_center|LOCUS_32530 19355 20464 gene locus_tag LOCUS_32540 19355 20464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 20519 22525 gene locus_tag LOCUS_32550 gene asnB 20519 22525 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_32550 22525 22791 gene locus_tag LOCUS_32560 22525 22791 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061274.1 protein_id gnl|my_center|LOCUS_32560 22851 24389 gene locus_tag LOCUS_32570 22851 24389 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061275.1 protein_id gnl|my_center|LOCUS_32570 24386 25372 gene locus_tag LOCUS_32580 gene nadE 24386 25372 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976175.1 protein_id gnl|my_center|LOCUS_32580 25377 26417 gene locus_tag LOCUS_32590 25377 26417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 26414 26908 gene locus_tag LOCUS_32600 26414 26908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 27221 26952 gene locus_tag LOCUS_32610 27221 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 27610 27218 gene locus_tag LOCUS_32620 27610 27218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 28998 27607 gene locus_tag LOCUS_32630 28998 27607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 31517 28995 gene locus_tag LOCUS_32640 31517 28995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 31836 32123 gene locus_tag LOCUS_32650 31836 32123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 32104 34854 gene locus_tag LOCUS_32660 32104 34854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 38021 35103 gene locus_tag LOCUS_32670 38021 35103 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_32670 38600 39877 gene locus_tag LOCUS_32680 38600 39877 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_32680 39896 40360 gene locus_tag LOCUS_32690 39896 40360 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_32690 40373 41320 gene locus_tag LOCUS_32700 40373 41320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 44124 41347 gene locus_tag LOCUS_32710 44124 41347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 44781 44155 gene locus_tag LOCUS_32720 44781 44155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 45151 46095 gene locus_tag LOCUS_32730 45151 46095 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_32730 46106 46843 gene locus_tag LOCUS_32740 46106 46843 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927082.1 protein_id gnl|my_center|LOCUS_32740 47266 47484 gene locus_tag LOCUS_32750 47266 47484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 47387 47749 gene locus_tag LOCUS_32760 47387 47749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence057 767 979 gene locus_tag LOCUS_32770 767 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 1328 996 gene locus_tag LOCUS_32780 1328 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 3084 2293 gene locus_tag LOCUS_32790 3084 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 3995 3081 gene locus_tag LOCUS_32800 3995 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 4466 4741 gene locus_tag LOCUS_32810 4466 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 5591 5112 gene locus_tag LOCUS_32820 5591 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 5634 6170 gene locus_tag LOCUS_32830 5634 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 6180 6572 gene locus_tag LOCUS_32840 6180 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 7450 7608 gene locus_tag LOCUS_32850 7450 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 7848 19067 gene locus_tag LOCUS_32860 7848 19067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 20658 19081 gene locus_tag LOCUS_32870 20658 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 22985 20655 gene locus_tag LOCUS_32880 22985 20655 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122892.1 protein_id gnl|my_center|LOCUS_32880 26614 22982 gene locus_tag LOCUS_32890 26614 22982 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616086.1 protein_id gnl|my_center|LOCUS_32890 27275 26631 gene locus_tag LOCUS_32900 27275 26631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 27819 27307 gene locus_tag LOCUS_32910 27819 27307 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324222.1 protein_id gnl|my_center|LOCUS_32910 28470 27823 gene locus_tag LOCUS_32920 28470 27823 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324221.1 protein_id gnl|my_center|LOCUS_32920 29350 28463 gene locus_tag LOCUS_32930 29350 28463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 29647 29904 gene locus_tag LOCUS_32940 29647 29904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 30356 29892 gene locus_tag LOCUS_32950 30356 29892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 31447 30359 gene locus_tag LOCUS_32960 31447 30359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 32881 31814 gene locus_tag LOCUS_32970 32881 31814 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615376.1 protein_id gnl|my_center|LOCUS_32970 38571 33055 gene locus_tag LOCUS_32980 38571 33055 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120926.1 protein_id gnl|my_center|LOCUS_32980 41004 38614 gene locus_tag LOCUS_32990 41004 38614 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921971.1 protein_id gnl|my_center|LOCUS_32990 43163 41001 gene locus_tag LOCUS_33000 43163 41001 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120924.1 protein_id gnl|my_center|LOCUS_33000 44005 43160 gene locus_tag LOCUS_33010 44005 43160 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120923.1 protein_id gnl|my_center|LOCUS_33010 45111 44083 gene locus_tag LOCUS_33020 45111 44083 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338403.1 protein_id gnl|my_center|LOCUS_33020 45314 46876 gene locus_tag LOCUS_33030 45314 46876 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_33030 >Feature sequence058 659 2014 gene locus_tag LOCUS_33040 659 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 3111 2002 gene locus_tag LOCUS_33050 3111 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 3482 4624 gene locus_tag LOCUS_33060 3482 4624 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_33060 4611 4850 gene locus_tag LOCUS_33070 4611 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 4852 5967 gene locus_tag LOCUS_33080 4852 5967 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094902.1 protein_id gnl|my_center|LOCUS_33080 5967 7238 gene locus_tag LOCUS_33090 5967 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 7289 8047 gene locus_tag LOCUS_33100 7289 8047 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480005.1 protein_id gnl|my_center|LOCUS_33100 8044 9006 gene locus_tag LOCUS_33110 8044 9006 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257986.1 protein_id gnl|my_center|LOCUS_33110 9019 10194 gene locus_tag LOCUS_33120 9019 10194 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533116.1 protein_id gnl|my_center|LOCUS_33120 10194 10856 gene locus_tag LOCUS_33130 10194 10856 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 protein_id gnl|my_center|LOCUS_33130 10853 11599 gene locus_tag LOCUS_33140 10853 11599 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026199.1 protein_id gnl|my_center|LOCUS_33140 11602 13836 gene locus_tag LOCUS_33150 11602 13836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 13925 15106 gene locus_tag LOCUS_33160 13925 15106 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147499.1 protein_id gnl|my_center|LOCUS_33160 15385 16875 gene locus_tag LOCUS_33170 15385 16875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 16965 20036 gene locus_tag LOCUS_33180 16965 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 20381 20653 gene locus_tag LOCUS_33190 20381 20653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 20730 21635 gene locus_tag LOCUS_33200 20730 21635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 21690 22412 gene locus_tag LOCUS_33210 21690 22412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118316.1 protein_id gnl|my_center|LOCUS_33210 22421 24073 gene locus_tag LOCUS_33220 22421 24073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 24422 27484 gene locus_tag LOCUS_33230 24422 27484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 28587 27553 gene locus_tag LOCUS_33240 28587 27553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 29351 28605 gene locus_tag LOCUS_33250 29351 28605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 30217 29387 gene locus_tag LOCUS_33260 30217 29387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 30428 31132 gene locus_tag LOCUS_33270 30428 31132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 31129 32298 gene locus_tag LOCUS_33280 31129 32298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 33352 32312 gene locus_tag LOCUS_33290 33352 32312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 33797 34963 gene locus_tag LOCUS_33300 33797 34963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921862.1 protein_id gnl|my_center|LOCUS_33300 35980 34976 gene locus_tag LOCUS_33310 35980 34976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 36789 36193 gene locus_tag LOCUS_33320 36789 36193 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395055.1 protein_id gnl|my_center|LOCUS_33320 38195 37068 gene locus_tag LOCUS_33330 38195 37068 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119510.1 protein_id gnl|my_center|LOCUS_33330 39610 38252 gene locus_tag LOCUS_33340 39610 38252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 40146 39607 gene locus_tag LOCUS_33350 40146 39607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 40762 40160 gene locus_tag LOCUS_33360 40762 40160 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_33360 41280 41086 gene locus_tag LOCUS_33370 41280 41086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 41215 42021 gene locus_tag LOCUS_33380 41215 42021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 43458 42259 gene locus_tag LOCUS_33390 43458 42259 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776531.1 protein_id gnl|my_center|LOCUS_33390 44267 43533 gene locus_tag LOCUS_33400 44267 43533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 45546 44281 gene locus_tag LOCUS_33410 45546 44281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 46715 45564 gene locus_tag LOCUS_33420 46715 45564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 >Feature sequence059 264 1598 gene locus_tag LOCUS_33430 264 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 1619 3103 gene locus_tag LOCUS_33440 1619 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 3270 4622 gene locus_tag LOCUS_33450 3270 4622 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_33450 5796 5020 gene locus_tag LOCUS_33460 5796 5020 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242402.1 protein_id gnl|my_center|LOCUS_33460 6305 6511 gene locus_tag LOCUS_33470 6305 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 8366 7227 gene locus_tag LOCUS_33480 8366 7227 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_33480 8798 10678 gene locus_tag LOCUS_33490 8798 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 10711 12114 gene locus_tag LOCUS_33500 10711 12114 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_33500 12205 13644 gene locus_tag LOCUS_33510 12205 13644 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_33510 13828 15150 gene locus_tag LOCUS_33520 13828 15150 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_33520 15161 16693 gene locus_tag LOCUS_33530 15161 16693 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_33530 18112 16847 gene locus_tag LOCUS_33540 18112 16847 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_33540 18497 18985 gene locus_tag LOCUS_33550 18497 18985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 22290 18928 gene locus_tag LOCUS_33560 22290 18928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 23093 22308 gene locus_tag LOCUS_33570 23093 22308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 24056 23112 gene locus_tag LOCUS_33580 24056 23112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 24912 24061 gene locus_tag LOCUS_33590 24912 24061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 26856 24916 gene locus_tag LOCUS_33600 26856 24916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 27638 26862 gene locus_tag LOCUS_33610 27638 26862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 28713 27748 gene locus_tag LOCUS_33620 28713 27748 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220240.1 protein_id gnl|my_center|LOCUS_33620 29645 28710 gene locus_tag LOCUS_33630 29645 28710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 30666 29707 gene locus_tag LOCUS_33640 30666 29707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 32457 30991 gene locus_tag LOCUS_33650 32457 30991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 33607 32612 gene locus_tag LOCUS_33660 33607 32612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 34181 33612 gene locus_tag LOCUS_33670 34181 33612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 34373 34194 gene locus_tag LOCUS_33680 34373 34194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 34603 34445 gene locus_tag LOCUS_33690 34603 34445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 35785 34673 gene locus_tag LOCUS_33700 35785 34673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 36471 40847 gene locus_tag LOCUS_33710 36471 40847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 41203 42918 gene locus_tag LOCUS_33720 41203 42918 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_33720 43339 44502 gene locus_tag LOCUS_33730 43339 44502 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_33730 44570 46288 gene locus_tag LOCUS_33740 44570 46288 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_33740 >Feature sequence060 1334 2998 gene locus_tag LOCUS_33750 1334 2998 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_33750 2995 3987 gene locus_tag LOCUS_33760 2995 3987 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326973.1 protein_id gnl|my_center|LOCUS_33760 4598 4329 gene locus_tag LOCUS_33770 4598 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 4856 6232 gene locus_tag LOCUS_33780 4856 6232 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_33780 6248 6832 gene locus_tag LOCUS_33790 6248 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 6829 7782 gene locus_tag LOCUS_33800 6829 7782 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_33800 8151 7804 gene locus_tag LOCUS_33810 8151 7804 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225637.1 protein_id gnl|my_center|LOCUS_33810 8421 8155 gene locus_tag LOCUS_33820 8421 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 8881 10476 gene locus_tag LOCUS_33830 8881 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 11337 10564 gene locus_tag LOCUS_33840 gene fabI 11337 10564 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057530.1 protein_id gnl|my_center|LOCUS_33840 13206 11464 gene locus_tag LOCUS_33850 13206 11464 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_33850 14331 13303 gene locus_tag LOCUS_33860 14331 13303 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_33860 15285 14371 gene locus_tag LOCUS_33870 15285 14371 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_33870 15631 16638 gene locus_tag LOCUS_33880 gene bioB 15631 16638 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326296.1 protein_id gnl|my_center|LOCUS_33880 18022 16694 gene locus_tag LOCUS_33890 gene gabT 18022 16694 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964736.1 protein_id gnl|my_center|LOCUS_33890 19032 18034 gene locus_tag LOCUS_33900 19032 18034 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_33900 20111 19050 gene locus_tag LOCUS_33910 20111 19050 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_33910 20743 20270 gene locus_tag LOCUS_33920 20743 20270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 20884 21123 gene locus_tag LOCUS_33930 20884 21123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 21767 25303 gene locus_tag LOCUS_33940 21767 25303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 25951 25352 gene locus_tag LOCUS_33950 25951 25352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 26650 26390 gene locus_tag LOCUS_33960 26650 26390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 26927 26643 gene locus_tag LOCUS_33970 26927 26643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 27409 28683 gene locus_tag LOCUS_33980 27409 28683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 29102 28827 gene locus_tag LOCUS_33990 29102 28827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 29596 30717 gene locus_tag LOCUS_34000 29596 30717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667978.1 protein_id gnl|my_center|LOCUS_34000 31011 32066 gene locus_tag LOCUS_34010 31011 32066 CDS product tRNA adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262485.1 protein_id gnl|my_center|LOCUS_34010 32127 32372 gene locus_tag LOCUS_34020 32127 32372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 34024 32549 gene locus_tag LOCUS_34030 34024 32549 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726980.1 protein_id gnl|my_center|LOCUS_34030 34871 34287 gene locus_tag LOCUS_34040 34871 34287 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_34040 38876 35277 gene locus_tag LOCUS_34050 38876 35277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 40105 38873 gene locus_tag LOCUS_34060 40105 38873 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442683.1 protein_id gnl|my_center|LOCUS_34060 40633 40361 gene locus_tag LOCUS_34070 40633 40361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 40745 42994 gene locus_tag LOCUS_34080 gene feoB 40745 42994 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939841.1 protein_id gnl|my_center|LOCUS_34080 43102 43881 gene locus_tag LOCUS_34090 43102 43881 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122726.1 protein_id gnl|my_center|LOCUS_34090 44591 44061 gene locus_tag LOCUS_34100 44591 44061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 45400 46983 gene locus_tag LOCUS_34110 45400 46983 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328293.1 protein_id gnl|my_center|LOCUS_34110 >Feature sequence061 3660 1828 gene locus_tag LOCUS_34120 3660 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 4843 3704 gene locus_tag LOCUS_34130 4843 3704 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_34130 5213 6955 gene locus_tag LOCUS_34140 5213 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 7125 9920 gene locus_tag LOCUS_34150 7125 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 11353 9935 gene locus_tag LOCUS_34160 11353 9935 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109239.1 protein_id gnl|my_center|LOCUS_34160 12410 11379 gene locus_tag LOCUS_34170 12410 11379 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_34170 13729 12407 gene locus_tag LOCUS_34180 13729 12407 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_34180 15003 14014 gene locus_tag LOCUS_34190 15003 14014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 16253 15189 gene locus_tag LOCUS_34200 16253 15189 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461131.1 protein_id gnl|my_center|LOCUS_34200 16923 16279 gene locus_tag LOCUS_34210 16923 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 18182 17013 gene locus_tag LOCUS_34220 18182 17013 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 protein_id gnl|my_center|LOCUS_34220 18526 18224 gene locus_tag LOCUS_34230 18526 18224 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891186.1 protein_id gnl|my_center|LOCUS_34230 19504 18791 gene locus_tag LOCUS_34240 19504 18791 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 protein_id gnl|my_center|LOCUS_34240 20354 19506 gene locus_tag LOCUS_34250 20354 19506 CDS product glucosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921804.1 protein_id gnl|my_center|LOCUS_34250 21826 20390 gene locus_tag LOCUS_34260 gene gabD 21826 20390 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772868.1 protein_id gnl|my_center|LOCUS_34260 22521 21874 gene locus_tag LOCUS_34270 gene fsa 22521 21874 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_34270 23279 22518 gene locus_tag LOCUS_34280 23279 22518 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_34280 26462 23394 gene locus_tag LOCUS_34290 26462 23394 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427762.1 protein_id gnl|my_center|LOCUS_34290 28213 26654 gene locus_tag LOCUS_34300 gene cimA 28213 26654 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332450.1 protein_id gnl|my_center|LOCUS_34300 31287 28615 gene locus_tag LOCUS_34310 31287 28615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 32340 31876 gene locus_tag LOCUS_34320 32340 31876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 33322 32507 gene locus_tag LOCUS_34330 33322 32507 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_34330 33437 34678 gene locus_tag LOCUS_34340 gene pepT 33437 34678 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121359.1 protein_id gnl|my_center|LOCUS_34340 34839 35858 gene locus_tag LOCUS_34350 34839 35858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 35969 36544 gene locus_tag LOCUS_34360 35969 36544 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_34360 38536 36548 gene locus_tag LOCUS_34370 gene argS 38536 36548 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120594.1 protein_id gnl|my_center|LOCUS_34370 38931 38533 gene locus_tag LOCUS_34380 38931 38533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 39385 39855 gene locus_tag LOCUS_34390 gene bcp 39385 39855 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337529.1 protein_id gnl|my_center|LOCUS_34390 39954 40937 gene locus_tag LOCUS_34400 39954 40937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 41401 41066 gene locus_tag LOCUS_34410 gene trxA 41401 41066 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_34410 41905 44040 gene locus_tag LOCUS_34420 41905 44040 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_34420 44839 44156 gene locus_tag LOCUS_34430 44839 44156 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122200.1 protein_id gnl|my_center|LOCUS_34430 44938 45165 gene locus_tag LOCUS_34440 44938 45165 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545791.1 protein_id gnl|my_center|LOCUS_34440 46090 45170 gene locus_tag LOCUS_34450 46090 45170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 <47113 46137 gene locus_tag LOCUS_34460 <47113 46137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325011.1:IMP dehydrogenase >Feature sequence062 451 110 gene locus_tag LOCUS_34470 451 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 1101 553 gene locus_tag LOCUS_34480 1101 553 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081283.1 protein_id gnl|my_center|LOCUS_34480 1573 1971 gene locus_tag LOCUS_34490 1573 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 3009 2095 gene locus_tag LOCUS_34500 3009 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 4742 3117 gene locus_tag LOCUS_34510 4742 3117 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_34510 5999 5028 gene locus_tag LOCUS_34520 5999 5028 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 protein_id gnl|my_center|LOCUS_34520 6585 6139 gene locus_tag LOCUS_34530 6585 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 7068 6688 gene locus_tag LOCUS_34540 7068 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 8291 7227 gene locus_tag LOCUS_34550 8291 7227 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_34550 9712 8552 gene locus_tag LOCUS_34560 9712 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 10581 10102 gene locus_tag LOCUS_34570 10581 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 11349 11014 gene locus_tag LOCUS_34580 11349 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 11771 11968 gene locus_tag LOCUS_34590 11771 11968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 12985 11993 gene locus_tag LOCUS_34600 12985 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 14043 13258 gene locus_tag LOCUS_34610 14043 13258 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530852.1 protein_id gnl|my_center|LOCUS_34610 17411 14106 gene locus_tag LOCUS_34620 17411 14106 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729190.1 protein_id gnl|my_center|LOCUS_34620 18063 17416 gene locus_tag LOCUS_34630 18063 17416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 19037 18063 gene locus_tag LOCUS_34640 19037 18063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 18945 19151 gene locus_tag LOCUS_34650 18945 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 19480 20295 gene locus_tag LOCUS_34660 19480 20295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 20556 21068 gene locus_tag LOCUS_34670 20556 21068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 21838 21131 gene locus_tag LOCUS_34680 21838 21131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 22710 21958 gene locus_tag LOCUS_34690 22710 21958 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656119.1 protein_id gnl|my_center|LOCUS_34690 24925 22796 gene locus_tag LOCUS_34700 gene pnp 24925 22796 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037246149.1 protein_id gnl|my_center|LOCUS_34700 25381 25112 gene locus_tag LOCUS_34710 gene rpsO 25381 25112 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329975.1 protein_id gnl|my_center|LOCUS_34710 27776 25545 gene locus_tag LOCUS_34720 27776 25545 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249708.1 protein_id gnl|my_center|LOCUS_34720 28832 28224 gene locus_tag LOCUS_34730 28832 28224 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140140.1 protein_id gnl|my_center|LOCUS_34730 31884 28981 gene locus_tag LOCUS_34740 31884 28981 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_34740 33070 32087 gene locus_tag LOCUS_34750 33070 32087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 34385 33120 gene locus_tag LOCUS_34760 34385 33120 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257569.1 protein_id gnl|my_center|LOCUS_34760 35320 34397 gene locus_tag LOCUS_34770 35320 34397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 36631 35441 gene locus_tag LOCUS_34780 36631 35441 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324545.1 protein_id gnl|my_center|LOCUS_34780 36834 37937 gene locus_tag LOCUS_34790 36834 37937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 37970 38707 gene locus_tag LOCUS_34800 37970 38707 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922323.1 protein_id gnl|my_center|LOCUS_34800 40035 39193 gene locus_tag LOCUS_34810 40035 39193 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815129.1 protein_id gnl|my_center|LOCUS_34810 40400 40131 gene locus_tag LOCUS_34820 40400 40131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 40629 40387 gene locus_tag LOCUS_34830 40629 40387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 43954 40808 gene locus_tag LOCUS_34840 43954 40808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 44787 45458 gene locus_tag LOCUS_34850 44787 45458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34850 45412 45675 gene locus_tag LOCUS_34860 45412 45675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34860 45684 45926 gene locus_tag LOCUS_34870 45684 45926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34870 >Feature sequence063 1115 78 gene locus_tag LOCUS_34880 1115 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 1650 1363 gene locus_tag LOCUS_34890 1650 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 2726 2424 gene locus_tag LOCUS_34900 2726 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 3653 2805 gene locus_tag LOCUS_34910 3653 2805 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_34910 5604 3865 gene locus_tag LOCUS_34920 5604 3865 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_34920 7404 5692 gene locus_tag LOCUS_34930 7404 5692 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_34930 8491 7430 gene locus_tag LOCUS_34940 8491 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120295.1 protein_id gnl|my_center|LOCUS_34940 8885 9892 gene locus_tag LOCUS_34950 8885 9892 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122566.1 protein_id gnl|my_center|LOCUS_34950 9886 10731 gene locus_tag LOCUS_34960 9886 10731 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378215.1 protein_id gnl|my_center|LOCUS_34960 10994 12196 gene locus_tag LOCUS_34970 10994 12196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 14527 12365 gene locus_tag LOCUS_34980 gene glgX 14527 12365 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_34980 15642 14872 gene locus_tag LOCUS_34990 15642 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 15985 17049 gene locus_tag LOCUS_35000 gene purM 15985 17049 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922559.1 protein_id gnl|my_center|LOCUS_35000 18367 17435 gene locus_tag LOCUS_35010 18367 17435 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326889.1 protein_id gnl|my_center|LOCUS_35010 19717 18884 gene locus_tag LOCUS_35020 19717 18884 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_35020 20564 19794 gene locus_tag LOCUS_35030 20564 19794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 21550 20786 gene locus_tag LOCUS_35040 21550 20786 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 protein_id gnl|my_center|LOCUS_35040 23135 21561 gene locus_tag LOCUS_35050 23135 21561 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766132.1 protein_id gnl|my_center|LOCUS_35050 24224 23136 gene locus_tag LOCUS_35060 24224 23136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_35060 24544 24221 gene locus_tag LOCUS_35070 24544 24221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 25881 24808 gene locus_tag LOCUS_35080 25881 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 27449 25890 gene locus_tag LOCUS_35090 27449 25890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 28643 27459 gene locus_tag LOCUS_35100 28643 27459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 28919 29746 gene locus_tag LOCUS_35110 28919 29746 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_35110 30164 29751 gene locus_tag LOCUS_35120 30164 29751 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921917.1 protein_id gnl|my_center|LOCUS_35120 31695 30241 gene locus_tag LOCUS_35130 31695 30241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 32745 31855 gene locus_tag LOCUS_35140 gene rsmH 32745 31855 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_35140 33573 33127 gene locus_tag LOCUS_35150 gene mraZ 33573 33127 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286645.1 protein_id gnl|my_center|LOCUS_35150 34892 33753 gene locus_tag LOCUS_35160 34892 33753 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122846.1 protein_id gnl|my_center|LOCUS_35160 35233 36297 gene locus_tag LOCUS_35170 gene queA 35233 36297 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120320.1 protein_id gnl|my_center|LOCUS_35170 36334 36975 gene locus_tag LOCUS_35180 36334 36975 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_35180 36972 38162 gene locus_tag LOCUS_35190 36972 38162 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_35190 38380 39513 gene locus_tag LOCUS_35200 38380 39513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 41309 39654 gene locus_tag LOCUS_35210 41309 39654 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_35210 42250 41306 gene locus_tag LOCUS_35220 42250 41306 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_35220 43626 42445 gene locus_tag LOCUS_35230 43626 42445 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_35230 43954 44586 gene locus_tag LOCUS_35240 43954 44586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 44714 46024 gene locus_tag LOCUS_35250 44714 46024 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence064 2 191 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgaagaagcgccctggcatcgaagggattgaaac 198 638 gene locus_tag LOCUS_35260 198 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 774 1061 gene locus_tag LOCUS_35270 774 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 1487 2935 gene locus_tag LOCUS_35280 1487 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 3926 2940 gene locus_tag LOCUS_35290 3926 2940 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324413.1 protein_id gnl|my_center|LOCUS_35290 4660 7248 gene locus_tag LOCUS_35300 4660 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 9486 7321 gene locus_tag LOCUS_35310 9486 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 9950 10984 gene locus_tag LOCUS_35320 gene xylA 9950 10984 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730977.1 protein_id gnl|my_center|LOCUS_35320 11367 11128 gene locus_tag LOCUS_35330 11367 11128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 11721 13088 gene locus_tag LOCUS_35340 11721 13088 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146578686.1 protein_id gnl|my_center|LOCUS_35340 13422 13201 gene locus_tag LOCUS_35350 13422 13201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 13717 14682 gene locus_tag LOCUS_35360 13717 14682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 14715 15632 gene locus_tag LOCUS_35370 14715 15632 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145034007.1 protein_id gnl|my_center|LOCUS_35370 16377 15769 gene locus_tag LOCUS_35380 16377 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 16585 17481 gene locus_tag LOCUS_35390 16585 17481 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 protein_id gnl|my_center|LOCUS_35390 17646 18170 gene locus_tag LOCUS_35400 17646 18170 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 protein_id gnl|my_center|LOCUS_35400 18419 19012 gene locus_tag LOCUS_35410 18419 19012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 20115 19039 gene locus_tag LOCUS_35420 20115 19039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 20705 20112 gene locus_tag LOCUS_35430 20705 20112 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229095.1 protein_id gnl|my_center|LOCUS_35430 22142 20835 gene locus_tag LOCUS_35440 22142 20835 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_35440 22711 22253 gene locus_tag LOCUS_35450 22711 22253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 23150 22665 gene locus_tag LOCUS_35460 23150 22665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 23512 24849 gene locus_tag LOCUS_35470 23512 24849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 26261 25335 gene locus_tag LOCUS_35480 26261 25335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 27026 26388 gene locus_tag LOCUS_35490 27026 26388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 27305 28135 gene locus_tag LOCUS_35500 27305 28135 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061273.1 protein_id gnl|my_center|LOCUS_35500 28170 28343 gene locus_tag LOCUS_35510 28170 28343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 28340 29986 gene locus_tag LOCUS_35520 28340 29986 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144273.1 protein_id gnl|my_center|LOCUS_35520 30065 30517 gene locus_tag LOCUS_35530 30065 30517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 30527 30733 gene locus_tag LOCUS_35540 30527 30733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 30736 31749 gene locus_tag LOCUS_35550 30736 31749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 31758 32549 gene locus_tag LOCUS_35560 31758 32549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 32582 33670 gene locus_tag LOCUS_35570 32582 33670 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_35570 33993 35402 gene locus_tag LOCUS_35580 33993 35402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 35714 36472 gene locus_tag LOCUS_35590 35714 36472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 36942 36622 gene locus_tag LOCUS_35600 36942 36622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 38691 37831 gene locus_tag LOCUS_35610 38691 37831 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255985.1 protein_id gnl|my_center|LOCUS_35610 39821 38691 gene locus_tag LOCUS_35620 39821 38691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 40090 39818 gene locus_tag LOCUS_35630 40090 39818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 43183 40307 gene locus_tag LOCUS_35640 43183 40307 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 protein_id gnl|my_center|LOCUS_35640 44951 43623 gene locus_tag LOCUS_35650 44951 43623 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_35650 >Feature sequence065 168 695 gene locus_tag LOCUS_35660 168 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 1915 740 gene locus_tag LOCUS_35670 1915 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 2636 1968 gene locus_tag LOCUS_35680 2636 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 3676 2633 gene locus_tag LOCUS_35690 3676 2633 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222158.1 protein_id gnl|my_center|LOCUS_35690 4684 3725 gene locus_tag LOCUS_35700 4684 3725 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_35700 5036 5989 gene locus_tag LOCUS_35710 5036 5989 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_35710 6000 6635 gene locus_tag LOCUS_35720 6000 6635 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_35720 6638 7894 gene locus_tag LOCUS_35730 6638 7894 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_35730 9195 7903 gene locus_tag LOCUS_35740 9195 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 10202 9435 gene locus_tag LOCUS_35750 10202 9435 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895306.1 protein_id gnl|my_center|LOCUS_35750 10465 11691 gene locus_tag LOCUS_35760 10465 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 12244 11732 gene locus_tag LOCUS_35770 12244 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 12995 13819 gene locus_tag LOCUS_35780 12995 13819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 15224 13977 gene locus_tag LOCUS_35790 15224 13977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_35790 16882 15224 gene locus_tag LOCUS_35800 16882 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 18285 17125 gene locus_tag LOCUS_35810 18285 17125 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_35810 19597 18287 gene locus_tag LOCUS_35820 19597 18287 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229037.1 protein_id gnl|my_center|LOCUS_35820 19810 20712 gene locus_tag LOCUS_35830 19810 20712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 21806 20949 gene locus_tag LOCUS_35840 21806 20949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 23971 22487 gene locus_tag LOCUS_35850 23971 22487 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_35850 25005 24166 gene locus_tag LOCUS_35860 25005 24166 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_35860 26146 25040 gene locus_tag LOCUS_35870 26146 25040 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940764.1 protein_id gnl|my_center|LOCUS_35870 26982 26143 gene locus_tag LOCUS_35880 26982 26143 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_35880 27413 26979 gene locus_tag LOCUS_35890 27413 26979 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_35890 29422 27410 gene locus_tag LOCUS_35900 29422 27410 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_35900 30321 29479 gene locus_tag LOCUS_35910 30321 29479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 31015 30434 gene locus_tag LOCUS_35920 31015 30434 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940769.1 protein_id gnl|my_center|LOCUS_35920 32769 31195 gene locus_tag LOCUS_35930 32769 31195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 33652 33146 gene locus_tag LOCUS_35940 gene smpB 33652 33146 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615559.1 protein_id gnl|my_center|LOCUS_35940 34130 33777 gene locus_tag LOCUS_35950 34130 33777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 34011 34445 gene locus_tag LOCUS_35960 34011 34445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 34681 35541 gene locus_tag LOCUS_35970 gene lipA 34681 35541 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665013.1 protein_id gnl|my_center|LOCUS_35970 36251 35553 gene locus_tag LOCUS_35980 36251 35553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35980 37544 38449 gene locus_tag LOCUS_35990 37544 38449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 38571 39332 gene locus_tag LOCUS_36000 38571 39332 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868017.1 protein_id gnl|my_center|LOCUS_36000 40156 44169 gene locus_tag LOCUS_36010 40156 44169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 >Feature sequence066 283 1551 gene locus_tag LOCUS_36020 283 1551 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007341012.1 protein_id gnl|my_center|LOCUS_36020 1851 1588 gene locus_tag LOCUS_36030 1851 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 2179 2535 gene locus_tag LOCUS_36040 2179 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 2532 3785 gene locus_tag LOCUS_36050 gene xcpR 2532 3785 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_36050 3897 4868 gene locus_tag LOCUS_36060 3897 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_36060 5797 5012 gene locus_tag LOCUS_36070 5797 5012 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122697.1 protein_id gnl|my_center|LOCUS_36070 6133 5834 gene locus_tag LOCUS_36080 6133 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 6388 7827 gene locus_tag LOCUS_36090 6388 7827 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_36090 7899 9143 gene locus_tag LOCUS_36100 7899 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 9656 10249 gene locus_tag LOCUS_36110 9656 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 10741 10508 gene locus_tag LOCUS_36120 10741 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 11149 12483 gene locus_tag LOCUS_36130 11149 12483 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_36130 12926 15382 gene locus_tag LOCUS_36140 12926 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 15453 15839 gene locus_tag LOCUS_36150 15453 15839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 16646 17053 gene locus_tag LOCUS_36160 16646 17053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616149.1 protein_id gnl|my_center|LOCUS_36160 17105 18094 gene locus_tag LOCUS_36170 17105 18094 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_36170 18351 20795 gene locus_tag LOCUS_36180 18351 20795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 23396 21012 gene locus_tag LOCUS_36190 23396 21012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 25642 23630 gene locus_tag LOCUS_36200 25642 23630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 26060 27445 gene locus_tag LOCUS_36210 26060 27445 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921354.1 protein_id gnl|my_center|LOCUS_36210 29448 28225 gene locus_tag LOCUS_36220 29448 28225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 32127 29773 gene locus_tag LOCUS_36230 32127 29773 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815631.1 protein_id gnl|my_center|LOCUS_36230 32413 33435 gene locus_tag LOCUS_36240 32413 33435 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922840.1 protein_id gnl|my_center|LOCUS_36240 33467 34363 gene locus_tag LOCUS_36250 33467 34363 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_36250 34440 36569 gene locus_tag LOCUS_36260 34440 36569 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117947.1 protein_id gnl|my_center|LOCUS_36260 36782 37117 gene locus_tag LOCUS_36270 36782 37117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 37635 37240 gene locus_tag LOCUS_36280 37635 37240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 37983 38987 gene locus_tag LOCUS_36290 37983 38987 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921799.1 protein_id gnl|my_center|LOCUS_36290 39169 41265 gene locus_tag LOCUS_36300 gene fusA 39169 41265 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120445.1 protein_id gnl|my_center|LOCUS_36300 41303 42994 gene locus_tag LOCUS_36310 41303 42994 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_36310 >Feature sequence067 839 1123 gene locus_tag LOCUS_36320 839 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 1205 2209 gene locus_tag LOCUS_36330 1205 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 3767 2430 gene locus_tag LOCUS_36340 3767 2430 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_36340 4677 3814 gene locus_tag LOCUS_36350 4677 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 5088 6614 gene locus_tag LOCUS_36360 5088 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_36360 6650 7951 gene locus_tag LOCUS_36370 6650 7951 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_36370 8395 8045 gene locus_tag LOCUS_36380 8395 8045 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311110.1 protein_id gnl|my_center|LOCUS_36380 8725 9375 gene locus_tag LOCUS_36390 gene folE 8725 9375 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336701.1 protein_id gnl|my_center|LOCUS_36390 9390 12371 gene locus_tag LOCUS_36400 9390 12371 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903811.1 protein_id gnl|my_center|LOCUS_36400 12368 12613 gene locus_tag LOCUS_36410 12368 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 12879 13595 gene locus_tag LOCUS_36420 12879 13595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_36420 13592 14965 gene locus_tag LOCUS_36430 13592 14965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_36430 15008 15721 gene locus_tag LOCUS_36440 15008 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 15971 16732 gene locus_tag LOCUS_36450 gene ricT 15971 16732 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615890.1 protein_id gnl|my_center|LOCUS_36450 16802 17233 gene locus_tag LOCUS_36460 16802 17233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_36460 18281 17481 gene locus_tag LOCUS_36470 gene fetB 18281 17481 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191253.1 protein_id gnl|my_center|LOCUS_36470 18715 18293 gene locus_tag LOCUS_36480 18715 18293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 18746 18967 gene locus_tag LOCUS_36490 18746 18967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 19564 19851 gene locus_tag LOCUS_36500 gene groES 19564 19851 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_36500 19959 21125 gene locus_tag LOCUS_36510 19959 21125 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037252469.1 protein_id gnl|my_center|LOCUS_36510 21135 22535 gene locus_tag LOCUS_36520 21135 22535 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811709.1 protein_id gnl|my_center|LOCUS_36520 24380 22632 gene locus_tag LOCUS_36530 24380 22632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 24751 25098 gene locus_tag LOCUS_36540 24751 25098 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084891.1 protein_id gnl|my_center|LOCUS_36540 25500 25916 gene locus_tag LOCUS_36550 25500 25916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 26183 26515 gene locus_tag LOCUS_36560 26183 26515 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329747.1 protein_id gnl|my_center|LOCUS_36560 27106 26660 gene locus_tag LOCUS_36570 27106 26660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 27313 27999 gene locus_tag LOCUS_36580 27313 27999 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921977.1 protein_id gnl|my_center|LOCUS_36580 28231 30615 gene locus_tag LOCUS_36590 28231 30615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 33598 30632 gene locus_tag LOCUS_36600 33598 30632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 34245 37727 gene locus_tag LOCUS_36610 34245 37727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 38177 39685 gene locus_tag LOCUS_36620 38177 39685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 40103 39687 gene locus_tag LOCUS_36630 40103 39687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 40446 40093 gene locus_tag LOCUS_36640 40446 40093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 40757 41500 gene locus_tag LOCUS_36650 40757 41500 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392826.1 protein_id gnl|my_center|LOCUS_36650 41775 42284 gene locus_tag LOCUS_36660 gene ilvN 41775 42284 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339870.1 protein_id gnl|my_center|LOCUS_36660 >Feature sequence068 4555 2915 gene locus_tag LOCUS_36670 4555 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 5509 5096 gene locus_tag LOCUS_36680 5509 5096 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967510.1 protein_id gnl|my_center|LOCUS_36680 5742 5506 gene locus_tag LOCUS_36690 5742 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 7346 5838 gene locus_tag LOCUS_36700 7346 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 7652 7416 gene locus_tag LOCUS_36710 7652 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 8071 11190 gene locus_tag LOCUS_36720 8071 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 11270 12598 gene locus_tag LOCUS_36730 11270 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 12689 13204 gene locus_tag LOCUS_36740 12689 13204 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_36740 13899 13345 gene locus_tag LOCUS_36750 13899 13345 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640287.1 protein_id gnl|my_center|LOCUS_36750 15106 14138 gene locus_tag LOCUS_36760 15106 14138 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_36760 16923 15853 gene locus_tag LOCUS_36770 16923 15853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 20638 16943 gene locus_tag LOCUS_36780 20638 16943 CDS product secretin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118422.1 protein_id gnl|my_center|LOCUS_36780 21498 21322 gene locus_tag LOCUS_36790 21498 21322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 22028 21561 gene locus_tag LOCUS_36800 22028 21561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 22664 22266 gene locus_tag LOCUS_36810 22664 22266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 23018 22719 gene locus_tag LOCUS_36820 23018 22719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 23536 23117 gene locus_tag LOCUS_36830 23536 23117 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335921.1 protein_id gnl|my_center|LOCUS_36830 23916 25238 gene locus_tag LOCUS_36840 23916 25238 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_36840 26632 25379 gene locus_tag LOCUS_36850 26632 25379 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202530.1 protein_id gnl|my_center|LOCUS_36850 26921 27250 gene locus_tag LOCUS_36860 26921 27250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 27247 29403 gene locus_tag LOCUS_36870 27247 29403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 29430 30359 gene locus_tag LOCUS_36880 29430 30359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331193.1 protein_id gnl|my_center|LOCUS_36880 30377 31969 gene locus_tag LOCUS_36890 30377 31969 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122320.1 protein_id gnl|my_center|LOCUS_36890 31982 32848 gene locus_tag LOCUS_36900 31982 32848 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226328.1 protein_id gnl|my_center|LOCUS_36900 33560 33102 gene locus_tag LOCUS_36910 33560 33102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 34724 33681 gene locus_tag LOCUS_36920 34724 33681 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922864.1 protein_id gnl|my_center|LOCUS_36920 35229 34858 gene locus_tag LOCUS_36930 35229 34858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 36311 35256 gene locus_tag LOCUS_36940 36311 35256 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921857.1 protein_id gnl|my_center|LOCUS_36940 36814 37227 gene locus_tag LOCUS_36950 36814 37227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 37383 39020 gene locus_tag LOCUS_36960 37383 39020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 39148 40059 gene locus_tag LOCUS_36970 39148 40059 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876382.1 protein_id gnl|my_center|LOCUS_36970 40184 40672 gene locus_tag LOCUS_36980 40184 40672 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_36980 41218 41694 gene locus_tag LOCUS_36990 41218 41694 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417353.1 protein_id gnl|my_center|LOCUS_36990 41844 42866 gene locus_tag LOCUS_37000 gene fliG 41844 42866 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326344.1 protein_id gnl|my_center|LOCUS_37000 >Feature sequence069 2112 784 gene locus_tag LOCUS_37010 2112 784 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_37010 3340 2729 gene locus_tag LOCUS_37020 3340 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 3543 4478 gene locus_tag LOCUS_37030 3543 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 4929 6344 gene locus_tag LOCUS_37040 gene dnaA 4929 6344 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815138.1 protein_id gnl|my_center|LOCUS_37040 6509 7198 gene locus_tag LOCUS_37050 6509 7198 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_37050 7211 9202 gene locus_tag LOCUS_37060 7211 9202 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_37060 9206 10123 gene locus_tag LOCUS_37070 9206 10123 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_37070 10127 10771 gene locus_tag LOCUS_37080 10127 10771 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_37080 10776 12266 gene locus_tag LOCUS_37090 10776 12266 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_37090 12266 13786 gene locus_tag LOCUS_37100 12266 13786 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_37100 13804 14577 gene locus_tag LOCUS_37110 13804 14577 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_37110 15104 15337 gene locus_tag LOCUS_37120 15104 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 15349 15627 gene locus_tag LOCUS_37130 15349 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 15627 16100 gene locus_tag LOCUS_37140 15627 16100 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334911.1 protein_id gnl|my_center|LOCUS_37140 17410 16112 gene locus_tag LOCUS_37150 17410 16112 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943127.1 protein_id gnl|my_center|LOCUS_37150 17887 20820 gene locus_tag LOCUS_37160 17887 20820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 20854 21774 gene locus_tag LOCUS_37170 20854 21774 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921754.1 protein_id gnl|my_center|LOCUS_37170 21951 25028 gene locus_tag LOCUS_37180 21951 25028 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197443608.1 protein_id gnl|my_center|LOCUS_37180 25253 25092 gene locus_tag LOCUS_37190 25253 25092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 29080 25721 gene locus_tag LOCUS_37200 29080 25721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 30466 29144 gene locus_tag LOCUS_37210 30466 29144 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_37210 31183 32535 gene locus_tag LOCUS_37220 31183 32535 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_37220 32572 33531 gene locus_tag LOCUS_37230 32572 33531 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665638.1 protein_id gnl|my_center|LOCUS_37230 33528 34871 gene locus_tag LOCUS_37240 33528 34871 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118398.1 protein_id gnl|my_center|LOCUS_37240 35671 34919 gene locus_tag LOCUS_37250 35671 34919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 35855 36550 gene locus_tag LOCUS_37260 35855 36550 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_37260 37233 36547 gene locus_tag LOCUS_37270 37233 36547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 38279 37230 gene locus_tag LOCUS_37280 gene floA 38279 37230 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327694.1 protein_id gnl|my_center|LOCUS_37280 38957 38382 gene locus_tag LOCUS_37290 38957 38382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 41125 38966 gene locus_tag LOCUS_37300 41125 38966 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921569.1 protein_id gnl|my_center|LOCUS_37300 42381 41521 gene locus_tag LOCUS_37310 42381 41521 CDS product TIGR03009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922291.1 protein_id gnl|my_center|LOCUS_37310 42652 42365 gene locus_tag LOCUS_37320 42652 42365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 >Feature sequence070 5284 1022 gene locus_tag LOCUS_37330 5284 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 5483 7414 gene locus_tag LOCUS_37340 5483 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 7451 7795 gene locus_tag LOCUS_37350 7451 7795 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095090.1 protein_id gnl|my_center|LOCUS_37350 8842 7997 gene locus_tag LOCUS_37360 gene aroE 8842 7997 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973723.1 protein_id gnl|my_center|LOCUS_37360 8986 9780 gene locus_tag LOCUS_37370 8986 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 9886 10575 gene locus_tag LOCUS_37380 gene bshB1 9886 10575 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230642.1 protein_id gnl|my_center|LOCUS_37380 10742 11263 gene locus_tag LOCUS_37390 10742 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 11260 12186 gene locus_tag LOCUS_37400 11260 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 12298 14646 gene locus_tag LOCUS_37410 12298 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 14745 16685 gene locus_tag LOCUS_37420 14745 16685 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106714628.1 protein_id gnl|my_center|LOCUS_37420 16723 17661 gene locus_tag LOCUS_37430 16723 17661 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_37430 17886 19772 gene locus_tag LOCUS_37440 17886 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 19750 21162 gene locus_tag LOCUS_37450 19750 21162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 22071 21202 gene locus_tag LOCUS_37460 22071 21202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 22415 24271 gene locus_tag LOCUS_37470 22415 24271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 24652 26811 gene locus_tag LOCUS_37480 gene pilM 24652 26811 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119060.1 protein_id gnl|my_center|LOCUS_37480 26844 28718 gene locus_tag LOCUS_37490 26844 28718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 28791 30782 gene locus_tag LOCUS_37500 28791 30782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 31610 35707 gene locus_tag LOCUS_37510 31610 35707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 35804 36190 gene locus_tag LOCUS_37520 35804 36190 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144314.1 protein_id gnl|my_center|LOCUS_37520 37640 36285 gene locus_tag LOCUS_37530 37640 36285 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_37530 38015 39574 gene locus_tag LOCUS_37540 38015 39574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 39585 40838 gene locus_tag LOCUS_37550 gene mutY 39585 40838 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117840.1 protein_id gnl|my_center|LOCUS_37550 >Feature sequence071 4507 215 gene locus_tag LOCUS_37560 4507 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 5622 4732 gene locus_tag LOCUS_37570 5622 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 5986 6786 gene locus_tag LOCUS_37580 gene panB 5986 6786 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122138.1 protein_id gnl|my_center|LOCUS_37580 7042 9120 gene locus_tag LOCUS_37590 7042 9120 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_37590 9517 9158 gene locus_tag LOCUS_37600 9517 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 9903 10802 gene locus_tag LOCUS_37610 9903 10802 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_37610 11965 10934 gene locus_tag LOCUS_37620 gene rtcA 11965 10934 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112809.1 protein_id gnl|my_center|LOCUS_37620 12239 12649 gene locus_tag LOCUS_37630 12239 12649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37630 12807 13556 gene locus_tag LOCUS_37640 12807 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 13598 15133 gene locus_tag LOCUS_37650 13598 15133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 16083 15181 gene locus_tag LOCUS_37660 16083 15181 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_37660 17040 16156 gene locus_tag LOCUS_37670 17040 16156 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121957.1 protein_id gnl|my_center|LOCUS_37670 17822 17052 gene locus_tag LOCUS_37680 17822 17052 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922035.1 protein_id gnl|my_center|LOCUS_37680 18970 17837 gene locus_tag LOCUS_37690 18970 17837 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_37690 19209 19135 gene locus_tag LOCUS_t00220 19209 19135 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 19414 19557 gene locus_tag LOCUS_37700 19414 19557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 19610 20503 gene locus_tag LOCUS_37710 19610 20503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 20588 21130 gene locus_tag LOCUS_37720 20588 21130 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327748.1 protein_id gnl|my_center|LOCUS_37720 21147 21452 gene locus_tag LOCUS_37730 21147 21452 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123488.1 protein_id gnl|my_center|LOCUS_37730 21449 22624 gene locus_tag LOCUS_37740 21449 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 22986 24425 gene locus_tag LOCUS_37750 22986 24425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 25115 24600 gene locus_tag LOCUS_37760 25115 24600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 29337 25273 gene locus_tag LOCUS_37770 29337 25273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 31173 29536 gene locus_tag LOCUS_37780 31173 29536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 31537 32562 gene locus_tag LOCUS_37790 31537 32562 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615603.1 protein_id gnl|my_center|LOCUS_37790 32831 33682 gene locus_tag LOCUS_37800 32831 33682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 33613 34905 gene locus_tag LOCUS_37810 33613 34905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 35170 34928 gene locus_tag LOCUS_37820 35170 34928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 35246 36841 gene locus_tag LOCUS_37830 35246 36841 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118026.1 protein_id gnl|my_center|LOCUS_37830 38611 37220 gene locus_tag LOCUS_37840 38611 37220 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_37840 39483 38716 gene locus_tag LOCUS_37850 39483 38716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 39746 40810 gene locus_tag LOCUS_37860 39746 40810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 40818 41039 gene locus_tag LOCUS_37870 40818 41039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 41268 41918 gene locus_tag LOCUS_37880 41268 41918 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143192.1 protein_id gnl|my_center|LOCUS_37880 >Feature sequence072 <1 2452 gene locus_tag LOCUS_37890 <1 2452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243665.1:tRNA nuclease WapA 5318 2514 gene locus_tag LOCUS_37900 5318 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 7766 5508 gene locus_tag LOCUS_37910 7766 5508 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121496.1 protein_id gnl|my_center|LOCUS_37910 8512 7763 gene locus_tag LOCUS_37920 8512 7763 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_37920 9656 8550 gene locus_tag LOCUS_37930 gene mqnC 9656 8550 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_37930 10422 9628 gene locus_tag LOCUS_37940 10422 9628 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_37940 10661 12163 gene locus_tag LOCUS_37950 10661 12163 CDS product ATPase with chaperone activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615735.1 protein_id gnl|my_center|LOCUS_37950 13446 12145 gene locus_tag LOCUS_37960 gene hemL 13446 12145 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331929.1 protein_id gnl|my_center|LOCUS_37960 15825 13471 gene locus_tag LOCUS_37970 15825 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 16905 16027 gene locus_tag LOCUS_37980 16905 16027 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_37980 17404 16922 gene locus_tag LOCUS_37990 gene greA 17404 16922 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339475.1 protein_id gnl|my_center|LOCUS_37990 18190 17651 gene locus_tag LOCUS_38000 18190 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 20323 18500 gene locus_tag LOCUS_38010 20323 18500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 23187 20425 gene locus_tag LOCUS_38020 23187 20425 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921396.1 protein_id gnl|my_center|LOCUS_38020 24030 23281 gene locus_tag LOCUS_38030 24030 23281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_38030 24655 26334 gene locus_tag LOCUS_38040 24655 26334 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_38040 26742 26434 gene locus_tag LOCUS_38050 26742 26434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 26665 27030 gene locus_tag LOCUS_38060 26665 27030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 27445 27125 gene locus_tag LOCUS_38070 gene lsrG 27445 27125 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098845.1 protein_id gnl|my_center|LOCUS_38070 30974 27657 gene locus_tag LOCUS_38080 30974 27657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 32124 31471 gene locus_tag LOCUS_38090 32124 31471 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_38090 33573 32155 gene locus_tag LOCUS_38100 gene pabB 33573 32155 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967940.1 protein_id gnl|my_center|LOCUS_38100 35000 33570 gene locus_tag LOCUS_38110 35000 33570 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118487.1 protein_id gnl|my_center|LOCUS_38110 35784 35005 gene locus_tag LOCUS_38120 35784 35005 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120816.1 protein_id gnl|my_center|LOCUS_38120 36394 35765 gene locus_tag LOCUS_38130 36394 35765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 37197 38405 gene locus_tag LOCUS_38140 37197 38405 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921970.1 protein_id gnl|my_center|LOCUS_38140 38402 39682 gene locus_tag LOCUS_38150 38402 39682 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921312.1 protein_id gnl|my_center|LOCUS_38150 40118 39660 gene locus_tag LOCUS_38160 40118 39660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 <41028 40304 gene locus_tag LOCUS_38170 <41028 40304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338728.1:DUF1559 domain-containing protein >Feature sequence073 111 335 gene locus_tag LOCUS_38180 111 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 1800 397 gene locus_tag LOCUS_38190 1800 397 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_38190 5293 1958 gene locus_tag LOCUS_38200 5293 1958 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766599.1 protein_id gnl|my_center|LOCUS_38200 5615 6106 gene locus_tag LOCUS_38210 5615 6106 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870310.1 protein_id gnl|my_center|LOCUS_38210 9961 6125 gene locus_tag LOCUS_38220 9961 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 10719 10294 gene locus_tag LOCUS_38230 10719 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 10755 11144 gene locus_tag LOCUS_38240 10755 11144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 14619 11089 gene locus_tag LOCUS_38250 14619 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 15059 14640 gene locus_tag LOCUS_38260 15059 14640 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_38260 16094 15075 gene locus_tag LOCUS_38270 16094 15075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 19239 16099 gene locus_tag LOCUS_38280 19239 16099 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123552.1 protein_id gnl|my_center|LOCUS_38280 22006 19718 gene locus_tag LOCUS_38290 22006 19718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 23543 22122 gene locus_tag LOCUS_38300 23543 22122 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_38300 24174 23596 gene locus_tag LOCUS_38310 24174 23596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 25613 24171 gene locus_tag LOCUS_38320 25613 24171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38320 27186 25858 gene locus_tag LOCUS_38330 27186 25858 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_38330 29674 27413 gene locus_tag LOCUS_38340 29674 27413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 29836 30699 gene locus_tag LOCUS_38350 29836 30699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 30708 32462 gene locus_tag LOCUS_38360 30708 32462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 34267 32678 gene locus_tag LOCUS_38370 34267 32678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 34546 35955 gene locus_tag LOCUS_38380 34546 35955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 36001 36618 gene locus_tag LOCUS_38390 36001 36618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 36608 36967 gene locus_tag LOCUS_38400 36608 36967 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_38400 36967 39336 gene locus_tag LOCUS_38410 36967 39336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615391.1 protein_id gnl|my_center|LOCUS_38410 39333 40259 gene locus_tag LOCUS_38420 39333 40259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_38420 40328 40750 gene locus_tag LOCUS_38430 40328 40750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 >Feature sequence074 522 1835 gene locus_tag LOCUS_38440 522 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 1851 6155 gene locus_tag LOCUS_38450 1851 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 6245 7024 gene locus_tag LOCUS_38460 6245 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 7216 8322 gene locus_tag LOCUS_38470 7216 8322 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615974.1 protein_id gnl|my_center|LOCUS_38470 8340 9320 gene locus_tag LOCUS_38480 8340 9320 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123498.1 protein_id gnl|my_center|LOCUS_38480 9465 10250 gene locus_tag LOCUS_38490 gene cyoE 9465 10250 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_38490 10872 10420 gene locus_tag LOCUS_38500 10872 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 13861 10877 gene locus_tag LOCUS_38510 13861 10877 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615526.1 protein_id gnl|my_center|LOCUS_38510 15405 14113 gene locus_tag LOCUS_38520 15405 14113 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922280.1 protein_id gnl|my_center|LOCUS_38520 15909 15457 gene locus_tag LOCUS_38530 15909 15457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 16033 16440 gene locus_tag LOCUS_38540 16033 16440 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853315.1 protein_id gnl|my_center|LOCUS_38540 16657 16992 gene locus_tag LOCUS_38550 16657 16992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 16986 18416 gene locus_tag LOCUS_38560 16986 18416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 18413 19669 gene locus_tag LOCUS_38570 18413 19669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 20630 19833 gene locus_tag LOCUS_38580 20630 19833 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_38580 21850 20714 gene locus_tag LOCUS_38590 gene dprA 21850 20714 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 protein_id gnl|my_center|LOCUS_38590 22974 21874 gene locus_tag LOCUS_38600 gene aroB 22974 21874 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846185.1 protein_id gnl|my_center|LOCUS_38600 23244 23023 gene locus_tag LOCUS_38610 23244 23023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 25797 23518 gene locus_tag LOCUS_38620 25797 23518 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122735.1 protein_id gnl|my_center|LOCUS_38620 28554 25885 gene locus_tag LOCUS_38630 28554 25885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 29380 28694 gene locus_tag LOCUS_38640 29380 28694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 29936 29682 gene locus_tag LOCUS_38650 29936 29682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 30014 31207 gene locus_tag LOCUS_38660 30014 31207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 33998 31251 gene locus_tag LOCUS_38670 33998 31251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 34376 35506 gene locus_tag LOCUS_38680 34376 35506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 35914 37263 gene locus_tag LOCUS_38690 35914 37263 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_38690 39544 37331 gene locus_tag LOCUS_38700 39544 37331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 >Feature sequence075 2 2569 gene locus_tag LOCUS_38710 2 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 2653 3564 gene locus_tag LOCUS_38720 2653 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 3566 5725 gene locus_tag LOCUS_38730 3566 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 9632 6318 gene locus_tag LOCUS_38740 gene carB 9632 6318 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123580.1 protein_id gnl|my_center|LOCUS_38740 12329 9882 gene locus_tag LOCUS_38750 12329 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 12588 13694 gene locus_tag LOCUS_38760 gene aroG 12588 13694 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_38760 13904 15325 gene locus_tag LOCUS_38770 13904 15325 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108982.1 protein_id gnl|my_center|LOCUS_38770 15788 15973 gene locus_tag LOCUS_38780 15788 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 15970 16314 gene locus_tag LOCUS_38790 15970 16314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 19250 16431 gene locus_tag LOCUS_38800 19250 16431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 20243 19587 gene locus_tag LOCUS_38810 20243 19587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 20273 20575 gene locus_tag LOCUS_38820 20273 20575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 21114 21656 gene locus_tag LOCUS_38830 gene hslV 21114 21656 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_38830 21644 22981 gene locus_tag LOCUS_38840 gene hslU 21644 22981 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081401.1 protein_id gnl|my_center|LOCUS_38840 25935 23143 gene locus_tag LOCUS_38850 25935 23143 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_38850 26549 26172 gene locus_tag LOCUS_38860 26549 26172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 26814 28517 gene locus_tag LOCUS_38870 26814 28517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 29974 28784 gene locus_tag LOCUS_38880 29974 28784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 31177 29978 gene locus_tag LOCUS_38890 31177 29978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 32136 31219 gene locus_tag LOCUS_38900 32136 31219 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454499.1 protein_id gnl|my_center|LOCUS_38900 32329 33123 gene locus_tag LOCUS_38910 32329 33123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 34826 33939 gene locus_tag LOCUS_38920 34826 33939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 36584 34845 gene locus_tag LOCUS_38930 36584 34845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 36989 37255 gene locus_tag LOCUS_38940 36989 37255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 37423 38343 gene locus_tag LOCUS_38950 37423 38343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 38537 38890 gene locus_tag LOCUS_38960 38537 38890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 >Feature sequence076 5604 1699 gene locus_tag LOCUS_38970 gene hrpA 5604 1699 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072088404.1 protein_id gnl|my_center|LOCUS_38970 6971 5613 gene locus_tag LOCUS_38980 6971 5613 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_38980 7319 7738 gene locus_tag LOCUS_38990 7319 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 7797 8966 gene locus_tag LOCUS_39000 7797 8966 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922784.1 protein_id gnl|my_center|LOCUS_39000 9010 9537 gene locus_tag LOCUS_39010 9010 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119839.1 protein_id gnl|my_center|LOCUS_39010 9591 11138 gene locus_tag LOCUS_39020 9591 11138 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 protein_id gnl|my_center|LOCUS_39020 11340 12032 gene locus_tag LOCUS_39030 11340 12032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119837.1 protein_id gnl|my_center|LOCUS_39030 12035 13177 gene locus_tag LOCUS_39040 12035 13177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922783.1 protein_id gnl|my_center|LOCUS_39040 14049 13702 gene locus_tag LOCUS_39050 14049 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 14130 14879 gene locus_tag LOCUS_39060 14130 14879 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_39060 15048 18743 gene locus_tag LOCUS_39070 15048 18743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 18982 18746 gene locus_tag LOCUS_39080 18982 18746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 20295 18979 gene locus_tag LOCUS_39090 20295 18979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 20819 20292 gene locus_tag LOCUS_39100 20819 20292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 20955 21668 gene locus_tag LOCUS_39110 20955 21668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 23207 21783 gene locus_tag LOCUS_39120 23207 21783 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_39120 23974 26160 gene locus_tag LOCUS_39130 23974 26160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 27320 26355 gene locus_tag LOCUS_39140 27320 26355 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 protein_id gnl|my_center|LOCUS_39140 28579 27317 gene locus_tag LOCUS_39150 28579 27317 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943127.1 protein_id gnl|my_center|LOCUS_39150 30203 28764 gene locus_tag LOCUS_39160 30203 28764 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_39160 31975 30557 gene locus_tag LOCUS_39170 31975 30557 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_39170 32316 33503 gene locus_tag LOCUS_39180 32316 33503 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_39180 33782 33582 gene locus_tag LOCUS_39190 33782 33582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 34210 33917 gene locus_tag LOCUS_39200 34210 33917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 35446 34301 gene locus_tag LOCUS_39210 35446 34301 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324978.1 protein_id gnl|my_center|LOCUS_39210 35806 36009 gene locus_tag LOCUS_39220 35806 36009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 36010 36438 gene locus_tag LOCUS_39230 36010 36438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 39291 36505 gene locus_tag LOCUS_39240 39291 36505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 >Feature sequence077 1761 313 gene locus_tag LOCUS_39250 1761 313 CDS product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387337.1 protein_id gnl|my_center|LOCUS_39250 3926 2070 gene locus_tag LOCUS_39260 3926 2070 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_39260 5035 4091 gene locus_tag LOCUS_39270 5035 4091 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922076.1 protein_id gnl|my_center|LOCUS_39270 5933 5025 gene locus_tag LOCUS_39280 gene murQ 5933 5025 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121425.1 protein_id gnl|my_center|LOCUS_39280 6188 7924 gene locus_tag LOCUS_39290 6188 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 8000 8869 gene locus_tag LOCUS_39300 8000 8869 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_39300 10043 9039 gene locus_tag LOCUS_39310 10043 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 10707 10156 gene locus_tag LOCUS_39320 10707 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 11250 11699 gene locus_tag LOCUS_39330 11250 11699 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403171.1 protein_id gnl|my_center|LOCUS_39330 11690 12247 gene locus_tag LOCUS_39340 11690 12247 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_39340 12312 12809 gene locus_tag LOCUS_39350 12312 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 12811 14037 gene locus_tag LOCUS_39360 12811 14037 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964319.1 protein_id gnl|my_center|LOCUS_39360 14038 14526 gene locus_tag LOCUS_39370 gene nuoE 14038 14526 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967798.1 protein_id gnl|my_center|LOCUS_39370 14537 15889 gene locus_tag LOCUS_39380 gene nuoF 14537 15889 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_39380 15907 17535 gene locus_tag LOCUS_39390 15907 17535 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_39390 17634 18872 gene locus_tag LOCUS_39400 gene nuoH 17634 18872 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104353.1 protein_id gnl|my_center|LOCUS_39400 18869 19501 gene locus_tag LOCUS_39410 18869 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 19498 20277 gene locus_tag LOCUS_39420 19498 20277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 20274 20726 gene locus_tag LOCUS_39430 20274 20726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 20719 22773 gene locus_tag LOCUS_39440 gene nuoL 20719 22773 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_39440 22781 26131 gene locus_tag LOCUS_39450 22781 26131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 26142 27530 gene locus_tag LOCUS_39460 26142 27530 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_39460 27645 28076 gene locus_tag LOCUS_39470 27645 28076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 28422 28093 gene locus_tag LOCUS_39480 28422 28093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 28674 30242 gene locus_tag LOCUS_39490 28674 30242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39490 30239 32653 gene locus_tag LOCUS_39500 30239 32653 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139545.1 protein_id gnl|my_center|LOCUS_39500 33802 32717 gene locus_tag LOCUS_39510 33802 32717 CDS product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120381.1 protein_id gnl|my_center|LOCUS_39510 34153 34884 gene locus_tag LOCUS_39520 34153 34884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_39520 34986 36839 gene locus_tag LOCUS_39530 34986 36839 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122406.1 protein_id gnl|my_center|LOCUS_39530 37037 37318 gene locus_tag LOCUS_39540 37037 37318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 38190 37372 gene locus_tag LOCUS_39550 38190 37372 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941117.1 protein_id gnl|my_center|LOCUS_39550 >Feature sequence078 505 233 gene locus_tag LOCUS_39560 505 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 749 1021 gene locus_tag LOCUS_39570 749 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 1394 2197 gene locus_tag LOCUS_39580 1394 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 7658 2457 gene locus_tag LOCUS_39590 7658 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 10620 7645 gene locus_tag LOCUS_39600 10620 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 12295 10646 gene locus_tag LOCUS_39610 12295 10646 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551607.1 protein_id gnl|my_center|LOCUS_39610 13547 13338 gene locus_tag LOCUS_39620 13547 13338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 14609 13770 gene locus_tag LOCUS_39630 14609 13770 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459931.1 protein_id gnl|my_center|LOCUS_39630 14868 15887 gene locus_tag LOCUS_39640 14868 15887 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_39640 16249 15788 gene locus_tag LOCUS_39650 16249 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 16287 17525 gene locus_tag LOCUS_39660 16287 17525 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462479.1 protein_id gnl|my_center|LOCUS_39660 17593 18249 gene locus_tag LOCUS_39670 17593 18249 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243002.1 protein_id gnl|my_center|LOCUS_39670 18422 19366 gene locus_tag LOCUS_39680 18422 19366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494081.1 protein_id gnl|my_center|LOCUS_39680 19378 20361 gene locus_tag LOCUS_39690 19378 20361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39690 20374 21384 gene locus_tag LOCUS_39700 20374 21384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39700 21402 22910 gene locus_tag LOCUS_39710 21402 22910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 23102 24208 gene locus_tag LOCUS_39720 23102 24208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 24392 25582 gene locus_tag LOCUS_39730 24392 25582 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_39730 25597 26607 gene locus_tag LOCUS_39740 25597 26607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 26607 27293 gene locus_tag LOCUS_39750 26607 27293 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026199.1 protein_id gnl|my_center|LOCUS_39750 27443 29095 gene locus_tag LOCUS_39760 27443 29095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 30383 29169 gene locus_tag LOCUS_39770 30383 29169 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_39770 31630 30398 gene locus_tag LOCUS_39780 31630 30398 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_39780 32730 31687 gene locus_tag LOCUS_39790 32730 31687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 33810 33067 gene locus_tag LOCUS_39800 33810 33067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 36640 34061 gene locus_tag LOCUS_39810 36640 34061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 >Feature sequence079 1839 715 gene locus_tag LOCUS_39820 gene mnmE 1839 715 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_39820 5279 1836 gene locus_tag LOCUS_39830 5279 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 6403 5330 gene locus_tag LOCUS_39840 gene hypE 6403 5330 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893646.1 protein_id gnl|my_center|LOCUS_39840 6853 6518 gene locus_tag LOCUS_39850 6853 6518 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327966.1 protein_id gnl|my_center|LOCUS_39850 7653 6940 gene locus_tag LOCUS_39860 7653 6940 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121230.1 protein_id gnl|my_center|LOCUS_39860 8023 7805 gene locus_tag LOCUS_39870 8023 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 8056 8472 gene locus_tag LOCUS_39880 8056 8472 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_39880 8987 8481 gene locus_tag LOCUS_39890 8987 8481 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_39890 9544 11016 gene locus_tag LOCUS_39900 9544 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435122.1 protein_id gnl|my_center|LOCUS_39900 11254 13443 gene locus_tag LOCUS_39910 11254 13443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 14734 13460 gene locus_tag LOCUS_39920 14734 13460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 16364 14973 gene locus_tag LOCUS_39930 gene gdhA 16364 14973 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094817.1 protein_id gnl|my_center|LOCUS_39930 16832 16497 gene locus_tag LOCUS_39940 16832 16497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 18760 17321 gene locus_tag LOCUS_39950 18760 17321 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_39950 20640 18772 gene locus_tag LOCUS_39960 20640 18772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 23774 20637 gene locus_tag LOCUS_39970 23774 20637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 24811 23840 gene locus_tag LOCUS_39980 24811 23840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 26092 25169 gene locus_tag LOCUS_39990 26092 25169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 26188 29616 gene locus_tag LOCUS_40000 26188 29616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 30194 29814 gene locus_tag LOCUS_40010 30194 29814 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312649.1 protein_id gnl|my_center|LOCUS_40010 30501 30199 gene locus_tag LOCUS_40020 30501 30199 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971536.1 protein_id gnl|my_center|LOCUS_40020 30792 32141 gene locus_tag LOCUS_40030 30792 32141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 33477 32221 gene locus_tag LOCUS_40040 33477 32221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 33774 35156 gene locus_tag LOCUS_40050 33774 35156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 35723 36574 gene locus_tag LOCUS_40060 35723 36574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 36778 37041 gene locus_tag LOCUS_40070 36778 37041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 37048 37245 gene locus_tag LOCUS_40080 37048 37245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 >Feature sequence080 138 479 gene locus_tag LOCUS_40090 138 479 CDS product DUF5320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392926.1 protein_id gnl|my_center|LOCUS_40090 543 1274 gene locus_tag LOCUS_40100 543 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 1324 2046 gene locus_tag LOCUS_40110 1324 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 2068 3975 gene locus_tag LOCUS_40120 2068 3975 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113078.1 protein_id gnl|my_center|LOCUS_40120 3972 4991 gene locus_tag LOCUS_40130 3972 4991 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582429.1 protein_id gnl|my_center|LOCUS_40130 4994 5998 gene locus_tag LOCUS_40140 4994 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 5995 8028 gene locus_tag LOCUS_40150 5995 8028 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269414.1 protein_id gnl|my_center|LOCUS_40150 8076 9263 gene locus_tag LOCUS_40160 8076 9263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 9876 10298 gene locus_tag LOCUS_40170 9876 10298 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454293.1 protein_id gnl|my_center|LOCUS_40170 10689 12110 gene locus_tag LOCUS_40180 10689 12110 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_40180 12179 12490 gene locus_tag LOCUS_40190 12179 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 12524 12928 gene locus_tag LOCUS_40200 12524 12928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 14181 12967 gene locus_tag LOCUS_40210 14181 12967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 14238 14378 gene locus_tag LOCUS_40220 14238 14378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 14621 14391 gene locus_tag LOCUS_40230 14621 14391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 15070 14633 gene locus_tag LOCUS_40240 15070 14633 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 protein_id gnl|my_center|LOCUS_40240 16511 15369 gene locus_tag LOCUS_40250 16511 15369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 16825 16508 gene locus_tag LOCUS_40260 16825 16508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 18902 16818 gene locus_tag LOCUS_40270 gene hdrA 18902 16818 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_40270 20289 18889 gene locus_tag LOCUS_40280 20289 18889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 20513 20319 gene locus_tag LOCUS_40290 20513 20319 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430011.1 protein_id gnl|my_center|LOCUS_40290 21057 20647 gene locus_tag LOCUS_40300 21057 20647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 21320 21066 gene locus_tag LOCUS_40310 21320 21066 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_40310 21713 21351 gene locus_tag LOCUS_40320 21713 21351 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391975.1 protein_id gnl|my_center|LOCUS_40320 22123 21749 gene locus_tag LOCUS_40330 22123 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 22314 22658 gene locus_tag LOCUS_40340 22314 22658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 22676 23014 gene locus_tag LOCUS_40350 22676 23014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392788.1 protein_id gnl|my_center|LOCUS_40350 23386 23910 gene locus_tag LOCUS_40360 23386 23910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 24212 23907 gene locus_tag LOCUS_40370 24212 23907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 24504 24950 gene locus_tag LOCUS_40380 24504 24950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 25119 25901 gene locus_tag LOCUS_40390 25119 25901 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921674.1 protein_id gnl|my_center|LOCUS_40390 25907 27526 gene locus_tag LOCUS_40400 gene nadB 25907 27526 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_40400 27566 28153 gene locus_tag LOCUS_40410 27566 28153 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_40410 28227 28940 gene locus_tag LOCUS_40420 28227 28940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 29503 28934 gene locus_tag LOCUS_40430 29503 28934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 29891 29409 gene locus_tag LOCUS_40440 29891 29409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 30133 29903 gene locus_tag LOCUS_40450 30133 29903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 31673 30396 gene locus_tag LOCUS_40460 31673 30396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 32498 31956 gene locus_tag LOCUS_40470 32498 31956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 32388 32681 gene locus_tag LOCUS_40480 32388 32681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 33122 32712 gene locus_tag LOCUS_40490 33122 32712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 35574 33097 gene locus_tag LOCUS_40500 35574 33097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 >Feature sequence081 399 109 gene locus_tag LOCUS_40510 399 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 804 520 gene locus_tag LOCUS_40520 804 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 2036 813 gene locus_tag LOCUS_40530 2036 813 CDS product DUF1887 family CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545976.1 protein_id gnl|my_center|LOCUS_40530 2961 2050 gene locus_tag LOCUS_40540 gene cas6 2961 2050 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388907.1 protein_id gnl|my_center|LOCUS_40540 5843 3339 gene locus_tag LOCUS_40550 5843 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 6283 5867 gene locus_tag LOCUS_40560 6283 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 7211 6297 gene locus_tag LOCUS_40570 gene cmr4 7211 6297 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 protein_id gnl|my_center|LOCUS_40570 8388 7189 gene locus_tag LOCUS_40580 8388 7189 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229143.1 protein_id gnl|my_center|LOCUS_40580 11009 8385 gene locus_tag LOCUS_40590 11009 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 12309 12088 gene locus_tag LOCUS_40600 12309 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 12196 12591 gene locus_tag LOCUS_40610 12196 12591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 12689 13060 gene locus_tag LOCUS_40620 12689 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 13320 14654 gene locus_tag LOCUS_40630 13320 14654 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_40630 14747 15055 gene locus_tag LOCUS_40640 14747 15055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 15522 15217 gene locus_tag LOCUS_40650 15522 15217 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883135.1 protein_id gnl|my_center|LOCUS_40650 16223 15519 gene locus_tag LOCUS_40660 16223 15519 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_40660 17479 16244 gene locus_tag LOCUS_40670 17479 16244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 17506 17745 gene locus_tag LOCUS_40680 17506 17745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 17800 20337 gene locus_tag LOCUS_40690 17800 20337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 20714 20388 gene locus_tag LOCUS_40700 20714 20388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 22986 21661 gene locus_tag LOCUS_40710 22986 21661 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_40710 23228 24310 gene locus_tag LOCUS_40720 23228 24310 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870305.1 protein_id gnl|my_center|LOCUS_40720 24321 25913 gene locus_tag LOCUS_40730 24321 25913 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_40730 25924 28041 gene locus_tag LOCUS_40740 25924 28041 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_40740 28060 28842 gene locus_tag LOCUS_40750 gene kdsB 28060 28842 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123860.1 protein_id gnl|my_center|LOCUS_40750 29128 30813 gene locus_tag LOCUS_40760 29128 30813 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_40760 30810 31235 gene locus_tag LOCUS_40770 30810 31235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 31879 31394 gene locus_tag LOCUS_40780 31879 31394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 33569 32223 gene locus_tag LOCUS_40790 33569 32223 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_40790 33722 34354 gene locus_tag LOCUS_40800 33722 34354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 34351 36486 gene locus_tag LOCUS_40810 gene yagF 34351 36486 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_40810 >Feature sequence082 225 494 gene locus_tag LOCUS_40820 225 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 491 1768 gene locus_tag LOCUS_40830 491 1768 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_40830 1806 3884 gene locus_tag LOCUS_40840 1806 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 4315 4488 gene locus_tag LOCUS_40850 4315 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 5291 4608 gene locus_tag LOCUS_40860 5291 4608 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_40860 5638 5856 gene locus_tag LOCUS_40870 5638 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 6719 5829 gene locus_tag LOCUS_40880 6719 5829 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481395.1 protein_id gnl|my_center|LOCUS_40880 9676 6737 gene locus_tag LOCUS_40890 9676 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 12135 9673 gene locus_tag LOCUS_40900 12135 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 13022 12303 gene locus_tag LOCUS_40910 13022 12303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 20419 13169 gene locus_tag LOCUS_40920 20419 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 21189 21419 gene locus_tag LOCUS_40930 21189 21419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 22844 21477 gene locus_tag LOCUS_40940 22844 21477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 23691 29777 gene locus_tag LOCUS_40950 23691 29777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 30578 32269 gene locus_tag LOCUS_40960 30578 32269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 32949 34565 gene locus_tag LOCUS_40970 32949 34565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 >Feature sequence083 2107 482 gene locus_tag LOCUS_40980 2107 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_40980 2841 2104 gene locus_tag LOCUS_40990 2841 2104 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_40990 2975 4924 gene locus_tag LOCUS_41000 gene selB 2975 4924 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_41000 5261 5533 gene locus_tag LOCUS_41010 5261 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 5530 5937 gene locus_tag LOCUS_41020 5530 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 9497 6072 gene locus_tag LOCUS_41030 9497 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 9848 10930 gene locus_tag LOCUS_41040 9848 10930 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122045.1 protein_id gnl|my_center|LOCUS_41040 11010 13727 gene locus_tag LOCUS_41050 gene acnA 11010 13727 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118669.1 protein_id gnl|my_center|LOCUS_41050 15833 13743 gene locus_tag LOCUS_41060 15833 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 17291 16221 gene locus_tag LOCUS_41070 17291 16221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 18475 17303 gene locus_tag LOCUS_41080 18475 17303 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324978.1 protein_id gnl|my_center|LOCUS_41080 18637 20022 gene locus_tag LOCUS_41090 18637 20022 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258475.1 protein_id gnl|my_center|LOCUS_41090 20072 22219 gene locus_tag LOCUS_41100 20072 22219 CDS product enterotoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703586.1 protein_id gnl|my_center|LOCUS_41100 22357 23184 gene locus_tag LOCUS_41110 22357 23184 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_41110 23374 25104 gene locus_tag LOCUS_41120 23374 25104 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933778.1 protein_id gnl|my_center|LOCUS_41120 25131 26057 gene locus_tag LOCUS_41130 25131 26057 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_41130 26047 27117 gene locus_tag LOCUS_41140 26047 27117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 27189 28163 gene locus_tag LOCUS_41150 27189 28163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 28402 29175 gene locus_tag LOCUS_41160 28402 29175 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_41160 29393 32134 gene locus_tag LOCUS_41170 29393 32134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 32170 33780 gene locus_tag LOCUS_41180 32170 33780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 35132 34125 gene locus_tag LOCUS_41190 35132 34125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 35773 36117 gene locus_tag LOCUS_41200 35773 36117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 >Feature sequence084 4732 1676 gene locus_tag LOCUS_41210 4732 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 5130 6737 gene locus_tag LOCUS_41220 5130 6737 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118144.1 protein_id gnl|my_center|LOCUS_41220 8374 6809 gene locus_tag LOCUS_41230 8374 6809 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146502713.1 protein_id gnl|my_center|LOCUS_41230 9788 8433 gene locus_tag LOCUS_41240 9788 8433 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_41240 10032 10472 gene locus_tag LOCUS_41250 10032 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 10385 10684 gene locus_tag LOCUS_41260 10385 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 11242 13029 gene locus_tag LOCUS_41270 11242 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 14676 13519 gene locus_tag LOCUS_41280 14676 13519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 15658 14669 gene locus_tag LOCUS_41290 15658 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 16953 16378 gene locus_tag LOCUS_41300 16953 16378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41300 19826 17055 gene locus_tag LOCUS_41310 19826 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 21438 19990 gene locus_tag LOCUS_41320 21438 19990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 24840 21532 gene locus_tag LOCUS_41330 24840 21532 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_41330 25218 27200 gene locus_tag LOCUS_41340 25218 27200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 28382 27240 gene locus_tag LOCUS_41350 28382 27240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 29073 28408 gene locus_tag LOCUS_41360 29073 28408 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123154.1 protein_id gnl|my_center|LOCUS_41360 29256 30647 gene locus_tag LOCUS_41370 29256 30647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 31048 32220 gene locus_tag LOCUS_41380 31048 32220 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_41380 32248 32748 gene locus_tag LOCUS_41390 32248 32748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 34614 33160 gene locus_tag LOCUS_41400 34614 33160 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_41400 35147 35764 gene locus_tag LOCUS_41410 35147 35764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 36030 36509 gene locus_tag LOCUS_41420 36030 36509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 >Feature sequence085 3 1931 gene locus_tag LOCUS_41430 3 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 2172 2765 gene locus_tag LOCUS_41440 2172 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 6137 2862 gene locus_tag LOCUS_41450 6137 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 6539 6195 gene locus_tag LOCUS_41460 6539 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 8523 7114 gene locus_tag LOCUS_41470 8523 7114 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_41470 12475 8783 gene locus_tag LOCUS_41480 12475 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 15610 12497 gene locus_tag LOCUS_41490 15610 12497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 16055 17632 gene locus_tag LOCUS_41500 16055 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 18982 17759 gene locus_tag LOCUS_41510 18982 17759 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922057.1 protein_id gnl|my_center|LOCUS_41510 19855 19109 gene locus_tag LOCUS_41520 19855 19109 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328055.1 protein_id gnl|my_center|LOCUS_41520 20495 21433 gene locus_tag LOCUS_41530 20495 21433 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921954.1 protein_id gnl|my_center|LOCUS_41530 21800 23458 gene locus_tag LOCUS_41540 21800 23458 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669321.1 protein_id gnl|my_center|LOCUS_41540 23550 25139 gene locus_tag LOCUS_41550 23550 25139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 25173 27701 gene locus_tag LOCUS_41560 25173 27701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 27752 28906 gene locus_tag LOCUS_41570 27752 28906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 28999 29226 gene locus_tag LOCUS_41580 28999 29226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 29629 29426 gene locus_tag LOCUS_41590 29629 29426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 29931 29626 gene locus_tag LOCUS_41600 29931 29626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 30332 29907 gene locus_tag LOCUS_41610 30332 29907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 30798 30430 gene locus_tag LOCUS_41620 30798 30430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 31022 30795 gene locus_tag LOCUS_41630 31022 30795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 31684 31271 gene locus_tag LOCUS_41640 31684 31271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 32263 31814 gene locus_tag LOCUS_41650 32263 31814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 32490 32263 gene locus_tag LOCUS_41660 32490 32263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 33139 32759 gene locus_tag LOCUS_41670 33139 32759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 33639 33238 gene locus_tag LOCUS_41680 33639 33238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 33966 33766 gene locus_tag LOCUS_41690 33966 33766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 34247 33963 gene locus_tag LOCUS_41700 34247 33963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 35025 34477 gene locus_tag LOCUS_41710 35025 34477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 <36569 35363 gene locus_tag LOCUS_41720 <36569 35363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_138390504.1:IS91 family transposase >Feature sequence086 660 2144 gene locus_tag LOCUS_41730 gene ffh 660 2144 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_41730 2228 2614 gene locus_tag LOCUS_41740 2228 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 2621 3364 gene locus_tag LOCUS_41750 gene trmD 2621 3364 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123923.1 protein_id gnl|my_center|LOCUS_41750 3361 3792 gene locus_tag LOCUS_41760 gene rplS 3361 3792 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 protein_id gnl|my_center|LOCUS_41760 3829 4269 gene locus_tag LOCUS_41770 3829 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 4329 4676 gene locus_tag LOCUS_41780 4329 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 4843 7278 gene locus_tag LOCUS_41790 4843 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099150691.1 protein_id gnl|my_center|LOCUS_41790 8703 7369 gene locus_tag LOCUS_41800 8703 7369 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_41800 10621 8852 gene locus_tag LOCUS_41810 10621 8852 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_41810 10838 11953 gene locus_tag LOCUS_41820 10838 11953 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922273.1 protein_id gnl|my_center|LOCUS_41820 12031 12627 gene locus_tag LOCUS_41830 12031 12627 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122486.1 protein_id gnl|my_center|LOCUS_41830 12672 15776 gene locus_tag LOCUS_41840 12672 15776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 15773 16312 gene locus_tag LOCUS_41850 gene hpt 15773 16312 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327769.1 protein_id gnl|my_center|LOCUS_41850 16309 17478 gene locus_tag LOCUS_41860 16309 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 17523 18620 gene locus_tag LOCUS_41870 17523 18620 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_41870 18830 20785 gene locus_tag LOCUS_41880 gene asnB 18830 20785 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_41880 20899 21873 gene locus_tag LOCUS_41890 20899 21873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 22114 24207 gene locus_tag LOCUS_41900 22114 24207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 24255 25808 gene locus_tag LOCUS_41910 24255 25808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 26182 27234 gene locus_tag LOCUS_41920 26182 27234 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325404.1 protein_id gnl|my_center|LOCUS_41920 27918 28427 gene locus_tag LOCUS_41930 27918 28427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 29289 28444 gene locus_tag LOCUS_41940 29289 28444 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336481.1 protein_id gnl|my_center|LOCUS_41940 29544 29804 gene locus_tag LOCUS_41950 29544 29804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 31056 29779 gene locus_tag LOCUS_41960 31056 29779 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_41960 33076 31238 gene locus_tag LOCUS_41970 33076 31238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 33503 33180 gene locus_tag LOCUS_41980 33503 33180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330016.1 protein_id gnl|my_center|LOCUS_41980 34891 33572 gene locus_tag LOCUS_41990 34891 33572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 35077 35862 gene locus_tag LOCUS_42000 35077 35862 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121390.1 protein_id gnl|my_center|LOCUS_42000 36006 36365 gene locus_tag LOCUS_tm00010 36006 36365 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence087 181 852 gene locus_tag LOCUS_42010 181 852 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112457.1 protein_id gnl|my_center|LOCUS_42010 987 1556 gene locus_tag LOCUS_42020 987 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 1626 1928 gene locus_tag LOCUS_42030 1626 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 2843 2493 gene locus_tag LOCUS_42040 2843 2493 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190909147.1 protein_id gnl|my_center|LOCUS_42040 3124 2843 gene locus_tag LOCUS_42050 3124 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 4135 5118 gene locus_tag LOCUS_42060 4135 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 5115 5612 gene locus_tag LOCUS_42070 5115 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 5669 6559 gene locus_tag LOCUS_42080 5669 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 8072 6996 gene locus_tag LOCUS_42090 8072 6996 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_42090 8425 9501 gene locus_tag LOCUS_42100 8425 9501 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072538.1 protein_id gnl|my_center|LOCUS_42100 9536 10048 gene locus_tag LOCUS_42110 9536 10048 CDS product DUF1569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669324.1 protein_id gnl|my_center|LOCUS_42110 11070 10144 gene locus_tag LOCUS_42120 gene rbsK 11070 10144 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077610.1 protein_id gnl|my_center|LOCUS_42120 12471 11074 gene locus_tag LOCUS_42130 12471 11074 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123471.1 protein_id gnl|my_center|LOCUS_42130 14887 12479 gene locus_tag LOCUS_42140 14887 12479 CDS product YidC/Oxa1 family insertase periplasmic-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615850.1 protein_id gnl|my_center|LOCUS_42140 15816 15061 gene locus_tag LOCUS_42150 15816 15061 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_42150 16027 16701 gene locus_tag LOCUS_42160 gene tsaB 16027 16701 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817349.1 protein_id gnl|my_center|LOCUS_42160 16872 17444 gene locus_tag LOCUS_42170 16872 17444 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_42170 17489 20017 gene locus_tag LOCUS_42180 17489 20017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 20181 21431 gene locus_tag LOCUS_42190 20181 21431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 22826 22365 gene locus_tag LOCUS_42200 22826 22365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 22890 23144 gene locus_tag LOCUS_42210 22890 23144 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265886.1 protein_id gnl|my_center|LOCUS_42210 23168 23482 gene locus_tag LOCUS_42220 23168 23482 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143494.1 protein_id gnl|my_center|LOCUS_42220 24201 24461 gene locus_tag LOCUS_42230 24201 24461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 25566 25790 gene locus_tag LOCUS_42240 25566 25790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 25957 26196 gene locus_tag LOCUS_42250 25957 26196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 26689 26303 gene locus_tag LOCUS_42260 26689 26303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 27198 28823 gene locus_tag LOCUS_42270 27198 28823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 28738 29772 gene locus_tag LOCUS_42280 28738 29772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 30038 31669 gene locus_tag LOCUS_42290 30038 31669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 31925 34741 gene locus_tag LOCUS_42300 31925 34741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 34744 35433 gene locus_tag LOCUS_42310 34744 35433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 36074 35466 gene locus_tag LOCUS_42320 36074 35466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 36258 36058 gene locus_tag LOCUS_42330 36258 36058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 >Feature sequence088 1343 351 gene locus_tag LOCUS_42340 1343 351 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329702.1 protein_id gnl|my_center|LOCUS_42340 2387 1470 gene locus_tag LOCUS_42350 2387 1470 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329701.1 protein_id gnl|my_center|LOCUS_42350 4222 2387 gene locus_tag LOCUS_42360 4222 2387 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123940.1 protein_id gnl|my_center|LOCUS_42360 4374 4877 gene locus_tag LOCUS_42370 4374 4877 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404532.1 protein_id gnl|my_center|LOCUS_42370 5135 4893 gene locus_tag LOCUS_42380 5135 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 5846 7159 gene locus_tag LOCUS_42390 5846 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 7162 7752 gene locus_tag LOCUS_42400 7162 7752 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258090.1 protein_id gnl|my_center|LOCUS_42400 8031 8933 gene locus_tag LOCUS_42410 8031 8933 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615454.1 protein_id gnl|my_center|LOCUS_42410 8976 9392 gene locus_tag LOCUS_42420 8976 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 9666 10295 gene locus_tag LOCUS_42430 9666 10295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 10592 11092 gene locus_tag LOCUS_42440 10592 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 12728 11250 gene locus_tag LOCUS_42450 12728 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 13819 14442 gene locus_tag LOCUS_42460 13819 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 15966 14524 gene locus_tag LOCUS_42470 15966 14524 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 protein_id gnl|my_center|LOCUS_42470 20185 15959 gene locus_tag LOCUS_42480 gene gltB 20185 15959 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_42480 17179 17080 gene locus_tag LOCUS_t00230 17179 17080 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20303 20488 gene locus_tag LOCUS_42490 20303 20488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 21347 20826 gene locus_tag LOCUS_42500 21347 20826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 21925 21344 gene locus_tag LOCUS_42510 21925 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 23154 21922 gene locus_tag LOCUS_42520 23154 21922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 23511 23747 gene locus_tag LOCUS_42530 23511 23747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 23757 24608 gene locus_tag LOCUS_42540 23757 24608 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_42540 24881 26488 gene locus_tag LOCUS_42550 24881 26488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 26505 26987 gene locus_tag LOCUS_42560 26505 26987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 28432 27014 gene locus_tag LOCUS_42570 28432 27014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 28984 30207 gene locus_tag LOCUS_42580 28984 30207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 30394 30669 gene locus_tag LOCUS_42590 30394 30669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 31394 30813 gene locus_tag LOCUS_42600 31394 30813 CDS product transcription termination/antitermination NusG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327462.1 protein_id gnl|my_center|LOCUS_42600 32308 31415 gene locus_tag LOCUS_42610 gene galU 32308 31415 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_42610 32502 34382 gene locus_tag LOCUS_42620 32502 34382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 36051 34600 gene locus_tag LOCUS_42630 gene pyk 36051 34600 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058108.1 protein_id gnl|my_center|LOCUS_42630 35993 36289 gene locus_tag LOCUS_42640 35993 36289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 >Feature sequence089 2893 107 gene locus_tag LOCUS_42650 2893 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 3947 5335 gene locus_tag LOCUS_42660 3947 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 5577 6941 gene locus_tag LOCUS_42670 5577 6941 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_42670 9980 7155 gene locus_tag LOCUS_42680 9980 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 10542 10321 gene locus_tag LOCUS_42690 10542 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 11313 10705 gene locus_tag LOCUS_42700 11313 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 11722 13095 gene locus_tag LOCUS_42710 11722 13095 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_42710 13260 16190 gene locus_tag LOCUS_42720 13260 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 16243 17151 gene locus_tag LOCUS_42730 16243 17151 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_42730 17688 17239 gene locus_tag LOCUS_42740 17688 17239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 17981 17685 gene locus_tag LOCUS_42750 17981 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 19121 19282 gene locus_tag LOCUS_42760 19121 19282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 20356 19346 gene locus_tag LOCUS_42770 20356 19346 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083552.1 protein_id gnl|my_center|LOCUS_42770 22264 21515 gene locus_tag LOCUS_42780 22264 21515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 25228 22304 gene locus_tag LOCUS_42790 25228 22304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 25637 27811 gene locus_tag LOCUS_42800 25637 27811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 29386 27971 gene locus_tag LOCUS_42810 29386 27971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 30260 29754 gene locus_tag LOCUS_42820 30260 29754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 30553 30260 gene locus_tag LOCUS_42830 30553 30260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 30941 33997 gene locus_tag LOCUS_42840 30941 33997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 34076 35632 gene locus_tag LOCUS_42850 34076 35632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 35798 36007 gene locus_tag LOCUS_42860 35798 36007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 >Feature sequence090 2191 1265 gene locus_tag LOCUS_42870 2191 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 2509 2273 gene locus_tag LOCUS_42880 2509 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 3294 2563 gene locus_tag LOCUS_42890 3294 2563 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229964.1 protein_id gnl|my_center|LOCUS_42890 5830 3599 gene locus_tag LOCUS_42900 5830 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 6991 5876 gene locus_tag LOCUS_42910 6991 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 10395 6997 gene locus_tag LOCUS_42920 10395 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 11009 10581 gene locus_tag LOCUS_42930 11009 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 12119 11115 gene locus_tag LOCUS_42940 12119 11115 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_42940 13380 12241 gene locus_tag LOCUS_42950 13380 12241 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_42950 14153 13725 gene locus_tag LOCUS_42960 14153 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 14374 14769 gene locus_tag LOCUS_42970 14374 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 15274 14927 gene locus_tag LOCUS_42980 15274 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 17447 15357 gene locus_tag LOCUS_42990 17447 15357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 18173 17538 gene locus_tag LOCUS_43000 18173 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 18964 18266 gene locus_tag LOCUS_43010 18964 18266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 20549 19293 gene locus_tag LOCUS_43020 20549 19293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 21422 20592 gene locus_tag LOCUS_43030 21422 20592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 22025 22567 gene locus_tag LOCUS_43040 22025 22567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 24089 22716 gene locus_tag LOCUS_43050 24089 22716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 24375 25604 gene locus_tag LOCUS_43060 24375 25604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 25629 26933 gene locus_tag LOCUS_43070 25629 26933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 28026 27118 gene locus_tag LOCUS_43080 28026 27118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 27923 28159 gene locus_tag LOCUS_43090 27923 28159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 29027 28188 gene locus_tag LOCUS_43100 29027 28188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 29460 31172 gene locus_tag LOCUS_43110 29460 31172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 31903 31178 gene locus_tag LOCUS_43120 31903 31178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 32959 33294 gene locus_tag LOCUS_43130 32959 33294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 33359 33751 gene locus_tag LOCUS_43140 33359 33751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 33748 34842 gene locus_tag LOCUS_43150 33748 34842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 34860 35486 gene locus_tag LOCUS_43160 34860 35486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 35498 35758 gene locus_tag LOCUS_43170 35498 35758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 >Feature sequence091 1759 308 gene locus_tag LOCUS_43180 1759 308 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_43180 2734 2375 gene locus_tag LOCUS_43190 2734 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 3131 2901 gene locus_tag LOCUS_43200 3131 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 3584 3360 gene locus_tag LOCUS_43210 3584 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 5230 3581 gene locus_tag LOCUS_43220 5230 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 10799 5124 gene locus_tag LOCUS_43230 10799 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 11572 11186 gene locus_tag LOCUS_43240 11572 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 11508 12515 gene locus_tag LOCUS_43250 11508 12515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 14731 12581 gene locus_tag LOCUS_43260 14731 12581 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_43260 15392 14778 gene locus_tag LOCUS_43270 15392 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 16037 15438 gene locus_tag LOCUS_43280 16037 15438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 16367 16113 gene locus_tag LOCUS_43290 16367 16113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 16257 19196 gene locus_tag LOCUS_43300 16257 19196 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_43300 19393 20763 gene locus_tag LOCUS_43310 19393 20763 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 protein_id gnl|my_center|LOCUS_43310 20760 21368 gene locus_tag LOCUS_43320 20760 21368 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762097.1 protein_id gnl|my_center|LOCUS_43320 21557 21814 gene locus_tag LOCUS_43330 21557 21814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 22298 21984 gene locus_tag LOCUS_43340 22298 21984 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_43340 22568 24019 gene locus_tag LOCUS_43350 22568 24019 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_43350 24019 26286 gene locus_tag LOCUS_43360 24019 26286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 26622 27677 gene locus_tag LOCUS_43370 26622 27677 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_43370 27634 28536 gene locus_tag LOCUS_43380 27634 28536 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_43380 28668 30863 gene locus_tag LOCUS_43390 28668 30863 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117947.1 protein_id gnl|my_center|LOCUS_43390 30860 33241 gene locus_tag LOCUS_43400 30860 33241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 33607 33140 gene locus_tag LOCUS_43410 33607 33140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 >Feature sequence092 9457 8621 gene locus_tag LOCUS_43420 9457 8621 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921729.1 protein_id gnl|my_center|LOCUS_43420 10564 9752 gene locus_tag LOCUS_43430 10564 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921730.1 protein_id gnl|my_center|LOCUS_43430 12152 11043 gene locus_tag LOCUS_43440 12152 11043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 12500 13546 gene locus_tag LOCUS_43450 12500 13546 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_43450 13543 13878 gene locus_tag LOCUS_43460 13543 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 13946 15145 gene locus_tag LOCUS_43470 13946 15145 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121268.1 protein_id gnl|my_center|LOCUS_43470 16100 15249 gene locus_tag LOCUS_43480 16100 15249 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921729.1 protein_id gnl|my_center|LOCUS_43480 17030 16254 gene locus_tag LOCUS_43490 17030 16254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921730.1 protein_id gnl|my_center|LOCUS_43490 18577 17594 gene locus_tag LOCUS_43500 18577 17594 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 protein_id gnl|my_center|LOCUS_43500 19196 20398 gene locus_tag LOCUS_43510 19196 20398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 20450 21355 gene locus_tag LOCUS_43520 20450 21355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 21364 23586 gene locus_tag LOCUS_43530 21364 23586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 23646 25022 gene locus_tag LOCUS_43540 23646 25022 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110781.1 protein_id gnl|my_center|LOCUS_43540 25019 26164 gene locus_tag LOCUS_43550 25019 26164 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_43550 26167 27069 gene locus_tag LOCUS_43560 26167 27069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 27194 27850 gene locus_tag LOCUS_43570 27194 27850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 27865 28758 gene locus_tag LOCUS_43580 27865 28758 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_43580 28801 30363 gene locus_tag LOCUS_43590 28801 30363 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 protein_id gnl|my_center|LOCUS_43590 30524 31252 gene locus_tag LOCUS_43600 30524 31252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 31254 33521 gene locus_tag LOCUS_43610 31254 33521 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122749.1 protein_id gnl|my_center|LOCUS_43610 >Feature sequence093 327 632 gene locus_tag LOCUS_43620 327 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 1120 914 gene locus_tag LOCUS_43630 1120 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 1754 1125 gene locus_tag LOCUS_43640 1754 1125 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_43640 1766 2095 gene locus_tag LOCUS_43650 1766 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 4975 2126 gene locus_tag LOCUS_43660 4975 2126 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142749.1 protein_id gnl|my_center|LOCUS_43660 5939 5247 gene locus_tag LOCUS_43670 5939 5247 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964173.1 protein_id gnl|my_center|LOCUS_43670 6184 9708 gene locus_tag LOCUS_43680 6184 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 11468 9936 gene locus_tag LOCUS_43690 11468 9936 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_43690 11764 12444 gene locus_tag LOCUS_43700 11764 12444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 12441 12770 gene locus_tag LOCUS_43710 12441 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 14273 12885 gene locus_tag LOCUS_43720 14273 12885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 14472 18611 gene locus_tag LOCUS_43730 14472 18611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 19124 18693 gene locus_tag LOCUS_43740 19124 18693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 20143 19124 gene locus_tag LOCUS_43750 20143 19124 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_43750 20879 22270 gene locus_tag LOCUS_43760 20879 22270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 22501 23691 gene locus_tag LOCUS_43770 22501 23691 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868029.1 protein_id gnl|my_center|LOCUS_43770 23737 24495 gene locus_tag LOCUS_43780 23737 24495 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932495.1 protein_id gnl|my_center|LOCUS_43780 25526 24564 gene locus_tag LOCUS_43790 25526 24564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 26700 25552 gene locus_tag LOCUS_43800 gene mdtA 26700 25552 CDS product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678939.1 protein_id gnl|my_center|LOCUS_43800 29932 26705 gene locus_tag LOCUS_43810 29932 26705 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_43810 31249 30059 gene locus_tag LOCUS_43820 31249 30059 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015603286.1 protein_id gnl|my_center|LOCUS_43820 32674 31280 gene locus_tag LOCUS_43830 32674 31280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 <35662 32694 gene locus_tag LOCUS_43840 <35662 32694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208353729.1:amino acid adenylation domain-containing protein >Feature sequence094 73 3 gene locus_tag LOCUS_t00240 73 3 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 281 199 gene locus_tag LOCUS_t00250 281 199 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 560 487 gene locus_tag LOCUS_t00260 560 487 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2382 703 gene locus_tag LOCUS_43850 2382 703 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_43850 2862 4391 gene locus_tag LOCUS_43860 2862 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 6603 5083 gene locus_tag LOCUS_43870 6603 5083 CDS product IRE (iron responsive element) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922846.1 protein_id gnl|my_center|LOCUS_43870 8492 6600 gene locus_tag LOCUS_43880 8492 6600 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325469.1 protein_id gnl|my_center|LOCUS_43880 9426 8482 gene locus_tag LOCUS_43890 9426 8482 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_43890 9869 12331 gene locus_tag LOCUS_43900 9869 12331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 15580 12476 gene locus_tag LOCUS_43910 15580 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008670336.1 protein_id gnl|my_center|LOCUS_43910 15839 16078 gene locus_tag LOCUS_43920 15839 16078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 16312 16629 gene locus_tag LOCUS_43930 16312 16629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 16771 16962 gene locus_tag LOCUS_43940 16771 16962 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327487.1 protein_id gnl|my_center|LOCUS_43940 17051 17746 gene locus_tag LOCUS_43950 17051 17746 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814050.1 protein_id gnl|my_center|LOCUS_43950 17760 18008 gene locus_tag LOCUS_43960 17760 18008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 18111 21344 gene locus_tag LOCUS_43970 18111 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 21811 21389 gene locus_tag LOCUS_43980 21811 21389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 22124 21804 gene locus_tag LOCUS_43990 22124 21804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 25048 22223 gene locus_tag LOCUS_44000 25048 22223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 25629 25045 gene locus_tag LOCUS_44010 25629 25045 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_44010 27603 25846 gene locus_tag LOCUS_44020 27603 25846 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922444.1 protein_id gnl|my_center|LOCUS_44020 29190 27838 gene locus_tag LOCUS_44030 29190 27838 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932892.1 protein_id gnl|my_center|LOCUS_44030 30702 29209 gene locus_tag LOCUS_44040 30702 29209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324153.1 protein_id gnl|my_center|LOCUS_44040 31237 30713 gene locus_tag LOCUS_44050 31237 30713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 31825 33141 gene locus_tag LOCUS_44060 31825 33141 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_44060 33713 33066 gene locus_tag LOCUS_44070 33713 33066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 34554 34171 gene locus_tag LOCUS_44080 34554 34171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 34957 34637 gene locus_tag LOCUS_44090 34957 34637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 >Feature sequence095 1334 219 gene locus_tag LOCUS_44100 1334 219 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_44100 1694 4936 gene locus_tag LOCUS_44110 1694 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 5190 8390 gene locus_tag LOCUS_44120 5190 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 8487 9767 gene locus_tag LOCUS_44130 8487 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 9880 11664 gene locus_tag LOCUS_44140 9880 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 11758 12039 gene locus_tag LOCUS_44150 11758 12039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 13051 11990 gene locus_tag LOCUS_44160 13051 11990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 14367 13159 gene locus_tag LOCUS_44170 14367 13159 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124078.1 protein_id gnl|my_center|LOCUS_44170 14715 15626 gene locus_tag LOCUS_44180 14715 15626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 15647 17044 gene locus_tag LOCUS_44190 15647 17044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 17139 18614 gene locus_tag LOCUS_44200 gene xylB 17139 18614 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270490.1 protein_id gnl|my_center|LOCUS_44200 18611 19417 gene locus_tag LOCUS_44210 18611 19417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 19414 20214 gene locus_tag LOCUS_44220 19414 20214 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_44220 20232 21584 gene locus_tag LOCUS_44230 20232 21584 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_44230 21594 22364 gene locus_tag LOCUS_44240 gene phbB 21594 22364 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250412.1 protein_id gnl|my_center|LOCUS_44240 22557 23456 gene locus_tag LOCUS_44250 22557 23456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 23453 24520 gene locus_tag LOCUS_44260 23453 24520 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_44260 24590 25897 gene locus_tag LOCUS_44270 24590 25897 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_44270 29031 25867 gene locus_tag LOCUS_44280 29031 25867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 30803 29316 gene locus_tag LOCUS_44290 30803 29316 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_44290 31582 31019 gene locus_tag LOCUS_44300 31582 31019 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_44300 33873 32056 gene locus_tag LOCUS_44310 33873 32056 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_44310 35490 34144 gene locus_tag LOCUS_44320 35490 34144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_44320 >Feature sequence096 25357 23102 gene locus_tag LOCUS_44330 25357 23102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 25749 26669 gene locus_tag LOCUS_44340 25749 26669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 26657 27205 gene locus_tag LOCUS_44350 26657 27205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 27227 28816 gene locus_tag LOCUS_44360 27227 28816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 32618 29034 gene locus_tag LOCUS_44370 32618 29034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 32853 34940 gene locus_tag LOCUS_44380 32853 34940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 >Feature sequence097 595 2994 gene locus_tag LOCUS_44390 595 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109257.1 protein_id gnl|my_center|LOCUS_44390 2991 4229 gene locus_tag LOCUS_44400 2991 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 4479 6815 gene locus_tag LOCUS_44410 4479 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108901.1 protein_id gnl|my_center|LOCUS_44410 7026 7601 gene locus_tag LOCUS_44420 7026 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 8552 7692 gene locus_tag LOCUS_44430 gene sdhB 8552 7692 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122819.1 protein_id gnl|my_center|LOCUS_44430 10552 8585 gene locus_tag LOCUS_44440 gene sdhA 10552 8585 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122818.1 protein_id gnl|my_center|LOCUS_44440 11374 10577 gene locus_tag LOCUS_44450 11374 10577 CDS product succinate dehydrogenase cytochrome b558 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922342.1 protein_id gnl|my_center|LOCUS_44450 11957 12355 gene locus_tag LOCUS_44460 11957 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 14325 12436 gene locus_tag LOCUS_44470 14325 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 16694 14682 gene locus_tag LOCUS_44480 gene ftsH 16694 14682 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120515.1 protein_id gnl|my_center|LOCUS_44480 17062 18213 gene locus_tag LOCUS_44490 17062 18213 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_44490 18198 20372 gene locus_tag LOCUS_44500 18198 20372 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435048.1 protein_id gnl|my_center|LOCUS_44500 20524 21603 gene locus_tag LOCUS_44510 gene lpxD 20524 21603 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922341.1 protein_id gnl|my_center|LOCUS_44510 21603 22562 gene locus_tag LOCUS_44520 gene lpxI 21603 22562 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_44520 22589 23395 gene locus_tag LOCUS_44530 22589 23395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 24255 23518 gene locus_tag LOCUS_44540 gene ric 24255 23518 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963399.1 protein_id gnl|my_center|LOCUS_44540 24875 24252 gene locus_tag LOCUS_44550 24875 24252 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986296.1 protein_id gnl|my_center|LOCUS_44550 25385 24963 gene locus_tag LOCUS_44560 25385 24963 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922126.1 protein_id gnl|my_center|LOCUS_44560 27816 25429 gene locus_tag LOCUS_44570 27816 25429 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197954.1 protein_id gnl|my_center|LOCUS_44570 28097 29269 gene locus_tag LOCUS_44580 28097 29269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 31299 29332 gene locus_tag LOCUS_44590 31299 29332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 31973 31404 gene locus_tag LOCUS_44600 31973 31404 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_44600 32708 32043 gene locus_tag LOCUS_44610 32708 32043 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_44610 34589 32955 gene locus_tag LOCUS_44620 34589 32955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 >Feature sequence098 <1 1505 gene locus_tag LOCUS_44630 <1 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920818.1:MotA/TolQ/ExbB proton channel family protein 1492 2292 gene locus_tag LOCUS_44640 1492 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 2296 3429 gene locus_tag LOCUS_44650 2296 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 3578 5038 gene locus_tag LOCUS_44660 gene cdaA 3578 5038 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941532.1 protein_id gnl|my_center|LOCUS_44660 5278 6123 gene locus_tag LOCUS_44670 5278 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 6141 6566 gene locus_tag LOCUS_44680 6141 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 6506 6835 gene locus_tag LOCUS_44690 6506 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 7784 6876 gene locus_tag LOCUS_44700 7784 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44700 9572 7803 gene locus_tag LOCUS_44710 9572 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 10235 9702 gene locus_tag LOCUS_44720 10235 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 11564 10251 gene locus_tag LOCUS_44730 11564 10251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 12054 13253 gene locus_tag LOCUS_44740 12054 13253 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942829.1 protein_id gnl|my_center|LOCUS_44740 13371 16184 gene locus_tag LOCUS_44750 13371 16184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 16181 17077 gene locus_tag LOCUS_44760 16181 17077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 18346 17426 gene locus_tag LOCUS_44770 18346 17426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 19451 18546 gene locus_tag LOCUS_44780 19451 18546 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329973.1 protein_id gnl|my_center|LOCUS_44780 19450 20934 gene locus_tag LOCUS_44790 19450 20934 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_44790 21128 22519 gene locus_tag LOCUS_44800 21128 22519 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_44800 22773 24014 gene locus_tag LOCUS_44810 gene mraY 22773 24014 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530954.1 protein_id gnl|my_center|LOCUS_44810 24032 25045 gene locus_tag LOCUS_44820 gene murG 24032 25045 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103107.1 protein_id gnl|my_center|LOCUS_44820 28573 25664 gene locus_tag LOCUS_44830 28573 25664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 30641 28719 gene locus_tag LOCUS_44840 30641 28719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 31957 30638 gene locus_tag LOCUS_44850 31957 30638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 32164 32958 gene locus_tag LOCUS_44860 32164 32958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 33255 33638 gene locus_tag LOCUS_44870 33255 33638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 >Feature sequence099 282 809 gene locus_tag LOCUS_44880 282 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 2680 989 gene locus_tag LOCUS_44890 2680 989 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_44890 3625 2756 gene locus_tag LOCUS_44900 3625 2756 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809919.1 protein_id gnl|my_center|LOCUS_44900 5204 3615 gene locus_tag LOCUS_44910 5204 3615 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942559.1 protein_id gnl|my_center|LOCUS_44910 6026 5388 gene locus_tag LOCUS_44920 6026 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 7271 6369 gene locus_tag LOCUS_44930 7271 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 8151 7273 gene locus_tag LOCUS_44940 gene murB 8151 7273 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_44940 9559 8108 gene locus_tag LOCUS_44950 gene murC 9559 8108 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_44950 10964 9663 gene locus_tag LOCUS_44960 10964 9663 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447220.1 protein_id gnl|my_center|LOCUS_44960 12074 11166 gene locus_tag LOCUS_44970 gene nhaR 12074 11166 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_44970 12217 12561 gene locus_tag LOCUS_44980 12217 12561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 12620 12826 gene locus_tag LOCUS_44990 gene csrA 12620 12826 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036902.1 protein_id gnl|my_center|LOCUS_44990 13049 14068 gene locus_tag LOCUS_45000 13049 14068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 14072 15079 gene locus_tag LOCUS_45010 14072 15079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 17665 15188 gene locus_tag LOCUS_45020 17665 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 19324 17846 gene locus_tag LOCUS_45030 19324 17846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_45030 19563 19811 gene locus_tag LOCUS_45040 19563 19811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 19826 20866 gene locus_tag LOCUS_45050 gene trpD 19826 20866 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_45050 20863 21627 gene locus_tag LOCUS_45060 gene trpC 20863 21627 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919765.1 protein_id gnl|my_center|LOCUS_45060 21779 22321 gene locus_tag LOCUS_45070 21779 22321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 22671 23426 gene locus_tag LOCUS_45080 22671 23426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 23540 24295 gene locus_tag LOCUS_45090 gene azf 23540 24295 CDS product NAD-dependent glucose-6-phosphate dehydrogenase Azf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289099.1 protein_id gnl|my_center|LOCUS_45090 24326 25093 gene locus_tag LOCUS_45100 24326 25093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 25090 26148 gene locus_tag LOCUS_45110 25090 26148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 28573 26192 gene locus_tag LOCUS_45120 28573 26192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 33995 29604 gene locus_tag LOCUS_45130 33995 29604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 >Feature sequence100 768 370 gene locus_tag LOCUS_45140 768 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 1751 1053 gene locus_tag LOCUS_45150 1751 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 3236 1827 gene locus_tag LOCUS_45160 3236 1827 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727913.1 protein_id gnl|my_center|LOCUS_45160 3484 5676 gene locus_tag LOCUS_45170 3484 5676 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121109.1 protein_id gnl|my_center|LOCUS_45170 5748 6086 gene locus_tag LOCUS_45180 5748 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 6283 7323 gene locus_tag LOCUS_45190 6283 7323 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_45190 7443 8540 gene locus_tag LOCUS_45200 gene serC 7443 8540 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434814.1 protein_id gnl|my_center|LOCUS_45200 8625 10007 gene locus_tag LOCUS_45210 8625 10007 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_45210 10081 10314 gene locus_tag LOCUS_45220 10081 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 10676 11746 gene locus_tag LOCUS_45230 10676 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 13216 12077 gene locus_tag LOCUS_45240 gene proB 13216 12077 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331575.1 protein_id gnl|my_center|LOCUS_45240 13449 15026 gene locus_tag LOCUS_45250 13449 15026 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327245.1 protein_id gnl|my_center|LOCUS_45250 15295 16014 gene locus_tag LOCUS_45260 gene hisA 15295 16014 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327023.1 protein_id gnl|my_center|LOCUS_45260 16045 18141 gene locus_tag LOCUS_45270 gene fusA 16045 18141 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_45270 18453 19463 gene locus_tag LOCUS_45280 18453 19463 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_45280 22222 19553 gene locus_tag LOCUS_45290 22222 19553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 22994 22482 gene locus_tag LOCUS_45300 22994 22482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 23412 23014 gene locus_tag LOCUS_45310 23412 23014 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327186.1 protein_id gnl|my_center|LOCUS_45310 24881 23427 gene locus_tag LOCUS_45320 gene atpD 24881 23427 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122672.1 protein_id gnl|my_center|LOCUS_45320 25811 24921 gene locus_tag LOCUS_45330 gene atpG 25811 24921 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122671.1 protein_id gnl|my_center|LOCUS_45330 27373 25829 gene locus_tag LOCUS_45340 gene atpA 27373 25829 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334261.1 protein_id gnl|my_center|LOCUS_45340 27977 27324 gene locus_tag LOCUS_45350 27977 27324 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036760.1 protein_id gnl|my_center|LOCUS_45350 28696 27992 gene locus_tag LOCUS_45360 28696 27992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 29048 28737 gene locus_tag LOCUS_45370 gene atpE 29048 28737 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777530.1 protein_id gnl|my_center|LOCUS_45370 29909 29100 gene locus_tag LOCUS_45380 gene atpB 29909 29100 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327177.1 protein_id gnl|my_center|LOCUS_45380 30373 29906 gene locus_tag LOCUS_45390 30373 29906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 30594 30370 gene locus_tag LOCUS_45400 30594 30370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 30894 31070 gene locus_tag LOCUS_45410 30894 31070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 32132 31074 gene locus_tag LOCUS_45420 32132 31074 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922921.1 protein_id gnl|my_center|LOCUS_45420 32314 33429 gene locus_tag LOCUS_45430 32314 33429 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324953.1 protein_id gnl|my_center|LOCUS_45430 33455 34390 gene locus_tag LOCUS_45440 gene pyrF 33455 34390 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_45440 >Feature sequence101 390 1964 gene locus_tag LOCUS_45450 390 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 2135 2326 gene locus_tag LOCUS_45460 2135 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 2367 2657 gene locus_tag LOCUS_45470 2367 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 3018 2698 gene locus_tag LOCUS_45480 3018 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 4482 3055 gene locus_tag LOCUS_45490 4482 3055 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_45490 4830 4498 gene locus_tag LOCUS_45500 4830 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 5474 4938 gene locus_tag LOCUS_45510 5474 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 6509 5652 gene locus_tag LOCUS_45520 6509 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 6931 6581 gene locus_tag LOCUS_45530 6931 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122820.1 protein_id gnl|my_center|LOCUS_45530 7895 7158 gene locus_tag LOCUS_45540 gene coxK1 7895 7158 CDS product Dot/Icm T4SS effector protein kinase CoxK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957418.1 protein_id gnl|my_center|LOCUS_45540 8542 7937 gene locus_tag LOCUS_45550 8542 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 9286 8618 gene locus_tag LOCUS_45560 9286 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 11111 9417 gene locus_tag LOCUS_45570 11111 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 11451 12236 gene locus_tag LOCUS_45580 gene nagB 11451 12236 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461409.1 protein_id gnl|my_center|LOCUS_45580 12284 13573 gene locus_tag LOCUS_45590 12284 13573 CDS product putative sugar nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 protein_id gnl|my_center|LOCUS_45590 13585 13839 gene locus_tag LOCUS_45600 13585 13839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 13861 15258 gene locus_tag LOCUS_45610 13861 15258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 15374 17314 gene locus_tag LOCUS_45620 15374 17314 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921839.1 protein_id gnl|my_center|LOCUS_45620 17976 17389 gene locus_tag LOCUS_45630 17976 17389 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_45630 19394 17967 gene locus_tag LOCUS_45640 19394 17967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 19881 21239 gene locus_tag LOCUS_45650 19881 21239 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_45650 21292 21777 gene locus_tag LOCUS_45660 21292 21777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 21984 22703 gene locus_tag LOCUS_45670 21984 22703 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787482.1 protein_id gnl|my_center|LOCUS_45670 22700 23110 gene locus_tag LOCUS_45680 22700 23110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 23308 23126 gene locus_tag LOCUS_45690 23308 23126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 23564 23334 gene locus_tag LOCUS_45700 23564 23334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 23798 26149 gene locus_tag LOCUS_45710 23798 26149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 26508 26245 gene locus_tag LOCUS_45720 26508 26245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 27018 26794 gene locus_tag LOCUS_45730 27018 26794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 30399 27196 gene locus_tag LOCUS_45740 30399 27196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 31433 30402 gene locus_tag LOCUS_45750 31433 30402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 32164 31829 gene locus_tag LOCUS_45760 32164 31829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 32701 33144 gene locus_tag LOCUS_45770 32701 33144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 <34455 33110 gene locus_tag LOCUS_45780 <34455 33110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121674.1:formylglycine-generating enzyme family protein >Feature sequence102 332 676 gene locus_tag LOCUS_45790 332 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 899 2065 gene locus_tag LOCUS_45800 899 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 2464 2667 gene locus_tag LOCUS_45810 2464 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 2780 3022 gene locus_tag LOCUS_45820 2780 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 3094 3324 gene locus_tag LOCUS_45830 3094 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 3454 3654 gene locus_tag LOCUS_45840 3454 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 3658 4089 gene locus_tag LOCUS_45850 3658 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 4267 6222 gene locus_tag LOCUS_45860 4267 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 6248 8074 gene locus_tag LOCUS_45870 6248 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 8534 8325 gene locus_tag LOCUS_45880 8534 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 11486 8808 gene locus_tag LOCUS_45890 11486 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 12361 11900 gene locus_tag LOCUS_45900 12361 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 12438 13196 gene locus_tag LOCUS_45910 12438 13196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 14508 13162 gene locus_tag LOCUS_45920 14508 13162 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_45920 15273 14953 gene locus_tag LOCUS_45930 15273 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 15677 15426 gene locus_tag LOCUS_45940 15677 15426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 20858 15699 gene locus_tag LOCUS_45950 20858 15699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 21688 21452 gene locus_tag LOCUS_45960 21688 21452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 21666 22733 gene locus_tag LOCUS_45970 21666 22733 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119138.1 protein_id gnl|my_center|LOCUS_45970 23365 26577 gene locus_tag LOCUS_45980 23365 26577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 26894 27508 gene locus_tag LOCUS_45990 26894 27508 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074921927.1 protein_id gnl|my_center|LOCUS_45990 27766 33558 gene locus_tag LOCUS_46000 27766 33558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 >Feature sequence103 466 5124 gene locus_tag LOCUS_46010 466 5124 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922115.1 protein_id gnl|my_center|LOCUS_46010 5149 6183 gene locus_tag LOCUS_46020 5149 6183 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_46020 6218 7273 gene locus_tag LOCUS_46030 6218 7273 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_46030 7263 8141 gene locus_tag LOCUS_46040 7263 8141 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_46040 8145 10370 gene locus_tag LOCUS_46050 8145 10370 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921453.1 protein_id gnl|my_center|LOCUS_46050 10367 12859 gene locus_tag LOCUS_46060 10367 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 12856 15102 gene locus_tag LOCUS_46070 12856 15102 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921470.1 protein_id gnl|my_center|LOCUS_46070 15105 16826 gene locus_tag LOCUS_46080 15105 16826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921469.1 protein_id gnl|my_center|LOCUS_46080 17057 18130 gene locus_tag LOCUS_46090 17057 18130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 18827 18288 gene locus_tag LOCUS_46100 18827 18288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 19185 19442 gene locus_tag LOCUS_46110 19185 19442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 19426 20373 gene locus_tag LOCUS_46120 19426 20373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 20366 21256 gene locus_tag LOCUS_46130 20366 21256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 21253 22209 gene locus_tag LOCUS_46140 21253 22209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_46140 22202 22987 gene locus_tag LOCUS_46150 22202 22987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 23683 23003 gene locus_tag LOCUS_46160 23683 23003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 23792 24499 gene locus_tag LOCUS_46170 23792 24499 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404487.1 protein_id gnl|my_center|LOCUS_46170 25539 24613 gene locus_tag LOCUS_46180 25539 24613 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258521.1 protein_id gnl|my_center|LOCUS_46180 26726 25536 gene locus_tag LOCUS_46190 26726 25536 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337640.1 protein_id gnl|my_center|LOCUS_46190 26812 28095 gene locus_tag LOCUS_46200 gene aroA 26812 28095 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072383.1 protein_id gnl|my_center|LOCUS_46200 28527 28285 gene locus_tag LOCUS_46210 28527 28285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 28875 29423 gene locus_tag LOCUS_46220 28875 29423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 29712 32153 gene locus_tag LOCUS_46230 29712 32153 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_46230 >Feature sequence104 751 2298 gene locus_tag LOCUS_46240 751 2298 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940504.1 protein_id gnl|my_center|LOCUS_46240 3023 3823 gene locus_tag LOCUS_46250 3023 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 4050 5297 gene locus_tag LOCUS_46260 4050 5297 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172666.1 protein_id gnl|my_center|LOCUS_46260 5310 8483 gene locus_tag LOCUS_46270 5310 8483 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268123.1 protein_id gnl|my_center|LOCUS_46270 9568 8444 gene locus_tag LOCUS_46280 9568 8444 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_46280 9534 9944 gene locus_tag LOCUS_46290 9534 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 10028 11188 gene locus_tag LOCUS_46300 10028 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 11541 13802 gene locus_tag LOCUS_46310 11541 13802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 14835 13915 gene locus_tag LOCUS_46320 14835 13915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 15240 14959 gene locus_tag LOCUS_46330 15240 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 16194 15532 gene locus_tag LOCUS_46340 gene cysC 16194 15532 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332129.1 protein_id gnl|my_center|LOCUS_46340 16436 18562 gene locus_tag LOCUS_46350 16436 18562 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_46350 18597 19178 gene locus_tag LOCUS_46360 18597 19178 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226951.1 protein_id gnl|my_center|LOCUS_46360 19335 20435 gene locus_tag LOCUS_46370 19335 20435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 20715 22673 gene locus_tag LOCUS_46380 20715 22673 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_46380 22704 24083 gene locus_tag LOCUS_46390 22704 24083 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_46390 27454 24260 gene locus_tag LOCUS_46400 27454 24260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 27704 28180 gene locus_tag LOCUS_46410 27704 28180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 29155 28208 gene locus_tag LOCUS_46420 29155 28208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 30524 29256 gene locus_tag LOCUS_46430 30524 29256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921591.1 protein_id gnl|my_center|LOCUS_46430 30710 32011 gene locus_tag LOCUS_46440 30710 32011 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_46440 33535 32093 gene locus_tag LOCUS_46450 33535 32093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 >Feature sequence105 239 1225 gene locus_tag LOCUS_46460 239 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 1390 1890 gene locus_tag LOCUS_46470 1390 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 1907 3946 gene locus_tag LOCUS_46480 1907 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 3936 3861 gene locus_tag LOCUS_t00270 3936 3861 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5760 4072 gene locus_tag LOCUS_46490 5760 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 6657 5875 gene locus_tag LOCUS_46500 6657 5875 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_46500 7500 6664 gene locus_tag LOCUS_46510 7500 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 7833 8549 gene locus_tag LOCUS_46520 gene ppiA 7833 8549 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477215.1 protein_id gnl|my_center|LOCUS_46520 9825 8620 gene locus_tag LOCUS_46530 9825 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 11329 9950 gene locus_tag LOCUS_46540 11329 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 12281 11547 gene locus_tag LOCUS_46550 gene rph 12281 11547 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330546.1 protein_id gnl|my_center|LOCUS_46550 13257 12340 gene locus_tag LOCUS_46560 gene argF 13257 12340 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921923.1 protein_id gnl|my_center|LOCUS_46560 14496 13294 gene locus_tag LOCUS_46570 14496 13294 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_46570 15785 14877 gene locus_tag LOCUS_46580 gene argB 15785 14877 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335411.1 protein_id gnl|my_center|LOCUS_46580 16040 16498 gene locus_tag LOCUS_46590 16040 16498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 16503 17453 gene locus_tag LOCUS_46600 16503 17453 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_46600 17651 18784 gene locus_tag LOCUS_46610 17651 18784 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325730.1 protein_id gnl|my_center|LOCUS_46610 19022 19645 gene locus_tag LOCUS_46620 19022 19645 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324826.1 protein_id gnl|my_center|LOCUS_46620 19696 20253 gene locus_tag LOCUS_46630 gene pth 19696 20253 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122535.1 protein_id gnl|my_center|LOCUS_46630 20277 20753 gene locus_tag LOCUS_46640 20277 20753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 20814 21314 gene locus_tag LOCUS_46650 20814 21314 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_46650 21382 21939 gene locus_tag LOCUS_46660 gene rplI 21382 21939 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122533.1 protein_id gnl|my_center|LOCUS_46660 22163 23587 gene locus_tag LOCUS_46670 gene dnaB 22163 23587 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118493.1 protein_id gnl|my_center|LOCUS_46670 25622 23622 gene locus_tag LOCUS_46680 25622 23622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 26200 25619 gene locus_tag LOCUS_46690 26200 25619 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_46690 26743 27945 gene locus_tag LOCUS_46700 26743 27945 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963600.1 protein_id gnl|my_center|LOCUS_46700 28186 30645 gene locus_tag LOCUS_46710 28186 30645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117825.1 protein_id gnl|my_center|LOCUS_46710 30694 31620 gene locus_tag LOCUS_46720 30694 31620 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_46720 >Feature sequence106 355 636 gene locus_tag LOCUS_46730 355 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 623 1147 gene locus_tag LOCUS_46740 623 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 1466 2749 gene locus_tag LOCUS_46750 1466 2749 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333174.1 protein_id gnl|my_center|LOCUS_46750 2765 3553 gene locus_tag LOCUS_46760 gene uppS 2765 3553 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328291.1 protein_id gnl|my_center|LOCUS_46760 3630 4514 gene locus_tag LOCUS_46770 3630 4514 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262999.1 protein_id gnl|my_center|LOCUS_46770 5950 4577 gene locus_tag LOCUS_46780 5950 4577 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392890.1 protein_id gnl|my_center|LOCUS_46780 6666 6091 gene locus_tag LOCUS_46790 6666 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 7885 6833 gene locus_tag LOCUS_46800 7885 6833 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120858.1 protein_id gnl|my_center|LOCUS_46800 7766 8128 gene locus_tag LOCUS_46810 7766 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 9055 9651 gene locus_tag LOCUS_46820 9055 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 9734 12277 gene locus_tag LOCUS_46830 9734 12277 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_46830 12423 13823 gene locus_tag LOCUS_46840 12423 13823 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_46840 13868 15070 gene locus_tag LOCUS_46850 13868 15070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145385480.1 protein_id gnl|my_center|LOCUS_46850 15067 15297 gene locus_tag LOCUS_46860 15067 15297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 15297 15869 gene locus_tag LOCUS_46870 15297 15869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 15866 17185 gene locus_tag LOCUS_46880 15866 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 17182 19005 gene locus_tag LOCUS_46890 17182 19005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 19098 21533 gene locus_tag LOCUS_46900 19098 21533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 21637 23238 gene locus_tag LOCUS_46910 21637 23238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 23390 24142 gene locus_tag LOCUS_46920 23390 24142 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_46920 26294 24297 gene locus_tag LOCUS_46930 26294 24297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 27683 26352 gene locus_tag LOCUS_46940 27683 26352 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_46940 28977 27718 gene locus_tag LOCUS_46950 28977 27718 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 protein_id gnl|my_center|LOCUS_46950 30453 29017 gene locus_tag LOCUS_46960 30453 29017 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_46960 31927 31220 gene locus_tag LOCUS_46970 31927 31220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 32147 31932 gene locus_tag LOCUS_46980 32147 31932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 >Feature sequence107 1054 347 gene locus_tag LOCUS_46990 1054 347 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814769.1 protein_id gnl|my_center|LOCUS_46990 1149 2450 gene locus_tag LOCUS_47000 1149 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 2447 3790 gene locus_tag LOCUS_47010 2447 3790 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943835.1 protein_id gnl|my_center|LOCUS_47010 3993 5366 gene locus_tag LOCUS_47020 3993 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_47020 6040 5462 gene locus_tag LOCUS_47030 gene rdgB 6040 5462 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921833.1 protein_id gnl|my_center|LOCUS_47030 7258 6098 gene locus_tag LOCUS_47040 7258 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326644.1 protein_id gnl|my_center|LOCUS_47040 7481 8245 gene locus_tag LOCUS_47050 7481 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 8487 9455 gene locus_tag LOCUS_47060 8487 9455 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442722.1 protein_id gnl|my_center|LOCUS_47060 9677 12436 gene locus_tag LOCUS_47070 9677 12436 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615472.1 protein_id gnl|my_center|LOCUS_47070 13942 12584 gene locus_tag LOCUS_47080 13942 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 15319 14573 gene locus_tag LOCUS_47090 15319 14573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_47090 16513 15497 gene locus_tag LOCUS_47100 16513 15497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 19949 16539 gene locus_tag LOCUS_47110 19949 16539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 20616 21800 gene locus_tag LOCUS_47120 20616 21800 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 protein_id gnl|my_center|LOCUS_47120 23455 21809 gene locus_tag LOCUS_47130 23455 21809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 23894 24208 gene locus_tag LOCUS_47140 23894 24208 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_47140 25303 24230 gene locus_tag LOCUS_47150 25303 24230 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809384.1 protein_id gnl|my_center|LOCUS_47150 26259 25300 gene locus_tag LOCUS_47160 26259 25300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_47160 30195 26275 gene locus_tag LOCUS_47170 30195 26275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 31335 31027 gene locus_tag LOCUS_47180 31335 31027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 31547 31332 gene locus_tag LOCUS_47190 31547 31332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 31800 31555 gene locus_tag LOCUS_47200 31800 31555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 >Feature sequence108 8329 9513 gene locus_tag LOCUS_47210 8329 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 13169 9645 gene locus_tag LOCUS_47220 13169 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 15101 13389 gene locus_tag LOCUS_47230 15101 13389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 16385 17545 gene locus_tag LOCUS_47240 16385 17545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 19038 17698 gene locus_tag LOCUS_47250 19038 17698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 20643 19063 gene locus_tag LOCUS_47260 20643 19063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 20923 22776 gene locus_tag LOCUS_47270 20923 22776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 22959 22777 gene locus_tag LOCUS_47280 22959 22777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 22909 23085 gene locus_tag LOCUS_47290 22909 23085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 23435 24463 gene locus_tag LOCUS_47300 23435 24463 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427765.1 protein_id gnl|my_center|LOCUS_47300 25042 24515 gene locus_tag LOCUS_47310 25042 24515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 25670 25035 gene locus_tag LOCUS_47320 25670 25035 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_47320 26654 25680 gene locus_tag LOCUS_47330 26654 25680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 27055 28605 gene locus_tag LOCUS_47340 27055 28605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 30016 28994 gene locus_tag LOCUS_47350 30016 28994 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921814.1 protein_id gnl|my_center|LOCUS_47350 <32304 30464 gene locus_tag LOCUS_47360 <32304 30464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202172.1:DUF6057 family protein >Feature sequence109 1300 149 gene locus_tag LOCUS_47370 1300 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 2294 1266 gene locus_tag LOCUS_47380 2294 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 2417 3799 gene locus_tag LOCUS_47390 2417 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 3796 4182 gene locus_tag LOCUS_47400 3796 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 4239 6395 gene locus_tag LOCUS_47410 4239 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 6395 7978 gene locus_tag LOCUS_47420 6395 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 7975 9228 gene locus_tag LOCUS_47430 7975 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 9281 13552 gene locus_tag LOCUS_47440 9281 13552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 13549 14382 gene locus_tag LOCUS_47450 13549 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 14379 15539 gene locus_tag LOCUS_47460 14379 15539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 15554 17251 gene locus_tag LOCUS_47470 15554 17251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 17232 17825 gene locus_tag LOCUS_47480 17232 17825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 17822 19288 gene locus_tag LOCUS_47490 17822 19288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 19340 20896 gene locus_tag LOCUS_47500 gene gndA 19340 20896 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_47500 21607 21293 gene locus_tag LOCUS_47510 21607 21293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 22672 21644 gene locus_tag LOCUS_47520 22672 21644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026192137.1 protein_id gnl|my_center|LOCUS_47520 23338 24174 gene locus_tag LOCUS_47530 23338 24174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 24307 25560 gene locus_tag LOCUS_47540 24307 25560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 25729 26556 gene locus_tag LOCUS_47550 25729 26556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 27968 26745 gene locus_tag LOCUS_47560 27968 26745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 28894 27983 gene locus_tag LOCUS_47570 28894 27983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 29580 29140 gene locus_tag LOCUS_47580 29580 29140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 30042 29818 gene locus_tag LOCUS_47590 30042 29818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 31144 30518 gene locus_tag LOCUS_47600 31144 30518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 >Feature sequence110 233 595 gene locus_tag LOCUS_47610 233 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 890 3691 gene locus_tag LOCUS_47620 890 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 4019 6946 gene locus_tag LOCUS_47630 4019 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 7172 7558 gene locus_tag LOCUS_47640 7172 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 10402 7577 gene locus_tag LOCUS_47650 10402 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 11208 10444 gene locus_tag LOCUS_47660 gene hisF 11208 10444 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391341.1 protein_id gnl|my_center|LOCUS_47660 11443 14271 gene locus_tag LOCUS_47670 11443 14271 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338417.1 protein_id gnl|my_center|LOCUS_47670 14440 15669 gene locus_tag LOCUS_47680 gene odhB 14440 15669 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122198.1 protein_id gnl|my_center|LOCUS_47680 15670 17061 gene locus_tag LOCUS_47690 gene lpdA 15670 17061 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119002.1 protein_id gnl|my_center|LOCUS_47690 17317 17015 gene locus_tag LOCUS_47700 17317 17015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 18409 17660 gene locus_tag LOCUS_47710 18409 17660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 20052 18577 gene locus_tag LOCUS_47720 20052 18577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 21630 20107 gene locus_tag LOCUS_47730 21630 20107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 22455 21643 gene locus_tag LOCUS_47740 22455 21643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 22943 23995 gene locus_tag LOCUS_47750 22943 23995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 24167 24832 gene locus_tag LOCUS_47760 24167 24832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 24955 26475 gene locus_tag LOCUS_47770 24955 26475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_47770 26788 27978 gene locus_tag LOCUS_47780 gene metK 26788 27978 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331112.1 protein_id gnl|my_center|LOCUS_47780 27986 28858 gene locus_tag LOCUS_47790 27986 28858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 29026 28742 gene locus_tag LOCUS_47800 29026 28742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 29701 29378 gene locus_tag LOCUS_47810 29701 29378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 31318 29942 gene locus_tag LOCUS_47820 31318 29942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47820 >Feature sequence111 1171 599 gene locus_tag LOCUS_47830 1171 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 2256 1234 gene locus_tag LOCUS_47840 2256 1234 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_47840 2548 3120 gene locus_tag LOCUS_47850 2548 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 4707 3181 gene locus_tag LOCUS_47860 4707 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_47860 5029 4832 gene locus_tag LOCUS_47870 5029 4832 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_47870 5553 6482 gene locus_tag LOCUS_47880 5553 6482 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120550.1 protein_id gnl|my_center|LOCUS_47880 6519 7283 gene locus_tag LOCUS_47890 6519 7283 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_47890 7321 8172 gene locus_tag LOCUS_47900 7321 8172 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_47900 8176 9873 gene locus_tag LOCUS_47910 gene ilvD 8176 9873 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584102.1 protein_id gnl|my_center|LOCUS_47910 10107 11090 gene locus_tag LOCUS_47920 10107 11090 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_47920 11155 11598 gene locus_tag LOCUS_47930 11155 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 11937 12761 gene locus_tag LOCUS_47940 11937 12761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 12871 14583 gene locus_tag LOCUS_47950 12871 14583 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_47950 14570 15778 gene locus_tag LOCUS_47960 14570 15778 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_47960 15828 16271 gene locus_tag LOCUS_47970 gene xcpT 15828 16271 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_47970 16687 17199 gene locus_tag LOCUS_47980 16687 17199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 17196 17600 gene locus_tag LOCUS_47990 17196 17600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 17800 18735 gene locus_tag LOCUS_48000 17800 18735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 19010 20692 gene locus_tag LOCUS_48010 19010 20692 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921874.1 protein_id gnl|my_center|LOCUS_48010 20759 22207 gene locus_tag LOCUS_48020 20759 22207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120490.1 protein_id gnl|my_center|LOCUS_48020 22207 23124 gene locus_tag LOCUS_48030 22207 23124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 23432 23803 gene locus_tag LOCUS_48040 23432 23803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 23935 24225 gene locus_tag LOCUS_48050 23935 24225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 24410 24315 gene locus_tag LOCUS_t00280 24410 24315 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 24572 25783 gene locus_tag LOCUS_48060 24572 25783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 27180 26650 gene locus_tag LOCUS_48070 27180 26650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 27578 27177 gene locus_tag LOCUS_48080 27578 27177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 28013 29548 gene locus_tag LOCUS_48090 28013 29548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 31184 29619 gene locus_tag LOCUS_48100 31184 29619 CDS product C25 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260597.1 protein_id gnl|my_center|LOCUS_48100 31421 31492 gene locus_tag LOCUS_t00290 31421 31492 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence112 1745 390 gene locus_tag LOCUS_48110 1745 390 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_48110 1841 2572 gene locus_tag LOCUS_48120 1841 2572 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051345837.1 protein_id gnl|my_center|LOCUS_48120 3583 2696 gene locus_tag LOCUS_48130 3583 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 4659 3712 gene locus_tag LOCUS_48140 4659 3712 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012164238.1 protein_id gnl|my_center|LOCUS_48140 6342 4675 gene locus_tag LOCUS_48150 6342 4675 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479312.1 protein_id gnl|my_center|LOCUS_48150 6925 6443 gene locus_tag LOCUS_48160 6925 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 7178 7783 gene locus_tag LOCUS_48170 7178 7783 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 protein_id gnl|my_center|LOCUS_48170 7828 9000 gene locus_tag LOCUS_48180 7828 9000 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_48180 9005 9949 gene locus_tag LOCUS_48190 9005 9949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_48190 10007 10411 gene locus_tag LOCUS_48200 10007 10411 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_48200 10566 11537 gene locus_tag LOCUS_48210 10566 11537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_48210 11534 12670 gene locus_tag LOCUS_48220 11534 12670 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_48220 12670 13800 gene locus_tag LOCUS_48230 12670 13800 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_48230 15613 14093 gene locus_tag LOCUS_48240 15613 14093 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665727.1 protein_id gnl|my_center|LOCUS_48240 16733 15615 gene locus_tag LOCUS_48250 16733 15615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 17208 16747 gene locus_tag LOCUS_48260 17208 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 18164 17250 gene locus_tag LOCUS_48270 18164 17250 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_48270 18574 19245 gene locus_tag LOCUS_48280 18574 19245 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729516.1 protein_id gnl|my_center|LOCUS_48280 19277 19462 gene locus_tag LOCUS_48290 19277 19462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 19712 20629 gene locus_tag LOCUS_48300 19712 20629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 20792 21475 gene locus_tag LOCUS_48310 20792 21475 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331623.1 protein_id gnl|my_center|LOCUS_48310 21540 24050 gene locus_tag LOCUS_48320 21540 24050 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921682.1 protein_id gnl|my_center|LOCUS_48320 24263 25354 gene locus_tag LOCUS_48330 gene prfB 24263 25354 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146392543.1 protein_id gnl|my_center|LOCUS_48330 25354 25722 gene locus_tag LOCUS_48340 25354 25722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 27940 25736 gene locus_tag LOCUS_48350 27940 25736 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118388.1 protein_id gnl|my_center|LOCUS_48350 28143 29168 gene locus_tag LOCUS_48360 28143 29168 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_48360 29380 30519 gene locus_tag LOCUS_48370 29380 30519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 >Feature sequence113 1258 32 gene locus_tag LOCUS_48380 1258 32 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121715.1 protein_id gnl|my_center|LOCUS_48380 1667 3898 gene locus_tag LOCUS_48390 1667 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 5169 5567 gene locus_tag LOCUS_48400 5169 5567 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640294.1 protein_id gnl|my_center|LOCUS_48400 5564 9328 gene locus_tag LOCUS_48410 5564 9328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 9766 11142 gene locus_tag LOCUS_48420 9766 11142 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_48420 11578 11150 gene locus_tag LOCUS_48430 11578 11150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 12688 11753 gene locus_tag LOCUS_48440 12688 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 13258 12974 gene locus_tag LOCUS_48450 13258 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 13632 16142 gene locus_tag LOCUS_48460 13632 16142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 18915 16444 gene locus_tag LOCUS_48470 18915 16444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 20750 18927 gene locus_tag LOCUS_48480 20750 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 21208 21459 gene locus_tag LOCUS_48490 21208 21459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 22414 22193 gene locus_tag LOCUS_48500 22414 22193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 23019 22708 gene locus_tag LOCUS_48510 23019 22708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 23450 23704 gene locus_tag LOCUS_48520 23450 23704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 23831 24136 gene locus_tag LOCUS_48530 23831 24136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 25266 25904 gene locus_tag LOCUS_48540 25266 25904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48540 27179 26568 gene locus_tag LOCUS_48550 27179 26568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 27540 27079 gene locus_tag LOCUS_48560 27540 27079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 28823 27537 gene locus_tag LOCUS_48570 28823 27537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 29486 29052 gene locus_tag LOCUS_48580 29486 29052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 30598 30831 gene locus_tag LOCUS_48590 30598 30831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 30828 31031 gene locus_tag LOCUS_48600 30828 31031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 >Feature sequence114 240 316 gene locus_tag LOCUS_t00300 240 316 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 512 1090 gene locus_tag LOCUS_48610 512 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 1071 2102 gene locus_tag LOCUS_48620 1071 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 2109 2573 gene locus_tag LOCUS_48630 2109 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 2552 2965 gene locus_tag LOCUS_48640 2552 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 2990 3184 gene locus_tag LOCUS_48650 2990 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 3181 3381 gene locus_tag LOCUS_48660 3181 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 3381 3848 gene locus_tag LOCUS_48670 3381 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 3912 4280 gene locus_tag LOCUS_48680 3912 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 5024 5464 gene locus_tag LOCUS_48690 5024 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 5461 6639 gene locus_tag LOCUS_48700 5461 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 7129 7422 gene locus_tag LOCUS_48710 7129 7422 CDS product DUF4326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076534005.1 protein_id gnl|my_center|LOCUS_48710 7419 7793 gene locus_tag LOCUS_48720 7419 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 7798 8913 gene locus_tag LOCUS_48730 7798 8913 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215829472.1 protein_id gnl|my_center|LOCUS_48730 9165 10058 gene locus_tag LOCUS_48740 9165 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 10036 10713 gene locus_tag LOCUS_48750 10036 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 10710 10949 gene locus_tag LOCUS_48760 10710 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 10922 11368 gene locus_tag LOCUS_48770 10922 11368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 11657 11457 gene locus_tag LOCUS_48780 11657 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 12123 11725 gene locus_tag LOCUS_48790 12123 11725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 12425 12216 gene locus_tag LOCUS_48800 12425 12216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 12790 12458 gene locus_tag LOCUS_48810 12790 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 12964 13416 gene locus_tag LOCUS_48820 12964 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 13385 15136 gene locus_tag LOCUS_48830 13385 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 15130 16800 gene locus_tag LOCUS_48840 15130 16800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 16800 17153 gene locus_tag LOCUS_48850 16800 17153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 17150 17323 gene locus_tag LOCUS_48860 17150 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 17475 18395 gene locus_tag LOCUS_48870 17475 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 18419 19531 gene locus_tag LOCUS_48880 18419 19531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 19566 20369 gene locus_tag LOCUS_48890 19566 20369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 20437 20871 gene locus_tag LOCUS_48900 20437 20871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 20871 22199 gene locus_tag LOCUS_48910 20871 22199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 22196 22324 gene locus_tag LOCUS_48920 22196 22324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 22434 22679 gene locus_tag LOCUS_48930 22434 22679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 22692 23030 gene locus_tag LOCUS_48940 22692 23030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 23015 23200 gene locus_tag LOCUS_48950 23015 23200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 23330 23986 gene locus_tag LOCUS_48960 23330 23986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 23983 24894 gene locus_tag LOCUS_48970 23983 24894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 24904 25239 gene locus_tag LOCUS_48980 24904 25239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 25241 27448 gene locus_tag LOCUS_48990 25241 27448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 27458 28072 gene locus_tag LOCUS_49000 27458 28072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 28075 29226 gene locus_tag LOCUS_49010 28075 29226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 >Feature sequence115 1297 353 gene locus_tag LOCUS_49020 1297 353 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_49020 2925 1498 gene locus_tag LOCUS_49030 2925 1498 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_49030 4166 2952 gene locus_tag LOCUS_49040 4166 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 7814 4407 gene locus_tag LOCUS_49050 7814 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 8133 10673 gene locus_tag LOCUS_49060 8133 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 10717 12240 gene locus_tag LOCUS_49070 10717 12240 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030106.1 protein_id gnl|my_center|LOCUS_49070 12593 13036 gene locus_tag LOCUS_49080 12593 13036 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922319.1 protein_id gnl|my_center|LOCUS_49080 13092 13484 gene locus_tag LOCUS_49090 13092 13484 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922983.1 protein_id gnl|my_center|LOCUS_49090 15386 13680 gene locus_tag LOCUS_49100 15386 13680 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_49100 15780 18632 gene locus_tag LOCUS_49110 15780 18632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 18636 20372 gene locus_tag LOCUS_49120 18636 20372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 22229 20421 gene locus_tag LOCUS_49130 22229 20421 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 protein_id gnl|my_center|LOCUS_49130 24434 22233 gene locus_tag LOCUS_49140 24434 22233 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615483.1 protein_id gnl|my_center|LOCUS_49140 24607 24831 gene locus_tag LOCUS_49150 24607 24831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 24837 26114 gene locus_tag LOCUS_49160 gene larA 24837 26114 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224947.1 protein_id gnl|my_center|LOCUS_49160 27039 26185 gene locus_tag LOCUS_49170 gene rfbD 27039 26185 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_49170 27711 27235 gene locus_tag LOCUS_49180 27711 27235 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_49180 28609 27713 gene locus_tag LOCUS_49190 gene rfbA 28609 27713 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_49190 29713 28631 gene locus_tag LOCUS_49200 gene rfbB 29713 28631 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522250.1 protein_id gnl|my_center|LOCUS_49200 30657 29710 gene locus_tag LOCUS_49210 30657 29710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 >Feature sequence116 2475 1000 gene locus_tag LOCUS_49220 2475 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 4444 2498 gene locus_tag LOCUS_49230 4444 2498 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_49230 6143 5169 gene locus_tag LOCUS_49240 6143 5169 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922157.1 protein_id gnl|my_center|LOCUS_49240 6388 8421 gene locus_tag LOCUS_49250 6388 8421 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_49250 10940 8883 gene locus_tag LOCUS_49260 10940 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 12534 11287 gene locus_tag LOCUS_49270 12534 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 13059 12541 gene locus_tag LOCUS_49280 13059 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49280 14013 13108 gene locus_tag LOCUS_49290 14013 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 15711 14377 gene locus_tag LOCUS_49300 15711 14377 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_49300 16349 17326 gene locus_tag LOCUS_49310 gene degA 16349 17326 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_49310 17363 18598 gene locus_tag LOCUS_49320 gene rifK 17363 18598 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_49320 18666 20918 gene locus_tag LOCUS_49330 18666 20918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 22177 20984 gene locus_tag LOCUS_49340 gene argJ 22177 20984 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119260.1 protein_id gnl|my_center|LOCUS_49340 23406 22399 gene locus_tag LOCUS_49350 gene argC 23406 22399 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118924.1 protein_id gnl|my_center|LOCUS_49350 24728 24108 gene locus_tag LOCUS_49360 24728 24108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 25135 24710 gene locus_tag LOCUS_49370 25135 24710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 25493 26575 gene locus_tag LOCUS_49380 25493 26575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 27327 28844 gene locus_tag LOCUS_49390 27327 28844 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_49390 29170 28841 gene locus_tag LOCUS_49400 29170 28841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 30459 29311 gene locus_tag LOCUS_49410 30459 29311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 >Feature sequence117 1915 134 gene locus_tag LOCUS_49420 1915 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 2382 2020 gene locus_tag LOCUS_49430 2382 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 3220 2441 gene locus_tag LOCUS_49440 gene fabG 3220 2441 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_49440 4434 3274 gene locus_tag LOCUS_49450 4434 3274 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_49450 5720 4431 gene locus_tag LOCUS_49460 5720 4431 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705295.1 protein_id gnl|my_center|LOCUS_49460 5957 8944 gene locus_tag LOCUS_49470 5957 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 9053 11191 gene locus_tag LOCUS_49480 9053 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 11416 12672 gene locus_tag LOCUS_49490 11416 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 13006 13959 gene locus_tag LOCUS_49500 13006 13959 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_49500 14026 14463 gene locus_tag LOCUS_49510 14026 14463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 18740 15075 gene locus_tag LOCUS_49520 18740 15075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 19004 19690 gene locus_tag LOCUS_49530 19004 19690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 20057 20731 gene locus_tag LOCUS_49540 20057 20731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 20724 22343 gene locus_tag LOCUS_49550 20724 22343 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_49550 25551 22537 gene locus_tag LOCUS_49560 25551 22537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 29301 25792 gene locus_tag LOCUS_49570 29301 25792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 29903 30679 gene locus_tag LOCUS_49580 29903 30679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 >Feature sequence118 531 2426 gene locus_tag LOCUS_49590 531 2426 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_49590 3614 2484 gene locus_tag LOCUS_49600 3614 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 4885 3668 gene locus_tag LOCUS_49610 4885 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 6390 5035 gene locus_tag LOCUS_49620 gene nrfD 6390 5035 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_49620 9421 6383 gene locus_tag LOCUS_49630 9421 6383 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_49630 10119 9469 gene locus_tag LOCUS_49640 10119 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 11740 10127 gene locus_tag LOCUS_49650 11740 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 11886 11746 gene locus_tag LOCUS_49660 11886 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 12554 11850 gene locus_tag LOCUS_49670 gene narI 12554 11850 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934155.1 protein_id gnl|my_center|LOCUS_49670 13069 12551 gene locus_tag LOCUS_49680 13069 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 14694 13207 gene locus_tag LOCUS_49690 gene narH 14694 13207 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692685.1 protein_id gnl|my_center|LOCUS_49690 18449 14805 gene locus_tag LOCUS_49700 18449 14805 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243085.1 protein_id gnl|my_center|LOCUS_49700 19505 18582 gene locus_tag LOCUS_49710 19505 18582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 19889 19521 gene locus_tag LOCUS_49720 19889 19521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 20254 21081 gene locus_tag LOCUS_49730 20254 21081 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529020.1 protein_id gnl|my_center|LOCUS_49730 21172 21594 gene locus_tag LOCUS_49740 21172 21594 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528705.1 protein_id gnl|my_center|LOCUS_49740 21629 23059 gene locus_tag LOCUS_49750 21629 23059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 23105 23713 gene locus_tag LOCUS_49760 23105 23713 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_49760 23749 24846 gene locus_tag LOCUS_49770 23749 24846 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_49770 26303 25065 gene locus_tag LOCUS_49780 26303 25065 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393430.1 protein_id gnl|my_center|LOCUS_49780 28024 26378 gene locus_tag LOCUS_49790 gene hcp 28024 26378 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870473.1 protein_id gnl|my_center|LOCUS_49790 <29963 28114 gene locus_tag LOCUS_49800 <29963 28114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261108.1:efflux RND transporter permease subunit >Feature sequence119 1868 531 gene locus_tag LOCUS_49810 1868 531 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_49810 2136 3059 gene locus_tag LOCUS_49820 2136 3059 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123950.1 protein_id gnl|my_center|LOCUS_49820 3166 4128 gene locus_tag LOCUS_49830 3166 4128 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327669.1 protein_id gnl|my_center|LOCUS_49830 5081 4482 gene locus_tag LOCUS_49840 5081 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 5080 5958 gene locus_tag LOCUS_49850 5080 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 6065 6733 gene locus_tag LOCUS_49860 6065 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 6751 7569 gene locus_tag LOCUS_49870 gene mshM 6751 7569 CDS product MSHA fimbrial biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_49870 7804 8949 gene locus_tag LOCUS_49880 7804 8949 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878541.1 protein_id gnl|my_center|LOCUS_49880 9263 10810 gene locus_tag LOCUS_49890 9263 10810 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615433.1 protein_id gnl|my_center|LOCUS_49890 11743 10835 gene locus_tag LOCUS_49900 11743 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 12640 11774 gene locus_tag LOCUS_49910 12640 11774 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325558.1 protein_id gnl|my_center|LOCUS_49910 12858 12631 gene locus_tag LOCUS_49920 12858 12631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 13868 12945 gene locus_tag LOCUS_49930 gene rsmA 13868 12945 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922514.1 protein_id gnl|my_center|LOCUS_49930 14458 13862 gene locus_tag LOCUS_49940 14458 13862 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 protein_id gnl|my_center|LOCUS_49940 15398 14580 gene locus_tag LOCUS_49950 gene pssA 15398 14580 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616286.1 protein_id gnl|my_center|LOCUS_49950 16373 15414 gene locus_tag LOCUS_49960 16373 15414 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921674.1 protein_id gnl|my_center|LOCUS_49960 16611 17891 gene locus_tag LOCUS_49970 gene eno 16611 17891 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123706.1 protein_id gnl|my_center|LOCUS_49970 17976 18530 gene locus_tag LOCUS_49980 17976 18530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 20875 18557 gene locus_tag LOCUS_49990 20875 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 21605 21000 gene locus_tag LOCUS_50000 21605 21000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 23527 21602 gene locus_tag LOCUS_50010 gene speA 23527 21602 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119511.1 protein_id gnl|my_center|LOCUS_50010 25366 24782 gene locus_tag LOCUS_50020 25366 24782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 27047 25539 gene locus_tag LOCUS_50030 27047 25539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 28352 27162 gene locus_tag LOCUS_50040 28352 27162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 28967 28386 gene locus_tag LOCUS_50050 28967 28386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 >Feature sequence120 1358 378 gene locus_tag LOCUS_50060 1358 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 1446 2759 gene locus_tag LOCUS_50070 1446 2759 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_50070 2763 3752 gene locus_tag LOCUS_50080 2763 3752 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532950.1 protein_id gnl|my_center|LOCUS_50080 3767 5071 gene locus_tag LOCUS_50090 3767 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 5068 5739 gene locus_tag LOCUS_50100 5068 5739 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921911.1 protein_id gnl|my_center|LOCUS_50100 6397 5795 gene locus_tag LOCUS_50110 6397 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 7202 6456 gene locus_tag LOCUS_50120 7202 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 8253 7309 gene locus_tag LOCUS_50130 8253 7309 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_50130 9762 8311 gene locus_tag LOCUS_50140 9762 8311 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_50140 9974 11443 gene locus_tag LOCUS_50150 9974 11443 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073841.1 protein_id gnl|my_center|LOCUS_50150 11440 13623 gene locus_tag LOCUS_50160 11440 13623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 13633 14271 gene locus_tag LOCUS_50170 13633 14271 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545712.1 protein_id gnl|my_center|LOCUS_50170 14271 14798 gene locus_tag LOCUS_50180 14271 14798 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_50180 14806 16050 gene locus_tag LOCUS_50190 14806 16050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 17841 16147 gene locus_tag LOCUS_50200 17841 16147 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_50200 18273 20621 gene locus_tag LOCUS_50210 18273 20621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 20786 22447 gene locus_tag LOCUS_50220 20786 22447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 25643 22395 gene locus_tag LOCUS_50230 25643 22395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 29514 26059 gene locus_tag LOCUS_50240 29514 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 >Feature sequence121 1903 1415 gene locus_tag LOCUS_50250 1903 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 2707 2102 gene locus_tag LOCUS_50260 2707 2102 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393403.1 protein_id gnl|my_center|LOCUS_50260 4106 2910 gene locus_tag LOCUS_50270 4106 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 4329 8672 gene locus_tag LOCUS_50280 4329 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 9242 10441 gene locus_tag LOCUS_50290 9242 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 10883 12769 gene locus_tag LOCUS_50300 10883 12769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 14859 12805 gene locus_tag LOCUS_50310 14859 12805 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_50310 16416 14890 gene locus_tag LOCUS_50320 16416 14890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_50320 17119 16772 gene locus_tag LOCUS_50330 17119 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 18708 17302 gene locus_tag LOCUS_50340 18708 17302 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_50340 19250 20035 gene locus_tag LOCUS_50350 19250 20035 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615399.1 protein_id gnl|my_center|LOCUS_50350 20952 20032 gene locus_tag LOCUS_50360 20952 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 21698 20946 gene locus_tag LOCUS_50370 21698 20946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 24778 21656 gene locus_tag LOCUS_50380 24778 21656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 26150 24789 gene locus_tag LOCUS_50390 26150 24789 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108575.1 protein_id gnl|my_center|LOCUS_50390 28852 26363 gene locus_tag LOCUS_50400 28852 26363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 >Feature sequence122 1894 3075 gene locus_tag LOCUS_50410 1894 3075 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108695.1 protein_id gnl|my_center|LOCUS_50410 3131 5509 gene locus_tag LOCUS_50420 3131 5509 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108625.1 protein_id gnl|my_center|LOCUS_50420 7205 6378 gene locus_tag LOCUS_50430 7205 6378 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_50430 7565 9727 gene locus_tag LOCUS_50440 7565 9727 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_50440 9743 9985 gene locus_tag LOCUS_50450 gene acpP 9743 9985 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_50450 10070 11626 gene locus_tag LOCUS_50460 10070 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 11922 12815 gene locus_tag LOCUS_50470 11922 12815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 12870 13466 gene locus_tag LOCUS_50480 12870 13466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 17923 13616 gene locus_tag LOCUS_50490 17923 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 18176 17973 gene locus_tag LOCUS_50500 18176 17973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 18518 21373 gene locus_tag LOCUS_50510 gene uvrA 18518 21373 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_50510 21373 22410 gene locus_tag LOCUS_50520 21373 22410 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232375.1 protein_id gnl|my_center|LOCUS_50520 22700 22386 gene locus_tag LOCUS_50530 22700 22386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 22971 23753 gene locus_tag LOCUS_50540 22971 23753 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_50540 23781 25226 gene locus_tag LOCUS_50550 23781 25226 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_50550 25235 25885 gene locus_tag LOCUS_50560 25235 25885 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944374.1 protein_id gnl|my_center|LOCUS_50560 27517 26204 gene locus_tag LOCUS_50570 27517 26204 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119436.1 protein_id gnl|my_center|LOCUS_50570 27942 27514 gene locus_tag LOCUS_50580 27942 27514 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330765.1 protein_id gnl|my_center|LOCUS_50580 28570 28076 gene locus_tag LOCUS_50590 28570 28076 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943199.1 protein_id gnl|my_center|LOCUS_50590 28887 28567 gene locus_tag LOCUS_50600 28887 28567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 >Feature sequence123 3202 1805 gene locus_tag LOCUS_50610 gene selA 3202 1805 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393981.1 protein_id gnl|my_center|LOCUS_50610 3891 3217 gene locus_tag LOCUS_50620 3891 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 4320 5600 gene locus_tag LOCUS_50630 4320 5600 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_50630 5817 5984 gene locus_tag LOCUS_50640 5817 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 7207 6284 gene locus_tag LOCUS_50650 7207 6284 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_50650 7427 8767 gene locus_tag LOCUS_50660 7427 8767 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_50660 8764 10284 gene locus_tag LOCUS_50670 8764 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 10324 10836 gene locus_tag LOCUS_50680 10324 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 11400 13520 gene locus_tag LOCUS_50690 11400 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 13674 14801 gene locus_tag LOCUS_50700 13674 14801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 14814 15506 gene locus_tag LOCUS_50710 14814 15506 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_50710 15512 16618 gene locus_tag LOCUS_50720 15512 16618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_50720 16711 17349 gene locus_tag LOCUS_50730 16711 17349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 17465 18463 gene locus_tag LOCUS_50740 17465 18463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 18638 19084 gene locus_tag LOCUS_50750 18638 19084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 19112 19705 gene locus_tag LOCUS_50760 19112 19705 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_50760 20486 19758 gene locus_tag LOCUS_50770 20486 19758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 22168 20516 gene locus_tag LOCUS_50780 22168 20516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 22578 22207 gene locus_tag LOCUS_50790 22578 22207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 26421 22639 gene locus_tag LOCUS_50800 26421 22639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 26716 26525 gene locus_tag LOCUS_50810 26716 26525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 27273 26890 gene locus_tag LOCUS_50820 27273 26890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 27612 28571 gene locus_tag LOCUS_50830 27612 28571 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_50830 28733 29281 gene locus_tag LOCUS_50840 28733 29281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 29679 29182 gene locus_tag LOCUS_50850 29679 29182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 >Feature sequence124 138 416 gene locus_tag LOCUS_50860 138 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 705 1085 gene locus_tag LOCUS_50870 705 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 1233 2252 gene locus_tag LOCUS_50880 1233 2252 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927014.1 protein_id gnl|my_center|LOCUS_50880 2454 3668 gene locus_tag LOCUS_50890 2454 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 3758 4834 gene locus_tag LOCUS_50900 3758 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 6568 4928 gene locus_tag LOCUS_50910 6568 4928 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_50910 7607 7536 gene locus_tag LOCUS_t00310 7607 7536 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7689 7617 gene locus_tag LOCUS_t00320 7689 7617 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8381 7737 gene locus_tag LOCUS_50920 8381 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 8484 8411 gene locus_tag LOCUS_t00330 8484 8411 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9424 8546 gene locus_tag LOCUS_50930 9424 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 9651 9579 gene locus_tag LOCUS_t00340 9651 9579 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9729 9657 gene locus_tag LOCUS_t00350 9729 9657 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9816 9742 gene locus_tag LOCUS_t00360 9816 9742 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10453 9857 gene locus_tag LOCUS_50940 10453 9857 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_50940 10551 10477 gene locus_tag LOCUS_t00370 10551 10477 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 10656 10573 gene locus_tag LOCUS_t00380 10656 10573 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10743 10670 gene locus_tag LOCUS_t00390 10743 10670 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10836 10748 gene locus_tag LOCUS_t00400 10836 10748 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10918 10847 gene locus_tag LOCUS_t00410 10918 10847 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11001 10929 gene locus_tag LOCUS_t00420 11001 10929 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11140 11069 gene locus_tag LOCUS_t00430 11140 11069 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11223 11150 gene locus_tag LOCUS_t00440 11223 11150 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11306 11230 gene locus_tag LOCUS_t00450 11306 11230 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11555 11470 gene locus_tag LOCUS_t00460 11555 11470 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11636 11563 gene locus_tag LOCUS_t00470 11636 11563 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11716 11643 gene locus_tag LOCUS_t00480 11716 11643 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11819 11735 gene locus_tag LOCUS_t00490 11819 11735 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 11914 11836 gene locus_tag LOCUS_t00500 11914 11836 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11999 11925 gene locus_tag LOCUS_t00510 11999 11925 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 12088 12014 gene locus_tag LOCUS_t00520 12088 12014 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12176 12103 gene locus_tag LOCUS_t00530 12176 12103 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12254 12181 gene locus_tag LOCUS_t00540 12254 12181 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12452 12379 gene locus_tag LOCUS_t00550 12452 12379 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 12556 12471 gene locus_tag LOCUS_t00560 12556 12471 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12646 12571 gene locus_tag LOCUS_t00570 12646 12571 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12748 12676 gene locus_tag LOCUS_t00580 12748 12676 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12829 12757 gene locus_tag LOCUS_t00590 12829 12757 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12921 12838 gene locus_tag LOCUS_t00600 12921 12838 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13002 12926 gene locus_tag LOCUS_t00610 13002 12926 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 13083 13008 gene locus_tag LOCUS_t00620 13083 13008 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13160 13089 gene locus_tag LOCUS_t00630 13160 13089 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13274 13202 gene locus_tag LOCUS_t00640 13274 13202 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13358 13285 gene locus_tag LOCUS_t00650 13358 13285 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13448 13375 gene locus_tag LOCUS_t00660 13448 13375 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 13526 13453 gene locus_tag LOCUS_t00670 13526 13453 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13671 13599 gene locus_tag LOCUS_t00680 13671 13599 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 13752 13679 gene locus_tag LOCUS_t00690 13752 13679 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14040 13968 gene locus_tag LOCUS_t00700 14040 13968 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 14511 15698 gene locus_tag LOCUS_50950 14511 15698 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615395.1 protein_id gnl|my_center|LOCUS_50950 16720 15713 gene locus_tag LOCUS_50960 16720 15713 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289230.1 protein_id gnl|my_center|LOCUS_50960 17908 16721 gene locus_tag LOCUS_50970 17908 16721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 18148 19887 gene locus_tag LOCUS_50980 18148 19887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 19963 21999 gene locus_tag LOCUS_50990 19963 21999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 22366 22181 gene locus_tag LOCUS_51000 22366 22181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 22691 22855 gene locus_tag LOCUS_51010 22691 22855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 23033 22863 gene locus_tag LOCUS_51020 23033 22863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 23296 23030 gene locus_tag LOCUS_51030 23296 23030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 23865 23308 gene locus_tag LOCUS_51040 23865 23308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 24502 23909 gene locus_tag LOCUS_51050 24502 23909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937351.1 protein_id gnl|my_center|LOCUS_51050 25162 24545 gene locus_tag LOCUS_51060 25162 24545 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545227.1 protein_id gnl|my_center|LOCUS_51060 25448 25167 gene locus_tag LOCUS_51070 25448 25167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 25427 25648 gene locus_tag LOCUS_51080 25427 25648 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941743.1 protein_id gnl|my_center|LOCUS_51080 25656 26027 gene locus_tag LOCUS_51090 25656 26027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 26801 26031 gene locus_tag LOCUS_51100 26801 26031 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786402.1 protein_id gnl|my_center|LOCUS_51100 27147 26842 gene locus_tag LOCUS_51110 27147 26842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 27559 27179 gene locus_tag LOCUS_51120 27559 27179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 27728 28300 gene locus_tag LOCUS_51130 27728 28300 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_51130 28594 28319 gene locus_tag LOCUS_51140 28594 28319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 29177 28617 gene locus_tag LOCUS_51150 29177 28617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 >Feature sequence125 305 1183 gene locus_tag LOCUS_51160 gene folD 305 1183 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922068.1 protein_id gnl|my_center|LOCUS_51160 1400 3502 gene locus_tag LOCUS_51170 1400 3502 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_51170 4449 3910 gene locus_tag LOCUS_51180 4449 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 5212 4775 gene locus_tag LOCUS_51190 5212 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 6497 5508 gene locus_tag LOCUS_51200 6497 5508 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897464.1 protein_id gnl|my_center|LOCUS_51200 7309 6494 gene locus_tag LOCUS_51210 gene fepC 7309 6494 CDS product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097639.1 protein_id gnl|my_center|LOCUS_51210 8238 7306 gene locus_tag LOCUS_51220 8238 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 8590 8252 gene locus_tag LOCUS_51230 8590 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 8968 8759 gene locus_tag LOCUS_51240 8968 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 9485 11035 gene locus_tag LOCUS_51250 9485 11035 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922561.1 protein_id gnl|my_center|LOCUS_51250 11090 11175 gene locus_tag LOCUS_t00710 11090 11175 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12078 13772 gene locus_tag LOCUS_51260 12078 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 13998 16847 gene locus_tag LOCUS_51270 13998 16847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 18509 16989 gene locus_tag LOCUS_51280 18509 16989 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037250650.1 protein_id gnl|my_center|LOCUS_51280 18756 18514 gene locus_tag LOCUS_51290 18756 18514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 18976 19734 gene locus_tag LOCUS_51300 18976 19734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 19661 21259 gene locus_tag LOCUS_51310 19661 21259 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921045.1 protein_id gnl|my_center|LOCUS_51310 21281 24376 gene locus_tag LOCUS_51320 21281 24376 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922671.1 protein_id gnl|my_center|LOCUS_51320 27989 24402 gene locus_tag LOCUS_51330 27989 24402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 28558 28109 gene locus_tag LOCUS_51340 28558 28109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 29259 28555 gene locus_tag LOCUS_51350 29259 28555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 >Feature sequence126 1194 217 gene locus_tag LOCUS_51360 1194 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 1770 1195 gene locus_tag LOCUS_51370 1770 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 2265 1783 gene locus_tag LOCUS_51380 2265 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 3010 2591 gene locus_tag LOCUS_51390 3010 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 3624 4796 gene locus_tag LOCUS_51400 3624 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 4937 5650 gene locus_tag LOCUS_51410 4937 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 5654 6457 gene locus_tag LOCUS_51420 5654 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 6436 7170 gene locus_tag LOCUS_51430 6436 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 7656 8561 gene locus_tag LOCUS_51440 7656 8561 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_51440 9248 8709 gene locus_tag LOCUS_51450 9248 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 11126 9300 gene locus_tag LOCUS_51460 11126 9300 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_51460 11526 12560 gene locus_tag LOCUS_51470 11526 12560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 12729 12989 gene locus_tag LOCUS_51480 12729 12989 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119905.1 protein_id gnl|my_center|LOCUS_51480 13156 14622 gene locus_tag LOCUS_51490 13156 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117691.1 protein_id gnl|my_center|LOCUS_51490 16313 14619 gene locus_tag LOCUS_51500 16313 14619 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_51500 16549 16620 gene locus_tag LOCUS_t00720 16549 16620 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 18134 16743 gene locus_tag LOCUS_51510 18134 16743 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229302.1 protein_id gnl|my_center|LOCUS_51510 21113 18834 gene locus_tag LOCUS_51520 21113 18834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 21566 22417 gene locus_tag LOCUS_51530 21566 22417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 22675 23163 gene locus_tag LOCUS_51540 22675 23163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 23339 24520 gene locus_tag LOCUS_51550 23339 24520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 24680 24895 gene locus_tag LOCUS_51560 24680 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 24892 25542 gene locus_tag LOCUS_51570 24892 25542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 25539 25937 gene locus_tag LOCUS_51580 25539 25937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 25940 26476 gene locus_tag LOCUS_51590 25940 26476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 26476 27318 gene locus_tag LOCUS_51600 26476 27318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 27315 29186 gene locus_tag LOCUS_51610 27315 29186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 >Feature sequence127 810 1826 gene locus_tag LOCUS_51620 810 1826 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121665.1 protein_id gnl|my_center|LOCUS_51620 2485 4443 gene locus_tag LOCUS_51630 2485 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 4448 5995 gene locus_tag LOCUS_51640 4448 5995 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_51640 7259 6171 gene locus_tag LOCUS_51650 7259 6171 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122130.1 protein_id gnl|my_center|LOCUS_51650 7630 8103 gene locus_tag LOCUS_51660 7630 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 8650 8234 gene locus_tag LOCUS_51670 8650 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51670 9195 9431 gene locus_tag LOCUS_51680 9195 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 9431 9700 gene locus_tag LOCUS_51690 9431 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 9966 9712 gene locus_tag LOCUS_51700 9966 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 10471 11757 gene locus_tag LOCUS_51710 10471 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 11859 12947 gene locus_tag LOCUS_51720 11859 12947 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_51720 13498 13271 gene locus_tag LOCUS_51730 13498 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 14628 14092 gene locus_tag LOCUS_51740 14628 14092 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_51740 15080 16201 gene locus_tag LOCUS_51750 15080 16201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 17898 16219 gene locus_tag LOCUS_51760 17898 16219 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427734.1 protein_id gnl|my_center|LOCUS_51760 19317 17968 gene locus_tag LOCUS_51770 gene trkA 19317 17968 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327001.1 protein_id gnl|my_center|LOCUS_51770 19549 19343 gene locus_tag LOCUS_51780 19549 19343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 20190 19588 gene locus_tag LOCUS_51790 20190 19588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 20845 20444 gene locus_tag LOCUS_51800 20845 20444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 21085 21954 gene locus_tag LOCUS_51810 21085 21954 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327663.1 protein_id gnl|my_center|LOCUS_51810 22131 22204 gene locus_tag LOCUS_t00730 22131 22204 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 22628 23110 gene locus_tag LOCUS_51820 22628 23110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 23447 23286 gene locus_tag LOCUS_51830 23447 23286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 25358 24333 gene locus_tag LOCUS_51840 25358 24333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 25635 25375 gene locus_tag LOCUS_51850 25635 25375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 26093 26911 gene locus_tag LOCUS_51860 26093 26911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 26942 28348 gene locus_tag LOCUS_51870 26942 28348 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_51870 28361 28963 gene locus_tag LOCUS_51880 28361 28963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 >Feature sequence128 259 68 gene locus_tag LOCUS_51890 259 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 1801 272 gene locus_tag LOCUS_51900 1801 272 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332236.1 protein_id gnl|my_center|LOCUS_51900 2190 1873 gene locus_tag LOCUS_51910 2190 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 3699 2398 gene locus_tag LOCUS_51920 3699 2398 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_51920 3944 5158 gene locus_tag LOCUS_51930 gene ribA 3944 5158 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123761.1 protein_id gnl|my_center|LOCUS_51930 5538 6701 gene locus_tag LOCUS_51940 5538 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 6956 7399 gene locus_tag LOCUS_51950 6956 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 7788 7420 gene locus_tag LOCUS_51960 7788 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 7781 10459 gene locus_tag LOCUS_51970 7781 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 10772 12235 gene locus_tag LOCUS_51980 gene cls 10772 12235 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210648.1 protein_id gnl|my_center|LOCUS_51980 12970 14613 gene locus_tag LOCUS_51990 12970 14613 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121117.1 protein_id gnl|my_center|LOCUS_51990 15040 14741 gene locus_tag LOCUS_52000 15040 14741 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668605.1 protein_id gnl|my_center|LOCUS_52000 15811 15479 gene locus_tag LOCUS_52010 15811 15479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 16055 16849 gene locus_tag LOCUS_52020 16055 16849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 18242 16812 gene locus_tag LOCUS_52030 18242 16812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 18919 21747 gene locus_tag LOCUS_52040 18919 21747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 21849 22262 gene locus_tag LOCUS_52050 21849 22262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 22259 23437 gene locus_tag LOCUS_52060 22259 23437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 23659 25194 gene locus_tag LOCUS_52070 23659 25194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 25331 28726 gene locus_tag LOCUS_52080 25331 28726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 >Feature sequence129 1392 82 gene locus_tag LOCUS_52090 1392 82 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_52090 5953 2453 gene locus_tag LOCUS_52100 5953 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 7845 6049 gene locus_tag LOCUS_52110 7845 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 8381 11386 gene locus_tag LOCUS_52120 8381 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 12695 11484 gene locus_tag LOCUS_52130 12695 11484 CDS product agarase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189932637.1 protein_id gnl|my_center|LOCUS_52130 14835 12772 gene locus_tag LOCUS_52140 14835 12772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 14877 16319 gene locus_tag LOCUS_52150 14877 16319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 16378 16569 gene locus_tag LOCUS_52160 16378 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 18051 16717 gene locus_tag LOCUS_52170 18051 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 18219 19244 gene locus_tag LOCUS_52180 18219 19244 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029688.1 protein_id gnl|my_center|LOCUS_52180 19264 20133 gene locus_tag LOCUS_52190 19264 20133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 20932 20315 gene locus_tag LOCUS_52200 20932 20315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 21036 23075 gene locus_tag LOCUS_52210 21036 23075 CDS product DUF4838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236914.1 protein_id gnl|my_center|LOCUS_52210 23090 25939 gene locus_tag LOCUS_52220 23090 25939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 25939 26718 gene locus_tag LOCUS_52230 25939 26718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 26928 27812 gene locus_tag LOCUS_52240 26928 27812 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_52240 27926 28309 gene locus_tag LOCUS_52250 27926 28309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 28242 28643 gene locus_tag LOCUS_52260 28242 28643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 >Feature sequence130 409 684 gene locus_tag LOCUS_52270 409 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 849 2468 gene locus_tag LOCUS_52280 849 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 2465 3856 gene locus_tag LOCUS_52290 2465 3856 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 protein_id gnl|my_center|LOCUS_52290 3870 4742 gene locus_tag LOCUS_52300 3870 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 4759 5721 gene locus_tag LOCUS_52310 4759 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 8812 6077 gene locus_tag LOCUS_52320 8812 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 10435 8963 gene locus_tag LOCUS_52330 10435 8963 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_52330 12150 10504 gene locus_tag LOCUS_52340 12150 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 13135 14211 gene locus_tag LOCUS_52350 13135 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 14254 14898 gene locus_tag LOCUS_52360 14254 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122087.1 protein_id gnl|my_center|LOCUS_52360 14924 15997 gene locus_tag LOCUS_52370 14924 15997 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226619.1 protein_id gnl|my_center|LOCUS_52370 16036 18840 gene locus_tag LOCUS_52380 16036 18840 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139236412.1 protein_id gnl|my_center|LOCUS_52380 20049 19570 gene locus_tag LOCUS_52390 20049 19570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 21017 20088 gene locus_tag LOCUS_52400 21017 20088 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388824.1 protein_id gnl|my_center|LOCUS_52400 21775 21074 gene locus_tag LOCUS_52410 21775 21074 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388822.1 protein_id gnl|my_center|LOCUS_52410 22554 21772 gene locus_tag LOCUS_52420 22554 21772 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388821.1 protein_id gnl|my_center|LOCUS_52420 23154 22861 gene locus_tag LOCUS_52430 23154 22861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 23160 24095 gene locus_tag LOCUS_52440 gene ala 23160 24095 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_52440 24535 25665 gene locus_tag LOCUS_52450 24535 25665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 25817 26761 gene locus_tag LOCUS_52460 25817 26761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 27387 28202 gene locus_tag LOCUS_52470 27387 28202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 >Feature sequence131 340 1089 gene locus_tag LOCUS_52480 340 1089 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268013.1 protein_id gnl|my_center|LOCUS_52480 1307 1822 gene locus_tag LOCUS_52490 1307 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 2461 2306 gene locus_tag LOCUS_52500 2461 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 2665 2468 gene locus_tag LOCUS_52510 2665 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52510 5754 2695 gene locus_tag LOCUS_52520 5754 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 7440 6352 gene locus_tag LOCUS_52530 7440 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 8693 7443 gene locus_tag LOCUS_52540 8693 7443 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_52540 9369 8848 gene locus_tag LOCUS_52550 9369 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 12411 9472 gene locus_tag LOCUS_52560 12411 9472 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_52560 12556 12813 gene locus_tag LOCUS_52570 12556 12813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 12900 13592 gene locus_tag LOCUS_52580 12900 13592 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795919.1 protein_id gnl|my_center|LOCUS_52580 13589 15010 gene locus_tag LOCUS_52590 13589 15010 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393971.1 protein_id gnl|my_center|LOCUS_52590 15268 15732 gene locus_tag LOCUS_52600 15268 15732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 18914 15777 gene locus_tag LOCUS_52610 18914 15777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 20637 18931 gene locus_tag LOCUS_52620 20637 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 21961 20924 gene locus_tag LOCUS_52630 21961 20924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 22315 23610 gene locus_tag LOCUS_52640 22315 23610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 23624 25387 gene locus_tag LOCUS_52650 23624 25387 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_52650 25572 25949 gene locus_tag LOCUS_52660 gene crcB 25572 25949 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_52660 25967 26308 gene locus_tag LOCUS_52670 25967 26308 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_52670 26544 27266 gene locus_tag LOCUS_52680 26544 27266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 27511 27873 gene locus_tag LOCUS_52690 27511 27873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 >Feature sequence132 337 537 gene locus_tag LOCUS_52700 337 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 547 882 gene locus_tag LOCUS_52710 547 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 1044 1337 gene locus_tag LOCUS_52720 1044 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 1472 1840 gene locus_tag LOCUS_52730 1472 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 3314 1773 gene locus_tag LOCUS_52740 3314 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 6096 3463 gene locus_tag LOCUS_52750 6096 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 6430 7023 gene locus_tag LOCUS_52760 6430 7023 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812379.1 protein_id gnl|my_center|LOCUS_52760 7072 7665 gene locus_tag LOCUS_52770 7072 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 8987 7878 gene locus_tag LOCUS_52780 8987 7878 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942002.1 protein_id gnl|my_center|LOCUS_52780 9901 8987 gene locus_tag LOCUS_52790 gene cysW 9901 8987 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 protein_id gnl|my_center|LOCUS_52790 10744 9905 gene locus_tag LOCUS_52800 gene cysT 10744 9905 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_52800 11947 10832 gene locus_tag LOCUS_52810 11947 10832 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_52810 12722 12414 gene locus_tag LOCUS_52820 12722 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 12866 15376 gene locus_tag LOCUS_52830 12866 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 15421 15585 gene locus_tag LOCUS_52840 15421 15585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 15685 17292 gene locus_tag LOCUS_52850 15685 17292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 18457 17324 gene locus_tag LOCUS_52860 18457 17324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 20294 18870 gene locus_tag LOCUS_52870 20294 18870 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_52870 22426 20324 gene locus_tag LOCUS_52880 22426 20324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 22652 23578 gene locus_tag LOCUS_52890 22652 23578 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229868.1 protein_id gnl|my_center|LOCUS_52890 25868 23505 gene locus_tag LOCUS_52900 25868 23505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 27237 26278 gene locus_tag LOCUS_52910 27237 26278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 >Feature sequence133 825 4646 gene locus_tag LOCUS_52920 825 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 5033 4710 gene locus_tag LOCUS_52930 5033 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 5383 5309 gene locus_tag LOCUS_t00740 5383 5309 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5960 5676 gene locus_tag LOCUS_52940 5960 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 6193 6738 gene locus_tag LOCUS_52950 6193 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 6846 9572 gene locus_tag LOCUS_52960 gene aceE 6846 9572 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_52960 9638 10984 gene locus_tag LOCUS_52970 9638 10984 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119355.1 protein_id gnl|my_center|LOCUS_52970 10998 12422 gene locus_tag LOCUS_52980 gene lpdA 10998 12422 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_52980 12521 13255 gene locus_tag LOCUS_52990 12521 13255 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921820.1 protein_id gnl|my_center|LOCUS_52990 13562 15592 gene locus_tag LOCUS_53000 13562 15592 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_53000 15690 16505 gene locus_tag LOCUS_53010 15690 16505 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187830.1 protein_id gnl|my_center|LOCUS_53010 16514 17293 gene locus_tag LOCUS_53020 16514 17293 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 protein_id gnl|my_center|LOCUS_53020 19402 17438 gene locus_tag LOCUS_53030 19402 17438 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664668.1 protein_id gnl|my_center|LOCUS_53030 19866 21902 gene locus_tag LOCUS_53040 19866 21902 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922336.1 protein_id gnl|my_center|LOCUS_53040 21922 22827 gene locus_tag LOCUS_53050 21922 22827 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117849.1 protein_id gnl|my_center|LOCUS_53050 23164 22883 gene locus_tag LOCUS_53060 23164 22883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 23045 25093 gene locus_tag LOCUS_53070 23045 25093 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_53070 25748 25203 gene locus_tag LOCUS_53080 25748 25203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 >Feature sequence134 301 1620 gene locus_tag LOCUS_53090 301 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 2988 1624 gene locus_tag LOCUS_53100 2988 1624 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_53100 3438 6314 gene locus_tag LOCUS_53110 3438 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 6370 7278 gene locus_tag LOCUS_53120 6370 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 7326 9185 gene locus_tag LOCUS_53130 7326 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 9242 12868 gene locus_tag LOCUS_53140 9242 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 13125 14372 gene locus_tag LOCUS_53150 13125 14372 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_53150 14489 14938 gene locus_tag LOCUS_53160 14489 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 16077 15646 gene locus_tag LOCUS_53170 16077 15646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 19648 16478 gene locus_tag LOCUS_53180 19648 16478 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120396.1 protein_id gnl|my_center|LOCUS_53180 22446 19645 gene locus_tag LOCUS_53190 22446 19645 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120395.1 protein_id gnl|my_center|LOCUS_53190 22754 23818 gene locus_tag LOCUS_53200 22754 23818 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_53200 25673 25918 gene locus_tag LOCUS_53210 25673 25918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 26393 25974 gene locus_tag LOCUS_53220 26393 25974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 26693 26400 gene locus_tag LOCUS_53230 26693 26400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 >Feature sequence135 978 151 gene locus_tag LOCUS_53240 gene hpaI 978 151 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067428.1 protein_id gnl|my_center|LOCUS_53240 1617 1150 gene locus_tag LOCUS_53250 1617 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 1903 1661 gene locus_tag LOCUS_53260 1903 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 5340 1960 gene locus_tag LOCUS_53270 5340 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 5498 5815 gene locus_tag LOCUS_53280 gene nirD 5498 5815 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_53280 5848 6339 gene locus_tag LOCUS_53290 5848 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 6671 7063 gene locus_tag LOCUS_53300 6671 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 7524 7141 gene locus_tag LOCUS_53310 7524 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 8180 7521 gene locus_tag LOCUS_53320 8180 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 8808 9797 gene locus_tag LOCUS_53330 8808 9797 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_53330 9797 10678 gene locus_tag LOCUS_53340 9797 10678 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_53340 10679 11620 gene locus_tag LOCUS_53350 10679 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405284.1 protein_id gnl|my_center|LOCUS_53350 11617 12687 gene locus_tag LOCUS_53360 11617 12687 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_53360 12687 13718 gene locus_tag LOCUS_53370 12687 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53370 13715 15394 gene locus_tag LOCUS_53380 13715 15394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 15396 17297 gene locus_tag LOCUS_53390 15396 17297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 17294 18076 gene locus_tag LOCUS_53400 17294 18076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 19587 18082 gene locus_tag LOCUS_53410 19587 18082 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_53410 20361 19885 gene locus_tag LOCUS_53420 20361 19885 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_53420 21057 20377 gene locus_tag LOCUS_53430 21057 20377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333116.1 protein_id gnl|my_center|LOCUS_53430 22176 21295 gene locus_tag LOCUS_53440 gene hisG 22176 21295 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_53440 22598 22173 gene locus_tag LOCUS_53450 gene hisI 22598 22173 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_53450 22758 23564 gene locus_tag LOCUS_53460 22758 23564 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140508.1 protein_id gnl|my_center|LOCUS_53460 25222 23882 gene locus_tag LOCUS_53470 25222 23882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 >Feature sequence136 2638 251 gene locus_tag LOCUS_53480 2638 251 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_53480 4187 2709 gene locus_tag LOCUS_53490 4187 2709 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_53490 4857 4486 gene locus_tag LOCUS_53500 4857 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 5840 5241 gene locus_tag LOCUS_53510 5840 5241 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_53510 6736 5855 gene locus_tag LOCUS_53520 6736 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 8451 7006 gene locus_tag LOCUS_53530 8451 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 9645 8584 gene locus_tag LOCUS_53540 9645 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666288.1 protein_id gnl|my_center|LOCUS_53540 10279 9638 gene locus_tag LOCUS_53550 10279 9638 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_53550 11612 10731 gene locus_tag LOCUS_53560 11612 10731 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_53560 11888 12760 gene locus_tag LOCUS_53570 11888 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 12838 14919 gene locus_tag LOCUS_53580 12838 14919 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_53580 15609 14986 gene locus_tag LOCUS_53590 15609 14986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 16153 19845 gene locus_tag LOCUS_53600 16153 19845 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260976.1 protein_id gnl|my_center|LOCUS_53600 19846 21198 gene locus_tag LOCUS_53610 19846 21198 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_53610 21381 23276 gene locus_tag LOCUS_53620 21381 23276 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119127.1 protein_id gnl|my_center|LOCUS_53620 23384 24268 gene locus_tag LOCUS_53630 23384 24268 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922494.1 protein_id gnl|my_center|LOCUS_53630 24425 25249 gene locus_tag LOCUS_53640 24425 25249 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921566.1 protein_id gnl|my_center|LOCUS_53640 25453 26061 gene locus_tag LOCUS_53650 gene hisH 25453 26061 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_53650 >Feature sequence137 3777 427 gene locus_tag LOCUS_53660 3777 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 4340 4726 gene locus_tag LOCUS_53670 4340 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 6123 4723 gene locus_tag LOCUS_53680 6123 4723 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_53680 6113 6292 gene locus_tag LOCUS_53690 6113 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 6341 7135 gene locus_tag LOCUS_53700 6341 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 7154 8161 gene locus_tag LOCUS_53710 7154 8161 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 protein_id gnl|my_center|LOCUS_53710 8199 8609 gene locus_tag LOCUS_53720 8199 8609 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_53720 8726 10189 gene locus_tag LOCUS_53730 8726 10189 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582544.1 protein_id gnl|my_center|LOCUS_53730 11167 10850 gene locus_tag LOCUS_53740 11167 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 11406 11185 gene locus_tag LOCUS_53750 11406 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 12550 11660 gene locus_tag LOCUS_53760 12550 11660 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022404.1 protein_id gnl|my_center|LOCUS_53760 13438 12569 gene locus_tag LOCUS_53770 13438 12569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 14523 13450 gene locus_tag LOCUS_53780 14523 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 15080 14520 gene locus_tag LOCUS_53790 15080 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 15366 15085 gene locus_tag LOCUS_53800 15366 15085 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022407.1 protein_id gnl|my_center|LOCUS_53800 16186 15491 gene locus_tag LOCUS_53810 16186 15491 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_53810 16613 16176 gene locus_tag LOCUS_53820 16613 16176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 16995 16606 gene locus_tag LOCUS_53830 16995 16606 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_53830 18172 16985 gene locus_tag LOCUS_53840 gene atpD 18172 16985 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_53840 19685 18213 gene locus_tag LOCUS_53850 19685 18213 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941216.1 protein_id gnl|my_center|LOCUS_53850 19888 19739 gene locus_tag LOCUS_53860 19888 19739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 21780 20374 gene locus_tag LOCUS_53870 21780 20374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 24565 21782 gene locus_tag LOCUS_53880 24565 21782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 24854 25159 gene locus_tag LOCUS_53890 24854 25159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 25204 25701 gene locus_tag LOCUS_53900 25204 25701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 >Feature sequence138 708 980 gene locus_tag LOCUS_53910 708 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53910 3070 1259 gene locus_tag LOCUS_53920 3070 1259 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 protein_id gnl|my_center|LOCUS_53920 3645 3070 gene locus_tag LOCUS_53930 3645 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 3911 4393 gene locus_tag LOCUS_53940 3911 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 4521 5756 gene locus_tag LOCUS_53950 4521 5756 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921978.1 protein_id gnl|my_center|LOCUS_53950 5807 6625 gene locus_tag LOCUS_53960 5807 6625 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121488.1 protein_id gnl|my_center|LOCUS_53960 10545 6781 gene locus_tag LOCUS_53970 10545 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 10642 11958 gene locus_tag LOCUS_53980 10642 11958 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_53980 13606 11972 gene locus_tag LOCUS_53990 13606 11972 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_53990 13799 16390 gene locus_tag LOCUS_54000 13799 16390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 18310 16574 gene locus_tag LOCUS_54010 18310 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 18461 19042 gene locus_tag LOCUS_54020 18461 19042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 20609 19218 gene locus_tag LOCUS_54030 20609 19218 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615810.1 protein_id gnl|my_center|LOCUS_54030 21802 20630 gene locus_tag LOCUS_54040 21802 20630 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121147.1 protein_id gnl|my_center|LOCUS_54040 23308 22025 gene locus_tag LOCUS_54050 23308 22025 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615817.1 protein_id gnl|my_center|LOCUS_54050 25824 23938 gene locus_tag LOCUS_54060 25824 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 >Feature sequence139 114 314 gene locus_tag LOCUS_54070 114 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 499 759 gene locus_tag LOCUS_54080 499 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 792 4037 gene locus_tag LOCUS_54090 792 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 4049 8467 gene locus_tag LOCUS_54100 4049 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 8710 11925 gene locus_tag LOCUS_54110 8710 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 11934 12164 gene locus_tag LOCUS_54120 11934 12164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 12976 14064 gene locus_tag LOCUS_54130 12976 14064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 15371 14454 gene locus_tag LOCUS_54140 15371 14454 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_54140 15598 17709 gene locus_tag LOCUS_54150 15598 17709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 17956 21384 gene locus_tag LOCUS_54160 17956 21384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922055.1 protein_id gnl|my_center|LOCUS_54160 21389 22129 gene locus_tag LOCUS_54170 21389 22129 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121331.1 protein_id gnl|my_center|LOCUS_54170 22132 22596 gene locus_tag LOCUS_54180 22132 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 22892 23857 gene locus_tag LOCUS_54190 22892 23857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 23890 24912 gene locus_tag LOCUS_54200 23890 24912 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_54200 25033 26028 gene locus_tag LOCUS_54210 25033 26028 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_54210 >Feature sequence140 1202 147 gene locus_tag LOCUS_54220 1202 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 4284 1720 gene locus_tag LOCUS_54230 4284 1720 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982246.1 protein_id gnl|my_center|LOCUS_54230 5120 6667 gene locus_tag LOCUS_54240 5120 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 9022 6743 gene locus_tag LOCUS_54250 9022 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 9742 10728 gene locus_tag LOCUS_54260 9742 10728 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_54260 10803 11258 gene locus_tag LOCUS_54270 10803 11258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 12866 12309 gene locus_tag LOCUS_54280 12866 12309 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_54280 13950 12904 gene locus_tag LOCUS_54290 13950 12904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 14049 17582 gene locus_tag LOCUS_54300 14049 17582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 17929 18258 gene locus_tag LOCUS_54310 17929 18258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 19170 18442 gene locus_tag LOCUS_54320 19170 18442 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081684.1 protein_id gnl|my_center|LOCUS_54320 21357 19657 gene locus_tag LOCUS_54330 21357 19657 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_54330 21814 24426 gene locus_tag LOCUS_54340 21814 24426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 24643 24431 gene locus_tag LOCUS_54350 24643 24431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 <25788 24827 gene locus_tag LOCUS_54360 <25788 24827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004541251.1:sialidase family protein >Feature sequence141 1922 426 gene locus_tag LOCUS_54370 1922 426 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144273.1 protein_id gnl|my_center|LOCUS_54370 2590 2012 gene locus_tag LOCUS_54380 2590 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 3004 2813 gene locus_tag LOCUS_54390 3004 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 3372 3004 gene locus_tag LOCUS_54400 3372 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 4009 3422 gene locus_tag LOCUS_54410 4009 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 4142 3933 gene locus_tag LOCUS_54420 4142 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 4581 4279 gene locus_tag LOCUS_54430 4581 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 5242 4640 gene locus_tag LOCUS_54440 5242 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 6294 5503 gene locus_tag LOCUS_54450 6294 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 6637 6359 gene locus_tag LOCUS_54460 6637 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 7291 8601 gene locus_tag LOCUS_54470 7291 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 8652 9560 gene locus_tag LOCUS_54480 8652 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942591.1 protein_id gnl|my_center|LOCUS_54480 10438 9608 gene locus_tag LOCUS_54490 10438 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 10649 12481 gene locus_tag LOCUS_54500 10649 12481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 12527 14956 gene locus_tag LOCUS_54510 12527 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 15003 17012 gene locus_tag LOCUS_54520 15003 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 17086 17604 gene locus_tag LOCUS_54530 17086 17604 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123255.1 protein_id gnl|my_center|LOCUS_54530 17594 18361 gene locus_tag LOCUS_54540 17594 18361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 18780 18340 gene locus_tag LOCUS_54550 18780 18340 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932613.1 protein_id gnl|my_center|LOCUS_54550 18971 19252 gene locus_tag LOCUS_54560 18971 19252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 19520 19747 gene locus_tag LOCUS_54570 19520 19747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 19671 22619 gene locus_tag LOCUS_54580 19671 22619 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064471.1 protein_id gnl|my_center|LOCUS_54580 22616 23659 gene locus_tag LOCUS_54590 22616 23659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064472.1 protein_id gnl|my_center|LOCUS_54590 >Feature sequence142 842 264 gene locus_tag LOCUS_54600 842 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 1806 964 gene locus_tag LOCUS_54610 1806 964 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839268.1 protein_id gnl|my_center|LOCUS_54610 2419 2048 gene locus_tag LOCUS_54620 2419 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 4526 2424 gene locus_tag LOCUS_54630 4526 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54630 6006 4693 gene locus_tag LOCUS_54640 6006 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 6245 8401 gene locus_tag LOCUS_54650 6245 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921289.1 protein_id gnl|my_center|LOCUS_54650 8505 8978 gene locus_tag LOCUS_54660 8505 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326944.1 protein_id gnl|my_center|LOCUS_54660 9230 8985 gene locus_tag LOCUS_54670 9230 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 9412 10677 gene locus_tag LOCUS_54680 9412 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 10855 12324 gene locus_tag LOCUS_54690 10855 12324 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_54690 12300 16514 gene locus_tag LOCUS_54700 12300 16514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 17686 16598 gene locus_tag LOCUS_54710 17686 16598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 18473 17751 gene locus_tag LOCUS_54720 18473 17751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 21372 18463 gene locus_tag LOCUS_54730 21372 18463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 23867 21489 gene locus_tag LOCUS_54740 23867 21489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 24348 24276 gene locus_tag LOCUS_t00750 24348 24276 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 24885 24451 gene locus_tag LOCUS_54750 24885 24451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 25259 24903 gene locus_tag LOCUS_54760 25259 24903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54760 >Feature sequence143 176 352 gene locus_tag LOCUS_54770 176 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 486 1859 gene locus_tag LOCUS_54780 486 1859 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616161.1 protein_id gnl|my_center|LOCUS_54780 1867 3258 gene locus_tag LOCUS_54790 1867 3258 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123058.1 protein_id gnl|my_center|LOCUS_54790 4180 4953 gene locus_tag LOCUS_54800 4180 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54800 5197 6369 gene locus_tag LOCUS_54810 5197 6369 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921817.1 protein_id gnl|my_center|LOCUS_54810 6366 9596 gene locus_tag LOCUS_54820 6366 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 12537 9661 gene locus_tag LOCUS_54830 12537 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 13535 12861 gene locus_tag LOCUS_54840 13535 12861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 14549 13707 gene locus_tag LOCUS_54850 14549 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 15084 18740 gene locus_tag LOCUS_54860 15084 18740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 19659 18757 gene locus_tag LOCUS_54870 19659 18757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 21431 19659 gene locus_tag LOCUS_54880 21431 19659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 22893 21631 gene locus_tag LOCUS_54890 22893 21631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 24275 22899 gene locus_tag LOCUS_54900 24275 22899 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_54900 <25507 24282 gene locus_tag LOCUS_54910 <25507 24282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083453276.1:universal stress protein >Feature sequence144 <1 1553 gene locus_tag LOCUS_54920 <1 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922330.1:dockerin type I domain-containing protein 1575 6512 gene locus_tag LOCUS_54930 1575 6512 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122240.1 protein_id gnl|my_center|LOCUS_54930 8317 6614 gene locus_tag LOCUS_54940 8317 6614 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_54940 10433 8667 gene locus_tag LOCUS_54950 10433 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 11579 10647 gene locus_tag LOCUS_54960 11579 10647 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_54960 12054 13331 gene locus_tag LOCUS_54970 12054 13331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 13408 15249 gene locus_tag LOCUS_54980 13408 15249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 15262 16467 gene locus_tag LOCUS_54990 15262 16467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 19435 16949 gene locus_tag LOCUS_55000 19435 16949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 20948 19506 gene locus_tag LOCUS_55010 20948 19506 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_55010 22633 21074 gene locus_tag LOCUS_55020 gene rny 22633 21074 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325643.1 protein_id gnl|my_center|LOCUS_55020 23846 24793 gene locus_tag LOCUS_55030 23846 24793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 >Feature sequence145 284 1969 gene locus_tag LOCUS_55040 284 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 2274 3383 gene locus_tag LOCUS_55050 2274 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 3516 4973 gene locus_tag LOCUS_55060 3516 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 4970 6940 gene locus_tag LOCUS_55070 4970 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 6997 7293 gene locus_tag LOCUS_55080 6997 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 9003 7540 gene locus_tag LOCUS_55090 9003 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 10129 9158 gene locus_tag LOCUS_55100 10129 9158 CDS product DUF21 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324277.1 protein_id gnl|my_center|LOCUS_55100 11391 10126 gene locus_tag LOCUS_55110 11391 10126 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324278.1 protein_id gnl|my_center|LOCUS_55110 13260 11434 gene locus_tag LOCUS_55120 13260 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615466.1 protein_id gnl|my_center|LOCUS_55120 13744 14121 gene locus_tag LOCUS_55130 13744 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 15314 14181 gene locus_tag LOCUS_55140 15314 14181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 15941 15465 gene locus_tag LOCUS_55150 15941 15465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 17366 16146 gene locus_tag LOCUS_55160 17366 16146 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_55160 18747 17626 gene locus_tag LOCUS_55170 18747 17626 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359867.1 protein_id gnl|my_center|LOCUS_55170 18847 19320 gene locus_tag LOCUS_55180 18847 19320 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660073.1 protein_id gnl|my_center|LOCUS_55180 19452 20705 gene locus_tag LOCUS_55190 19452 20705 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_55190 20715 24263 gene locus_tag LOCUS_55200 20715 24263 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922355.1 protein_id gnl|my_center|LOCUS_55200 >Feature sequence146 1209 445 gene locus_tag LOCUS_55210 1209 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 1725 2201 gene locus_tag LOCUS_55220 1725 2201 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117815.1 protein_id gnl|my_center|LOCUS_55220 2208 3539 gene locus_tag LOCUS_55230 gene hisS 2208 3539 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117814.1 protein_id gnl|my_center|LOCUS_55230 5376 3697 gene locus_tag LOCUS_55240 5376 3697 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 protein_id gnl|my_center|LOCUS_55240 6148 5609 gene locus_tag LOCUS_55250 6148 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 8337 6145 gene locus_tag LOCUS_55260 8337 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55260 8772 8401 gene locus_tag LOCUS_55270 8772 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 8963 8787 gene locus_tag LOCUS_55280 8963 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 9124 8960 gene locus_tag LOCUS_55290 9124 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 10012 9212 gene locus_tag LOCUS_55300 10012 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 10681 10358 gene locus_tag LOCUS_55310 10681 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 10947 10678 gene locus_tag LOCUS_55320 10947 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 11178 11570 gene locus_tag LOCUS_55330 11178 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 12037 11567 gene locus_tag LOCUS_55340 12037 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 12436 13500 gene locus_tag LOCUS_55350 12436 13500 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122825.1 protein_id gnl|my_center|LOCUS_55350 13692 14132 gene locus_tag LOCUS_55360 13692 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 14157 14642 gene locus_tag LOCUS_55370 14157 14642 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197879.1 protein_id gnl|my_center|LOCUS_55370 15104 15397 gene locus_tag LOCUS_55380 15104 15397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 15428 18559 gene locus_tag LOCUS_55390 15428 18559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 20256 18754 gene locus_tag LOCUS_55400 20256 18754 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_55400 23446 20282 gene locus_tag LOCUS_55410 23446 20282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 23934 23587 gene locus_tag LOCUS_55420 23934 23587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 24155 23931 gene locus_tag LOCUS_55430 24155 23931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 >Feature sequence147 3841 683 gene locus_tag LOCUS_55440 3841 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 4097 5212 gene locus_tag LOCUS_55450 4097 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 5556 5299 gene locus_tag LOCUS_55460 5556 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 6920 5592 gene locus_tag LOCUS_55470 6920 5592 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_55470 7309 7959 gene locus_tag LOCUS_55480 7309 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55480 8159 8593 gene locus_tag LOCUS_55490 8159 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 8780 9160 gene locus_tag LOCUS_55500 8780 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 9289 9831 gene locus_tag LOCUS_55510 9289 9831 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909489.1 protein_id gnl|my_center|LOCUS_55510 10288 9842 gene locus_tag LOCUS_55520 10288 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 10553 11107 gene locus_tag LOCUS_55530 10553 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 11450 11160 gene locus_tag LOCUS_55540 11450 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 11772 12437 gene locus_tag LOCUS_55550 11772 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 12465 13784 gene locus_tag LOCUS_55560 12465 13784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 13876 14187 gene locus_tag LOCUS_55570 13876 14187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 14772 14479 gene locus_tag LOCUS_55580 14772 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 15210 14869 gene locus_tag LOCUS_55590 15210 14869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 15665 15207 gene locus_tag LOCUS_55600 15665 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 16413 15667 gene locus_tag LOCUS_55610 16413 15667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 16846 16475 gene locus_tag LOCUS_55620 16846 16475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 17715 16855 gene locus_tag LOCUS_55630 17715 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 18082 17750 gene locus_tag LOCUS_55640 18082 17750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 18983 18084 gene locus_tag LOCUS_55650 18983 18084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 19541 19230 gene locus_tag LOCUS_55660 19541 19230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 20615 19596 gene locus_tag LOCUS_55670 20615 19596 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_55670 21111 20737 gene locus_tag LOCUS_55680 21111 20737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 21662 21480 gene locus_tag LOCUS_55690 21662 21480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 21970 22941 gene locus_tag LOCUS_55700 21970 22941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 23221 24204 gene locus_tag LOCUS_55710 23221 24204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 >Feature sequence148 1729 851 gene locus_tag LOCUS_55720 1729 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 2981 1779 gene locus_tag LOCUS_55730 2981 1779 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902726.1 protein_id gnl|my_center|LOCUS_55730 4278 3280 gene locus_tag LOCUS_55740 4278 3280 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_55740 4628 4470 gene locus_tag LOCUS_55750 4628 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 5494 4661 gene locus_tag LOCUS_55760 5494 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 7056 5638 gene locus_tag LOCUS_55770 7056 5638 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_55770 9066 8443 gene locus_tag LOCUS_55780 9066 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 9527 9108 gene locus_tag LOCUS_55790 9527 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 9799 9524 gene locus_tag LOCUS_55800 9799 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 11578 9995 gene locus_tag LOCUS_55810 11578 9995 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921975.1 protein_id gnl|my_center|LOCUS_55810 14218 12035 gene locus_tag LOCUS_55820 gene vpsO 14218 12035 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_55820 15169 14306 gene locus_tag LOCUS_55830 15169 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 15709 16650 gene locus_tag LOCUS_55840 15709 16650 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_55840 16723 17136 gene locus_tag LOCUS_55850 16723 17136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616149.1 protein_id gnl|my_center|LOCUS_55850 17765 20236 gene locus_tag LOCUS_55860 17765 20236 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_55860 20776 23502 gene locus_tag LOCUS_55870 20776 23502 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_55870 23516 24427 gene locus_tag LOCUS_55880 23516 24427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 >Feature sequence149 362 57 gene locus_tag LOCUS_55890 362 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 1816 731 gene locus_tag LOCUS_55900 1816 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 2154 3560 gene locus_tag LOCUS_55910 2154 3560 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402000.1 protein_id gnl|my_center|LOCUS_55910 3677 6610 gene locus_tag LOCUS_55920 3677 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 7676 6579 gene locus_tag LOCUS_55930 7676 6579 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_55930 7850 8269 gene locus_tag LOCUS_55940 7850 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 8638 10188 gene locus_tag LOCUS_55950 8638 10188 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081614227.1 protein_id gnl|my_center|LOCUS_55950 10364 12694 gene locus_tag LOCUS_55960 10364 12694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 14670 13030 gene locus_tag LOCUS_55970 14670 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 16122 14731 gene locus_tag LOCUS_55980 16122 14731 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_55980 16282 16198 gene locus_tag LOCUS_t00760 16282 16198 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16542 17837 gene locus_tag LOCUS_55990 16542 17837 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_55990 17809 17979 gene locus_tag LOCUS_56000 17809 17979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328828.1 protein_id gnl|my_center|LOCUS_56000 18683 18006 gene locus_tag LOCUS_56010 18683 18006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 19190 18690 gene locus_tag LOCUS_56020 19190 18690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 19450 20106 gene locus_tag LOCUS_56030 gene hypB 19450 20106 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_56030 20164 22485 gene locus_tag LOCUS_56040 gene hypF 20164 22485 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_56040 22489 22761 gene locus_tag LOCUS_56050 22489 22761 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_56050 22758 23855 gene locus_tag LOCUS_56060 gene hypD 22758 23855 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_56060 24108 23863 gene locus_tag LOCUS_56070 24108 23863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 >Feature sequence150 >Feature sequence151 817 137 gene locus_tag LOCUS_56080 817 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989535.1 protein_id gnl|my_center|LOCUS_56080 2122 971 gene locus_tag LOCUS_56090 2122 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_56090 2377 3552 gene locus_tag LOCUS_56100 2377 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 4097 3936 gene locus_tag LOCUS_56110 4097 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 4047 5414 gene locus_tag LOCUS_56120 4047 5414 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123069.1 protein_id gnl|my_center|LOCUS_56120 5521 6996 gene locus_tag LOCUS_56130 5521 6996 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_56130 8470 7139 gene locus_tag LOCUS_56140 8470 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117961.1 protein_id gnl|my_center|LOCUS_56140 12856 9944 gene locus_tag LOCUS_56150 12856 9944 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280508.1 protein_id gnl|my_center|LOCUS_56150 16247 12933 gene locus_tag LOCUS_56160 16247 12933 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_56160 19284 16264 gene locus_tag LOCUS_56170 19284 16264 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_56170 19922 19281 gene locus_tag LOCUS_56180 19922 19281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 21319 19919 gene locus_tag LOCUS_56190 21319 19919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 22059 21580 gene locus_tag LOCUS_56200 22059 21580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 23687 22116 gene locus_tag LOCUS_56210 23687 22116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 >Feature sequence152 5422 1877 gene locus_tag LOCUS_56220 5422 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 6234 6443 gene locus_tag LOCUS_56230 6234 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 6446 7405 gene locus_tag LOCUS_56240 6446 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56240 7665 7438 gene locus_tag LOCUS_56250 7665 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 8010 10385 gene locus_tag LOCUS_56260 8010 10385 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121337.1 protein_id gnl|my_center|LOCUS_56260 10990 10778 gene locus_tag LOCUS_56270 10990 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 11979 11221 gene locus_tag LOCUS_56280 11979 11221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 12109 12387 gene locus_tag LOCUS_56290 12109 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 13043 13291 gene locus_tag LOCUS_56300 13043 13291 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791529.1 protein_id gnl|my_center|LOCUS_56300 13368 14111 gene locus_tag LOCUS_56310 13368 14111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 14756 14672 gene locus_tag LOCUS_t00770 14756 14672 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16380 14803 gene locus_tag LOCUS_56320 16380 14803 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258088.1 protein_id gnl|my_center|LOCUS_56320 18022 16634 gene locus_tag LOCUS_56330 gene asnS 18022 16634 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337912.1 protein_id gnl|my_center|LOCUS_56330 18318 20783 gene locus_tag LOCUS_56340 18318 20783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 22198 20891 gene locus_tag LOCUS_56350 22198 20891 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_56350 23682 22399 gene locus_tag LOCUS_56360 23682 22399 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_56360 >Feature sequence153 330 133 gene locus_tag LOCUS_56370 330 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56370 1038 739 gene locus_tag LOCUS_56380 1038 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 1243 995 gene locus_tag LOCUS_56390 1243 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 1220 1609 gene locus_tag LOCUS_56400 1220 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 1700 2188 gene locus_tag LOCUS_56410 1700 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56410 2478 2738 gene locus_tag LOCUS_56420 2478 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 3491 4801 gene locus_tag LOCUS_56430 3491 4801 CDS product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261016.1 protein_id gnl|my_center|LOCUS_56430 4986 4783 gene locus_tag LOCUS_56440 4986 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 7255 5033 gene locus_tag LOCUS_56450 7255 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 8572 7571 gene locus_tag LOCUS_56460 8572 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 9045 8806 gene locus_tag LOCUS_56470 9045 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 9896 11737 gene locus_tag LOCUS_56480 9896 11737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 11758 14265 gene locus_tag LOCUS_56490 11758 14265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 14289 15035 gene locus_tag LOCUS_56500 14289 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 17475 15145 gene locus_tag LOCUS_56510 17475 15145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 19618 17537 gene locus_tag LOCUS_56520 19618 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 19926 20495 gene locus_tag LOCUS_56530 19926 20495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 20492 22933 gene locus_tag LOCUS_56540 20492 22933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 23036 23317 gene locus_tag LOCUS_56550 23036 23317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 >Feature sequence154 2147 165 gene locus_tag LOCUS_56560 2147 165 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766740.1 protein_id gnl|my_center|LOCUS_56560 2578 3468 gene locus_tag LOCUS_56570 2578 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 3461 3784 gene locus_tag LOCUS_56580 3461 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 3948 4265 gene locus_tag LOCUS_56590 3948 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 4611 5309 gene locus_tag LOCUS_56600 4611 5309 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121456.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_56600 5628 6950 gene locus_tag LOCUS_56610 5628 6950 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_56610 7003 9432 gene locus_tag LOCUS_56620 7003 9432 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260401.1 protein_id gnl|my_center|LOCUS_56620 9461 12028 gene locus_tag LOCUS_56630 9461 12028 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_56630 12068 13942 gene locus_tag LOCUS_56640 12068 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 14042 14473 gene locus_tag LOCUS_56650 14042 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 14726 15763 gene locus_tag LOCUS_56660 14726 15763 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_56660 17119 15788 gene locus_tag LOCUS_56670 17119 15788 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259655.1 protein_id gnl|my_center|LOCUS_56670 17478 19088 gene locus_tag LOCUS_56680 17478 19088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 20099 19179 gene locus_tag LOCUS_56690 20099 19179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 20538 21773 gene locus_tag LOCUS_56700 20538 21773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 23036 21900 gene locus_tag LOCUS_56710 23036 21900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 >Feature sequence155 2128 341 gene locus_tag LOCUS_56720 2128 341 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_56720 2623 3795 gene locus_tag LOCUS_56730 2623 3795 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_56730 3896 4177 gene locus_tag LOCUS_56740 3896 4177 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194392.1 protein_id gnl|my_center|LOCUS_56740 4208 5620 gene locus_tag LOCUS_56750 4208 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56750 6895 5642 gene locus_tag LOCUS_56760 6895 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 7505 7155 gene locus_tag LOCUS_56770 7505 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 7896 7510 gene locus_tag LOCUS_56780 7896 7510 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431194.1 protein_id gnl|my_center|LOCUS_56780 8439 8023 gene locus_tag LOCUS_56790 gene rnk 8439 8023 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 protein_id gnl|my_center|LOCUS_56790 8859 8443 gene locus_tag LOCUS_56800 8859 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 9508 9786 gene locus_tag LOCUS_56810 9508 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 9827 10291 gene locus_tag LOCUS_56820 gene rnk 9827 10291 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815299.1 protein_id gnl|my_center|LOCUS_56820 10471 12717 gene locus_tag LOCUS_56830 10471 12717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 12737 13312 gene locus_tag LOCUS_56840 12737 13312 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393271.1 protein_id gnl|my_center|LOCUS_56840 16675 13418 gene locus_tag LOCUS_56850 16675 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 16947 17034 gene locus_tag LOCUS_t00780 16947 17034 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18258 16966 gene locus_tag LOCUS_56860 18258 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 18620 18255 gene locus_tag LOCUS_56870 18620 18255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 20307 18502 gene locus_tag LOCUS_56880 20307 18502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 21817 20465 gene locus_tag LOCUS_56890 21817 20465 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263718.1 protein_id gnl|my_center|LOCUS_56890 22862 21942 gene locus_tag LOCUS_56900 22862 21942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 >Feature sequence156 1482 898 gene locus_tag LOCUS_56910 1482 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 2344 1649 gene locus_tag LOCUS_56920 2344 1649 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667131.1 protein_id gnl|my_center|LOCUS_56920 3215 2412 gene locus_tag LOCUS_56930 3215 2412 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_56930 3721 4425 gene locus_tag LOCUS_56940 3721 4425 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_56940 4400 7048 gene locus_tag LOCUS_56950 4400 7048 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_56950 7045 8151 gene locus_tag LOCUS_56960 7045 8151 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_56960 8388 10682 gene locus_tag LOCUS_56970 8388 10682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 11044 11403 gene locus_tag LOCUS_56980 11044 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 11953 14949 gene locus_tag LOCUS_56990 11953 14949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 14943 17078 gene locus_tag LOCUS_57000 14943 17078 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779460.1 protein_id gnl|my_center|LOCUS_57000 17115 17282 gene locus_tag LOCUS_57010 17115 17282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57010 17286 19331 gene locus_tag LOCUS_57020 17286 19331 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_57020 19328 19774 gene locus_tag LOCUS_57030 19328 19774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 19782 21170 gene locus_tag LOCUS_57040 19782 21170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 22210 22992 gene locus_tag LOCUS_57050 22210 22992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 >Feature sequence157 1092 481 gene locus_tag LOCUS_57060 1092 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 1642 1187 gene locus_tag LOCUS_57070 1642 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57070 2115 1666 gene locus_tag LOCUS_57080 2115 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 3823 2651 gene locus_tag LOCUS_57090 3823 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 4322 5770 gene locus_tag LOCUS_57100 4322 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 9617 7266 gene locus_tag LOCUS_57110 9617 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57110 10214 13018 gene locus_tag LOCUS_57120 10214 13018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 13131 13367 gene locus_tag LOCUS_57130 13131 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 15260 14661 gene locus_tag LOCUS_57140 15260 14661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 15637 15909 gene locus_tag LOCUS_57150 15637 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 18503 16179 gene locus_tag LOCUS_57160 18503 16179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 19050 19502 gene locus_tag LOCUS_57170 19050 19502 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023752.1 protein_id gnl|my_center|LOCUS_57170 20254 19499 gene locus_tag LOCUS_57180 20254 19499 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_57180 >Feature sequence158 249 1292 gene locus_tag LOCUS_57190 249 1292 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119708.1 protein_id gnl|my_center|LOCUS_57190 1289 2677 gene locus_tag LOCUS_57200 1289 2677 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121952.1 protein_id gnl|my_center|LOCUS_57200 2883 4565 gene locus_tag LOCUS_57210 2883 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 4878 6389 gene locus_tag LOCUS_57220 4878 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 6502 6693 gene locus_tag LOCUS_57230 6502 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 6842 8152 gene locus_tag LOCUS_57240 6842 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 9660 8638 gene locus_tag LOCUS_57250 9660 8638 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_57250 11726 9807 gene locus_tag LOCUS_57260 11726 9807 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_57260 12706 11783 gene locus_tag LOCUS_57270 gene selD 12706 11783 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301201.1 protein_id gnl|my_center|LOCUS_57270 14640 13522 gene locus_tag LOCUS_57280 14640 13522 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120182.1 protein_id gnl|my_center|LOCUS_57280 15443 14637 gene locus_tag LOCUS_57290 gene lpxA 15443 14637 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328498.1 protein_id gnl|my_center|LOCUS_57290 16414 15539 gene locus_tag LOCUS_57300 gene lpxC 16414 15539 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615542.1 protein_id gnl|my_center|LOCUS_57300 17174 16506 gene locus_tag LOCUS_57310 17174 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 17940 19631 gene locus_tag LOCUS_57320 17940 19631 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121786.1 protein_id gnl|my_center|LOCUS_57320 19757 19963 gene locus_tag LOCUS_57330 19757 19963 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969698.1 protein_id gnl|my_center|LOCUS_57330 19997 20875 gene locus_tag LOCUS_57340 19997 20875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57340 21526 21056 gene locus_tag LOCUS_57350 21526 21056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 22269 22048 gene locus_tag LOCUS_57360 22269 22048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 >Feature sequence159 207 2183 gene locus_tag LOCUS_57370 207 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57370 2418 2119 gene locus_tag LOCUS_57380 2418 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 4121 3144 gene locus_tag LOCUS_57390 4121 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 5149 4526 gene locus_tag LOCUS_57400 5149 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 6596 7480 gene locus_tag LOCUS_57410 6596 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 7562 8797 gene locus_tag LOCUS_57420 7562 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 8804 10099 gene locus_tag LOCUS_57430 8804 10099 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_57430 10277 11557 gene locus_tag LOCUS_57440 10277 11557 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_57440 11611 13287 gene locus_tag LOCUS_57450 11611 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 13337 14086 gene locus_tag LOCUS_57460 13337 14086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 15175 14642 gene locus_tag LOCUS_57470 15175 14642 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082498.1 protein_id gnl|my_center|LOCUS_57470 15308 15817 gene locus_tag LOCUS_57480 15308 15817 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 protein_id gnl|my_center|LOCUS_57480 15836 17491 gene locus_tag LOCUS_57490 15836 17491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57490 17534 18415 gene locus_tag LOCUS_57500 17534 18415 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332819.1 protein_id gnl|my_center|LOCUS_57500 18465 20834 gene locus_tag LOCUS_57510 18465 20834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 >Feature sequence160 <1 515 gene locus_tag LOCUS_57520 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929296.1:Uma2 family endonuclease 1223 534 gene locus_tag LOCUS_57530 gene bshB1 1223 534 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_57530 1970 1755 gene locus_tag LOCUS_57540 1970 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 1969 3339 gene locus_tag LOCUS_57550 1969 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 3593 4840 gene locus_tag LOCUS_57560 3593 4840 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_57560 4847 5578 gene locus_tag LOCUS_57570 4847 5578 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 protein_id gnl|my_center|LOCUS_57570 7824 5755 gene locus_tag LOCUS_57580 gene fusA 7824 5755 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121593.1 protein_id gnl|my_center|LOCUS_57580 8442 7972 gene locus_tag LOCUS_57590 gene rpsG 8442 7972 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 protein_id gnl|my_center|LOCUS_57590 8885 8517 gene locus_tag LOCUS_57600 gene rpsL 8885 8517 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326865.1 protein_id gnl|my_center|LOCUS_57600 13371 8986 gene locus_tag LOCUS_57610 gene rpoC 13371 8986 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333812.1 protein_id gnl|my_center|LOCUS_57610 17200 13475 gene locus_tag LOCUS_57620 gene rpoB 17200 13475 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340662.1 protein_id gnl|my_center|LOCUS_57620 17844 17434 gene locus_tag LOCUS_57630 gene rplL 17844 17434 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324459.1 protein_id gnl|my_center|LOCUS_57630 18591 18001 gene locus_tag LOCUS_57640 gene rplJ 18591 18001 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 protein_id gnl|my_center|LOCUS_57640 19355 18675 gene locus_tag LOCUS_57650 gene rplA 19355 18675 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324457.1 protein_id gnl|my_center|LOCUS_57650 19789 19364 gene locus_tag LOCUS_57660 gene rplK 19789 19364 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324993.1 protein_id gnl|my_center|LOCUS_57660 20628 19801 gene locus_tag LOCUS_57670 gene nusG 20628 19801 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324992.1 protein_id gnl|my_center|LOCUS_57670 21096 20689 gene locus_tag LOCUS_57680 gene secE 21096 20689 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324991.1 protein_id gnl|my_center|LOCUS_57680 21229 21156 gene locus_tag LOCUS_t00790 21229 21156 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 22455 21256 gene locus_tag LOCUS_57690 gene tuf 22455 21256 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121621.1 protein_id gnl|my_center|LOCUS_57690 >Feature sequence161 420 668 gene locus_tag LOCUS_57700 420 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706168.1 protein_id gnl|my_center|LOCUS_57700 679 936 gene locus_tag LOCUS_57710 679 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 1085 1234 gene locus_tag LOCUS_57720 1085 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 1279 2829 gene locus_tag LOCUS_57730 1279 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 3321 3773 gene locus_tag LOCUS_57740 3321 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57740 3770 4120 gene locus_tag LOCUS_57750 3770 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57750 5391 4447 gene locus_tag LOCUS_57760 5391 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 7403 6015 gene locus_tag LOCUS_57770 7403 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 7777 8418 gene locus_tag LOCUS_57780 7777 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 8442 9641 gene locus_tag LOCUS_57790 8442 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 9686 10180 gene locus_tag LOCUS_57800 9686 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 10191 11051 gene locus_tag LOCUS_57810 10191 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57810 11074 11364 gene locus_tag LOCUS_57820 11074 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 11589 12680 gene locus_tag LOCUS_57830 11589 12680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57830 12715 14421 gene locus_tag LOCUS_57840 12715 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 14469 14786 gene locus_tag LOCUS_57850 14469 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 14877 15707 gene locus_tag LOCUS_57860 14877 15707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 15864 16571 gene locus_tag LOCUS_57870 15864 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 16568 17455 gene locus_tag LOCUS_57880 16568 17455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57880 17880 18209 gene locus_tag LOCUS_57890 17880 18209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 19629 18787 gene locus_tag LOCUS_57900 19629 18787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57900 21146 19701 gene locus_tag LOCUS_57910 21146 19701 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403781.1 protein_id gnl|my_center|LOCUS_57910 >Feature sequence162 4568 456 gene locus_tag LOCUS_57920 4568 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 5059 4580 gene locus_tag LOCUS_57930 5059 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 5745 5380 gene locus_tag LOCUS_57940 5745 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57940 6063 6135 gene locus_tag LOCUS_t00800 6063 6135 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6582 6214 gene locus_tag LOCUS_57950 6582 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 6789 6863 gene locus_tag LOCUS_t00810 6789 6863 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8435 7077 gene locus_tag LOCUS_57960 8435 7077 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_57960 8810 12931 gene locus_tag LOCUS_57970 8810 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 16180 13256 gene locus_tag LOCUS_57980 16180 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 16534 17088 gene locus_tag LOCUS_57990 16534 17088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 17941 18174 gene locus_tag LOCUS_58000 17941 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 18190 18642 gene locus_tag LOCUS_58010 18190 18642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 19542 20153 gene locus_tag LOCUS_58020 19542 20153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 20143 20832 gene locus_tag LOCUS_58030 20143 20832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 >Feature sequence163 681 505 gene locus_tag LOCUS_58040 681 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58040 1409 2704 gene locus_tag LOCUS_58050 1409 2704 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_58050 2701 3777 gene locus_tag LOCUS_58060 2701 3777 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391963.1 protein_id gnl|my_center|LOCUS_58060 3788 4396 gene locus_tag LOCUS_58070 3788 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 4440 7904 gene locus_tag LOCUS_58080 4440 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 8362 8027 gene locus_tag LOCUS_58090 8362 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 8979 8350 gene locus_tag LOCUS_58100 8979 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 9258 12461 gene locus_tag LOCUS_58110 9258 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58110 12632 13291 gene locus_tag LOCUS_58120 12632 13291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 13457 13266 gene locus_tag LOCUS_58130 13457 13266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58130 13497 14810 gene locus_tag LOCUS_58140 13497 14810 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_58140 15734 14973 gene locus_tag LOCUS_58150 15734 14973 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023938.1 protein_id gnl|my_center|LOCUS_58150 16691 16957 gene locus_tag LOCUS_58160 16691 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58160 16947 17561 gene locus_tag LOCUS_58170 16947 17561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 17650 18906 gene locus_tag LOCUS_58180 17650 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 19164 20453 gene locus_tag LOCUS_58190 19164 20453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921591.1 protein_id gnl|my_center|LOCUS_58190 21619 20567 gene locus_tag LOCUS_58200 21619 20567 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_58200 >Feature sequence164 54 332 gene locus_tag LOCUS_58210 54 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 851 405 gene locus_tag LOCUS_58220 851 405 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971831.1 protein_id gnl|my_center|LOCUS_58220 1330 875 gene locus_tag LOCUS_58230 1330 875 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545540.1 protein_id gnl|my_center|LOCUS_58230 2126 1335 gene locus_tag LOCUS_58240 gene cysK 2126 1335 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_58240 2854 2411 gene locus_tag LOCUS_58250 2854 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 5649 3052 gene locus_tag LOCUS_58260 5649 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58260 8078 5646 gene locus_tag LOCUS_58270 8078 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 9088 11586 gene locus_tag LOCUS_58280 9088 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 11844 15005 gene locus_tag LOCUS_58290 11844 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 15182 16429 gene locus_tag LOCUS_58300 gene macA 15182 16429 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267826.1 protein_id gnl|my_center|LOCUS_58300 16477 19773 gene locus_tag LOCUS_58310 16477 19773 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 protein_id gnl|my_center|LOCUS_58310 20625 19774 gene locus_tag LOCUS_58320 20625 19774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 20682 20957 gene locus_tag LOCUS_58330 20682 20957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58330 >Feature sequence165 544 266 gene locus_tag LOCUS_58340 544 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 1212 961 gene locus_tag LOCUS_58350 1212 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58350 1595 1209 gene locus_tag LOCUS_58360 1595 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 2914 1670 gene locus_tag LOCUS_58370 2914 1670 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_58370 3487 4296 gene locus_tag LOCUS_58380 3487 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 4314 9173 gene locus_tag LOCUS_58390 4314 9173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58390 9367 9606 gene locus_tag LOCUS_58400 9367 9606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 13043 10149 gene locus_tag LOCUS_58410 13043 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 14168 13635 gene locus_tag LOCUS_58420 14168 13635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 15163 14549 gene locus_tag LOCUS_58430 15163 14549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 15406 15906 gene locus_tag LOCUS_58440 15406 15906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 18209 15993 gene locus_tag LOCUS_58450 18209 15993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58450 18607 18206 gene locus_tag LOCUS_58460 18607 18206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58460 19191 18766 gene locus_tag LOCUS_58470 19191 18766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58470 19463 20065 gene locus_tag LOCUS_58480 19463 20065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 20106 20432 gene locus_tag LOCUS_58490 20106 20432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 20545 20318 gene locus_tag LOCUS_58500 20545 20318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 >Feature sequence166 1391 225 gene locus_tag LOCUS_58510 1391 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 2080 1388 gene locus_tag LOCUS_58520 2080 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 3047 2265 gene locus_tag LOCUS_58530 3047 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921699.1 protein_id gnl|my_center|LOCUS_58530 4009 3050 gene locus_tag LOCUS_58540 4009 3050 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336191.1 protein_id gnl|my_center|LOCUS_58540 4872 4006 gene locus_tag LOCUS_58550 4872 4006 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922274.1 protein_id gnl|my_center|LOCUS_58550 7363 5051 gene locus_tag LOCUS_58560 7363 5051 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120826.1 protein_id gnl|my_center|LOCUS_58560 8036 7374 gene locus_tag LOCUS_58570 8036 7374 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172747.1 protein_id gnl|my_center|LOCUS_58570 10287 8248 gene locus_tag LOCUS_58580 10287 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 10568 12154 gene locus_tag LOCUS_58590 10568 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 12324 12800 gene locus_tag LOCUS_58600 gene moaC 12324 12800 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093030.1 protein_id gnl|my_center|LOCUS_58600 12876 13877 gene locus_tag LOCUS_58610 12876 13877 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615392.1 protein_id gnl|my_center|LOCUS_58610 14420 13950 gene locus_tag LOCUS_58620 gene nrdR 14420 13950 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_58620 15014 15523 gene locus_tag LOCUS_58630 15014 15523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 17266 15689 gene locus_tag LOCUS_58640 gene rpoN 17266 15689 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435015.1 protein_id gnl|my_center|LOCUS_58640 18016 17411 gene locus_tag LOCUS_58650 gene recR 18016 17411 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327785.1 protein_id gnl|my_center|LOCUS_58650 18408 18028 gene locus_tag LOCUS_58660 18408 18028 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706069.1 protein_id gnl|my_center|LOCUS_58660 18914 18507 gene locus_tag LOCUS_58670 18914 18507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 20227 18962 gene locus_tag LOCUS_58680 20227 18962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 20961 20677 gene locus_tag LOCUS_58690 20961 20677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 >Feature sequence167 693 1157 gene locus_tag LOCUS_58700 693 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 4280 1197 gene locus_tag LOCUS_58710 4280 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58710 6017 4548 gene locus_tag LOCUS_58720 6017 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 6605 8230 gene locus_tag LOCUS_58730 6605 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 8405 10000 gene locus_tag LOCUS_58740 8405 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 10940 10020 gene locus_tag LOCUS_58750 10940 10020 CDS product lpg2370 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948074.1 protein_id gnl|my_center|LOCUS_58750 11269 10943 gene locus_tag LOCUS_58760 11269 10943 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_58760 11631 11266 gene locus_tag LOCUS_58770 11631 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 13632 11983 gene locus_tag LOCUS_58780 13632 11983 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667792.1 protein_id gnl|my_center|LOCUS_58780 15289 13808 gene locus_tag LOCUS_58790 15289 13808 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328443.1 protein_id gnl|my_center|LOCUS_58790 17441 15300 gene locus_tag LOCUS_58800 17441 15300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 18297 19535 gene locus_tag LOCUS_58810 18297 19535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 19583 21010 gene locus_tag LOCUS_58820 19583 21010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 >Feature sequence168 965 642 gene locus_tag LOCUS_58830 965 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58830 2070 1141 gene locus_tag LOCUS_58840 2070 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 2911 2135 gene locus_tag LOCUS_58850 2911 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 3350 3269 gene locus_tag LOCUS_t00820 3350 3269 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6872 3531 gene locus_tag LOCUS_58860 6872 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58860 10535 7266 gene locus_tag LOCUS_58870 10535 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58870 12105 10933 gene locus_tag LOCUS_58880 12105 10933 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_58880 16695 12757 gene locus_tag LOCUS_58890 16695 12757 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119558.1 protein_id gnl|my_center|LOCUS_58890 16938 16702 gene locus_tag LOCUS_58900 16938 16702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 17557 16841 gene locus_tag LOCUS_58910 17557 16841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 17838 17566 gene locus_tag LOCUS_58920 17838 17566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 18474 18214 gene locus_tag LOCUS_58930 18474 18214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 19837 18593 gene locus_tag LOCUS_58940 19837 18593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 20220 20876 gene locus_tag LOCUS_58950 20220 20876 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_58950 >Feature sequence169 448 915 gene locus_tag LOCUS_58960 448 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 915 2912 gene locus_tag LOCUS_58970 915 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 2909 3394 gene locus_tag LOCUS_58980 2909 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 3391 4941 gene locus_tag LOCUS_58990 3391 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 4946 6616 gene locus_tag LOCUS_59000 4946 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 6609 10064 gene locus_tag LOCUS_59010 6609 10064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 10067 11194 gene locus_tag LOCUS_59020 10067 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 11208 12089 gene locus_tag LOCUS_59030 11208 12089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 12086 12724 gene locus_tag LOCUS_59040 12086 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 12807 14081 gene locus_tag LOCUS_59050 12807 14081 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_59050 14095 14601 gene locus_tag LOCUS_59060 14095 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 14598 14780 gene locus_tag LOCUS_59070 14598 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 14829 16685 gene locus_tag LOCUS_59080 14829 16685 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_59080 16682 17743 gene locus_tag LOCUS_59090 16682 17743 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_59090 17752 19212 gene locus_tag LOCUS_59100 17752 19212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 19212 19616 gene locus_tag LOCUS_59110 19212 19616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 19606 20205 gene locus_tag LOCUS_59120 19606 20205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 >Feature sequence170 499 314 gene locus_tag LOCUS_59130 499 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 1462 581 gene locus_tag LOCUS_59140 1462 581 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_59140 1786 1487 gene locus_tag LOCUS_59150 1786 1487 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921550.1 protein_id gnl|my_center|LOCUS_59150 2569 1799 gene locus_tag LOCUS_59160 2569 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 2833 2576 gene locus_tag LOCUS_59170 gene eutN 2833 2576 CDS product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762193.1 protein_id gnl|my_center|LOCUS_59170 4298 2853 gene locus_tag LOCUS_59180 4298 2853 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_59180 4749 4402 gene locus_tag LOCUS_59190 4749 4402 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_59190 5936 4752 gene locus_tag LOCUS_59200 5936 4752 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118936.1 protein_id gnl|my_center|LOCUS_59200 6296 6027 gene locus_tag LOCUS_59210 6296 6027 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324357.1 protein_id gnl|my_center|LOCUS_59210 6664 6362 gene locus_tag LOCUS_59220 6664 6362 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_59220 7413 6751 gene locus_tag LOCUS_59230 7413 6751 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 protein_id gnl|my_center|LOCUS_59230 8198 7419 gene locus_tag LOCUS_59240 8198 7419 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_59240 8798 8571 gene locus_tag LOCUS_59250 gene infA 8798 8571 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_59250 9026 9099 gene locus_tag LOCUS_t00830 9026 9099 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 11848 9437 gene locus_tag LOCUS_59260 11848 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 13282 12062 gene locus_tag LOCUS_59270 13282 12062 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_59270 14436 13387 gene locus_tag LOCUS_59280 14436 13387 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_59280 14840 15481 gene locus_tag LOCUS_59290 14840 15481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 15523 16602 gene locus_tag LOCUS_59300 gene holA 15523 16602 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326016.1 protein_id gnl|my_center|LOCUS_59300 16940 18091 gene locus_tag LOCUS_59310 16940 18091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59310 19508 18609 gene locus_tag LOCUS_59320 19508 18609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 >Feature sequence171 1562 2476 gene locus_tag LOCUS_59330 1562 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59330 2473 3510 gene locus_tag LOCUS_59340 2473 3510 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_59340 3528 4859 gene locus_tag LOCUS_59350 3528 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 5288 4887 gene locus_tag LOCUS_59360 5288 4887 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942259.1 protein_id gnl|my_center|LOCUS_59360 6503 5298 gene locus_tag LOCUS_59370 6503 5298 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_59370 6773 8194 gene locus_tag LOCUS_59380 6773 8194 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921298.1 protein_id gnl|my_center|LOCUS_59380 8198 8881 gene locus_tag LOCUS_59390 8198 8881 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 protein_id gnl|my_center|LOCUS_59390 8894 9325 gene locus_tag LOCUS_59400 8894 9325 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_59400 9350 10348 gene locus_tag LOCUS_59410 9350 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 13816 10364 gene locus_tag LOCUS_59420 13816 10364 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 protein_id gnl|my_center|LOCUS_59420 14933 13809 gene locus_tag LOCUS_59430 14933 13809 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839428.1 protein_id gnl|my_center|LOCUS_59430 15400 15549 gene locus_tag LOCUS_59440 15400 15549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 15913 16758 gene locus_tag LOCUS_59450 15913 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 17620 16775 gene locus_tag LOCUS_59460 17620 16775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 19321 17669 gene locus_tag LOCUS_59470 19321 17669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59470 20532 19792 gene locus_tag LOCUS_59480 20532 19792 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072670.1 protein_id gnl|my_center|LOCUS_59480 >Feature sequence172 4001 282 gene locus_tag LOCUS_59490 4001 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 4754 4062 gene locus_tag LOCUS_59500 4754 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 6045 5068 gene locus_tag LOCUS_59510 6045 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427741.1 protein_id gnl|my_center|LOCUS_59510 6217 7392 gene locus_tag LOCUS_59520 6217 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 7737 7411 gene locus_tag LOCUS_59530 7737 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 9040 8177 gene locus_tag LOCUS_59540 9040 8177 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275434.1 protein_id gnl|my_center|LOCUS_59540 9637 9882 gene locus_tag LOCUS_59550 9637 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 10238 11611 gene locus_tag LOCUS_59560 gene gabT 10238 11611 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930851.1 protein_id gnl|my_center|LOCUS_59560 11608 12873 gene locus_tag LOCUS_59570 11608 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59570 13357 12974 gene locus_tag LOCUS_59580 gene queF 13357 12974 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_59580 13523 14209 gene locus_tag LOCUS_59590 13523 14209 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921555.1 protein_id gnl|my_center|LOCUS_59590 14596 14315 gene locus_tag LOCUS_59600 gene rpsR 14596 14315 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236620859.1 protein_id gnl|my_center|LOCUS_59600 15027 16046 gene locus_tag LOCUS_59610 15027 16046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 16565 19375 gene locus_tag LOCUS_59620 16565 19375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59620 <20624 19419 gene locus_tag LOCUS_59630 <20624 19419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327432.1:SLC13 family permease >Feature sequence173 153 2912 gene locus_tag LOCUS_59640 153 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 2937 4826 gene locus_tag LOCUS_59650 2937 4826 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_59650 5818 4847 gene locus_tag LOCUS_59660 5818 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 7045 6257 gene locus_tag LOCUS_59670 7045 6257 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_59670 7368 8129 gene locus_tag LOCUS_59680 7368 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 8172 9593 gene locus_tag LOCUS_59690 gene uxaC 8172 9593 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_59690 10228 9608 gene locus_tag LOCUS_59700 10228 9608 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140140.1 protein_id gnl|my_center|LOCUS_59700 11096 11671 gene locus_tag LOCUS_59710 11096 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 11977 12420 gene locus_tag LOCUS_59720 11977 12420 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258015.1 protein_id gnl|my_center|LOCUS_59720 14230 12455 gene locus_tag LOCUS_59730 14230 12455 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_59730 14409 15389 gene locus_tag LOCUS_59740 14409 15389 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_59740 15417 17666 gene locus_tag LOCUS_59750 15417 17666 CDS product VacB/RNase II family 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121841.1 protein_id gnl|my_center|LOCUS_59750 18069 19997 gene locus_tag LOCUS_59760 18069 19997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_59760 >Feature sequence174 911 1117 gene locus_tag LOCUS_59770 911 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 1166 4732 gene locus_tag LOCUS_59780 1166 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 5195 5031 gene locus_tag LOCUS_59790 5195 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 5376 6062 gene locus_tag LOCUS_59800 5376 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 6667 6167 gene locus_tag LOCUS_59810 6667 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59810 7453 6692 gene locus_tag LOCUS_59820 7453 6692 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_59820 8156 8512 gene locus_tag LOCUS_59830 8156 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 8611 9648 gene locus_tag LOCUS_59840 8611 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 9564 11936 gene locus_tag LOCUS_59850 9564 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59850 13778 12774 gene locus_tag LOCUS_59860 13778 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59860 14745 17477 gene locus_tag LOCUS_59870 14745 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59870 18393 17860 gene locus_tag LOCUS_59880 18393 17860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59880 18733 18431 gene locus_tag LOCUS_59890 18733 18431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59890 20002 19559 gene locus_tag LOCUS_59900 20002 19559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59900 >Feature sequence175 1696 146 gene locus_tag LOCUS_59910 1696 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59910 1907 2929 gene locus_tag LOCUS_59920 1907 2929 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_59920 2926 3666 gene locus_tag LOCUS_59930 2926 3666 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889063.1 protein_id gnl|my_center|LOCUS_59930 4180 4866 gene locus_tag LOCUS_59940 4180 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 4863 5759 gene locus_tag LOCUS_59950 4863 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59950 5660 5971 gene locus_tag LOCUS_59960 5660 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 6676 5984 gene locus_tag LOCUS_59970 6676 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_59970 7297 6944 gene locus_tag LOCUS_59980 7297 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59980 7433 8830 gene locus_tag LOCUS_59990 7433 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59990 9468 8887 gene locus_tag LOCUS_60000 9468 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60000 9549 9866 gene locus_tag LOCUS_60010 9549 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60010 10819 9863 gene locus_tag LOCUS_60020 10819 9863 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817229.1 protein_id gnl|my_center|LOCUS_60020 11101 12105 gene locus_tag LOCUS_60030 11101 12105 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_60030 13631 12168 gene locus_tag LOCUS_60040 13631 12168 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198931.1 protein_id gnl|my_center|LOCUS_60040 13915 14784 gene locus_tag LOCUS_60050 13915 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60050 14852 15778 gene locus_tag LOCUS_60060 14852 15778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 15981 19655 gene locus_tag LOCUS_60070 15981 19655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60070 >Feature sequence176 734 1561 gene locus_tag LOCUS_60080 734 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 2203 2760 gene locus_tag LOCUS_60090 2203 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 3207 3650 gene locus_tag LOCUS_60100 3207 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60100 3733 5406 gene locus_tag LOCUS_60110 3733 5406 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_60110 5466 5984 gene locus_tag LOCUS_60120 5466 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60120 6148 6555 gene locus_tag LOCUS_60130 6148 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60130 6598 8904 gene locus_tag LOCUS_60140 6598 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60140 8972 11809 gene locus_tag LOCUS_60150 8972 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60150 11859 13064 gene locus_tag LOCUS_60160 11859 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 13111 13299 gene locus_tag LOCUS_60170 13111 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 13388 13975 gene locus_tag LOCUS_60180 13388 13975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 13951 14277 gene locus_tag LOCUS_60190 13951 14277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60190 14763 14428 gene locus_tag LOCUS_60200 14763 14428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60200 15522 14848 gene locus_tag LOCUS_60210 15522 14848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 15768 15529 gene locus_tag LOCUS_60220 15768 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60220 15980 16933 gene locus_tag LOCUS_60230 15980 16933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 19854 18520 gene locus_tag LOCUS_60240 19854 18520 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_60240 >Feature sequence177 2 372 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcccgcacgcgtgcgggcgtggattgaaac 2457 1432 gene locus_tag LOCUS_60250 2457 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60250 3498 2569 gene locus_tag LOCUS_60260 3498 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60260 4796 4116 gene locus_tag LOCUS_60270 4796 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60270 5175 5990 gene locus_tag LOCUS_60280 5175 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60280 6390 5914 gene locus_tag LOCUS_60290 gene dtd 6390 5914 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393181.1 protein_id gnl|my_center|LOCUS_60290 6614 7633 gene locus_tag LOCUS_60300 6614 7633 CDS product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705322.1 protein_id gnl|my_center|LOCUS_60300 7713 8321 gene locus_tag LOCUS_60310 gene cobC 7713 8321 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_60310 9052 8324 gene locus_tag LOCUS_60320 9052 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60320 9709 10818 gene locus_tag LOCUS_60330 9709 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 10999 11793 gene locus_tag LOCUS_60340 10999 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340214.1 protein_id gnl|my_center|LOCUS_60340 11820 13028 gene locus_tag LOCUS_60350 11820 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60350 13871 13245 gene locus_tag LOCUS_60360 13871 13245 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545227.1 protein_id gnl|my_center|LOCUS_60360 14415 15323 gene locus_tag LOCUS_60370 14415 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60370 15501 16613 gene locus_tag LOCUS_60380 15501 16613 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_60380 17153 17001 gene locus_tag LOCUS_60390 17153 17001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60390 17829 19379 gene locus_tag LOCUS_60400 17829 19379 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640267.1 protein_id gnl|my_center|LOCUS_60400 >Feature sequence178 114 302 gene locus_tag LOCUS_60410 114 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60410 1495 2571 gene locus_tag LOCUS_60420 1495 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60420 2675 4009 gene locus_tag LOCUS_60430 2675 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60430 4679 4939 gene locus_tag LOCUS_60440 4679 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 6249 4975 gene locus_tag LOCUS_60450 6249 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921591.1 protein_id gnl|my_center|LOCUS_60450 7191 8162 gene locus_tag LOCUS_60460 7191 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 9118 8216 gene locus_tag LOCUS_60470 9118 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60470 10133 9297 gene locus_tag LOCUS_60480 10133 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60480 10491 10673 gene locus_tag LOCUS_60490 10491 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60490 10675 12843 gene locus_tag LOCUS_60500 10675 12843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60500 13477 12791 gene locus_tag LOCUS_60510 13477 12791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60510 13747 14586 gene locus_tag LOCUS_60520 13747 14586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60520 14588 15493 gene locus_tag LOCUS_60530 14588 15493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60530 16955 15555 gene locus_tag LOCUS_60540 16955 15555 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_60540 17412 19055 gene locus_tag LOCUS_60550 17412 19055 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_60550 >Feature sequence179 3935 3636 gene locus_tag LOCUS_60560 3935 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60560 4527 3943 gene locus_tag LOCUS_60570 4527 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 6157 4958 gene locus_tag LOCUS_60580 6157 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60580 7883 7443 gene locus_tag LOCUS_60590 7883 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60590 7882 8094 gene locus_tag LOCUS_60600 7882 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60600 8663 8289 gene locus_tag LOCUS_60610 8663 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60610 9340 9077 gene locus_tag LOCUS_60620 9340 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 10933 9416 gene locus_tag LOCUS_60630 10933 9416 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940504.1 protein_id gnl|my_center|LOCUS_60630 11180 11821 gene locus_tag LOCUS_60640 11180 11821 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880156.1 protein_id gnl|my_center|LOCUS_60640 11842 12678 gene locus_tag LOCUS_60650 11842 12678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 13011 12703 gene locus_tag LOCUS_60660 13011 12703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 13010 13336 gene locus_tag LOCUS_60670 13010 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60670 13821 14165 gene locus_tag LOCUS_60680 13821 14165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 14373 14570 gene locus_tag LOCUS_60690 14373 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 14594 16105 gene locus_tag LOCUS_60700 14594 16105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60700 16269 16117 gene locus_tag LOCUS_60710 16269 16117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60710 16268 17779 gene locus_tag LOCUS_60720 16268 17779 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_60720 17799 18287 gene locus_tag LOCUS_60730 17799 18287 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_60730 18292 19506 gene locus_tag LOCUS_60740 18292 19506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667978.1 protein_id gnl|my_center|LOCUS_60740 >Feature sequence180 305 1318 gene locus_tag LOCUS_60750 305 1318 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_60750 2648 1329 gene locus_tag LOCUS_60760 2648 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60760 3590 2718 gene locus_tag LOCUS_60770 3590 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60770 4151 4510 gene locus_tag LOCUS_60780 4151 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60780 4988 4605 gene locus_tag LOCUS_60790 4988 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60790 5251 5889 gene locus_tag LOCUS_60800 5251 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60800 5886 6212 gene locus_tag LOCUS_60810 5886 6212 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 protein_id gnl|my_center|LOCUS_60810 6284 7948 gene locus_tag LOCUS_60820 6284 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60820 8466 9878 gene locus_tag LOCUS_60830 8466 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60830 10189 12411 gene locus_tag LOCUS_60840 10189 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 15265 12527 gene locus_tag LOCUS_60850 15265 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60850 18906 15403 gene locus_tag LOCUS_60860 18906 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60860 >Feature sequence181 498 67 gene locus_tag LOCUS_60870 498 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60870 2660 687 gene locus_tag LOCUS_60880 2660 687 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_60880 2911 3999 gene locus_tag LOCUS_60890 2911 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 4365 4910 gene locus_tag LOCUS_60900 4365 4910 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_60900 4903 5931 gene locus_tag LOCUS_60910 4903 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60910 6826 6338 gene locus_tag LOCUS_60920 6826 6338 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615935.1 protein_id gnl|my_center|LOCUS_60920 7573 7037 gene locus_tag LOCUS_60930 7573 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60930 8948 7641 gene locus_tag LOCUS_60940 8948 7641 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123159.1 protein_id gnl|my_center|LOCUS_60940 11229 9181 gene locus_tag LOCUS_60950 11229 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 13453 11489 gene locus_tag LOCUS_60960 13453 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60960 14866 13520 gene locus_tag LOCUS_60970 14866 13520 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_60970 15088 18594 gene locus_tag LOCUS_60980 15088 18594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 18985 19058 gene locus_tag LOCUS_t00840 18985 19058 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence182 4382 588 gene locus_tag LOCUS_60990 4382 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 7932 5458 gene locus_tag LOCUS_61000 7932 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61000 9245 8019 gene locus_tag LOCUS_61010 9245 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61010 11037 11372 gene locus_tag LOCUS_61020 11037 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61020 11481 14144 gene locus_tag LOCUS_61030 11481 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61030 14185 17487 gene locus_tag LOCUS_61040 14185 17487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61040 17490 17771 gene locus_tag LOCUS_61050 17490 17771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61050 <19067 17788 gene locus_tag LOCUS_61060 <19067 17788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922239.1:neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein >Feature sequence183 <1 3183 gene locus_tag LOCUS_61070 <1 3183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008671005.1:glycoside hydrolase family 78 protein 3983 3300 gene locus_tag LOCUS_61080 3983 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 5409 4123 gene locus_tag LOCUS_61090 5409 4123 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_61090 6675 5521 gene locus_tag LOCUS_61100 6675 5521 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_61100 6767 7822 gene locus_tag LOCUS_61110 6767 7822 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668096.1 protein_id gnl|my_center|LOCUS_61110 7819 8790 gene locus_tag LOCUS_61120 7819 8790 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228081.1 protein_id gnl|my_center|LOCUS_61120 9559 8894 gene locus_tag LOCUS_61130 9559 8894 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814050.1 protein_id gnl|my_center|LOCUS_61130 11525 9747 gene locus_tag LOCUS_61140 11525 9747 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_61140 12452 11643 gene locus_tag LOCUS_61150 gene trpA 12452 11643 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921878.1 protein_id gnl|my_center|LOCUS_61150 13706 12501 gene locus_tag LOCUS_61160 gene trpB 13706 12501 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324127.1 protein_id gnl|my_center|LOCUS_61160 14116 14613 gene locus_tag LOCUS_61170 14116 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61170 14891 15133 gene locus_tag LOCUS_61180 14891 15133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61180 16211 15126 gene locus_tag LOCUS_61190 16211 15126 CDS product DUF1570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616071.1 protein_id gnl|my_center|LOCUS_61190 17654 16356 gene locus_tag LOCUS_61200 17654 16356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 18431 17904 gene locus_tag LOCUS_61210 18431 17904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 >Feature sequence184 3121 1622 gene locus_tag LOCUS_61220 3121 1622 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118024.1 protein_id gnl|my_center|LOCUS_61220 3349 4137 gene locus_tag LOCUS_61230 3349 4137 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616226.1 protein_id gnl|my_center|LOCUS_61230 7159 4118 gene locus_tag LOCUS_61240 7159 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61240 7522 8562 gene locus_tag LOCUS_61250 gene tdh 7522 8562 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707888.1 protein_id gnl|my_center|LOCUS_61250 8589 9773 gene locus_tag LOCUS_61260 8589 9773 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_61260 9959 13813 gene locus_tag LOCUS_61270 9959 13813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61270 13836 14858 gene locus_tag LOCUS_61280 13836 14858 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730921.1 protein_id gnl|my_center|LOCUS_61280 14891 15607 gene locus_tag LOCUS_61290 14891 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61290 17065 15650 gene locus_tag LOCUS_61300 17065 15650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61300 >Feature sequence185 1161 2141 gene locus_tag LOCUS_61310 1161 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61310 3069 5078 gene locus_tag LOCUS_61320 3069 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 8328 5053 gene locus_tag LOCUS_61330 8328 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61330 9290 8445 gene locus_tag LOCUS_61340 9290 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 10639 9407 gene locus_tag LOCUS_61350 10639 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61350 11093 10809 gene locus_tag LOCUS_61360 11093 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61360 12265 11279 gene locus_tag LOCUS_61370 12265 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61370 13046 12309 gene locus_tag LOCUS_61380 13046 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61380 13573 13043 gene locus_tag LOCUS_61390 gene rpoE 13573 13043 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_61390 14430 13900 gene locus_tag LOCUS_61400 14430 13900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 14673 15983 gene locus_tag LOCUS_61410 14673 15983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61410 16996 15989 gene locus_tag LOCUS_61420 16996 15989 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338207.1 protein_id gnl|my_center|LOCUS_61420 18302 17145 gene locus_tag LOCUS_61430 18302 17145 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 protein_id gnl|my_center|LOCUS_61430 >Feature sequence186 3470 1422 gene locus_tag LOCUS_61440 3470 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61440 3941 3555 gene locus_tag LOCUS_61450 3941 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61450 5246 3951 gene locus_tag LOCUS_61460 5246 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61460 6138 5389 gene locus_tag LOCUS_61470 6138 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61470 6924 6193 gene locus_tag LOCUS_61480 6924 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61480 10804 7184 gene locus_tag LOCUS_61490 10804 7184 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020246.1 protein_id gnl|my_center|LOCUS_61490 11347 11874 gene locus_tag LOCUS_61500 11347 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61500 11969 12538 gene locus_tag LOCUS_61510 11969 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61510 16899 12877 gene locus_tag LOCUS_61520 16899 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61520 16825 17067 gene locus_tag LOCUS_61530 16825 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61530 >Feature sequence187 1628 66 gene locus_tag LOCUS_61540 1628 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61540 2373 1762 gene locus_tag LOCUS_61550 2373 1762 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121917.1 protein_id gnl|my_center|LOCUS_61550 2554 2757 gene locus_tag LOCUS_61560 2554 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61560 4913 2694 gene locus_tag LOCUS_61570 4913 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61570 6266 5124 gene locus_tag LOCUS_61580 6266 5124 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122108.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_61580 7127 6573 gene locus_tag LOCUS_61590 7127 6573 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_61590 7447 9918 gene locus_tag LOCUS_61600 7447 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 11089 10010 gene locus_tag LOCUS_61610 11089 10010 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256131.1 protein_id gnl|my_center|LOCUS_61610 11221 13656 gene locus_tag LOCUS_61620 11221 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61620 14403 13831 gene locus_tag LOCUS_61630 14403 13831 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_61630 16405 15053 gene locus_tag LOCUS_61640 16405 15053 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921498.1 protein_id gnl|my_center|LOCUS_61640 17250 16615 gene locus_tag LOCUS_61650 17250 16615 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_61650 >Feature sequence188 568 1533 gene locus_tag LOCUS_61660 568 1533 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_61660 2004 2981 gene locus_tag LOCUS_61670 2004 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61670 2981 5116 gene locus_tag LOCUS_61680 2981 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61680 5118 8228 gene locus_tag LOCUS_61690 5118 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61690 8228 9136 gene locus_tag LOCUS_61700 8228 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61700 9141 14705 gene locus_tag LOCUS_61710 9141 14705 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970454.1 protein_id gnl|my_center|LOCUS_61710 14698 15891 gene locus_tag LOCUS_61720 14698 15891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61720 15950 16342 gene locus_tag LOCUS_61730 15950 16342 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690774.1 protein_id gnl|my_center|LOCUS_61730 16345 17202 gene locus_tag LOCUS_61740 16345 17202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61740 17536 17994 gene locus_tag LOCUS_61750 17536 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 >Feature sequence189 <1 1999 gene locus_tag LOCUS_61760 <1 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224065207.1:helicase-related protein 1996 3876 gene locus_tag LOCUS_61770 1996 3876 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030178.1 protein_id gnl|my_center|LOCUS_61770 3882 4679 gene locus_tag LOCUS_61780 3882 4679 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013294890.1 protein_id gnl|my_center|LOCUS_61780 4707 7760 gene locus_tag LOCUS_61790 4707 7760 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020506622.1 protein_id gnl|my_center|LOCUS_61790 7782 8729 gene locus_tag LOCUS_61800 7782 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61800 8787 11738 gene locus_tag LOCUS_61810 8787 11738 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148590534.1 protein_id gnl|my_center|LOCUS_61810 12239 14350 gene locus_tag LOCUS_61820 12239 14350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61820 15305 14334 gene locus_tag LOCUS_61830 15305 14334 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763402.1 protein_id gnl|my_center|LOCUS_61830 15689 15342 gene locus_tag LOCUS_61840 15689 15342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61840 16083 16673 gene locus_tag LOCUS_61850 16083 16673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 17297 16911 gene locus_tag LOCUS_61860 17297 16911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61860 17972 18361 gene locus_tag LOCUS_61870 17972 18361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61870 >Feature sequence190 3286 1220 gene locus_tag LOCUS_61880 3286 1220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 protein_id gnl|my_center|LOCUS_61880 4554 3568 gene locus_tag LOCUS_61890 4554 3568 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123535.1 protein_id gnl|my_center|LOCUS_61890 6381 4588 gene locus_tag LOCUS_61900 6381 4588 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_61900 6611 7660 gene locus_tag LOCUS_61910 6611 7660 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_61910 8947 7781 gene locus_tag LOCUS_61920 8947 7781 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_61920 9828 9004 gene locus_tag LOCUS_61930 9828 9004 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_61930 10962 9904 gene locus_tag LOCUS_61940 10962 9904 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_61940 11168 11923 gene locus_tag LOCUS_61950 11168 11923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61950 12114 11812 gene locus_tag LOCUS_61960 12114 11812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61960 12478 12281 gene locus_tag LOCUS_61970 12478 12281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 12452 14242 gene locus_tag LOCUS_61980 12452 14242 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_61980 16782 14542 gene locus_tag LOCUS_61990 16782 14542 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_61990 17780 16854 gene locus_tag LOCUS_62000 17780 16854 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117849.1 protein_id gnl|my_center|LOCUS_62000 >Feature sequence191 163 414 gene locus_tag LOCUS_62010 163 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62010 2875 404 gene locus_tag LOCUS_62020 2875 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62020 4607 2904 gene locus_tag LOCUS_62030 4607 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62030 5717 4656 gene locus_tag LOCUS_62040 5717 4656 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_62040 5996 6289 gene locus_tag LOCUS_62050 5996 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62050 7177 6881 gene locus_tag LOCUS_62060 7177 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62060 7547 8950 gene locus_tag LOCUS_62070 gene argH 7547 8950 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227775.1 protein_id gnl|my_center|LOCUS_62070 8959 11253 gene locus_tag LOCUS_62080 8959 11253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62080 11250 12314 gene locus_tag LOCUS_62090 11250 12314 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434800.1 protein_id gnl|my_center|LOCUS_62090 13446 17237 gene locus_tag LOCUS_62100 gene pglW 13446 17237 CDS product BREX system serine/threonine kinase PglW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031052.1 protein_id gnl|my_center|LOCUS_62100 17287 18126 gene locus_tag LOCUS_62110 17287 18126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62110 >Feature sequence192 146 565 gene locus_tag LOCUS_62120 146 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62120 969 1352 gene locus_tag LOCUS_62130 969 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62130 1339 1989 gene locus_tag LOCUS_62140 1339 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 1993 2778 gene locus_tag LOCUS_62150 1993 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62150 2798 2971 gene locus_tag LOCUS_62160 2798 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 3925 3302 gene locus_tag LOCUS_62170 3925 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 4755 3934 gene locus_tag LOCUS_62180 4755 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 5386 4931 gene locus_tag LOCUS_62190 5386 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62190 8137 5426 gene locus_tag LOCUS_62200 8137 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 8565 10742 gene locus_tag LOCUS_62210 gene rhgW 8565 10742 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_62210 11229 10750 gene locus_tag LOCUS_62220 11229 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62220 11653 12690 gene locus_tag LOCUS_62230 11653 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 12700 13830 gene locus_tag LOCUS_62240 gene ugpC 12700 13830 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972908.1 protein_id gnl|my_center|LOCUS_62240 14079 15779 gene locus_tag LOCUS_62250 14079 15779 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325471.1 protein_id gnl|my_center|LOCUS_62250 17000 16746 gene locus_tag LOCUS_62260 17000 16746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 <18175 17046 gene locus_tag LOCUS_62270 <18175 17046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117924.1:phospholipase D-like domain-containing protein >Feature sequence193 56 128 gene locus_tag LOCUS_t00850 56 128 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 218 1945 gene locus_tag LOCUS_62280 218 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62280 1945 2898 gene locus_tag LOCUS_62290 1945 2898 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786931.1 protein_id gnl|my_center|LOCUS_62290 4560 2956 gene locus_tag LOCUS_62300 4560 2956 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082994.1 protein_id gnl|my_center|LOCUS_62300 4868 6118 gene locus_tag LOCUS_62310 4868 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62310 9785 6132 gene locus_tag LOCUS_62320 gene smc 9785 6132 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921931.1 protein_id gnl|my_center|LOCUS_62320 11818 9965 gene locus_tag LOCUS_62330 11818 9965 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120288.1 protein_id gnl|my_center|LOCUS_62330 12783 12010 gene locus_tag LOCUS_62340 12783 12010 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922368.1 protein_id gnl|my_center|LOCUS_62340 12679 13017 gene locus_tag LOCUS_62350 12679 13017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62350 13293 14489 gene locus_tag LOCUS_62360 13293 14489 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122949.1 protein_id gnl|my_center|LOCUS_62360 14666 15034 gene locus_tag LOCUS_62370 14666 15034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 15280 17646 gene locus_tag LOCUS_62380 15280 17646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62380 >Feature sequence194 1446 2888 gene locus_tag LOCUS_62390 1446 2888 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_62390 3172 5538 gene locus_tag LOCUS_62400 3172 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 5692 5546 gene locus_tag LOCUS_62410 5692 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 6200 5727 gene locus_tag LOCUS_62420 6200 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021936.1 protein_id gnl|my_center|LOCUS_62420 7855 7783 gene locus_tag LOCUS_t00860 7855 7783 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9485 7914 gene locus_tag LOCUS_62430 9485 7914 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120586.1 protein_id gnl|my_center|LOCUS_62430 10562 9513 gene locus_tag LOCUS_62440 10562 9513 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_62440 10802 14284 gene locus_tag LOCUS_62450 10802 14284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62450 14425 15900 gene locus_tag LOCUS_62460 14425 15900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62460 16171 17070 gene locus_tag LOCUS_62470 16171 17070 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815565.1 protein_id gnl|my_center|LOCUS_62470 >Feature sequence195 431 1099 gene locus_tag LOCUS_62480 431 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62480 1109 1924 gene locus_tag LOCUS_62490 1109 1924 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_62490 4719 1933 gene locus_tag LOCUS_62500 4719 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108901.1 protein_id gnl|my_center|LOCUS_62500 4868 5290 gene locus_tag LOCUS_62510 4868 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62510 5248 5508 gene locus_tag LOCUS_62520 5248 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62520 5821 5561 gene locus_tag LOCUS_62530 5821 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62530 6687 5824 gene locus_tag LOCUS_62540 6687 5824 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169980830.1 protein_id gnl|my_center|LOCUS_62540 6932 7249 gene locus_tag LOCUS_62550 6932 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62550 8100 7402 gene locus_tag LOCUS_62560 8100 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62560 8464 8988 gene locus_tag LOCUS_62570 8464 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 9230 9877 gene locus_tag LOCUS_62580 9230 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62580 9817 10254 gene locus_tag LOCUS_62590 9817 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62590 10251 10964 gene locus_tag LOCUS_62600 10251 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62600 11265 13448 gene locus_tag LOCUS_62610 gene recQ 11265 13448 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921919.1 protein_id gnl|my_center|LOCUS_62610 15522 13561 gene locus_tag LOCUS_62620 15522 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62620 <17329 16006 gene locus_tag LOCUS_62630 <17329 16006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121439.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence196 4030 107 gene locus_tag LOCUS_62640 4030 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62640 5498 4167 gene locus_tag LOCUS_62650 5498 4167 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_62650 5873 7207 gene locus_tag LOCUS_62660 5873 7207 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_62660 7273 7845 gene locus_tag LOCUS_62670 7273 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62670 7847 9178 gene locus_tag LOCUS_62680 7847 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62680 9261 9611 gene locus_tag LOCUS_62690 9261 9611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62690 9851 11896 gene locus_tag LOCUS_62700 9851 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62700 15797 12405 gene locus_tag LOCUS_62710 15797 12405 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972354.1 protein_id gnl|my_center|LOCUS_62710 17057 15819 gene locus_tag LOCUS_62720 17057 15819 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036629.1 protein_id gnl|my_center|LOCUS_62720 >Feature sequence197 348 1091 gene locus_tag LOCUS_62730 348 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 1319 3622 gene locus_tag LOCUS_62740 1319 3622 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294690.1 protein_id gnl|my_center|LOCUS_62740 3977 5464 gene locus_tag LOCUS_62750 3977 5464 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_62750 5569 6489 gene locus_tag LOCUS_62760 5569 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62760 6495 7223 gene locus_tag LOCUS_62770 6495 7223 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_62770 8336 7407 gene locus_tag LOCUS_62780 8336 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 10184 9024 gene locus_tag LOCUS_62790 10184 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62790 10395 10171 gene locus_tag LOCUS_62800 10395 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62800 11671 10379 gene locus_tag LOCUS_62810 gene ltrA 11671 10379 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_62810 13254 11668 gene locus_tag LOCUS_62820 13254 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62820 14059 13373 gene locus_tag LOCUS_62830 14059 13373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 14770 14117 gene locus_tag LOCUS_62840 14770 14117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 15270 14971 gene locus_tag LOCUS_62850 15270 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 16179 15352 gene locus_tag LOCUS_62860 16179 15352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62860 16925 16755 gene locus_tag LOCUS_62870 16925 16755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62870 >Feature sequence198 773 168 gene locus_tag LOCUS_62880 773 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62880 1455 883 gene locus_tag LOCUS_62890 1455 883 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921338.1 protein_id gnl|my_center|LOCUS_62890 4826 1629 gene locus_tag LOCUS_62900 4826 1629 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_62900 6014 5280 gene locus_tag LOCUS_62910 6014 5280 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326130.1 protein_id gnl|my_center|LOCUS_62910 7101 6139 gene locus_tag LOCUS_62920 7101 6139 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615838.1 protein_id gnl|my_center|LOCUS_62920 8990 7200 gene locus_tag LOCUS_62930 8990 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62930 9279 9896 gene locus_tag LOCUS_62940 gene ispF 9279 9896 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921639.1 protein_id gnl|my_center|LOCUS_62940 9893 11440 gene locus_tag LOCUS_62950 gene cysS 9893 11440 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921769.1 protein_id gnl|my_center|LOCUS_62950 11448 11963 gene locus_tag LOCUS_62960 gene ruvC 11448 11963 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 protein_id gnl|my_center|LOCUS_62960 12337 12567 gene locus_tag LOCUS_62970 12337 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62970 14049 12784 gene locus_tag LOCUS_62980 14049 12784 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_62980 16312 14057 gene locus_tag LOCUS_62990 16312 14057 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203736.1 protein_id gnl|my_center|LOCUS_62990 16761 16525 gene locus_tag LOCUS_63000 16761 16525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63000 >Feature sequence199 <1 695 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcaatcctctcgtggtcgaggcacgtcgtcagcc 2132 813 gene locus_tag LOCUS_63010 2132 813 CDS product TIGR02710 family CRISPR-associated CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876700.1 protein_id gnl|my_center|LOCUS_63010 3153 2176 gene locus_tag LOCUS_63020 gene cas6 3153 2176 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388907.1 protein_id gnl|my_center|LOCUS_63020 3536 3150 gene locus_tag LOCUS_63030 3536 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63030 4689 3565 gene locus_tag LOCUS_63040 4689 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 5275 4676 gene locus_tag LOCUS_63050 5275 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63050 6238 5279 gene locus_tag LOCUS_63060 6238 5279 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258159.1 protein_id gnl|my_center|LOCUS_63060 7104 6241 gene locus_tag LOCUS_63070 gene csx7 7104 6241 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258158.1 protein_id gnl|my_center|LOCUS_63070 7604 7119 gene locus_tag LOCUS_63080 7604 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 8025 7591 gene locus_tag LOCUS_63090 8025 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63090 9269 8022 gene locus_tag LOCUS_63100 9269 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63100 10039 9266 gene locus_tag LOCUS_63110 10039 9266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63110 11682 10036 gene locus_tag LOCUS_63120 11682 10036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63120 13241 11868 gene locus_tag LOCUS_63130 13241 11868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63130 14377 13256 gene locus_tag LOCUS_63140 14377 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 15157 14381 gene locus_tag LOCUS_63150 15157 14381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63150 16040 15171 gene locus_tag LOCUS_63160 16040 15171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63160 >Feature sequence200 4653 106 gene locus_tag LOCUS_63170 4653 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63170 5553 4714 gene locus_tag LOCUS_63180 5553 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 6506 5553 gene locus_tag LOCUS_63190 6506 5553 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_63190 8080 6701 gene locus_tag LOCUS_63200 8080 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63200 9599 8184 gene locus_tag LOCUS_63210 9599 8184 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_63210 9535 9789 gene locus_tag LOCUS_63220 9535 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63220 10052 10927 gene locus_tag LOCUS_63230 10052 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 12351 11044 gene locus_tag LOCUS_63240 12351 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 12830 14953 gene locus_tag LOCUS_63250 12830 14953 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328585.1 protein_id gnl|my_center|LOCUS_63250 15215 16372 gene locus_tag LOCUS_63260 15215 16372 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_63260 >Feature sequence201 1438 1956 gene locus_tag LOCUS_63270 1438 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63270 1959 3308 gene locus_tag LOCUS_63280 1959 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63280 4168 4572 gene locus_tag LOCUS_63290 4168 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63290 5530 5189 gene locus_tag LOCUS_63300 5530 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63300 5758 6174 gene locus_tag LOCUS_63310 5758 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63310 6171 7316 gene locus_tag LOCUS_63320 6171 7316 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331373.1 protein_id gnl|my_center|LOCUS_63320 7350 8105 gene locus_tag LOCUS_63330 7350 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63330 8120 9073 gene locus_tag LOCUS_63340 8120 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63340 9217 9399 gene locus_tag LOCUS_63350 9217 9399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 9418 9669 gene locus_tag LOCUS_63360 9418 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 9650 9904 gene locus_tag LOCUS_63370 9650 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63370 10116 10352 gene locus_tag LOCUS_63380 10116 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63380 10562 10768 gene locus_tag LOCUS_63390 10562 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 11058 13196 gene locus_tag LOCUS_63400 11058 13196 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_63400 13617 14168 gene locus_tag LOCUS_63410 13617 14168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 14235 16151 gene locus_tag LOCUS_63420 14235 16151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63420 >Feature sequence202 1986 196 gene locus_tag LOCUS_63430 1986 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 3092 2058 gene locus_tag LOCUS_63440 3092 2058 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345599.1 protein_id gnl|my_center|LOCUS_63440 3318 3142 gene locus_tag LOCUS_63450 3318 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63450 5085 3976 gene locus_tag LOCUS_63460 5085 3976 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921814.1 protein_id gnl|my_center|LOCUS_63460 5375 5770 gene locus_tag LOCUS_63470 5375 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63470 6421 7431 gene locus_tag LOCUS_63480 6421 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63480 7441 8400 gene locus_tag LOCUS_63490 7441 8400 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345599.1 protein_id gnl|my_center|LOCUS_63490 8435 9106 gene locus_tag LOCUS_63500 8435 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63500 9103 9585 gene locus_tag LOCUS_63510 9103 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63510 13078 10223 gene locus_tag LOCUS_63520 13078 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63520 13287 13742 gene locus_tag LOCUS_63530 13287 13742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63530 13851 14903 gene locus_tag LOCUS_63540 13851 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63540 15110 15346 gene locus_tag LOCUS_63550 15110 15346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63550 15746 15381 gene locus_tag LOCUS_63560 15746 15381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63560 >Feature sequence203 4352 450 gene locus_tag LOCUS_63570 4352 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63570 5873 4749 gene locus_tag LOCUS_63580 5873 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63580 6380 6138 gene locus_tag LOCUS_63590 6380 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63590 6645 7724 gene locus_tag LOCUS_63600 6645 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63600 8311 9348 gene locus_tag LOCUS_63610 8311 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63610 10094 9372 gene locus_tag LOCUS_63620 10094 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63620 12036 10120 gene locus_tag LOCUS_63630 12036 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63630 12006 12821 gene locus_tag LOCUS_63640 12006 12821 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172591.1 protein_id gnl|my_center|LOCUS_63640 12845 14035 gene locus_tag LOCUS_63650 12845 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63650 14086 15393 gene locus_tag LOCUS_63660 14086 15393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63660 >Feature sequence204 402 142 gene locus_tag LOCUS_63670 402 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63670 910 437 gene locus_tag LOCUS_63680 gene rpiB 910 437 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122948.1 protein_id gnl|my_center|LOCUS_63680 1970 1092 gene locus_tag LOCUS_63690 1970 1092 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169980830.1 protein_id gnl|my_center|LOCUS_63690 2254 2592 gene locus_tag LOCUS_63700 2254 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63700 5832 2887 gene locus_tag LOCUS_63710 5832 2887 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148590534.1 protein_id gnl|my_center|LOCUS_63710 6323 5838 gene locus_tag LOCUS_63720 6323 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 6567 6316 gene locus_tag LOCUS_63730 6567 6316 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_63730 7334 6702 gene locus_tag LOCUS_63740 7334 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63740 7734 7318 gene locus_tag LOCUS_63750 7734 7318 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_63750 10704 7774 gene locus_tag LOCUS_63760 10704 7774 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020506622.1 protein_id gnl|my_center|LOCUS_63760 11476 11099 gene locus_tag LOCUS_63770 11476 11099 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_63770 14841 11473 gene locus_tag LOCUS_63780 14841 11473 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_63780 15834 15385 gene locus_tag LOCUS_63790 15834 15385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63790 >Feature sequence205 478 233 gene locus_tag LOCUS_63800 478 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63800 1088 459 gene locus_tag LOCUS_63810 1088 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63810 1969 1133 gene locus_tag LOCUS_63820 1969 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63820 3764 2022 gene locus_tag LOCUS_63830 3764 2022 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798670.1 protein_id gnl|my_center|LOCUS_63830 4471 3803 gene locus_tag LOCUS_63840 4471 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63840 4745 4398 gene locus_tag LOCUS_63850 4745 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63850 5343 4834 gene locus_tag LOCUS_63860 5343 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63860 5629 5357 gene locus_tag LOCUS_63870 5629 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63870 5884 5636 gene locus_tag LOCUS_63880 5884 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63880 6674 5886 gene locus_tag LOCUS_63890 6674 5886 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_63890 7764 6802 gene locus_tag LOCUS_63900 7764 6802 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_63900 8762 7761 gene locus_tag LOCUS_63910 8762 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63910 11630 8859 gene locus_tag LOCUS_63920 11630 8859 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064478.1 protein_id gnl|my_center|LOCUS_63920 12114 11611 gene locus_tag LOCUS_63930 12114 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63930 12686 12144 gene locus_tag LOCUS_63940 12686 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63940 13961 12690 gene locus_tag LOCUS_63950 13961 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63950 >Feature sequence206 1215 226 gene locus_tag LOCUS_63960 1215 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63960 4021 1367 gene locus_tag LOCUS_63970 4021 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63970 4478 4140 gene locus_tag LOCUS_63980 4478 4140 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142925.1 protein_id gnl|my_center|LOCUS_63980 4736 4482 gene locus_tag LOCUS_63990 4736 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63990 5079 7589 gene locus_tag LOCUS_64000 5079 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64000 9862 7721 gene locus_tag LOCUS_64010 9862 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64010 11544 10102 gene locus_tag LOCUS_64020 11544 10102 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921348.1 protein_id gnl|my_center|LOCUS_64020 11796 13196 gene locus_tag LOCUS_64030 11796 13196 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081938.1 protein_id gnl|my_center|LOCUS_64030 13208 13906 gene locus_tag LOCUS_64040 13208 13906 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021775.1 protein_id gnl|my_center|LOCUS_64040 14004 15437 gene locus_tag LOCUS_64050 gene purB 14004 15437 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_64050 >Feature sequence207 1790 2038 gene locus_tag LOCUS_64060 1790 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64060 2058 2975 gene locus_tag LOCUS_64070 2058 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64070 2972 3877 gene locus_tag LOCUS_64080 2972 3877 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187713770.1 protein_id gnl|my_center|LOCUS_64080 3883 4854 gene locus_tag LOCUS_64090 3883 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 5434 5796 gene locus_tag LOCUS_64100 5434 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64100 7013 5802 gene locus_tag LOCUS_64110 7013 5802 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_64110 8583 7189 gene locus_tag LOCUS_64120 8583 7189 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_64120 10596 8605 gene locus_tag LOCUS_64130 gene nadE 10596 8605 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_64130 12080 10593 gene locus_tag LOCUS_64140 12080 10593 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_64140 12788 13075 gene locus_tag LOCUS_64150 12788 13075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64150 14595 14404 gene locus_tag LOCUS_64160 14595 14404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64160 14714 15067 gene locus_tag LOCUS_64170 14714 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64170 >Feature sequence208 3 443 gene locus_tag LOCUS_64180 3 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64180 834 475 gene locus_tag LOCUS_64190 834 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64190 2986 1559 gene locus_tag LOCUS_64200 2986 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64200 3444 5741 gene locus_tag LOCUS_64210 3444 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64210 5986 7545 gene locus_tag LOCUS_64220 5986 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64220 7720 8712 gene locus_tag LOCUS_64230 7720 8712 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326204.1 protein_id gnl|my_center|LOCUS_64230 8746 9204 gene locus_tag LOCUS_64240 8746 9204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64240 9778 12810 gene locus_tag LOCUS_64250 9778 12810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64250 >Feature sequence209 270 710 gene locus_tag LOCUS_64260 270 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64260 2219 888 gene locus_tag LOCUS_64270 2219 888 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_64270 3412 2216 gene locus_tag LOCUS_64280 3412 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64280 3490 4350 gene locus_tag LOCUS_64290 3490 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64290 4764 4414 gene locus_tag LOCUS_64300 4764 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64300 6048 4780 gene locus_tag LOCUS_64310 6048 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 6564 6788 gene locus_tag LOCUS_64320 6564 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64320 7094 6870 gene locus_tag LOCUS_64330 7094 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64330 8654 7164 gene locus_tag LOCUS_64340 8654 7164 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259854.1 protein_id gnl|my_center|LOCUS_64340 10838 8898 gene locus_tag LOCUS_64350 10838 8898 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115028.1 protein_id gnl|my_center|LOCUS_64350 11571 10900 gene locus_tag LOCUS_64360 11571 10900 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414103.1 protein_id gnl|my_center|LOCUS_64360 12393 13127 gene locus_tag LOCUS_64370 12393 13127 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_64370 13563 15107 gene locus_tag LOCUS_64380 13563 15107 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117871.1 protein_id gnl|my_center|LOCUS_64380 >Feature sequence210 307 615 gene locus_tag LOCUS_64390 307 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64390 1585 1926 gene locus_tag LOCUS_64400 1585 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64400 2043 2477 gene locus_tag LOCUS_64410 2043 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64410 2492 2731 gene locus_tag LOCUS_64420 2492 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64420 2791 3042 gene locus_tag LOCUS_64430 2791 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64430 3907 4236 gene locus_tag LOCUS_64440 3907 4236 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096894563.1 protein_id gnl|my_center|LOCUS_64440 4237 4578 gene locus_tag LOCUS_64450 4237 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 4840 5040 gene locus_tag LOCUS_64460 4840 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 5194 6093 gene locus_tag LOCUS_64470 5194 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64470 6090 6872 gene locus_tag LOCUS_64480 6090 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64480 7649 7059 gene locus_tag LOCUS_64490 7649 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_64490 8033 7743 gene locus_tag LOCUS_64500 8033 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64500 9192 8014 gene locus_tag LOCUS_64510 9192 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 9459 10592 gene locus_tag LOCUS_64520 9459 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 10603 10809 gene locus_tag LOCUS_64530 10603 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64530 14446 11111 gene locus_tag LOCUS_64540 14446 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 14911 14705 gene locus_tag LOCUS_64550 14911 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64550 >Feature sequence211 661 1125 gene locus_tag LOCUS_64560 661 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 1158 1589 gene locus_tag LOCUS_64570 1158 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64570 4340 1815 gene locus_tag LOCUS_64580 4340 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 4780 5754 gene locus_tag LOCUS_64590 4780 5754 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_64590 6027 8513 gene locus_tag LOCUS_64600 6027 8513 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_64600 8905 9471 gene locus_tag LOCUS_64610 8905 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64610 11126 9567 gene locus_tag LOCUS_64620 11126 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64620 11269 11613 gene locus_tag LOCUS_64630 11269 11613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64630 12652 11693 gene locus_tag LOCUS_64640 12652 11693 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_64640 14134 12746 gene locus_tag LOCUS_64650 14134 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64650 14901 15233 gene locus_tag LOCUS_64660 14901 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64660 >Feature sequence212 542 1648 gene locus_tag LOCUS_64670 542 1648 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023808673.1 protein_id gnl|my_center|LOCUS_64670 2140 3054 gene locus_tag LOCUS_64680 gene ccsA 2140 3054 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922278.1 protein_id gnl|my_center|LOCUS_64680 3051 4322 gene locus_tag LOCUS_64690 gene hemA 3051 4322 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334460.1 protein_id gnl|my_center|LOCUS_64690 5462 4440 gene locus_tag LOCUS_64700 5462 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64700 6169 5738 gene locus_tag LOCUS_64710 6169 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64710 6847 8004 gene locus_tag LOCUS_64720 6847 8004 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_64720 8156 9235 gene locus_tag LOCUS_64730 8156 9235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64730 9569 10681 gene locus_tag LOCUS_64740 gene dnaN 9569 10681 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427747.1 protein_id gnl|my_center|LOCUS_64740 10687 11001 gene locus_tag LOCUS_64750 10687 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64750 11004 13532 gene locus_tag LOCUS_64760 11004 13532 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247075.1 protein_id gnl|my_center|LOCUS_64760 14155 15098 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgcgtgtacggggaactc >Feature sequence213 2280 1024 gene locus_tag LOCUS_64770 2280 1024 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_64770 2830 3501 gene locus_tag LOCUS_64780 2830 3501 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_64780 3966 3520 gene locus_tag LOCUS_64790 3966 3520 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_64790 5908 4085 gene locus_tag LOCUS_64800 5908 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64800 6317 7336 gene locus_tag LOCUS_64810 6317 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64810 7370 8533 gene locus_tag LOCUS_64820 gene ispG 7370 8533 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 protein_id gnl|my_center|LOCUS_64820 10148 8487 gene locus_tag LOCUS_64830 gene lnt 10148 8487 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_64830 10779 10174 gene locus_tag LOCUS_64840 10779 10174 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333306.1 protein_id gnl|my_center|LOCUS_64840 11909 10992 gene locus_tag LOCUS_64850 11909 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64850 12523 13620 gene locus_tag LOCUS_64860 12523 13620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64860 14673 13825 gene locus_tag LOCUS_64870 14673 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64870 >Feature sequence214 2108 564 gene locus_tag LOCUS_64880 2108 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64880 2681 3385 gene locus_tag LOCUS_64890 2681 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64890 4774 3554 gene locus_tag LOCUS_64900 4774 3554 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764578.1 protein_id gnl|my_center|LOCUS_64900 5125 7197 gene locus_tag LOCUS_64910 5125 7197 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532458.1 protein_id gnl|my_center|LOCUS_64910 7223 8344 gene locus_tag LOCUS_64920 7223 8344 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931322.1 protein_id gnl|my_center|LOCUS_64920 8962 10320 gene locus_tag LOCUS_64930 8962 10320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64930 10321 11736 gene locus_tag LOCUS_64940 10321 11736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64940 12148 11762 gene locus_tag LOCUS_64950 gene cheY 12148 11762 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081049.1 protein_id gnl|my_center|LOCUS_64950 12561 12857 gene locus_tag LOCUS_64960 12561 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442631.1 protein_id gnl|my_center|LOCUS_64960 13855 12968 gene locus_tag LOCUS_64970 13855 12968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64970 14312 14767 gene locus_tag LOCUS_64980 14312 14767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64980 >Feature sequence215 997 1326 gene locus_tag LOCUS_64990 997 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64990 1348 1620 gene locus_tag LOCUS_65000 1348 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65000 2117 1677 gene locus_tag LOCUS_65010 2117 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65010 3982 2435 gene locus_tag LOCUS_65020 3982 2435 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_65020 4098 4829 gene locus_tag LOCUS_65030 4098 4829 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816854.1 protein_id gnl|my_center|LOCUS_65030 4826 7204 gene locus_tag LOCUS_65040 4826 7204 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_65040 7377 7748 gene locus_tag LOCUS_65050 7377 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65050 7994 8788 gene locus_tag LOCUS_65060 7994 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65060 8935 9300 gene locus_tag LOCUS_65070 8935 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65070 10031 9495 gene locus_tag LOCUS_65080 10031 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 13247 10035 gene locus_tag LOCUS_65090 13247 10035 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_65090 14506 13259 gene locus_tag LOCUS_65100 14506 13259 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921758.1 protein_id gnl|my_center|LOCUS_65100 >Feature sequence216 326 1168 gene locus_tag LOCUS_65110 326 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_65110 1722 1513 gene locus_tag LOCUS_65120 1722 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65120 3176 1719 gene locus_tag LOCUS_65130 3176 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65130 5312 3198 gene locus_tag LOCUS_65140 5312 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65140 9486 5317 gene locus_tag LOCUS_65150 9486 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 11868 9511 gene locus_tag LOCUS_65160 11868 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65160 13261 11861 gene locus_tag LOCUS_65170 13261 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65170 13588 13274 gene locus_tag LOCUS_65180 13588 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65180 13806 13603 gene locus_tag LOCUS_65190 13806 13603 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_65190 >Feature sequence217 3215 924 gene locus_tag LOCUS_65200 3215 924 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_65200 3407 5161 gene locus_tag LOCUS_65210 3407 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65210 6200 5328 gene locus_tag LOCUS_65220 6200 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65220 6916 6197 gene locus_tag LOCUS_65230 6916 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65230 7464 8381 gene locus_tag LOCUS_65240 7464 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65240 8569 9990 gene locus_tag LOCUS_65250 8569 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65250 10132 11235 gene locus_tag LOCUS_65260 10132 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65260 11256 12674 gene locus_tag LOCUS_65270 11256 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65270 13102 13944 gene locus_tag LOCUS_65280 13102 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65280 >Feature sequence218 878 1348 gene locus_tag LOCUS_65290 878 1348 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330832.1 protein_id gnl|my_center|LOCUS_65290 1441 1887 gene locus_tag LOCUS_65300 1441 1887 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908043.1 protein_id gnl|my_center|LOCUS_65300 1985 2281 gene locus_tag LOCUS_65310 1985 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65310 2295 2504 gene locus_tag LOCUS_65320 2295 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65320 3066 2398 gene locus_tag LOCUS_65330 3066 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65330 4487 3138 gene locus_tag LOCUS_65340 4487 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65340 4694 7270 gene locus_tag LOCUS_65350 4694 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65350 9057 7693 gene locus_tag LOCUS_65360 9057 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65360 9497 9240 gene locus_tag LOCUS_65370 9497 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65370 9769 12462 gene locus_tag LOCUS_65380 9769 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65380 >Feature sequence219 >Feature sequence220 612 109 gene locus_tag LOCUS_65390 612 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65390 3032 681 gene locus_tag LOCUS_65400 3032 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65400 5582 3117 gene locus_tag LOCUS_65410 5582 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65410 6050 5619 gene locus_tag LOCUS_65420 6050 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65420 13332 6139 gene locus_tag LOCUS_65430 13332 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65430 13559 13332 gene locus_tag LOCUS_65440 13559 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65440 14006 13830 gene locus_tag LOCUS_65450 14006 13830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65450 >Feature sequence221 306 127 gene locus_tag LOCUS_65460 306 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65460 1387 317 gene locus_tag LOCUS_65470 1387 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65470 2330 1404 gene locus_tag LOCUS_65480 2330 1404 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537325.1 protein_id gnl|my_center|LOCUS_65480 3719 2388 gene locus_tag LOCUS_65490 3719 2388 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324232.1 protein_id gnl|my_center|LOCUS_65490 4781 3762 gene locus_tag LOCUS_65500 4781 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65500 5559 5014 gene locus_tag LOCUS_65510 5559 5014 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326626.1 protein_id gnl|my_center|LOCUS_65510 6085 5702 gene locus_tag LOCUS_65520 6085 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65520 7634 7305 gene locus_tag LOCUS_65530 7634 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65530 7991 7638 gene locus_tag LOCUS_65540 7991 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65540 8231 8028 gene locus_tag LOCUS_65550 8231 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65550 10224 8755 gene locus_tag LOCUS_65560 10224 8755 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_65560 11011 10457 gene locus_tag LOCUS_65570 11011 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65570 11725 12243 gene locus_tag LOCUS_65580 11725 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65580 12244 13563 gene locus_tag LOCUS_65590 12244 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65590 >Feature sequence222 1192 506 gene locus_tag LOCUS_65600 1192 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65600 2588 1380 gene locus_tag LOCUS_65610 2588 1380 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880955.1 protein_id gnl|my_center|LOCUS_65610 3174 2977 gene locus_tag LOCUS_65620 gene csrA 3174 2977 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_65620 3972 3481 gene locus_tag LOCUS_65630 3972 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65630 4055 4969 gene locus_tag LOCUS_65640 4055 4969 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941197.1 protein_id gnl|my_center|LOCUS_65640 6296 4923 gene locus_tag LOCUS_65650 6296 4923 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_65650 6601 8100 gene locus_tag LOCUS_65660 gene xylB 6601 8100 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_65660 8146 9528 gene locus_tag LOCUS_65670 8146 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65670 12611 10299 gene locus_tag LOCUS_65680 12611 10299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65680 13562 12708 gene locus_tag LOCUS_65690 13562 12708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65690 >Feature sequence223 1149 478 gene locus_tag LOCUS_65700 1149 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65700 1958 1494 gene locus_tag LOCUS_65710 1958 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65710 2444 1962 gene locus_tag LOCUS_65720 2444 1962 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_65720 3660 4043 gene locus_tag LOCUS_65730 3660 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65730 4701 7103 gene locus_tag LOCUS_65740 4701 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65740 7203 7607 gene locus_tag LOCUS_65750 7203 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65750 7672 8580 gene locus_tag LOCUS_65760 7672 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65760 9003 8659 gene locus_tag LOCUS_65770 9003 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65770 11620 9068 gene locus_tag LOCUS_65780 11620 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65780 12405 12133 gene locus_tag LOCUS_65790 12405 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65790 13729 13905 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatggggccgcgacttttcagccgc >Feature sequence224 328 1314 gene locus_tag LOCUS_65800 328 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65800 2665 1304 gene locus_tag LOCUS_65810 2665 1304 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_65810 3390 2668 gene locus_tag LOCUS_65820 3390 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65820 5019 3655 gene locus_tag LOCUS_65830 5019 3655 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_65830 6724 5153 gene locus_tag LOCUS_65840 6724 5153 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_65840 8835 6811 gene locus_tag LOCUS_65850 8835 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65850 8975 9382 gene locus_tag LOCUS_65860 8975 9382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65860 9875 9414 gene locus_tag LOCUS_65870 9875 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65870 9947 11314 gene locus_tag LOCUS_65880 9947 11314 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_65880 11521 13104 gene locus_tag LOCUS_65890 11521 13104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65890 <13905 13225 gene locus_tag LOCUS_65900 <13905 13225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124127.1:acetate--CoA ligase >Feature sequence225 268 2514 gene locus_tag LOCUS_65910 268 2514 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768357.1 protein_id gnl|my_center|LOCUS_65910 2559 4187 gene locus_tag LOCUS_65920 gene pstA 2559 4187 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_65920 4194 5084 gene locus_tag LOCUS_65930 gene pstB 4194 5084 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_65930 5157 5846 gene locus_tag LOCUS_65940 gene phoU 5157 5846 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_65940 6963 5974 gene locus_tag LOCUS_65950 6963 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65950 7628 9295 gene locus_tag LOCUS_65960 7628 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65960 9365 10720 gene locus_tag LOCUS_65970 9365 10720 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_65970 10742 12922 gene locus_tag LOCUS_65980 10742 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65980 >Feature sequence226 2110 239 gene locus_tag LOCUS_65990 2110 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65990 4161 2227 gene locus_tag LOCUS_66000 4161 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66000 4606 4947 gene locus_tag LOCUS_66010 4606 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66010 5028 6473 gene locus_tag LOCUS_66020 5028 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66020 6553 8361 gene locus_tag LOCUS_66030 6553 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66030 8570 9691 gene locus_tag LOCUS_66040 8570 9691 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_66040 9688 12015 gene locus_tag LOCUS_66050 9688 12015 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_66050 12029 13246 gene locus_tag LOCUS_66060 12029 13246 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_66060 >Feature sequence227 2100 301 gene locus_tag LOCUS_66070 2100 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66070 2265 2984 gene locus_tag LOCUS_66080 2265 2984 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_66080 3276 4742 gene locus_tag LOCUS_66090 3276 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66090 4750 5466 gene locus_tag LOCUS_66100 4750 5466 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_66100 5812 6024 gene locus_tag LOCUS_66110 5812 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66110 6128 8290 gene locus_tag LOCUS_66120 6128 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66120 8487 9785 gene locus_tag LOCUS_66130 8487 9785 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_66130 10450 9953 gene locus_tag LOCUS_66140 10450 9953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66140 11197 10487 gene locus_tag LOCUS_66150 11197 10487 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814050.1 protein_id gnl|my_center|LOCUS_66150 >Feature sequence228 630 2096 gene locus_tag LOCUS_66160 630 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_66160 2355 5213 gene locus_tag LOCUS_66170 2355 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66170 5517 10262 gene locus_tag LOCUS_66180 5517 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66180 10580 10209 gene locus_tag LOCUS_66190 10580 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66190 12884 10692 gene locus_tag LOCUS_66200 12884 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66200 >Feature sequence229 3529 653 gene locus_tag LOCUS_66210 3529 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66210 3814 4647 gene locus_tag LOCUS_66220 3814 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66220 4772 6130 gene locus_tag LOCUS_66230 4772 6130 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_66230 6160 8214 gene locus_tag LOCUS_66240 6160 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66240 8777 8974 gene locus_tag LOCUS_66250 8777 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66250 8971 9210 gene locus_tag LOCUS_66260 8971 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66260 9876 9448 gene locus_tag LOCUS_66270 9876 9448 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967235.1 protein_id gnl|my_center|LOCUS_66270 10124 9876 gene locus_tag LOCUS_66280 10124 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66280 >Feature sequence230 3149 3958 gene locus_tag LOCUS_66290 3149 3958 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921869.1 protein_id gnl|my_center|LOCUS_66290 4176 5459 gene locus_tag LOCUS_66300 4176 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_66300 5491 6690 gene locus_tag LOCUS_66310 5491 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66310 6785 7456 gene locus_tag LOCUS_66320 6785 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66320 7464 9053 gene locus_tag LOCUS_66330 7464 9053 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 protein_id gnl|my_center|LOCUS_66330 9097 9435 gene locus_tag LOCUS_66340 gene mutT 9097 9435 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167088.1 protein_id gnl|my_center|LOCUS_66340 10468 9593 gene locus_tag LOCUS_66350 10468 9593 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665981.1 protein_id gnl|my_center|LOCUS_66350 11437 10544 gene locus_tag LOCUS_66360 11437 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66360 11616 11690 gene locus_tag LOCUS_t00870 11616 11690 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence231 770 108 gene locus_tag LOCUS_66370 770 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66370 2733 1036 gene locus_tag LOCUS_66380 2733 1036 CDS product IS66-like element ISSfl3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069533.1 protein_id gnl|my_center|LOCUS_66380 3416 3069 gene locus_tag LOCUS_66390 3416 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66390 5101 3638 gene locus_tag LOCUS_66400 5101 3638 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_66400 5458 5201 gene locus_tag LOCUS_66410 5458 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66410 5583 7172 gene locus_tag LOCUS_66420 5583 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66420 9852 7096 gene locus_tag LOCUS_66430 9852 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66430 10131 11678 gene locus_tag LOCUS_66440 10131 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66440 12388 11900 gene locus_tag LOCUS_66450 12388 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66450 >Feature sequence232 438 821 gene locus_tag LOCUS_66460 438 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66460 818 1531 gene locus_tag LOCUS_66470 818 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66470 1524 3032 gene locus_tag LOCUS_66480 1524 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66480 3103 4023 gene locus_tag LOCUS_66490 3103 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66490 4267 6975 gene locus_tag LOCUS_66500 4267 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66500 9387 7216 gene locus_tag LOCUS_66510 9387 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66510 9597 11279 gene locus_tag LOCUS_66520 9597 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66520 <12819 11739 gene locus_tag LOCUS_66530 <12819 11739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727481.1:D-aminoacylase >Feature sequence233 726 211 gene locus_tag LOCUS_66540 726 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66540 1637 1107 gene locus_tag LOCUS_66550 1637 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66550 2630 1836 gene locus_tag LOCUS_66560 2630 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66560 3430 2630 gene locus_tag LOCUS_66570 3430 2630 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 protein_id gnl|my_center|LOCUS_66570 4084 4641 gene locus_tag LOCUS_66580 4084 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66580 4778 4972 gene locus_tag LOCUS_66590 4778 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66590 5019 6056 gene locus_tag LOCUS_66600 5019 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66600 7982 6327 gene locus_tag LOCUS_66610 7982 6327 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 protein_id gnl|my_center|LOCUS_66610 10413 8173 gene locus_tag LOCUS_66620 10413 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66620 11469 10654 gene locus_tag LOCUS_66630 11469 10654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66630 >Feature sequence234 377 592 gene locus_tag LOCUS_66640 377 592 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870234.1 protein_id gnl|my_center|LOCUS_66640 666 3578 gene locus_tag LOCUS_66650 666 3578 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_66650 3575 4705 gene locus_tag LOCUS_66660 3575 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66660 4708 6444 gene locus_tag LOCUS_66670 4708 6444 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_66670 6505 7314 gene locus_tag LOCUS_66680 6505 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66680 7317 9140 gene locus_tag LOCUS_66690 7317 9140 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105162.1 protein_id gnl|my_center|LOCUS_66690 9115 9591 gene locus_tag LOCUS_66700 9115 9591 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_66700 9588 12302 gene locus_tag LOCUS_66710 9588 12302 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_66710 >Feature sequence235 75 1334 gene locus_tag LOCUS_66720 75 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66720 1741 2955 gene locus_tag LOCUS_66730 1741 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66730 3714 3391 gene locus_tag LOCUS_66740 3714 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66740 7083 4207 gene locus_tag LOCUS_66750 7083 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66750 7864 7592 gene locus_tag LOCUS_66760 7864 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 8575 8880 gene locus_tag LOCUS_66770 8575 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66770 9050 10858 gene locus_tag LOCUS_66780 9050 10858 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227328.1 protein_id gnl|my_center|LOCUS_66780 10877 11206 gene locus_tag LOCUS_66790 10877 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66790 11242 12315 gene locus_tag LOCUS_66800 11242 12315 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_66800 >Feature sequence236 973 2376 gene locus_tag LOCUS_66810 973 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66810 2609 2908 gene locus_tag LOCUS_66820 2609 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66820 3192 4592 gene locus_tag LOCUS_66830 3192 4592 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119698.1 protein_id gnl|my_center|LOCUS_66830 5569 4769 gene locus_tag LOCUS_66840 5569 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66840 7159 5648 gene locus_tag LOCUS_66850 7159 5648 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 protein_id gnl|my_center|LOCUS_66850 7591 10764 gene locus_tag LOCUS_66860 7591 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66860 11004 11204 gene locus_tag LOCUS_66870 11004 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66870 11220 12608 gene locus_tag LOCUS_66880 gene miaB 11220 12608 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 protein_id gnl|my_center|LOCUS_66880 >Feature sequence237 37 873 gene locus_tag LOCUS_66890 37 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66890 950 1954 gene locus_tag LOCUS_66900 950 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66900 2029 2274 gene locus_tag LOCUS_66910 2029 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66910 2311 2784 gene locus_tag LOCUS_66920 2311 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66920 2957 3535 gene locus_tag LOCUS_66930 2957 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66930 3532 4368 gene locus_tag LOCUS_66940 3532 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66940 5680 4607 gene locus_tag LOCUS_66950 5680 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66950 5902 8760 gene locus_tag LOCUS_66960 5902 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66960 8775 9671 gene locus_tag LOCUS_66970 8775 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66970 9700 11031 gene locus_tag LOCUS_66980 9700 11031 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_66980 11043 12407 gene locus_tag LOCUS_66990 11043 12407 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669087.1 protein_id gnl|my_center|LOCUS_66990 >Feature sequence238 <1 812 gene locus_tag LOCUS_67000 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967234.1:PAS domain S-box protein 815 1438 gene locus_tag LOCUS_67010 gene fixJ 815 1438 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085544.1 protein_id gnl|my_center|LOCUS_67010 1481 2794 gene locus_tag LOCUS_67020 1481 2794 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_67020 3098 5731 gene locus_tag LOCUS_67030 3098 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67030 5804 6301 gene locus_tag LOCUS_67040 5804 6301 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545419.1 protein_id gnl|my_center|LOCUS_67040 7406 6594 gene locus_tag LOCUS_67050 7406 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67050 8957 7515 gene locus_tag LOCUS_67060 8957 7515 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890416.1 protein_id gnl|my_center|LOCUS_67060 9046 9951 gene locus_tag LOCUS_67070 9046 9951 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_67070 11195 9948 gene locus_tag LOCUS_67080 11195 9948 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921859.1 protein_id gnl|my_center|LOCUS_67080 12438 11317 gene locus_tag LOCUS_67090 12438 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921966.1 protein_id gnl|my_center|LOCUS_67090 >Feature sequence239 452 159 gene locus_tag LOCUS_67100 452 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67100 351 1049 gene locus_tag LOCUS_67110 351 1049 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816749.1 protein_id gnl|my_center|LOCUS_67110 1323 2528 gene locus_tag LOCUS_67120 1323 2528 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_67120 2552 4180 gene locus_tag LOCUS_67130 gene serA 2552 4180 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326392.1 protein_id gnl|my_center|LOCUS_67130 4216 5256 gene locus_tag LOCUS_67140 4216 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67140 5467 5688 gene locus_tag LOCUS_67150 5467 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 6071 5694 gene locus_tag LOCUS_67160 6071 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67160 7339 6308 gene locus_tag LOCUS_67170 gene ruvB 7339 6308 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331968.1 protein_id gnl|my_center|LOCUS_67170 8406 7426 gene locus_tag LOCUS_67180 8406 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922189.1 protein_id gnl|my_center|LOCUS_67180 9498 8425 gene locus_tag LOCUS_67190 9498 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122051.1 protein_id gnl|my_center|LOCUS_67190 10254 9631 gene locus_tag LOCUS_67200 10254 9631 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326966.1 protein_id gnl|my_center|LOCUS_67200 11573 10287 gene locus_tag LOCUS_67210 11573 10287 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_67210 >Feature sequence240 626 138 gene locus_tag LOCUS_67220 626 138 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967809.1 protein_id gnl|my_center|LOCUS_67220 1098 670 gene locus_tag LOCUS_67230 1098 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67230 2766 1636 gene locus_tag LOCUS_67240 2766 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67240 3545 2763 gene locus_tag LOCUS_67250 3545 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67250 4336 3656 gene locus_tag LOCUS_67260 4336 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67260 5458 4412 gene locus_tag LOCUS_67270 5458 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67270 5795 5589 gene locus_tag LOCUS_67280 5795 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67280 8457 6157 gene locus_tag LOCUS_67290 8457 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67290 10640 8772 gene locus_tag LOCUS_67300 10640 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67300 11386 10637 gene locus_tag LOCUS_67310 11386 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67310 11731 11480 gene locus_tag LOCUS_67320 11731 11480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67320 11832 12347 gene locus_tag LOCUS_67330 11832 12347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67330 >Feature sequence241 1660 152 gene locus_tag LOCUS_67340 1660 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67340 3220 2204 gene locus_tag LOCUS_67350 3220 2204 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_67350 4394 3756 gene locus_tag LOCUS_67360 4394 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67360 4881 4384 gene locus_tag LOCUS_67370 4881 4384 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921996.1 protein_id gnl|my_center|LOCUS_67370 5149 5415 gene locus_tag LOCUS_67380 5149 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67380 6082 7602 gene locus_tag LOCUS_67390 6082 7602 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_67390 7614 8558 gene locus_tag LOCUS_67400 7614 8558 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145034007.1 protein_id gnl|my_center|LOCUS_67400 8585 9547 gene locus_tag LOCUS_67410 8585 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67410 9572 10426 gene locus_tag LOCUS_67420 9572 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67420 10420 11709 gene locus_tag LOCUS_67430 10420 11709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67430 >Feature sequence242 1919 3097 gene locus_tag LOCUS_67440 1919 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67440 3103 4752 gene locus_tag LOCUS_67450 3103 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67450 4832 6358 gene locus_tag LOCUS_67460 4832 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67460 6512 7279 gene locus_tag LOCUS_67470 6512 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67470 7986 7690 gene locus_tag LOCUS_67480 7986 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67480 8254 8036 gene locus_tag LOCUS_67490 8254 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67490 8469 8930 gene locus_tag LOCUS_67500 8469 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67500 9130 10260 gene locus_tag LOCUS_67510 9130 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67510 >Feature sequence243 412 1197 gene locus_tag LOCUS_67520 412 1197 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258579.1 protein_id gnl|my_center|LOCUS_67520 1437 1213 gene locus_tag LOCUS_67530 1437 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67530 1682 1530 gene locus_tag LOCUS_67540 1682 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67540 1987 1781 gene locus_tag LOCUS_67550 1987 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67550 2804 2508 gene locus_tag LOCUS_67560 2804 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67560 >Feature sequence244 811 212 gene locus_tag LOCUS_67570 811 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 1712 924 gene locus_tag LOCUS_67580 1712 924 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_67580 2052 3317 gene locus_tag LOCUS_67590 gene xseA 2052 3317 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119437.1 protein_id gnl|my_center|LOCUS_67590 3443 3619 gene locus_tag LOCUS_67600 3443 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67600 5522 3723 gene locus_tag LOCUS_67610 5522 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67610 5669 6559 gene locus_tag LOCUS_67620 5669 6559 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328910.1 protein_id gnl|my_center|LOCUS_67620 6568 7515 gene locus_tag LOCUS_67630 6568 7515 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527947.1 protein_id gnl|my_center|LOCUS_67630 7839 9506 gene locus_tag LOCUS_67640 7839 9506 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_67640 9583 10071 gene locus_tag LOCUS_67650 9583 10071 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468003.1 protein_id gnl|my_center|LOCUS_67650 10892 10089 gene locus_tag LOCUS_67660 10892 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67660 10975 12006 gene locus_tag LOCUS_67670 10975 12006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67670 >Feature sequence245 2534 954 gene locus_tag LOCUS_67680 2534 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67680 3573 2527 gene locus_tag LOCUS_67690 3573 2527 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909272.1 protein_id gnl|my_center|LOCUS_67690 4020 4859 gene locus_tag LOCUS_67700 4020 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67700 5678 4896 gene locus_tag LOCUS_67710 5678 4896 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_67710 6032 5787 gene locus_tag LOCUS_67720 6032 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67720 7113 6244 gene locus_tag LOCUS_67730 7113 6244 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392313.1 protein_id gnl|my_center|LOCUS_67730 8337 7126 gene locus_tag LOCUS_67740 8337 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67740 10439 8346 gene locus_tag LOCUS_67750 gene flhA 10439 8346 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121805.1 protein_id gnl|my_center|LOCUS_67750 10662 10877 gene locus_tag LOCUS_67760 10662 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67760 11009 12166 gene locus_tag LOCUS_67770 11009 12166 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411661.1 protein_id gnl|my_center|LOCUS_67770 >Feature sequence246 1128 1982 gene locus_tag LOCUS_67780 1128 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67780 1979 2392 gene locus_tag LOCUS_67790 1979 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67790 2406 6416 gene locus_tag LOCUS_67800 2406 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67800 6735 6379 gene locus_tag LOCUS_67810 6735 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67810 7456 7106 gene locus_tag LOCUS_67820 7456 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67820 7812 7456 gene locus_tag LOCUS_67830 7812 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67830 8091 7849 gene locus_tag LOCUS_67840 8091 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67840 8195 8016 gene locus_tag LOCUS_67850 8195 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67850 10324 8375 gene locus_tag LOCUS_67860 10324 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67860 10602 10321 gene locus_tag LOCUS_67870 10602 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67870 10774 10595 gene locus_tag LOCUS_67880 10774 10595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67880 10877 12091 gene locus_tag LOCUS_67890 10877 12091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67890 >Feature sequence247 288 938 gene locus_tag LOCUS_67900 288 938 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922815.1 protein_id gnl|my_center|LOCUS_67900 1137 1481 gene locus_tag LOCUS_67910 1137 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67910 1630 2100 gene locus_tag LOCUS_67920 1630 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67920 3601 2411 gene locus_tag LOCUS_67930 3601 2411 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_67930 4066 5535 gene locus_tag LOCUS_67940 4066 5535 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_67940 5814 6602 gene locus_tag LOCUS_67950 5814 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67950 6527 6772 gene locus_tag LOCUS_67960 6527 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67960 7148 8668 gene locus_tag LOCUS_67970 7148 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67970 8816 11203 gene locus_tag LOCUS_67980 8816 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67980 >Feature sequence248 48 233 gene locus_tag LOCUS_67990 48 233 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870234.1 protein_id gnl|my_center|LOCUS_67990 271 834 gene locus_tag LOCUS_68000 271 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68000 807 1964 gene locus_tag LOCUS_68010 807 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68010 1981 3360 gene locus_tag LOCUS_68020 1981 3360 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_68020 3360 4598 gene locus_tag LOCUS_68030 3360 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68030 4601 8098 gene locus_tag LOCUS_68040 4601 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68040 8098 9672 gene locus_tag LOCUS_68050 8098 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68050 9662 10615 gene locus_tag LOCUS_68060 9662 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68060 10634 11779 gene locus_tag LOCUS_68070 10634 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68070 >Feature sequence249 217 414 gene locus_tag LOCUS_68080 217 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68080 527 1225 gene locus_tag LOCUS_68090 527 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68090 1291 1662 gene locus_tag LOCUS_68100 1291 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68100 1659 1850 gene locus_tag LOCUS_68110 1659 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68110 1860 2231 gene locus_tag LOCUS_68120 1860 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68120 2420 3931 gene locus_tag LOCUS_68130 2420 3931 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_68130 3966 4976 gene locus_tag LOCUS_68140 3966 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68140 5072 5287 gene locus_tag LOCUS_68150 5072 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68150 5438 6595 gene locus_tag LOCUS_68160 5438 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68160 6704 6982 gene locus_tag LOCUS_68170 6704 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68170 6994 7251 gene locus_tag LOCUS_68180 6994 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68180 7244 7561 gene locus_tag LOCUS_68190 7244 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68190 7565 8086 gene locus_tag LOCUS_68200 7565 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68200 8094 8462 gene locus_tag LOCUS_68210 8094 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68210 8465 9043 gene locus_tag LOCUS_68220 8465 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68220 9040 9402 gene locus_tag LOCUS_68230 9040 9402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68230 9399 9605 gene locus_tag LOCUS_68240 9399 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68240 9608 10255 gene locus_tag LOCUS_68250 9608 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68250 10479 11423 gene locus_tag LOCUS_68260 10479 11423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68260 11435 11686 gene locus_tag LOCUS_68270 11435 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68270 >Feature sequence250 160 384 gene locus_tag LOCUS_68280 160 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68280 1301 321 gene locus_tag LOCUS_68290 1301 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68290 2487 1354 gene locus_tag LOCUS_68300 2487 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 2482 2808 gene locus_tag LOCUS_68310 2482 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68310 3522 3785 gene locus_tag LOCUS_68320 3522 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68320 3836 4822 gene locus_tag LOCUS_68330 3836 4822 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339548.1 protein_id gnl|my_center|LOCUS_68330 5013 5612 gene locus_tag LOCUS_68340 5013 5612 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_68340 5728 6003 gene locus_tag LOCUS_68350 5728 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68350 6081 6851 gene locus_tag LOCUS_68360 6081 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922454.1 protein_id gnl|my_center|LOCUS_68360 8458 6854 gene locus_tag LOCUS_68370 8458 6854 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_68370 11041 8693 gene locus_tag LOCUS_68380 11041 8693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68380 >Feature sequence251 74 3286 gene locus_tag LOCUS_68390 74 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68390 3240 3695 gene locus_tag LOCUS_68400 3240 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68400 5343 3907 gene locus_tag LOCUS_68410 5343 3907 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_68410 5373 6173 gene locus_tag LOCUS_68420 5373 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68420 6584 6267 gene locus_tag LOCUS_68430 6584 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68430 7273 9528 gene locus_tag LOCUS_68440 7273 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68440 10506 9565 gene locus_tag LOCUS_68450 10506 9565 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921669.1 protein_id gnl|my_center|LOCUS_68450 >Feature sequence252 797 1459 gene locus_tag LOCUS_68460 797 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68460 2823 1537 gene locus_tag LOCUS_68470 2823 1537 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_68470 3408 4364 gene locus_tag LOCUS_68480 3408 4364 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327421.1 protein_id gnl|my_center|LOCUS_68480 4411 5685 gene locus_tag LOCUS_68490 4411 5685 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_68490 5811 6509 gene locus_tag LOCUS_68500 5811 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68500 6828 8435 gene locus_tag LOCUS_68510 6828 8435 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080443.1 protein_id gnl|my_center|LOCUS_68510 9911 8637 gene locus_tag LOCUS_68520 gene purD 9911 8637 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334006.1 protein_id gnl|my_center|LOCUS_68520 10180 10752 gene locus_tag LOCUS_68530 10180 10752 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931994.1 protein_id gnl|my_center|LOCUS_68530 10761 11534 gene locus_tag LOCUS_68540 10761 11534 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_68540 >Feature sequence253 7121 5694 gene locus_tag LOCUS_68550 7121 5694 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146578646.1 protein_id gnl|my_center|LOCUS_68550 8707 7226 gene locus_tag LOCUS_68560 8707 7226 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 protein_id gnl|my_center|LOCUS_68560 9310 8891 gene locus_tag LOCUS_68570 9310 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68570 9384 10859 gene locus_tag LOCUS_68580 9384 10859 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_68580 >Feature sequence254 1325 891 gene locus_tag LOCUS_68590 1325 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68590 1712 1512 gene locus_tag LOCUS_68600 1712 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68600 3217 1736 gene locus_tag LOCUS_68610 3217 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68610 4059 3214 gene locus_tag LOCUS_68620 4059 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68620 4394 4125 gene locus_tag LOCUS_68630 4394 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68630 8889 4429 gene locus_tag LOCUS_68640 8889 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68640 11689 10373 gene locus_tag LOCUS_68650 11689 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68650 >Feature sequence255 4 276 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgcgtgtacggggaactc 641 327 gene locus_tag LOCUS_68660 gene cas2e 641 327 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942042.1 protein_id gnl|my_center|LOCUS_68660 1488 622 gene locus_tag LOCUS_68670 gene cas1e 1488 622 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942041.1 protein_id gnl|my_center|LOCUS_68670 2225 1530 gene locus_tag LOCUS_68680 gene cas5e 2225 1530 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933632.1 protein_id gnl|my_center|LOCUS_68680 3261 2215 gene locus_tag LOCUS_68690 gene cas7e 3261 2215 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 protein_id gnl|my_center|LOCUS_68690 3917 3288 gene locus_tag LOCUS_68700 gene cas6e 3917 3288 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933630.1 protein_id gnl|my_center|LOCUS_68700 4423 3914 gene locus_tag LOCUS_68710 4423 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68710 5985 4420 gene locus_tag LOCUS_68720 gene casA 5985 4420 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933628.1 protein_id gnl|my_center|LOCUS_68720 8552 5982 gene locus_tag LOCUS_68730 8552 5982 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933627.1 protein_id gnl|my_center|LOCUS_68730 9780 8767 gene locus_tag LOCUS_68740 9780 8767 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_68740 10829 11059 gene locus_tag LOCUS_68750 10829 11059 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_68750 11056 11442 gene locus_tag LOCUS_68760 11056 11442 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_68760 >Feature sequence256 1538 426 gene locus_tag LOCUS_68770 1538 426 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_68770 4172 1608 gene locus_tag LOCUS_68780 4172 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68780 5485 4169 gene locus_tag LOCUS_68790 5485 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68790 8369 5490 gene locus_tag LOCUS_68800 8369 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_68800 8763 9041 gene locus_tag LOCUS_68810 8763 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68810 9983 9384 gene locus_tag LOCUS_68820 9983 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68820 11535 10120 gene locus_tag LOCUS_68830 11535 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68830 >Feature sequence257 1890 124 gene locus_tag LOCUS_68840 1890 124 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_68840 5088 1927 gene locus_tag LOCUS_68850 5088 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68850 6008 5085 gene locus_tag LOCUS_68860 6008 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68860 7580 6012 gene locus_tag LOCUS_68870 7580 6012 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_68870 9139 7577 gene locus_tag LOCUS_68880 9139 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200386714.1 protein_id gnl|my_center|LOCUS_68880 10089 9136 gene locus_tag LOCUS_68890 10089 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_68890 <11537 10150 gene locus_tag LOCUS_68900 <11537 10150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546856.1:type I restriction-modification enzyme R subunit C-terminal domain-containing protein note possible pseudo, internal stop codon >Feature sequence258 1885 602 gene locus_tag LOCUS_68910 1885 602 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_68910 2034 2876 gene locus_tag LOCUS_68920 2034 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68920 3451 6093 gene locus_tag LOCUS_68930 3451 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68930 6246 6320 gene locus_tag LOCUS_t00880 6246 6320 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8757 6655 gene locus_tag LOCUS_68940 8757 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68940 10141 8828 gene locus_tag LOCUS_68950 10141 8828 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_68950 10960 11148 gene locus_tag LOCUS_68960 10960 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68960 >Feature sequence259 1659 220 gene locus_tag LOCUS_68970 1659 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68970 3062 1656 gene locus_tag LOCUS_68980 3062 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68980 3519 5282 gene locus_tag LOCUS_68990 3519 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68990 5648 5367 gene locus_tag LOCUS_69000 5648 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69000 5902 6183 gene locus_tag LOCUS_69010 5902 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69010 6296 7036 gene locus_tag LOCUS_69020 6296 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69020 8083 7172 gene locus_tag LOCUS_69030 8083 7172 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_69030 8532 10283 gene locus_tag LOCUS_69040 8532 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69040 10944 10264 gene locus_tag LOCUS_69050 10944 10264 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767407.1 protein_id gnl|my_center|LOCUS_69050 >Feature sequence260 <1 546 gene locus_tag LOCUS_69060 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932946.1:DUF134 domain-containing protein 709 1338 gene locus_tag LOCUS_69070 709 1338 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_69070 2157 2074 gene locus_tag LOCUS_t00890 2157 2074 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5058 2179 gene locus_tag LOCUS_69080 5058 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69080 5883 7409 gene locus_tag LOCUS_69090 5883 7409 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_69090 8555 7449 gene locus_tag LOCUS_69100 8555 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69100 8790 9824 gene locus_tag LOCUS_69110 gene dusB 8790 9824 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334998.1 protein_id gnl|my_center|LOCUS_69110 9885 10820 gene locus_tag LOCUS_69120 9885 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69120 >Feature sequence261 403 134 gene locus_tag LOCUS_69130 403 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69130 1277 738 gene locus_tag LOCUS_69140 1277 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69140 1966 4623 gene locus_tag LOCUS_69150 1966 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69150 4741 5847 gene locus_tag LOCUS_69160 4741 5847 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120960.1 protein_id gnl|my_center|LOCUS_69160 5883 6128 gene locus_tag LOCUS_69170 5883 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69170 6821 6201 gene locus_tag LOCUS_69180 gene wrbA 6821 6201 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946383.1 protein_id gnl|my_center|LOCUS_69180 7752 6919 gene locus_tag LOCUS_69190 7752 6919 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_69190 8871 7765 gene locus_tag LOCUS_69200 8871 7765 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_69200 10497 8893 gene locus_tag LOCUS_69210 10497 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69210 >Feature sequence262 166 1200 gene locus_tag LOCUS_69220 166 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69220 6009 1567 gene locus_tag LOCUS_69230 6009 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69230 6485 6105 gene locus_tag LOCUS_69240 6485 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69240 10462 6482 gene locus_tag LOCUS_69250 10462 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69250 >Feature sequence263 229 4209 gene locus_tag LOCUS_69260 229 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69260 4478 5746 gene locus_tag LOCUS_69270 4478 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69270 5812 6828 gene locus_tag LOCUS_69280 5812 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69280 6921 10133 gene locus_tag LOCUS_69290 6921 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69290 >Feature sequence264 764 444 gene locus_tag LOCUS_69300 764 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69300 3880 872 gene locus_tag LOCUS_69310 3880 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69310 5167 3929 gene locus_tag LOCUS_69320 5167 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69320 5622 7067 gene locus_tag LOCUS_69330 5622 7067 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819246.1 protein_id gnl|my_center|LOCUS_69330 8562 7231 gene locus_tag LOCUS_69340 8562 7231 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_69340 8989 10116 gene locus_tag LOCUS_69350 8989 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69350 >Feature sequence265 244 1866 gene locus_tag LOCUS_69360 244 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69360 2012 2269 gene locus_tag LOCUS_69370 2012 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69370 2314 2475 gene locus_tag LOCUS_69380 2314 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69380 2527 3675 gene locus_tag LOCUS_69390 2527 3675 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_69390 3748 4038 gene locus_tag LOCUS_69400 3748 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69400 5182 4010 gene locus_tag LOCUS_69410 gene metK 5182 4010 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_69410 6377 5256 gene locus_tag LOCUS_69420 gene metK 6377 5256 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056822.1 protein_id gnl|my_center|LOCUS_69420 6799 6377 gene locus_tag LOCUS_69430 6799 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69430 6680 7189 gene locus_tag LOCUS_69440 6680 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69440 7606 8061 gene locus_tag LOCUS_69450 7606 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69450 8276 7977 gene locus_tag LOCUS_69460 8276 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69460 10333 8255 gene locus_tag LOCUS_69470 10333 8255 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583749.1 protein_id gnl|my_center|LOCUS_69470 >Feature sequence266 351 962 gene locus_tag LOCUS_69480 351 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69480 1037 1333 gene locus_tag LOCUS_69490 1037 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69490 1704 4256 gene locus_tag LOCUS_69500 1704 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69500 4253 6559 gene locus_tag LOCUS_69510 4253 6559 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_69510 7363 7590 gene locus_tag LOCUS_69520 7363 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69520 8368 7649 gene locus_tag LOCUS_69530 8368 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69530 >Feature sequence267 1060 542 gene locus_tag LOCUS_69540 1060 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_69540 1305 1057 gene locus_tag LOCUS_69550 1305 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69550 2317 1463 gene locus_tag LOCUS_69560 2317 1463 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_69560 2851 2354 gene locus_tag LOCUS_69570 2851 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69570 3387 2860 gene locus_tag LOCUS_69580 3387 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69580 3746 3384 gene locus_tag LOCUS_69590 3746 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69590 5059 3791 gene locus_tag LOCUS_69600 5059 3791 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190444.1 protein_id gnl|my_center|LOCUS_69600 6249 5062 gene locus_tag LOCUS_69610 6249 5062 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_69610 7331 6249 gene locus_tag LOCUS_69620 gene xcpS 7331 6249 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_69620 8222 7509 gene locus_tag LOCUS_69630 8222 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69630 9287 8808 gene locus_tag LOCUS_69640 9287 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69640 9854 9483 gene locus_tag LOCUS_69650 gene tnpB 9854 9483 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_69650 >Feature sequence268 2028 403 gene locus_tag LOCUS_69660 2028 403 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921354.1 protein_id gnl|my_center|LOCUS_69660 2279 4198 gene locus_tag LOCUS_69670 2279 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69670 4774 4349 gene locus_tag LOCUS_69680 4774 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69680 5922 4918 gene locus_tag LOCUS_69690 5922 4918 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922391.1 protein_id gnl|my_center|LOCUS_69690 7280 6240 gene locus_tag LOCUS_69700 7280 6240 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330953.1 protein_id gnl|my_center|LOCUS_69700 7747 8718 gene locus_tag LOCUS_69710 7747 8718 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_69710 9621 9238 gene locus_tag LOCUS_69720 9621 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69720 >Feature sequence269 708 568 gene locus_tag LOCUS_69730 708 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69730 2285 837 gene locus_tag LOCUS_69740 2285 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69740 3412 2363 gene locus_tag LOCUS_69750 3412 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69750 4513 3575 gene locus_tag LOCUS_69760 4513 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69760 6549 4705 gene locus_tag LOCUS_69770 6549 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69770 8126 6546 gene locus_tag LOCUS_69780 8126 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69780 9584 8481 gene locus_tag LOCUS_69790 9584 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69790 >Feature sequence270 917 237 gene locus_tag LOCUS_69800 917 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69800 2457 1063 gene locus_tag LOCUS_69810 2457 1063 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_69810 2984 2565 gene locus_tag LOCUS_69820 2984 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69820 3999 3007 gene locus_tag LOCUS_69830 3999 3007 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_69830 5130 4795 gene locus_tag LOCUS_69840 5130 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69840 5020 5898 gene locus_tag LOCUS_69850 5020 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69850 5968 7404 gene locus_tag LOCUS_69860 5968 7404 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_69860 7488 8957 gene locus_tag LOCUS_69870 7488 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69870 <9941 9309 gene locus_tag LOCUS_69880 <9941 9309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922199.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence271 829 449 gene locus_tag LOCUS_69890 829 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69890 1071 790 gene locus_tag LOCUS_69900 1071 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69900 4632 1228 gene locus_tag LOCUS_69910 4632 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69910 5510 4728 gene locus_tag LOCUS_69920 5510 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69920 8914 5516 gene locus_tag LOCUS_69930 8914 5516 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_69930 <9918 9324 gene locus_tag LOCUS_69940 <9918 9324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107584.1:sugar phosphate isomerase/epimerase >Feature sequence272 1731 1276 gene locus_tag LOCUS_69950 gene tnpA 1731 1276 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_69950 2874 1861 gene locus_tag LOCUS_69960 2874 1861 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_69960 4391 3480 gene locus_tag LOCUS_69970 4391 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69970 5969 4518 gene locus_tag LOCUS_69980 5969 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69980 8079 6085 gene locus_tag LOCUS_69990 8079 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69990 8751 8086 gene locus_tag LOCUS_70000 8751 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70000 9663 8914 gene locus_tag LOCUS_70010 9663 8914 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937657.1 protein_id gnl|my_center|LOCUS_70010 >Feature sequence273 1462 77 gene locus_tag LOCUS_70020 1462 77 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_70020 1751 2023 gene locus_tag LOCUS_70030 1751 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70030 2078 4468 gene locus_tag LOCUS_70040 2078 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70040 5775 4732 gene locus_tag LOCUS_70050 5775 4732 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_70050 6630 6202 gene locus_tag LOCUS_70060 6630 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70060 7694 6729 gene locus_tag LOCUS_70070 7694 6729 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_70070 8534 8247 gene locus_tag LOCUS_70080 8534 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70080 9664 8552 gene locus_tag LOCUS_70090 9664 8552 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922391.1 protein_id gnl|my_center|LOCUS_70090 >Feature sequence274 1219 128 gene locus_tag LOCUS_70100 1219 128 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_70100 1918 1367 gene locus_tag LOCUS_70110 1918 1367 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_70110 2143 3678 gene locus_tag LOCUS_70120 gene trpE 2143 3678 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_70120 3773 4903 gene locus_tag LOCUS_70130 gene menC 3773 4903 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_70130 5053 5361 gene locus_tag LOCUS_70140 5053 5361 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207800.1 protein_id gnl|my_center|LOCUS_70140 5374 6879 gene locus_tag LOCUS_70150 5374 6879 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922613.1 protein_id gnl|my_center|LOCUS_70150 8950 7532 gene locus_tag LOCUS_70160 gene terL 8950 7532 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939974.1 protein_id gnl|my_center|LOCUS_70160 9065 9373 gene locus_tag LOCUS_70170 9065 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70170 >Feature sequence275 452 524 gene locus_tag LOCUS_t00900 452 524 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1100 1564 gene locus_tag LOCUS_70180 1100 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70180 1564 1914 gene locus_tag LOCUS_70190 1564 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70190 1988 2305 gene locus_tag LOCUS_70200 1988 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70200 2441 2665 gene locus_tag LOCUS_70210 2441 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70210 2683 5016 gene locus_tag LOCUS_70220 2683 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70220 5000 6643 gene locus_tag LOCUS_70230 5000 6643 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_70230 6647 7795 gene locus_tag LOCUS_70240 6647 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70240 7792 9558 gene locus_tag LOCUS_70250 7792 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70250 >Feature sequence276 3391 293 gene locus_tag LOCUS_70260 3391 293 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_70260 4152 3388 gene locus_tag LOCUS_70270 4152 3388 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_70270 4598 4149 gene locus_tag LOCUS_70280 4598 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062537442.1 protein_id gnl|my_center|LOCUS_70280 5961 4591 gene locus_tag LOCUS_70290 5961 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70290 6455 5958 gene locus_tag LOCUS_70300 6455 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70300 7696 6455 gene locus_tag LOCUS_70310 7696 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70310 9374 7686 gene locus_tag LOCUS_70320 9374 7686 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_70320 >Feature sequence277 <1 1522 gene locus_tag LOCUS_70330 <1 1522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222299.1:DUF3631 domain-containing protein 1842 2225 gene locus_tag LOCUS_70340 1842 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70340 2212 2538 gene locus_tag LOCUS_70350 2212 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70350 2606 3316 gene locus_tag LOCUS_70360 2606 3316 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_70360 3303 4811 gene locus_tag LOCUS_70370 3303 4811 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_70370 4804 7326 gene locus_tag LOCUS_70380 4804 7326 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492290.1 protein_id gnl|my_center|LOCUS_70380 7669 7367 gene locus_tag LOCUS_70390 7669 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70390 9538 8645 gene locus_tag LOCUS_70400 9538 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70400 >Feature sequence278 154 70 gene locus_tag LOCUS_t00910 154 70 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 354 1622 gene locus_tag LOCUS_70410 354 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70410 1938 1624 gene locus_tag LOCUS_70420 1938 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70420 2173 1922 gene locus_tag LOCUS_70430 2173 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70430 2697 2176 gene locus_tag LOCUS_70440 2697 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70440 4678 3056 gene locus_tag LOCUS_70450 4678 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70450 4847 6073 gene locus_tag LOCUS_70460 4847 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70460 6244 7050 gene locus_tag LOCUS_70470 6244 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70470 7176 8120 gene locus_tag LOCUS_70480 7176 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70480 8192 8758 gene locus_tag LOCUS_70490 8192 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70490 8779 9255 gene locus_tag LOCUS_70500 8779 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70500 >Feature sequence279 210 467 gene locus_tag LOCUS_70510 210 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70510 1175 1735 gene locus_tag LOCUS_70520 1175 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70520 2049 2288 gene locus_tag LOCUS_70530 2049 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70530 2325 2639 gene locus_tag LOCUS_70540 2325 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70540 5064 3613 gene locus_tag LOCUS_70550 5064 3613 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_70550 5376 6245 gene locus_tag LOCUS_70560 5376 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70560 7057 6242 gene locus_tag LOCUS_70570 7057 6242 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922316.1 protein_id gnl|my_center|LOCUS_70570 7438 8295 gene locus_tag LOCUS_70580 7438 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70580 9053 8259 gene locus_tag LOCUS_70590 9053 8259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70590 >Feature sequence280 1122 376 gene locus_tag LOCUS_70600 1122 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70600 3051 1255 gene locus_tag LOCUS_70610 3051 1255 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921899.1 protein_id gnl|my_center|LOCUS_70610 3633 3079 gene locus_tag LOCUS_70620 3633 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70620 3783 6431 gene locus_tag LOCUS_70630 3783 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70630 7659 6463 gene locus_tag LOCUS_70640 7659 6463 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_70640 9044 7659 gene locus_tag LOCUS_70650 gene bioA 9044 7659 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_70650 >Feature sequence281 2849 60 gene locus_tag LOCUS_70660 2849 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70660 7307 3159 gene locus_tag LOCUS_70670 7307 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70670 7960 7418 gene locus_tag LOCUS_70680 7960 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70680 >Feature sequence282 200 1123 gene locus_tag LOCUS_70690 200 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70690 1743 1459 gene locus_tag LOCUS_70700 1743 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70700 2361 2525 gene locus_tag LOCUS_70710 2361 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70710 2599 5217 gene locus_tag LOCUS_70720 2599 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70720 5254 6117 gene locus_tag LOCUS_70730 5254 6117 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082089305.1 protein_id gnl|my_center|LOCUS_70730 6192 8471 gene locus_tag LOCUS_70740 6192 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70740 >Feature sequence283 429 1727 gene locus_tag LOCUS_70750 429 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144056573.1 protein_id gnl|my_center|LOCUS_70750 1795 2787 gene locus_tag LOCUS_70760 1795 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70760 2867 4255 gene locus_tag LOCUS_70770 2867 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70770 4330 4524 gene locus_tag LOCUS_70780 4330 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70780 4718 4470 gene locus_tag LOCUS_70790 4718 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70790 5199 5834 gene locus_tag LOCUS_70800 5199 5834 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_70800 5998 6699 gene locus_tag LOCUS_70810 5998 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70810 6696 8579 gene locus_tag LOCUS_70820 6696 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127588486.1 protein_id gnl|my_center|LOCUS_70820 >Feature sequence284 172 1047 gene locus_tag LOCUS_70830 172 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70830 1174 1419 gene locus_tag LOCUS_70840 1174 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70840 1416 1913 gene locus_tag LOCUS_70850 1416 1913 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_70850 3206 1968 gene locus_tag LOCUS_70860 3206 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70860 3323 4366 gene locus_tag LOCUS_70870 3323 4366 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_70870 6323 4428 gene locus_tag LOCUS_70880 6323 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70880 7203 6442 gene locus_tag LOCUS_70890 7203 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 >Feature sequence285 4368 403 gene locus_tag LOCUS_70900 4368 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334944.1 protein_id gnl|my_center|LOCUS_70900 6304 4610 gene locus_tag LOCUS_70910 6304 4610 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921382.1 protein_id gnl|my_center|LOCUS_70910 6756 7595 gene locus_tag LOCUS_70920 6756 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70920 >Feature sequence286 928 806 gene locus_tag LOCUS_70930 928 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70930 906 2198 gene locus_tag LOCUS_70940 906 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70940 2195 4306 gene locus_tag LOCUS_70950 2195 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70950 4303 7164 gene locus_tag LOCUS_70960 4303 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70960 8144 7329 gene locus_tag LOCUS_70970 8144 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70970 9031 8141 gene locus_tag LOCUS_70980 9031 8141 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_70980 >Feature sequence287 185 3307 gene locus_tag LOCUS_70990 185 3307 CDS product [glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008674544.1 protein_id gnl|my_center|LOCUS_70990 4871 3585 gene locus_tag LOCUS_71000 4871 3585 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_71000 5329 7251 gene locus_tag LOCUS_71010 5329 7251 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_71010 7308 8300 gene locus_tag LOCUS_71020 7308 8300 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_71020 >Feature sequence288 720 1121 gene locus_tag LOCUS_71030 720 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71030 1318 1536 gene locus_tag LOCUS_71040 1318 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672712.1 protein_id gnl|my_center|LOCUS_71040 1650 2582 gene locus_tag LOCUS_71050 1650 2582 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332287.1 protein_id gnl|my_center|LOCUS_71050 2627 3595 gene locus_tag LOCUS_71060 gene trpS 2627 3595 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_71060 3608 4756 gene locus_tag LOCUS_71070 3608 4756 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120921.1 protein_id gnl|my_center|LOCUS_71070 4841 7093 gene locus_tag LOCUS_71080 4841 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71080 7444 7911 gene locus_tag LOCUS_71090 7444 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71090 7957 8940 gene locus_tag LOCUS_71100 7957 8940 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705190.1 protein_id gnl|my_center|LOCUS_71100 >Feature sequence289 564 1061 gene locus_tag LOCUS_71110 564 1061 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615364.1 protein_id gnl|my_center|LOCUS_71110 1767 1120 gene locus_tag LOCUS_71120 1767 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71120 3171 1831 gene locus_tag LOCUS_71130 3171 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71130 6098 3954 gene locus_tag LOCUS_71140 6098 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71140 6873 6265 gene locus_tag LOCUS_71150 6873 6265 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922102.1 protein_id gnl|my_center|LOCUS_71150 7323 7150 gene locus_tag LOCUS_71160 7323 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71160 8715 7390 gene locus_tag LOCUS_71170 8715 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71170 9157 8834 gene locus_tag LOCUS_71180 9157 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71180 >Feature sequence290 400 2103 gene locus_tag LOCUS_71190 400 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71190 2798 2046 gene locus_tag LOCUS_71200 2798 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71200 3405 4466 gene locus_tag LOCUS_71210 3405 4466 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922731.1 protein_id gnl|my_center|LOCUS_71210 4928 4623 gene locus_tag LOCUS_71220 4928 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71220 5314 6204 gene locus_tag LOCUS_71230 5314 6204 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_71230 6414 8810 gene locus_tag LOCUS_71240 6414 8810 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921616.1 protein_id gnl|my_center|LOCUS_71240 >Feature sequence291 565 744 gene locus_tag LOCUS_71250 565 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71250 810 1043 gene locus_tag LOCUS_71260 810 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71260 1306 2238 gene locus_tag LOCUS_71270 1306 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71270 2439 3248 gene locus_tag LOCUS_71280 2439 3248 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459063.1 protein_id gnl|my_center|LOCUS_71280 3245 3544 gene locus_tag LOCUS_71290 3245 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71290 3547 5250 gene locus_tag LOCUS_71300 3547 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71300 5262 5699 gene locus_tag LOCUS_71310 5262 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71310 5800 6648 gene locus_tag LOCUS_71320 5800 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71320 6762 7475 gene locus_tag LOCUS_71330 6762 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71330 7802 8566 gene locus_tag LOCUS_71340 7802 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71340 8646 8873 gene locus_tag LOCUS_71350 8646 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71350 >Feature sequence292 2099 3577 gene locus_tag LOCUS_71360 2099 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71360 3574 4995 gene locus_tag LOCUS_71370 3574 4995 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_71370 5355 5783 gene locus_tag LOCUS_71380 5355 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71380 5827 6093 gene locus_tag LOCUS_71390 5827 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71390 6188 6475 gene locus_tag LOCUS_71400 6188 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71400 6876 7331 gene locus_tag LOCUS_71410 6876 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71410 8576 7323 gene locus_tag LOCUS_71420 8576 7323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71420 >Feature sequence293 1470 757 gene locus_tag LOCUS_71430 1470 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71430 2693 1809 gene locus_tag LOCUS_71440 2693 1809 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_71440 3788 2907 gene locus_tag LOCUS_71450 3788 2907 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921645.1 protein_id gnl|my_center|LOCUS_71450 4544 4269 gene locus_tag LOCUS_71460 4544 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71460 4715 5377 gene locus_tag LOCUS_71470 4715 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71470 6078 5653 gene locus_tag LOCUS_71480 6078 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71480 6588 6193 gene locus_tag LOCUS_71490 6588 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71490 7257 7027 gene locus_tag LOCUS_71500 7257 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71500 7700 7140 gene locus_tag LOCUS_71510 7700 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71510 8245 8538 gene locus_tag LOCUS_71520 8245 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71520 >Feature sequence294 631 428 gene locus_tag LOCUS_71530 631 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71530 1552 1109 gene locus_tag LOCUS_71540 1552 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71540 5328 1978 gene locus_tag LOCUS_71550 5328 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71550 7212 5836 gene locus_tag LOCUS_71560 7212 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71560 7443 7847 gene locus_tag LOCUS_71570 7443 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71570 8563 7814 gene locus_tag LOCUS_71580 8563 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71580 >Feature sequence295 757 122 gene locus_tag LOCUS_71590 757 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71590 4600 824 gene locus_tag LOCUS_71600 4600 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71600 5640 4597 gene locus_tag LOCUS_71610 5640 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71610 7055 5667 gene locus_tag LOCUS_71620 7055 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71620 7977 7072 gene locus_tag LOCUS_71630 7977 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71630 8483 7974 gene locus_tag LOCUS_71640 8483 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71640 >Feature sequence296 4397 516 gene locus_tag LOCUS_71650 4397 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71650 5275 4571 gene locus_tag LOCUS_71660 5275 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71660 6028 5405 gene locus_tag LOCUS_71670 6028 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71670 6027 6200 gene locus_tag LOCUS_71680 6027 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71680 7356 6307 gene locus_tag LOCUS_71690 7356 6307 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704143.1 protein_id gnl|my_center|LOCUS_71690 7644 8627 gene locus_tag LOCUS_71700 7644 8627 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584146.1 protein_id gnl|my_center|LOCUS_71700 >Feature sequence297 305 1495 gene locus_tag LOCUS_71710 305 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71710 1765 1532 gene locus_tag LOCUS_71720 1765 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71720 2579 2274 gene locus_tag LOCUS_71730 2579 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71730 2467 3621 gene locus_tag LOCUS_71740 2467 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71740 3672 5150 gene locus_tag LOCUS_71750 3672 5150 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731185.1 protein_id gnl|my_center|LOCUS_71750 5311 5628 gene locus_tag LOCUS_71760 5311 5628 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_71760 6229 5807 gene locus_tag LOCUS_71770 6229 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71770 6707 7771 gene locus_tag LOCUS_71780 6707 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71780 <8819 7928 gene locus_tag LOCUS_71790 <8819 7928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941334.1:hydroxylamine reductase >Feature sequence298 410 1189 gene locus_tag LOCUS_71800 410 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71800 1680 2849 gene locus_tag LOCUS_71810 1680 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71810 2939 3928 gene locus_tag LOCUS_71820 2939 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71820 4871 4635 gene locus_tag LOCUS_71830 4871 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71830 4991 4872 gene locus_tag LOCUS_71840 4991 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71840 5527 5682 gene locus_tag LOCUS_71850 5527 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71850 6180 5764 gene locus_tag LOCUS_71860 6180 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71860 6740 6297 gene locus_tag LOCUS_71870 6740 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71870 7084 7797 gene locus_tag LOCUS_71880 7084 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71880 7926 8558 gene locus_tag LOCUS_71890 7926 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71890 >Feature sequence299 1528 74 gene locus_tag LOCUS_71900 1528 74 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_71900 1861 3006 gene locus_tag LOCUS_71910 1861 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71910 2936 5209 gene locus_tag LOCUS_71920 2936 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71920 6622 5684 gene locus_tag LOCUS_71930 6622 5684 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337514.1 protein_id gnl|my_center|LOCUS_71930 8001 6685 gene locus_tag LOCUS_71940 8001 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71940 8495 8025 gene locus_tag LOCUS_71950 8495 8025 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_71950 >Feature sequence300 4238 2751 gene locus_tag LOCUS_71960 4238 2751 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_71960 7054 4262 gene locus_tag LOCUS_71970 7054 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71970 >Feature sequence301 478 1758 gene locus_tag LOCUS_71980 478 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71980 1821 3503 gene locus_tag LOCUS_71990 1821 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71990 4443 4694 gene locus_tag LOCUS_72000 4443 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72000 5005 4664 gene locus_tag LOCUS_72010 5005 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72010 5472 6437 gene locus_tag LOCUS_72020 5472 6437 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_72020 7139 7573 gene locus_tag LOCUS_72030 7139 7573 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_72030 >Feature sequence302 30 278 gene locus_tag LOCUS_72040 30 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72040 543 2501 gene locus_tag LOCUS_72050 543 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72050 2606 5284 gene locus_tag LOCUS_72060 2606 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72060 5364 6365 gene locus_tag LOCUS_72070 5364 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72070 6370 6618 gene locus_tag LOCUS_72080 6370 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72080 7154 6780 gene locus_tag LOCUS_72090 7154 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72090 7568 8140 gene locus_tag LOCUS_72100 7568 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72100 8245 8442 gene locus_tag LOCUS_72110 8245 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72110 >Feature sequence303 1018 212 gene locus_tag LOCUS_72120 1018 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72120 1459 2127 gene locus_tag LOCUS_72130 1459 2127 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_72130 2253 4970 gene locus_tag LOCUS_72140 2253 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72140 5088 7274 gene locus_tag LOCUS_72150 5088 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72150 7970 7290 gene locus_tag LOCUS_72160 7970 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72160 <8655 7967 gene locus_tag LOCUS_72170 <8655 7967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083125798.1:IS481 family transposase >Feature sequence304 1155 3938 gene locus_tag LOCUS_72180 1155 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72180 5790 4735 gene locus_tag LOCUS_72190 5790 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72190 >Feature sequence305 149 454 gene locus_tag LOCUS_72200 149 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72200 861 427 gene locus_tag LOCUS_72210 861 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72210 984 2429 gene locus_tag LOCUS_72220 gene atpD 984 2429 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_72220 2673 3119 gene locus_tag LOCUS_72230 2673 3119 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_72230 3112 3450 gene locus_tag LOCUS_72240 3112 3450 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_72240 3443 3757 gene locus_tag LOCUS_72250 3443 3757 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022409.1 protein_id gnl|my_center|LOCUS_72250 3747 4442 gene locus_tag LOCUS_72260 3747 4442 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_72260 4475 4756 gene locus_tag LOCUS_72270 4475 4756 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_72270 4760 5602 gene locus_tag LOCUS_72280 4760 5602 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_72280 5599 7152 gene locus_tag LOCUS_72290 5599 7152 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_72290 7149 8042 gene locus_tag LOCUS_72300 7149 8042 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022404.1 protein_id gnl|my_center|LOCUS_72300 >Feature sequence306 1297 1085 gene locus_tag LOCUS_72310 1297 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72310 1782 1414 gene locus_tag LOCUS_72320 1782 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72320 3510 2284 gene locus_tag LOCUS_72330 3510 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72330 5917 3650 gene locus_tag LOCUS_72340 5917 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72340 6411 5893 gene locus_tag LOCUS_72350 6411 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72350 7578 7363 gene locus_tag LOCUS_72360 7578 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72360 <8555 7644 gene locus_tag LOCUS_72370 <8555 7644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164923035.1:alpha/beta hydrolase-fold protein >Feature sequence307 1056 1301 gene locus_tag LOCUS_72380 1056 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72380 2994 1639 gene locus_tag LOCUS_72390 2994 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72390 3781 3047 gene locus_tag LOCUS_72400 3781 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72400 5146 4085 gene locus_tag LOCUS_72410 5146 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72410 6381 6121 gene locus_tag LOCUS_72420 6381 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72420 6602 6384 gene locus_tag LOCUS_72430 6602 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72430 7224 7021 gene locus_tag LOCUS_72440 7224 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72440 7902 7270 gene locus_tag LOCUS_72450 7902 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72450 8400 8182 gene locus_tag LOCUS_72460 8400 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72460 >Feature sequence308 803 66 gene locus_tag LOCUS_72470 gene cas4 803 66 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176710.1 protein_id gnl|my_center|LOCUS_72470 1762 815 gene locus_tag LOCUS_72480 gene cas7c 1762 815 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388586.1 protein_id gnl|my_center|LOCUS_72480 3749 1914 gene locus_tag LOCUS_72490 gene cas8c 3749 1914 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392033.1 protein_id gnl|my_center|LOCUS_72490 4423 3746 gene locus_tag LOCUS_72500 gene cas5c 4423 3746 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_72500 7015 4727 gene locus_tag LOCUS_72510 7015 4727 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_72510 7170 7012 gene locus_tag LOCUS_72520 7170 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72520 7985 7194 gene locus_tag LOCUS_72530 7985 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72530 >Feature sequence309 1441 2010 gene locus_tag LOCUS_72540 1441 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329453.1 protein_id gnl|my_center|LOCUS_72540 2277 5324 gene locus_tag LOCUS_72550 2277 5324 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838961.1 protein_id gnl|my_center|LOCUS_72550 5344 6216 gene locus_tag LOCUS_72560 5344 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72560 6317 6736 gene locus_tag LOCUS_72570 6317 6736 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118238.1 protein_id gnl|my_center|LOCUS_72570 >Feature sequence310 >Feature sequence311 317 2056 gene locus_tag LOCUS_72580 317 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72580 2058 3206 gene locus_tag LOCUS_72590 2058 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72590 3538 5001 gene locus_tag LOCUS_72600 3538 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72600 6463 5093 gene locus_tag LOCUS_72610 6463 5093 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921976.1 protein_id gnl|my_center|LOCUS_72610 7107 6511 gene locus_tag LOCUS_72620 7107 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72620 8102 7536 gene locus_tag LOCUS_72630 8102 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72630 >Feature sequence312 163 612 gene locus_tag LOCUS_72640 163 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72640 792 865 gene locus_tag LOCUS_t00920 792 865 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1937 1317 gene locus_tag LOCUS_72650 1937 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72650 2176 2433 gene locus_tag LOCUS_72660 2176 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72660 2476 3657 gene locus_tag LOCUS_72670 2476 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72670 5488 3662 gene locus_tag LOCUS_72680 5488 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72680 6591 5500 gene locus_tag LOCUS_72690 6591 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72690 7194 6607 gene locus_tag LOCUS_72700 7194 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72700 7900 7313 gene locus_tag LOCUS_72710 7900 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72710 >Feature sequence313 186 1787 gene locus_tag LOCUS_72720 186 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72720 1819 2799 gene locus_tag LOCUS_72730 1819 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72730 2902 4356 gene locus_tag LOCUS_72740 2902 4356 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_72740 4269 5018 gene locus_tag LOCUS_72750 4269 5018 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_72750 6321 4999 gene locus_tag LOCUS_72760 6321 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72760 6888 7208 gene locus_tag LOCUS_72770 6888 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72770 7467 7898 gene locus_tag LOCUS_72780 7467 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72780 >Feature sequence314 2315 222 gene locus_tag LOCUS_72790 2315 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72790 3236 2655 gene locus_tag LOCUS_72800 3236 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72800 6345 3289 gene locus_tag LOCUS_72810 6345 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72810 >Feature sequence315 145 309 gene locus_tag LOCUS_72820 145 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72820 1253 618 gene locus_tag LOCUS_72830 1253 618 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_72830 2066 1365 gene locus_tag LOCUS_72840 2066 1365 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_72840 2626 2138 gene locus_tag LOCUS_72850 2626 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324288.1 protein_id gnl|my_center|LOCUS_72850 5856 2647 gene locus_tag LOCUS_72860 5856 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72860 6219 6467 gene locus_tag LOCUS_72870 6219 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72870 6881 6540 gene locus_tag LOCUS_72880 6881 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72880 7004 8110 gene locus_tag LOCUS_72890 7004 8110 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_72890 >Feature sequence316 1727 213 gene locus_tag LOCUS_72900 1727 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72900 3319 1829 gene locus_tag LOCUS_72910 3319 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72910 4981 3428 gene locus_tag LOCUS_72920 4981 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72920 5597 5067 gene locus_tag LOCUS_72930 5597 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72930 6676 5654 gene locus_tag LOCUS_72940 6676 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72940 8055 6766 gene locus_tag LOCUS_72950 8055 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72950 >Feature sequence317 577 801 gene locus_tag LOCUS_72960 577 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72960 966 1862 gene locus_tag LOCUS_72970 966 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72970 1893 3836 gene locus_tag LOCUS_72980 1893 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72980 3855 5570 gene locus_tag LOCUS_72990 3855 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72990 >Feature sequence318 274 471 gene locus_tag LOCUS_73000 274 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73000 716 1435 gene locus_tag LOCUS_73010 716 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73010 1832 1428 gene locus_tag LOCUS_73020 1832 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73020 2950 2057 gene locus_tag LOCUS_73030 2950 2057 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941223.1 protein_id gnl|my_center|LOCUS_73030 3279 2947 gene locus_tag LOCUS_73040 3279 2947 CDS product IS3 family transposase ISGsu7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941222.1 protein_id gnl|my_center|LOCUS_73040 7497 3304 gene locus_tag LOCUS_73050 7497 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73050 >Feature sequence319 1826 105 gene locus_tag LOCUS_73060 1826 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73060 3553 1961 gene locus_tag LOCUS_73070 3553 1961 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_73070 3968 3822 gene locus_tag LOCUS_73080 3968 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73080 4273 3977 gene locus_tag LOCUS_73090 4273 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73090 6277 4574 gene locus_tag LOCUS_73100 gene terL 6277 4574 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939974.1 protein_id gnl|my_center|LOCUS_73100 7039 6503 gene locus_tag LOCUS_73110 7039 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73110 >Feature sequence320 451 92 gene locus_tag LOCUS_73120 451 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73120 1775 885 gene locus_tag LOCUS_73130 1775 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73130 3525 2599 gene locus_tag LOCUS_73140 3525 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73140 5822 3579 gene locus_tag LOCUS_73150 5822 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73150 6994 5855 gene locus_tag LOCUS_73160 6994 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73160 7260 7925 gene locus_tag LOCUS_73170 7260 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73170 >Feature sequence321 178 3912 gene locus_tag LOCUS_73180 178 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73180 5067 3961 gene locus_tag LOCUS_73190 5067 3961 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_73190 6062 5064 gene locus_tag LOCUS_73200 gene hflK 6062 5064 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_73200 6576 7532 gene locus_tag LOCUS_73210 6576 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73210 7800 7991 gene locus_tag LOCUS_73220 7800 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73220 >Feature sequence322 1399 1992 gene locus_tag LOCUS_73230 1399 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73230 2086 3597 gene locus_tag LOCUS_73240 2086 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73240 3629 4633 gene locus_tag LOCUS_73250 3629 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73250 4656 6440 gene locus_tag LOCUS_73260 4656 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73260 6421 6843 gene locus_tag LOCUS_73270 6421 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73270 6929 7777 gene locus_tag LOCUS_73280 6929 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73280 >Feature sequence323 <1 603 gene locus_tag LOCUS_73290 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007336412.1:ECF-type sigma factor 707 5503 gene locus_tag LOCUS_73300 707 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73300 5625 7118 gene locus_tag LOCUS_73310 5625 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73310 7558 7959 gene locus_tag LOCUS_73320 7558 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73320 >Feature sequence324 1057 668 gene locus_tag LOCUS_73330 1057 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73330 1128 1379 gene locus_tag LOCUS_73340 1128 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73340 2130 3101 gene locus_tag LOCUS_73350 2130 3101 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_73350 3584 3802 gene locus_tag LOCUS_73360 3584 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73360 3880 4098 gene locus_tag LOCUS_73370 3880 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73370 4095 4337 gene locus_tag LOCUS_73380 4095 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73380 5258 4776 gene locus_tag LOCUS_73390 5258 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73390 5714 5466 gene locus_tag LOCUS_73400 5714 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73400 5890 6747 gene locus_tag LOCUS_73410 5890 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73410 6737 7093 gene locus_tag LOCUS_73420 6737 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73420 7249 7404 gene locus_tag LOCUS_73430 7249 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73430 >Feature sequence325 <1 907 gene locus_tag LOCUS_73440 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461023.1:cell wall-binding repeat-containing protein 953 2347 gene locus_tag LOCUS_73450 953 2347 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082154.1 protein_id gnl|my_center|LOCUS_73450 2363 4627 gene locus_tag LOCUS_73460 2363 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73460 4950 7406 gene locus_tag LOCUS_73470 4950 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73470 >Feature sequence326 768 1511 gene locus_tag LOCUS_73480 768 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73480 1607 1804 gene locus_tag LOCUS_73490 1607 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73490 1801 5391 gene locus_tag LOCUS_73500 1801 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73500 5388 7898 gene locus_tag LOCUS_73510 5388 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73510 >Feature sequence327 2947 155 gene locus_tag LOCUS_73520 2947 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73520 4603 3116 gene locus_tag LOCUS_73530 gene pap 4603 3116 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_73530 6023 4983 gene locus_tag LOCUS_73540 6023 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73540 <7714 6051 gene locus_tag LOCUS_73550 <7714 6051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922120.1:DUF1559 domain-containing protein >Feature sequence328 391 1143 gene locus_tag LOCUS_73560 391 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73560 1056 3092 gene locus_tag LOCUS_73570 1056 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73570 4195 3125 gene locus_tag LOCUS_73580 4195 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73580 4605 5762 gene locus_tag LOCUS_73590 4605 5762 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_73590 5766 7106 gene locus_tag LOCUS_73600 5766 7106 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_73600 >Feature sequence329 121 1578 gene locus_tag LOCUS_73610 121 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73610 2034 1540 gene locus_tag LOCUS_73620 2034 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73620 2990 2208 gene locus_tag LOCUS_73630 2990 2208 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_73630 4613 3075 gene locus_tag LOCUS_73640 4613 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73640 <7663 4648 gene locus_tag LOCUS_73650 <7663 4648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666716.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence330 2585 1557 gene locus_tag LOCUS_73660 2585 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73660 4474 2582 gene locus_tag LOCUS_73670 4474 2582 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100037.1 protein_id gnl|my_center|LOCUS_73670 5135 5284 gene locus_tag LOCUS_73680 5135 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73680 5310 5489 gene locus_tag LOCUS_73690 5310 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73690 5486 5695 gene locus_tag LOCUS_73700 5486 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73700 6116 5700 gene locus_tag LOCUS_73710 6116 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73710 6409 6116 gene locus_tag LOCUS_73720 6409 6116 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_73720 >Feature sequence331 3836 1950 gene locus_tag LOCUS_73730 3836 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73730 4177 5832 gene locus_tag LOCUS_73740 4177 5832 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921354.1 protein_id gnl|my_center|LOCUS_73740 6446 5934 gene locus_tag LOCUS_73750 6446 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616149.1 protein_id gnl|my_center|LOCUS_73750 <7439 6476 gene locus_tag LOCUS_73760 <7439 6476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338728.1:DUF1559 domain-containing protein >Feature sequence332 1311 955 gene locus_tag LOCUS_73770 1311 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73770 2134 1301 gene locus_tag LOCUS_73780 2134 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73780 2545 2333 gene locus_tag LOCUS_73790 2545 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73790 4117 3200 gene locus_tag LOCUS_73800 4117 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73800 4926 4117 gene locus_tag LOCUS_73810 4926 4117 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870446.1 protein_id gnl|my_center|LOCUS_73810 5219 6577 gene locus_tag LOCUS_73820 5219 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73820 7128 6775 gene locus_tag LOCUS_73830 7128 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73830 >Feature sequence333 812 393 gene locus_tag LOCUS_73840 812 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73840 1199 975 gene locus_tag LOCUS_73850 1199 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73850 1110 1598 gene locus_tag LOCUS_73860 1110 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73860 1598 1888 gene locus_tag LOCUS_73870 1598 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73870 1854 2297 gene locus_tag LOCUS_73880 1854 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73880 2294 4213 gene locus_tag LOCUS_73890 2294 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73890 4686 4943 gene locus_tag LOCUS_73900 4686 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73900 5352 4963 gene locus_tag LOCUS_73910 gene crcB 5352 4963 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227866.1 protein_id gnl|my_center|LOCUS_73910 6061 5549 gene locus_tag LOCUS_73920 6061 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73920 7188 6061 gene locus_tag LOCUS_73930 7188 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73930 >Feature sequence334 826 104 gene locus_tag LOCUS_73940 gene istB 826 104 CDS product IS21-like element ISBj11 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018270204.1 protein_id gnl|my_center|LOCUS_73940 1410 2075 gene locus_tag LOCUS_73950 1410 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73950 3432 3614 gene locus_tag LOCUS_73960 3432 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73960 4189 3530 gene locus_tag LOCUS_73970 4189 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73970 4867 4310 gene locus_tag LOCUS_73980 4867 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73980 5444 6721 gene locus_tag LOCUS_73990 5444 6721 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_73990 >Feature sequence335 4526 3042 gene locus_tag LOCUS_74000 4526 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74000 5113 4592 gene locus_tag LOCUS_74010 5113 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74010 6234 5272 gene locus_tag LOCUS_74020 gene dapA 6234 5272 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229186.1 protein_id gnl|my_center|LOCUS_74020 6497 6691 gene locus_tag LOCUS_74030 6497 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74030 >Feature sequence336 1344 2174 gene locus_tag LOCUS_74040 1344 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74040 2171 2674 gene locus_tag LOCUS_74050 2171 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74050 3067 2750 gene locus_tag LOCUS_74060 3067 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74060 5022 3916 gene locus_tag LOCUS_74070 5022 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74070 5471 5178 gene locus_tag LOCUS_74080 5471 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74080 5757 5999 gene locus_tag LOCUS_74090 5757 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74090 >Feature sequence337 418 657 gene locus_tag LOCUS_74100 418 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74100 1238 981 gene locus_tag LOCUS_74110 1238 981 CDS product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439502.1 protein_id gnl|my_center|LOCUS_74110 1817 1311 gene locus_tag LOCUS_74120 1817 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74120 1950 2609 gene locus_tag LOCUS_74130 1950 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74130 2606 2998 gene locus_tag LOCUS_74140 2606 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74140 2934 3836 gene locus_tag LOCUS_74150 2934 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74150 5847 4483 gene locus_tag LOCUS_74160 5847 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399369.1 protein_id gnl|my_center|LOCUS_74160 7008 6490 gene locus_tag LOCUS_74170 7008 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74170 >Feature sequence338 308 466 gene locus_tag LOCUS_74180 308 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74180 1983 1450 gene locus_tag LOCUS_74190 1983 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74190 2190 1999 gene locus_tag LOCUS_74200 2190 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74200 2893 2579 gene locus_tag LOCUS_74210 2893 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74210 4344 2956 gene locus_tag LOCUS_74220 4344 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74220 5998 4367 gene locus_tag LOCUS_74230 5998 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74230 6354 6148 gene locus_tag LOCUS_74240 6354 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74240 6982 6449 gene locus_tag LOCUS_74250 6982 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74250 >Feature sequence339 1091 66 gene locus_tag LOCUS_74260 1091 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74260 1228 2778 gene locus_tag LOCUS_74270 gene gguA 1228 2778 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992366.1 protein_id gnl|my_center|LOCUS_74270 2779 4122 gene locus_tag LOCUS_74280 2779 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74280 4230 5213 gene locus_tag LOCUS_74290 4230 5213 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061699.1 protein_id gnl|my_center|LOCUS_74290 >Feature sequence340 586 248 gene locus_tag LOCUS_74300 586 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74300 946 1146 gene locus_tag LOCUS_74310 946 1146 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870234.1 protein_id gnl|my_center|LOCUS_74310 1143 2063 gene locus_tag LOCUS_74320 1143 2063 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_74320 2593 3954 gene locus_tag LOCUS_74330 2593 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74330 5070 4150 gene locus_tag LOCUS_74340 5070 4150 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_74340 5323 5952 gene locus_tag LOCUS_74350 5323 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74350 6074 6949 gene locus_tag LOCUS_74360 6074 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74360 >Feature sequence341 628 347 gene locus_tag LOCUS_74370 628 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74370 3789 1897 gene locus_tag LOCUS_74380 3789 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74380 4795 3797 gene locus_tag LOCUS_74390 gene purR 4795 3797 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660510.1 protein_id gnl|my_center|LOCUS_74390 4995 5942 gene locus_tag LOCUS_74400 4995 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74400 >Feature sequence342 1796 846 gene locus_tag LOCUS_74410 1796 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74410 2694 1789 gene locus_tag LOCUS_74420 2694 1789 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_74420 2950 3408 gene locus_tag LOCUS_74430 2950 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74430 3444 4607 gene locus_tag LOCUS_74440 3444 4607 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_74440 4849 6177 gene locus_tag LOCUS_74450 4849 6177 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259620.1 protein_id gnl|my_center|LOCUS_74450 <7004 6408 gene locus_tag LOCUS_74460 <7004 6408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326690.1:beta-ketoacyl-[acyl-carrier-protein] synthase family protein >Feature sequence343 1698 325 gene locus_tag LOCUS_74470 1698 325 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100955.1 protein_id gnl|my_center|LOCUS_74470 2058 2537 gene locus_tag LOCUS_74480 2058 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74480 2846 3049 gene locus_tag LOCUS_74490 2846 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74490 2985 3413 gene locus_tag LOCUS_74500 2985 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74500 4086 3553 gene locus_tag LOCUS_74510 4086 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74510 4704 4144 gene locus_tag LOCUS_74520 4704 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74520 4943 4710 gene locus_tag LOCUS_74530 4943 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74530 6515 5088 gene locus_tag LOCUS_74540 6515 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74540 >Feature sequence344 721 365 gene locus_tag LOCUS_74550 721 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74550 3580 752 gene locus_tag LOCUS_74560 3580 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74560 5691 3610 gene locus_tag LOCUS_74570 5691 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74570 >Feature sequence345 <1 312 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcggcgacgtcgccgaccaagtgatcaactgacac 831 355 gene locus_tag LOCUS_74580 831 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_74580 1218 841 gene locus_tag LOCUS_74590 1218 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_74590 2057 1248 gene locus_tag LOCUS_74600 2057 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74600 2822 2154 gene locus_tag LOCUS_74610 2822 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74610 5804 2835 gene locus_tag LOCUS_74620 5804 2835 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_74620 6315 6001 gene locus_tag LOCUS_74630 6315 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74630 6540 6466 gene locus_tag LOCUS_t00930 6540 6466 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence346 694 975 gene locus_tag LOCUS_74640 694 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74640 1138 2988 gene locus_tag LOCUS_74650 1138 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74650 3083 3361 gene locus_tag LOCUS_74660 3083 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74660 4441 3332 gene locus_tag LOCUS_74670 4441 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74670 5061 4438 gene locus_tag LOCUS_74680 5061 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74680 5480 5764 gene locus_tag LOCUS_74690 5480 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74690 5761 6624 gene locus_tag LOCUS_74700 5761 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_74700 >Feature sequence347 3929 1338 gene locus_tag LOCUS_74710 3929 1338 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942750.1 protein_id gnl|my_center|LOCUS_74710 5032 3926 gene locus_tag LOCUS_74720 5032 3926 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435274.1 protein_id gnl|my_center|LOCUS_74720 6314 5064 gene locus_tag LOCUS_74730 6314 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74730 >Feature sequence348 188 1027 gene locus_tag LOCUS_74740 188 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74740 1371 1120 gene locus_tag LOCUS_74750 1371 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74750 2029 2562 gene locus_tag LOCUS_74760 2029 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74760 2704 3954 gene locus_tag LOCUS_74770 2704 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74770 3961 4269 gene locus_tag LOCUS_74780 3961 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74780 4290 4562 gene locus_tag LOCUS_74790 4290 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74790 4777 5787 gene locus_tag LOCUS_74800 4777 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74800 5838 6146 gene locus_tag LOCUS_74810 5838 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74810 >Feature sequence349 1596 4199 gene locus_tag LOCUS_74820 1596 4199 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_74820 4863 4612 gene locus_tag LOCUS_74830 4863 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74830 6644 4989 gene locus_tag LOCUS_74840 6644 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74840 >Feature sequence350 >Feature sequence351 1241 123 gene locus_tag LOCUS_74850 1241 123 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325404.1 protein_id gnl|my_center|LOCUS_74850 1952 2434 gene locus_tag LOCUS_74860 1952 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74860 2782 3234 gene locus_tag LOCUS_74870 2782 3234 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868963.1 protein_id gnl|my_center|LOCUS_74870 3477 4286 gene locus_tag LOCUS_74880 3477 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74880 4388 5341 gene locus_tag LOCUS_74890 gene cysK 4388 5341 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324150.1 protein_id gnl|my_center|LOCUS_74890 5375 5596 gene locus_tag LOCUS_74900 5375 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74900 5938 5708 gene locus_tag LOCUS_74910 5938 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74910 >Feature sequence352 1021 1173 gene locus_tag LOCUS_74920 1021 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74920 1538 2857 gene locus_tag LOCUS_74930 1538 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74930 2989 3291 gene locus_tag LOCUS_74940 2989 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74940 4457 3942 gene locus_tag LOCUS_74950 4457 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74950 4657 5832 gene locus_tag LOCUS_74960 4657 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74960 >Feature sequence353 474 749 gene locus_tag LOCUS_74970 474 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74970 1219 761 gene locus_tag LOCUS_74980 1219 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74980 2465 1314 gene locus_tag LOCUS_74990 2465 1314 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615454.1 protein_id gnl|my_center|LOCUS_74990 5643 3781 gene locus_tag LOCUS_75000 5643 3781 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922133.1 protein_id gnl|my_center|LOCUS_75000 6346 5690 gene locus_tag LOCUS_75010 6346 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75010 >Feature sequence354 25 938 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgacgacgtgcctcgacgacgagaggattgaaac 1042 2730 gene locus_tag LOCUS_75020 1042 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75020 2723 3703 gene locus_tag LOCUS_75030 2723 3703 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155366946.1 protein_id gnl|my_center|LOCUS_75030 3669 4007 gene locus_tag LOCUS_75040 3669 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75040 4007 4708 gene locus_tag LOCUS_75050 4007 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75050 4925 5491 gene locus_tag LOCUS_75060 4925 5491 CDS product 2-thiouracil desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393556.1 protein_id gnl|my_center|LOCUS_75060 6024 5524 gene locus_tag LOCUS_75070 6024 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75070 >Feature sequence355 <1 1529 gene locus_tag LOCUS_75080 <1 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:Calx-beta domain-containing protein 2267 4561 gene locus_tag LOCUS_75090 2267 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75090 6254 4899 gene locus_tag LOCUS_75100 6254 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75100 >Feature sequence356 91 1185 gene locus_tag LOCUS_75110 91 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75110 1247 2455 gene locus_tag LOCUS_75120 1247 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75120 3350 3550 gene locus_tag LOCUS_75130 3350 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75130 3565 4092 gene locus_tag LOCUS_75140 3565 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75140 4165 4386 gene locus_tag LOCUS_75150 4165 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75150 4962 4540 gene locus_tag LOCUS_75160 4962 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75160 >Feature sequence357 499 1980 gene locus_tag LOCUS_75170 499 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75170 1980 2759 gene locus_tag LOCUS_75180 1980 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75180 2798 5689 gene locus_tag LOCUS_75190 2798 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75190 >Feature sequence358 1118 141 gene locus_tag LOCUS_75200 1118 141 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269390.1 protein_id gnl|my_center|LOCUS_75200 1684 2373 gene locus_tag LOCUS_75210 1684 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75210 2377 3408 gene locus_tag LOCUS_75220 2377 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75220 3405 4613 gene locus_tag LOCUS_75230 gene nrfD 3405 4613 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_75230 4724 6229 gene locus_tag LOCUS_75240 4724 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75240 >Feature sequence359 1198 1800 gene locus_tag LOCUS_75250 1198 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75250 2019 1828 gene locus_tag LOCUS_75260 2019 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75260 2387 2016 gene locus_tag LOCUS_75270 2387 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75270 3024 2440 gene locus_tag LOCUS_75280 3024 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75280 3938 3321 gene locus_tag LOCUS_75290 3938 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75290 5276 5488 gene locus_tag LOCUS_75300 5276 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75300 >Feature sequence360 762 424 gene locus_tag LOCUS_75310 762 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75310 1018 1215 gene locus_tag LOCUS_75320 1018 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_75320 1269 1784 gene locus_tag LOCUS_75330 1269 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_75330 >Feature sequence361 1724 366 gene locus_tag LOCUS_75340 1724 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_75340 5708 1782 gene locus_tag LOCUS_75350 5708 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75350 >Feature sequence362 1396 302 gene locus_tag LOCUS_75360 1396 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75360 3391 1535 gene locus_tag LOCUS_75370 3391 1535 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_75370 >Feature sequence363 209 1120 gene locus_tag LOCUS_75380 gene galU 209 1120 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881105.1 protein_id gnl|my_center|LOCUS_75380 1117 2130 gene locus_tag LOCUS_75390 1117 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75390 <6121 2254 gene locus_tag LOCUS_75400 <6121 2254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein >Feature sequence364 2768 3727 gene locus_tag LOCUS_75410 2768 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_75410 4448 4684 gene locus_tag LOCUS_75420 4448 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75420 4697 4942 gene locus_tag LOCUS_75430 4697 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75430 5017 5538 gene locus_tag LOCUS_75440 5017 5538 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_75440 >Feature sequence365 525 863 gene locus_tag LOCUS_75450 525 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75450 976 1851 gene locus_tag LOCUS_75460 976 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75460 1863 2174 gene locus_tag LOCUS_75470 1863 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75470 2420 2602 gene locus_tag LOCUS_75480 2420 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75480 2686 4110 gene locus_tag LOCUS_75490 2686 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75490 4206 4781 gene locus_tag LOCUS_75500 4206 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75500 4778 5611 gene locus_tag LOCUS_75510 4778 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75510 >Feature sequence366 307 501 gene locus_tag LOCUS_75520 307 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75520 511 4659 gene locus_tag LOCUS_75530 511 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75530 4656 5582 gene locus_tag LOCUS_75540 4656 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75540 >Feature sequence367 321 626 gene locus_tag LOCUS_75550 321 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75550 2770 686 gene locus_tag LOCUS_75560 2770 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75560 >Feature sequence368 929 255 gene locus_tag LOCUS_75570 929 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75570 1141 1872 gene locus_tag LOCUS_75580 1141 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75580 1960 2139 gene locus_tag LOCUS_75590 1960 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75590 2126 2344 gene locus_tag LOCUS_75600 2126 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75600 2341 3657 gene locus_tag LOCUS_75610 2341 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75610 3654 3968 gene locus_tag LOCUS_75620 3654 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75620 4000 4263 gene locus_tag LOCUS_75630 4000 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75630 4362 4589 gene locus_tag LOCUS_75640 4362 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75640 4616 5938 gene locus_tag LOCUS_75650 4616 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75650 5957 5870 gene locus_tag LOCUS_t00940 5957 5870 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence369 1213 992 gene locus_tag LOCUS_75660 1213 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75660 3221 1233 gene locus_tag LOCUS_75670 3221 1233 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225268.1 protein_id gnl|my_center|LOCUS_75670 3986 3540 gene locus_tag LOCUS_75680 3986 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75680 4171 3983 gene locus_tag LOCUS_75690 4171 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75690 4171 4425 gene locus_tag LOCUS_75700 4171 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75700 4583 5350 gene locus_tag LOCUS_75710 4583 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75710 >Feature sequence370 <1 1606 gene locus_tag LOCUS_75720 <1 1606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387995.1:DEAD/DEAH box helicase family protein note possible pseudo, frameshifted 1488 2849 gene locus_tag LOCUS_75730 1488 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_75730 2850 3188 gene locus_tag LOCUS_75740 2850 3188 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142925.1 protein_id gnl|my_center|LOCUS_75740 3404 4507 gene locus_tag LOCUS_75750 3404 4507 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142948.1 protein_id gnl|my_center|LOCUS_75750 4626 5282 gene locus_tag LOCUS_75760 4626 5282 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142947.1 protein_id gnl|my_center|LOCUS_75760 >Feature sequence371 2432 1764 gene locus_tag LOCUS_75770 2432 1764 CDS product DUF3780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117920.1 protein_id gnl|my_center|LOCUS_75770 5514 2437 gene locus_tag LOCUS_75780 5514 2437 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117919.1 protein_id gnl|my_center|LOCUS_75780 5741 5538 gene locus_tag LOCUS_75790 5741 5538 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459051.1 protein_id gnl|my_center|LOCUS_75790 >Feature sequence372 600 298 gene locus_tag LOCUS_75800 600 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75800 4952 630 gene locus_tag LOCUS_75810 4952 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75810 5843 5370 gene locus_tag LOCUS_75820 5843 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75820 >Feature sequence373 101 874 gene locus_tag LOCUS_75830 101 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75830 871 1920 gene locus_tag LOCUS_75840 871 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75840 1943 4234 gene locus_tag LOCUS_75850 1943 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75850 4250 5689 gene locus_tag LOCUS_75860 4250 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75860 >Feature sequence374 1447 386 gene locus_tag LOCUS_75870 1447 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75870 2128 1535 gene locus_tag LOCUS_75880 2128 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75880 2373 2107 gene locus_tag LOCUS_75890 2373 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75890 2278 2475 gene locus_tag LOCUS_75900 2278 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75900 4070 4861 gene locus_tag LOCUS_75910 4070 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75910 4858 5475 gene locus_tag LOCUS_75920 4858 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75920 >Feature sequence375 <1 736 gene locus_tag LOCUS_75930 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010927303.1:asparagine synthase (glutamine-hydrolyzing) 733 1938 gene locus_tag LOCUS_75940 733 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75940 1992 2294 gene locus_tag LOCUS_75950 1992 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75950 2287 2994 gene locus_tag LOCUS_75960 2287 2994 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 protein_id gnl|my_center|LOCUS_75960 2991 4043 gene locus_tag LOCUS_75970 2991 4043 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667998.1 protein_id gnl|my_center|LOCUS_75970 4051 4761 gene locus_tag LOCUS_75980 4051 4761 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088734.1 protein_id gnl|my_center|LOCUS_75980 >Feature sequence376 1613 66 gene locus_tag LOCUS_75990 1613 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75990 2951 1692 gene locus_tag LOCUS_76000 gene wecB 2951 1692 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942883.1 protein_id gnl|my_center|LOCUS_76000 4274 2991 gene locus_tag LOCUS_76010 4274 2991 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_76010 4920 4357 gene locus_tag LOCUS_76020 4920 4357 CDS product transcription termination/antitermination NusG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327462.1 protein_id gnl|my_center|LOCUS_76020 >Feature sequence377 1399 890 gene locus_tag LOCUS_76030 1399 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76030 3107 1602 gene locus_tag LOCUS_76040 3107 1602 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921354.1 protein_id gnl|my_center|LOCUS_76040 3477 5291 gene locus_tag LOCUS_76050 3477 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76050 >Feature sequence378 1483 62 gene locus_tag LOCUS_76060 1483 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76060 3583 1520 gene locus_tag LOCUS_76070 3583 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76070 5671 3623 gene locus_tag LOCUS_76080 5671 3623 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_76080 >Feature sequence379 >Feature sequence380 620 1930 gene locus_tag LOCUS_76090 620 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76090 2078 4474 gene locus_tag LOCUS_76100 2078 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76100 5024 5100 gene locus_tag LOCUS_t00950 5024 5100 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence381 2452 836 gene locus_tag LOCUS_76110 gene terL 2452 836 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939974.1 protein_id gnl|my_center|LOCUS_76110 2921 2439 gene locus_tag LOCUS_76120 2921 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76120 4020 2899 gene locus_tag LOCUS_76130 4020 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76130 4609 4052 gene locus_tag LOCUS_76140 4609 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76140 4888 4634 gene locus_tag LOCUS_76150 4888 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76150 5424 5062 gene locus_tag LOCUS_76160 5424 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76160 >Feature sequence382 3120 4211 gene locus_tag LOCUS_76170 3120 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76170 4873 4334 gene locus_tag LOCUS_76180 4873 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76180 >Feature sequence383 306 1727 gene locus_tag LOCUS_76190 306 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76190 1843 2409 gene locus_tag LOCUS_76200 1843 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76200 2500 2730 gene locus_tag LOCUS_76210 2500 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76210 2720 2968 gene locus_tag LOCUS_76220 2720 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76220 3020 3835 gene locus_tag LOCUS_76230 3020 3835 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104945.1 protein_id gnl|my_center|LOCUS_76230 3756 4634 gene locus_tag LOCUS_76240 3756 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76240 5205 5366 gene locus_tag LOCUS_76250 5205 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76250 >Feature sequence384 1393 257 gene locus_tag LOCUS_76260 1393 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76260 2562 1390 gene locus_tag LOCUS_76270 gene cas7e 2562 1390 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227612.1 protein_id gnl|my_center|LOCUS_76270 3254 2559 gene locus_tag LOCUS_76280 3254 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76280 5047 3251 gene locus_tag LOCUS_76290 5047 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76290 >Feature sequence385 494 1141 gene locus_tag LOCUS_76300 494 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76300 1253 4972 gene locus_tag LOCUS_76310 1253 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76310 5292 5119 gene locus_tag LOCUS_76320 5292 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76320 >Feature sequence386 3671 273 gene locus_tag LOCUS_76330 3671 273 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389847.1 protein_id gnl|my_center|LOCUS_76330 4983 3673 gene locus_tag LOCUS_76340 4983 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76340 >Feature sequence387 >Feature sequence388 3286 1310 gene locus_tag LOCUS_76350 3286 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76350 3627 3929 gene locus_tag LOCUS_76360 3627 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76360 3886 5073 gene locus_tag LOCUS_76370 3886 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76370 >Feature sequence389 1108 1935 gene locus_tag LOCUS_76380 1108 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_76380 1940 2503 gene locus_tag LOCUS_76390 1940 2503 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_76390 >Feature sequence390 195 479 gene locus_tag LOCUS_76400 195 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_76400 689 1000 gene locus_tag LOCUS_76410 689 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76410 1004 1222 gene locus_tag LOCUS_76420 1004 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76420 1543 3969 gene locus_tag LOCUS_76430 1543 3969 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879160.1 protein_id gnl|my_center|LOCUS_76430 4037 4999 gene locus_tag LOCUS_76440 4037 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76440 >Feature sequence391 99 362 gene locus_tag LOCUS_76450 99 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76450 2397 820 gene locus_tag LOCUS_76460 2397 820 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_76460 3091 2450 gene locus_tag LOCUS_76470 3091 2450 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123567.1 protein_id gnl|my_center|LOCUS_76470 <5186 3833 gene locus_tag LOCUS_76480 <5186 3833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein >Feature sequence392 793 317 gene locus_tag LOCUS_76490 793 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76490 2851 1310 gene locus_tag LOCUS_76500 2851 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76500 4912 2987 gene locus_tag LOCUS_76510 4912 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76510 >Feature sequence393 518 207 gene locus_tag LOCUS_76520 518 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76520 553 1167 gene locus_tag LOCUS_76530 gene sigE 553 1167 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855001.1 protein_id gnl|my_center|LOCUS_76530 1183 5046 gene locus_tag LOCUS_76540 1183 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76540 >Feature sequence394 489 1130 gene locus_tag LOCUS_76550 489 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76550 1167 1316 gene locus_tag LOCUS_76560 1167 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76560 1430 1726 gene locus_tag LOCUS_76570 1430 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76570 1996 2202 gene locus_tag LOCUS_76580 1996 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76580 2202 2618 gene locus_tag LOCUS_76590 2202 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76590 3228 2881 gene locus_tag LOCUS_76600 3228 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76600 4510 3404 gene locus_tag LOCUS_76610 4510 3404 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226897.1 protein_id gnl|my_center|LOCUS_76610 >Feature sequence395 1180 1923 gene locus_tag LOCUS_76620 1180 1923 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_76620 3360 1951 gene locus_tag LOCUS_76630 3360 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_76630 4514 3558 gene locus_tag LOCUS_76640 gene dusB 4514 3558 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035999.1 protein_id gnl|my_center|LOCUS_76640 >Feature sequence396 206 679 gene locus_tag LOCUS_76650 206 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76650 884 693 gene locus_tag LOCUS_76660 884 693 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327487.1 protein_id gnl|my_center|LOCUS_76660 1179 1469 gene locus_tag LOCUS_76670 1179 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76670 1793 2845 gene locus_tag LOCUS_76680 1793 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76680 3250 4407 gene locus_tag LOCUS_76690 3250 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76690 >Feature sequence397 3120 88 gene locus_tag LOCUS_76700 3120 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76700 5083 4358 gene locus_tag LOCUS_76710 5083 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76710 >Feature sequence398 130 516 gene locus_tag LOCUS_76720 130 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76720 504 1778 gene locus_tag LOCUS_76730 504 1778 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065206.1 protein_id gnl|my_center|LOCUS_76730 1989 2336 gene locus_tag LOCUS_76740 1989 2336 CDS product STAS-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928718.1 protein_id gnl|my_center|LOCUS_76740 2715 2392 gene locus_tag LOCUS_76750 2715 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76750 2748 3251 gene locus_tag LOCUS_76760 2748 3251 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615364.1 protein_id gnl|my_center|LOCUS_76760 3807 3508 gene locus_tag LOCUS_76770 3807 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76770 4360 3860 gene locus_tag LOCUS_76780 4360 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76780 4552 5076 gene locus_tag LOCUS_76790 4552 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76790 >Feature sequence399 <1 1109 gene locus_tag LOCUS_76800 <1 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120669.1:VWA domain-containing protein 1753 1202 gene locus_tag LOCUS_76810 1753 1202 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_76810 2027 2527 gene locus_tag LOCUS_76820 2027 2527 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326693.1 protein_id gnl|my_center|LOCUS_76820 2581 3333 gene locus_tag LOCUS_76830 gene fabG 2581 3333 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402833.1 protein_id gnl|my_center|LOCUS_76830 3389 3781 gene locus_tag LOCUS_76840 3389 3781 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326692.1 protein_id gnl|my_center|LOCUS_76840 3822 4406 gene locus_tag LOCUS_76850 3822 4406 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326691.1 protein_id gnl|my_center|LOCUS_76850 >Feature sequence400 582 340 gene locus_tag LOCUS_76860 582 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76860 847 2619 gene locus_tag LOCUS_76870 847 2619 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922207.1 protein_id gnl|my_center|LOCUS_76870 4006 3044 gene locus_tag LOCUS_76880 4006 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76880 4447 4193 gene locus_tag LOCUS_76890 4447 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76890 >Feature sequence401 327 127 gene locus_tag LOCUS_76900 327 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76900 227 1087 gene locus_tag LOCUS_76910 227 1087 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921506.1 protein_id gnl|my_center|LOCUS_76910 2116 1097 gene locus_tag LOCUS_76920 2116 1097 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061140.1 protein_id gnl|my_center|LOCUS_76920 3448 2537 gene locus_tag LOCUS_76930 3448 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76930 >Feature sequence402 2572 557 gene locus_tag LOCUS_76940 2572 557 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921450.1 protein_id gnl|my_center|LOCUS_76940 3014 5014 gene locus_tag LOCUS_76950 3014 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76950 >Feature sequence403 858 1844 gene locus_tag LOCUS_76960 858 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76960 2905 1856 gene locus_tag LOCUS_76970 2905 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76970 3955 2936 gene locus_tag LOCUS_76980 3955 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76980 4122 4760 gene locus_tag LOCUS_76990 4122 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76990 >Feature sequence404 <1 528 gene locus_tag LOCUS_77000 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082599.1:cephalosporin-C deacetylase 937 2673 gene locus_tag LOCUS_77010 937 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77010 3254 2784 gene locus_tag LOCUS_77020 3254 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77020 4347 3337 gene locus_tag LOCUS_77030 4347 3337 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_77030 4645 4848 gene locus_tag LOCUS_77040 4645 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77040 >Feature sequence405 386 1150 gene locus_tag LOCUS_77050 386 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77050 1586 1170 gene locus_tag LOCUS_77060 1586 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77060 1552 1800 gene locus_tag LOCUS_77070 1552 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77070 2749 1778 gene locus_tag LOCUS_77080 2749 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77080 3662 2856 gene locus_tag LOCUS_77090 3662 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77090 4786 3662 gene locus_tag LOCUS_77100 4786 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77100 >Feature sequence406 1473 853 gene locus_tag LOCUS_77110 1473 853 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_77110 4523 1599 gene locus_tag LOCUS_77120 4523 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77120 >Feature sequence407 1507 425 gene locus_tag LOCUS_77130 1507 425 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122024.1 protein_id gnl|my_center|LOCUS_77130 2302 1655 gene locus_tag LOCUS_77140 2302 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77140 2589 3863 gene locus_tag LOCUS_77150 2589 3863 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329509.1 protein_id gnl|my_center|LOCUS_77150 >Feature sequence408 3 1016 gene locus_tag LOCUS_77160 3 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77160 1425 1625 gene locus_tag LOCUS_77170 1425 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77170 3827 1980 gene locus_tag LOCUS_77180 3827 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77180 4808 4230 gene locus_tag LOCUS_77190 4808 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77190 >Feature sequence409 1612 263 gene locus_tag LOCUS_77200 1612 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77200 3054 1687 gene locus_tag LOCUS_77210 3054 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77210 4447 3116 gene locus_tag LOCUS_77220 4447 3116 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_77220 >Feature sequence410 177 374 gene locus_tag LOCUS_77230 177 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77230 894 4829 gene locus_tag LOCUS_77240 894 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77240 >Feature sequence411 360 124 gene locus_tag LOCUS_77250 360 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77250 1504 467 gene locus_tag LOCUS_77260 1504 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77260 1980 1777 gene locus_tag LOCUS_77270 1980 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77270 2607 2086 gene locus_tag LOCUS_77280 2607 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77280 3763 2888 gene locus_tag LOCUS_77290 3763 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77290 4317 3955 gene locus_tag LOCUS_77300 4317 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77300 4650 4387 gene locus_tag LOCUS_77310 4650 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77310 >Feature sequence412 455 141 gene locus_tag LOCUS_77320 455 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77320 841 470 gene locus_tag LOCUS_77330 841 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77330 1376 1140 gene locus_tag LOCUS_77340 1376 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77340 1825 1373 gene locus_tag LOCUS_77350 1825 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77350 2136 1825 gene locus_tag LOCUS_77360 2136 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77360 2397 3134 gene locus_tag LOCUS_77370 2397 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77370 3139 3822 gene locus_tag LOCUS_77380 3139 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77380 3806 4681 gene locus_tag LOCUS_77390 3806 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77390 >Feature sequence413 1364 150 gene locus_tag LOCUS_77400 1364 150 CDS product IS701-like element ISRba4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921909.1 protein_id gnl|my_center|LOCUS_77400 2273 1737 gene locus_tag LOCUS_77410 2273 1737 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 protein_id gnl|my_center|LOCUS_77410 2568 3389 gene locus_tag LOCUS_77420 2568 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77420 >Feature sequence414 253 534 gene locus_tag LOCUS_77430 253 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77430 566 2215 gene locus_tag LOCUS_77440 566 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77440 2299 2475 gene locus_tag LOCUS_77450 2299 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77450 2489 3919 gene locus_tag LOCUS_77460 2489 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77460 3969 4589 gene locus_tag LOCUS_77470 3969 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77470 4608 4820 gene locus_tag LOCUS_77480 4608 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77480 >Feature sequence415 784 2088 gene locus_tag LOCUS_77490 784 2088 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_77490 2446 3882 gene locus_tag LOCUS_77500 2446 3882 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_77500 <4834 3958 gene locus_tag LOCUS_77510 <4834 3958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053061013.1:neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein >Feature sequence416 4153 713 gene locus_tag LOCUS_77520 4153 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77520 >Feature sequence417 1283 708 gene locus_tag LOCUS_77530 1283 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77530 1293 1481 gene locus_tag LOCUS_77540 1293 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77540 2010 2204 gene locus_tag LOCUS_77550 2010 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77550 <4790 3716 gene locus_tag LOCUS_77560 <4790 3716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024691572.1:tyrosine-type recombinase/integrase >Feature sequence418 400 86 gene locus_tag LOCUS_77570 400 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77570 1165 428 gene locus_tag LOCUS_77580 1165 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77580 1959 1162 gene locus_tag LOCUS_77590 1959 1162 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_77590 3476 1959 gene locus_tag LOCUS_77600 3476 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77600 >Feature sequence419 716 1321 gene locus_tag LOCUS_77610 716 1321 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722329.1 protein_id gnl|my_center|LOCUS_77610 1318 1812 gene locus_tag LOCUS_77620 gene nuoE 1318 1812 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_77620 1892 3781 gene locus_tag LOCUS_77630 gene nuoF 1892 3781 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_77630 >Feature sequence420 750 157 gene locus_tag LOCUS_77640 750 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77640 1477 734 gene locus_tag LOCUS_77650 1477 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77650 1942 2136 gene locus_tag LOCUS_77660 1942 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77660 3145 2123 gene locus_tag LOCUS_77670 3145 2123 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014665.1 protein_id gnl|my_center|LOCUS_77670 4259 3159 gene locus_tag LOCUS_77680 4259 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77680 >Feature sequence421 1936 1121 gene locus_tag LOCUS_77690 1936 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77690 2447 3379 gene locus_tag LOCUS_77700 2447 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77700 4198 3971 gene locus_tag LOCUS_77710 4198 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77710 >Feature sequence422 <1 1339 gene locus_tag LOCUS_77720 <1 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106518184.1:alpha/beta hydrolase 1395 1577 gene locus_tag LOCUS_77730 1395 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77730 1574 3208 gene locus_tag LOCUS_77740 1574 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77740 3499 3672 gene locus_tag LOCUS_77750 3499 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77750 3943 3773 gene locus_tag LOCUS_77760 3943 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77760 >Feature sequence423 478 161 gene locus_tag LOCUS_77770 gene sugE 478 161 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123025.1 protein_id gnl|my_center|LOCUS_77770 3104 486 gene locus_tag LOCUS_77780 3104 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77780 3138 3866 gene locus_tag LOCUS_77790 gene bioD 3138 3866 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921893.1 protein_id gnl|my_center|LOCUS_77790 >Feature sequence424 87 1163 gene locus_tag LOCUS_77800 87 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77800 1114 1770 gene locus_tag LOCUS_77810 1114 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77810 2011 2742 gene locus_tag LOCUS_77820 2011 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77820 2843 3544 gene locus_tag LOCUS_77830 2843 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77830 3635 4108 gene locus_tag LOCUS_77840 3635 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77840 >Feature sequence425 541 2049 gene locus_tag LOCUS_77850 541 2049 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_77850 3698 2223 gene locus_tag LOCUS_77860 3698 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77860 <4716 3805 gene locus_tag LOCUS_77870 <4716 3805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615657.1:sialidase family protein >Feature sequence426 4505 1149 gene locus_tag LOCUS_77880 4505 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77880 >Feature sequence427 507 2903 gene locus_tag LOCUS_77890 507 2903 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253280.1 protein_id gnl|my_center|LOCUS_77890 3056 4498 gene locus_tag LOCUS_77900 3056 4498 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_77900 >Feature sequence428 2854 1106 gene locus_tag LOCUS_77910 2854 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77910 3809 2892 gene locus_tag LOCUS_77920 3809 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77920 4191 3823 gene locus_tag LOCUS_77930 gene tnpB 4191 3823 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070113393.1 protein_id gnl|my_center|LOCUS_77930 4493 4188 gene locus_tag LOCUS_77940 4493 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77940 >Feature sequence429 3840 2659 gene locus_tag LOCUS_77950 3840 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77950 >Feature sequence430 143 1252 gene locus_tag LOCUS_77960 143 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77960 1249 1794 gene locus_tag LOCUS_77970 1249 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77970 1848 4154 gene locus_tag LOCUS_77980 gene pglZ 1848 4154 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_77980 >Feature sequence431 387 1742 gene locus_tag LOCUS_77990 387 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77990 1991 3004 gene locus_tag LOCUS_78000 1991 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78000 4109 3051 gene locus_tag LOCUS_78010 4109 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78010 <4661 4114 gene locus_tag LOCUS_78020 <4661 4114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068042.1:PASTA domain-containing protein >Feature sequence432 3514 491 gene locus_tag LOCUS_78030 3514 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78030 3937 4275 gene locus_tag LOCUS_78040 3937 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78040 >Feature sequence433 >Feature sequence434 168 485 gene locus_tag LOCUS_78050 168 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78050 616 1788 gene locus_tag LOCUS_78060 616 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78060 2185 2376 gene locus_tag LOCUS_78070 2185 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78070 2498 2331 gene locus_tag LOCUS_78080 2498 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78080 2497 2682 gene locus_tag LOCUS_78090 2497 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78090 2896 3780 gene locus_tag LOCUS_78100 2896 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78100 4014 3784 gene locus_tag LOCUS_78110 4014 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78110 >Feature sequence435 3 482 gene locus_tag LOCUS_78120 3 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78120 569 2986 gene locus_tag LOCUS_78130 569 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78130 >Feature sequence436 86 541 gene locus_tag LOCUS_78140 86 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78140 554 1012 gene locus_tag LOCUS_78150 554 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78150 2350 1115 gene locus_tag LOCUS_78160 2350 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78160 2987 2433 gene locus_tag LOCUS_78170 2987 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78170 3423 3716 gene locus_tag LOCUS_78180 3423 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78180 >Feature sequence437 133 444 gene locus_tag LOCUS_78190 133 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78190 456 707 gene locus_tag LOCUS_78200 456 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78200 1174 2187 gene locus_tag LOCUS_78210 1174 2187 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114494.1 protein_id gnl|my_center|LOCUS_78210 2837 2965 gene locus_tag LOCUS_78220 2837 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78220 3448 3702 gene locus_tag LOCUS_78230 3448 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78230 >Feature sequence438 >Feature sequence439 944 171 gene locus_tag LOCUS_78240 944 171 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664611.1 protein_id gnl|my_center|LOCUS_78240 3307 1142 gene locus_tag LOCUS_78250 3307 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78250 3628 4059 gene locus_tag LOCUS_78260 3628 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78260 >Feature sequence440 75 260 gene locus_tag LOCUS_78270 75 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78270 484 1347 gene locus_tag LOCUS_78280 484 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78280 1637 2155 gene locus_tag LOCUS_78290 1637 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78290 2346 3359 gene locus_tag LOCUS_78300 2346 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78300 >Feature sequence441 <1 1285 gene locus_tag LOCUS_78310 <1 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118029.1:sulfatase-like hydrolase/transferase 1312 2751 gene locus_tag LOCUS_78320 1312 2751 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_78320 2757 4031 gene locus_tag LOCUS_78330 2757 4031 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_78330 >Feature sequence442 <1 727 gene locus_tag LOCUS_78340 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528702.1:PLP-dependent aspartate aminotransferase family protein 1593 2120 gene locus_tag LOCUS_78350 1593 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78350 2216 2404 gene locus_tag LOCUS_78360 2216 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78360 2602 2769 gene locus_tag LOCUS_78370 2602 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78370 <4480 2826 gene locus_tag LOCUS_78380 <4480 2826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994157.1:methyl-accepting chemotaxis protein >Feature sequence443 >Feature sequence444 795 2357 gene locus_tag LOCUS_78390 795 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_78390 2406 2678 gene locus_tag LOCUS_78400 2406 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78400 2703 3653 gene locus_tag LOCUS_78410 2703 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78410 <4477 3763 gene locus_tag LOCUS_78420 <4477 3763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123424.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence445 920 633 gene locus_tag LOCUS_78430 920 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78430 1273 1004 gene locus_tag LOCUS_78440 1273 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78440 1675 1358 gene locus_tag LOCUS_78450 1675 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78450 2049 1669 gene locus_tag LOCUS_78460 2049 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78460 2691 2050 gene locus_tag LOCUS_78470 2691 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78470 3478 3083 gene locus_tag LOCUS_78480 3478 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78480 3778 3512 gene locus_tag LOCUS_78490 3778 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78490 4198 3932 gene locus_tag LOCUS_78500 4198 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78500 >Feature sequence446 290 568 gene locus_tag LOCUS_78510 290 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78510 565 723 gene locus_tag LOCUS_78520 565 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78520 720 923 gene locus_tag LOCUS_78530 720 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78530 2685 1168 gene locus_tag LOCUS_78540 2685 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78540 2734 3072 gene locus_tag LOCUS_78550 2734 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78550 4126 3284 gene locus_tag LOCUS_78560 4126 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78560 4313 4116 gene locus_tag LOCUS_78570 4313 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78570 >Feature sequence447 <1 244 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatcccttcgatgccagggcgcttcttcaggc 2239 491 gene locus_tag LOCUS_78580 2239 491 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139540890.1 protein_id gnl|my_center|LOCUS_78580 3140 2205 gene locus_tag LOCUS_78590 3140 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78590 3558 3196 gene locus_tag LOCUS_78600 gene tnpB 3558 3196 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084591.1 protein_id gnl|my_center|LOCUS_78600 3956 3555 gene locus_tag LOCUS_78610 3956 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78610 4076 4411 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatcccttcgatgccagggcgcttcttcaggc >Feature sequence448 <1 1784 gene locus_tag LOCUS_78620 <1 1784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921690.1:acetylxylan esterase 2899 2012 gene locus_tag LOCUS_78630 2899 2012 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_78630 3934 2912 gene locus_tag LOCUS_78640 3934 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78640 4191 4021 gene locus_tag LOCUS_78650 4191 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78650 >Feature sequence449 250 546 gene locus_tag LOCUS_78660 250 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78660 620 1198 gene locus_tag LOCUS_78670 620 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78670 1314 1817 gene locus_tag LOCUS_78680 1314 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78680 2130 1870 gene locus_tag LOCUS_78690 2130 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78690 2340 2603 gene locus_tag LOCUS_78700 2340 2603 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_78700 2604 2954 gene locus_tag LOCUS_78710 2604 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78710 3012 4160 gene locus_tag LOCUS_78720 3012 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78720 >Feature sequence450 >Feature sequence451 1171 2 gene locus_tag LOCUS_78730 1171 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78730 1359 1946 gene locus_tag LOCUS_78740 1359 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78740 >Feature sequence452 <1 3479 gene locus_tag LOCUS_78750 <1 3479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962421.1:TaqI-like C-terminal specificity domain-containing protein 3524 3754 gene locus_tag LOCUS_78760 3524 3754 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258326.1 protein_id gnl|my_center|LOCUS_78760 3751 4137 gene locus_tag LOCUS_78770 3751 4137 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_78770 >Feature sequence453 2591 2673 gene locus_tag LOCUS_t00960 2591 2673 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence454 266 1696 gene locus_tag LOCUS_78780 266 1696 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_78780 1962 1720 gene locus_tag LOCUS_78790 1962 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78790 2052 2246 gene locus_tag LOCUS_78800 2052 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78800 <4283 2391 gene locus_tag LOCUS_78810 <4283 2391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928482.1:beta-propeller fold lactonase family protein >Feature sequence455 291 64 gene locus_tag LOCUS_78820 291 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78820 2510 381 gene locus_tag LOCUS_78830 2510 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78830 3410 2847 gene locus_tag LOCUS_78840 3410 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78840 >Feature sequence456 884 1867 gene locus_tag LOCUS_78850 884 1867 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442722.1 protein_id gnl|my_center|LOCUS_78850 >Feature sequence457 892 65 gene locus_tag LOCUS_78860 892 65 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_78860 827 915 gene locus_tag LOCUS_t00970 827 915 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1843 1052 gene locus_tag LOCUS_78870 1843 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78870 3413 1974 gene locus_tag LOCUS_78880 3413 1974 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_78880 <4255 3420 gene locus_tag LOCUS_78890 <4255 3420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030721.1:glycosyltransferase family 1 protein >Feature sequence458 194 493 gene locus_tag LOCUS_78900 194 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78900 490 1068 gene locus_tag LOCUS_78910 490 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78910 981 1181 gene locus_tag LOCUS_78920 981 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78920 1514 1678 gene locus_tag LOCUS_78930 1514 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78930 2112 3581 gene locus_tag LOCUS_78940 2112 3581 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_78940 >Feature sequence459 >Feature sequence460 2677 725 gene locus_tag LOCUS_78950 2677 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78950 >Feature sequence461 182 376 gene locus_tag LOCUS_78960 182 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78960 623 408 gene locus_tag LOCUS_78970 623 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78970 2256 748 gene locus_tag LOCUS_78980 2256 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78980 3305 2427 gene locus_tag LOCUS_78990 3305 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78990 3459 3674 gene locus_tag LOCUS_79000 3459 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79000 3963 3637 gene locus_tag LOCUS_79010 3963 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79010 >Feature sequence462 62 412 gene locus_tag LOCUS_79020 62 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79020 409 801 gene locus_tag LOCUS_79030 gene dndE 409 801 CDS product DNA sulfur modification protein DndE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296384.1 protein_id gnl|my_center|LOCUS_79030 847 1125 gene locus_tag LOCUS_79040 847 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79040 1484 1762 gene locus_tag LOCUS_79050 1484 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79050 1743 2147 gene locus_tag LOCUS_79060 1743 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79060 2569 2384 gene locus_tag LOCUS_79070 2569 2384 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_79070 2796 2566 gene locus_tag LOCUS_79080 2796 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79080 3508 3203 gene locus_tag LOCUS_79090 3508 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79090 >Feature sequence463 761 207 gene locus_tag LOCUS_79100 761 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79100 1417 845 gene locus_tag LOCUS_79110 1417 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79110 2691 1609 gene locus_tag LOCUS_79120 2691 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79120 4080 2821 gene locus_tag LOCUS_79130 4080 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117702.1 protein_id gnl|my_center|LOCUS_79130 >Feature sequence464 <1 1717 gene locus_tag LOCUS_79140 <1 1717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146459048.1:DUF1156 domain-containing protein 1754 1984 gene locus_tag LOCUS_79150 1754 1984 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_79150 1995 2384 gene locus_tag LOCUS_79160 1995 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79160 >Feature sequence465 213 578 gene locus_tag LOCUS_79170 213 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79170 629 2200 gene locus_tag LOCUS_79180 629 2200 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917061.1 protein_id gnl|my_center|LOCUS_79180 2200 2988 gene locus_tag LOCUS_79190 2200 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79190 3000 3284 gene locus_tag LOCUS_79200 3000 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79200 3609 3367 gene locus_tag LOCUS_79210 3609 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79210 >Feature sequence466 223 672 gene locus_tag LOCUS_79220 223 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79220 838 1308 gene locus_tag LOCUS_79230 838 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79230 1435 2490 gene locus_tag LOCUS_79240 1435 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79240 2697 3443 gene locus_tag LOCUS_79250 2697 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79250 3487 3975 gene locus_tag LOCUS_79260 3487 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79260 >Feature sequence467 75 1952 gene locus_tag LOCUS_79270 75 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79270 >Feature sequence468 2276 147 gene locus_tag LOCUS_79280 2276 147 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038872.1 protein_id gnl|my_center|LOCUS_79280 3616 2273 gene locus_tag LOCUS_79290 3616 2273 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084727.1 protein_id gnl|my_center|LOCUS_79290 >Feature sequence469 338 2674 gene locus_tag LOCUS_79300 338 2674 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119132.1 protein_id gnl|my_center|LOCUS_79300 2671 3648 gene locus_tag LOCUS_79310 2671 3648 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_79310 >Feature sequence470 658 368 gene locus_tag LOCUS_79320 658 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79320 2022 853 gene locus_tag LOCUS_79330 2022 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79330 3274 2072 gene locus_tag LOCUS_79340 3274 2072 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_79340 3716 3789 gene locus_tag LOCUS_t00980 3716 3789 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence471 <1 3446 gene locus_tag LOCUS_79350 <1 3446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891828.1:class I SAM-dependent DNA methyltransferase >Feature sequence472 <1 771 gene locus_tag LOCUS_79360 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047813294.1:recombinase RecA 3350 864 gene locus_tag LOCUS_79370 3350 864 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170304.1 protein_id gnl|my_center|LOCUS_79370 >Feature sequence473 2 952 gene locus_tag LOCUS_79380 2 952 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779464.1 protein_id gnl|my_center|LOCUS_79380 1540 1127 gene locus_tag LOCUS_79390 1540 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79390 2300 1866 gene locus_tag LOCUS_79400 2300 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79400 3801 2866 gene locus_tag LOCUS_79410 3801 2866 CDS product auxin efflux carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582699.1 protein_id gnl|my_center|LOCUS_79410 >Feature sequence474 321 3257 gene locus_tag LOCUS_79420 321 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79420 >Feature sequence475 2415 130 gene locus_tag LOCUS_79430 2415 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79430 2706 3275 gene locus_tag LOCUS_79440 2706 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79440 3327 3740 gene locus_tag LOCUS_79450 3327 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79450 >Feature sequence476 1577 165 gene locus_tag LOCUS_79460 1577 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79460 3578 1587 gene locus_tag LOCUS_79470 3578 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79470 >Feature sequence477 127 627 gene locus_tag LOCUS_79480 127 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79480 1002 2555 gene locus_tag LOCUS_79490 1002 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79490 2549 3496 gene locus_tag LOCUS_79500 2549 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79500 3903 3544 gene locus_tag LOCUS_79510 3903 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79510 >Feature sequence478 163 459 gene locus_tag LOCUS_79520 163 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79520 583 3036 gene locus_tag LOCUS_79530 583 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79530 >Feature sequence479 487 1866 gene locus_tag LOCUS_79540 487 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79540 2333 1959 gene locus_tag LOCUS_79550 2333 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79550 3469 2468 gene locus_tag LOCUS_79560 3469 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_79560 >Feature sequence480 1374 385 gene locus_tag LOCUS_79570 1374 385 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_79570 1969 1472 gene locus_tag LOCUS_79580 1969 1472 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_79580 <3888 2461 gene locus_tag LOCUS_79590 <3888 2461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061038.1:H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA >Feature sequence481 394 606 gene locus_tag LOCUS_79600 394 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79600 527 1741 gene locus_tag LOCUS_79610 527 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79610 1759 3168 gene locus_tag LOCUS_79620 1759 3168 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_79620 >Feature sequence482 1429 1277 gene locus_tag LOCUS_79630 1429 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79630 2418 1411 gene locus_tag LOCUS_79640 2418 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79640 2879 2406 gene locus_tag LOCUS_79650 2879 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79650 3776 3132 gene locus_tag LOCUS_79660 3776 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79660 >Feature sequence483 >Feature sequence484 253 423 gene locus_tag LOCUS_79670 253 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79670 517 1095 gene locus_tag LOCUS_79680 517 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79680 1182 1388 gene locus_tag LOCUS_79690 1182 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79690 1385 1558 gene locus_tag LOCUS_79700 1385 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79700 1578 2528 gene locus_tag LOCUS_79710 1578 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79710 2587 3372 gene locus_tag LOCUS_79720 2587 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79720 >Feature sequence485 1449 439 gene locus_tag LOCUS_79730 1449 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79730 >Feature sequence486 941 857 gene locus_tag LOCUS_t00990 941 857 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2279 1008 gene locus_tag LOCUS_79740 gene rho 2279 1008 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330229.1 protein_id gnl|my_center|LOCUS_79740 >Feature sequence487 338 814 gene locus_tag LOCUS_79750 338 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79750 1000 2700 gene locus_tag LOCUS_79760 1000 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79760 2706 3683 gene locus_tag LOCUS_79770 2706 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79770 >Feature sequence488 696 436 gene locus_tag LOCUS_79780 696 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79780 1092 877 gene locus_tag LOCUS_79790 1092 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142613.1 protein_id gnl|my_center|LOCUS_79790 1172 3067 gene locus_tag LOCUS_79800 1172 3067 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 protein_id gnl|my_center|LOCUS_79800 >Feature sequence489 <1 1442 gene locus_tag LOCUS_79810 <1 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051073366.1:sulfatase 1603 2667 gene locus_tag LOCUS_79820 1603 2667 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_79820 3132 3524 gene locus_tag LOCUS_79830 3132 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79830 >Feature sequence490 772 2193 gene locus_tag LOCUS_79840 772 2193 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_79840 >Feature sequence491 1958 720 gene locus_tag LOCUS_79850 1958 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79850 2713 1952 gene locus_tag LOCUS_79860 2713 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79860 >Feature sequence492 876 337 gene locus_tag LOCUS_79870 876 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79870 956 1162 gene locus_tag LOCUS_79880 956 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79880 2230 1166 gene locus_tag LOCUS_79890 2230 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79890 >Feature sequence493 845 621 gene locus_tag LOCUS_79900 845 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79900 1191 973 gene locus_tag LOCUS_79910 1191 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79910 1524 1318 gene locus_tag LOCUS_79920 1524 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79920 1811 1653 gene locus_tag LOCUS_79930 1811 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79930 3407 2409 gene locus_tag LOCUS_79940 3407 2409 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_79940 >Feature sequence494 817 458 gene locus_tag LOCUS_79950 817 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79950 1238 2338 gene locus_tag LOCUS_79960 1238 2338 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615603.1 protein_id gnl|my_center|LOCUS_79960 3434 2883 gene locus_tag LOCUS_79970 3434 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79970 >Feature sequence495 218 694 gene locus_tag LOCUS_79980 218 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79980 814 1833 gene locus_tag LOCUS_79990 814 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79990 >Feature sequence496 267 1172 gene locus_tag LOCUS_80000 267 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80000 >Feature sequence497 469 1485 gene locus_tag LOCUS_80010 469 1485 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122477.1 protein_id gnl|my_center|LOCUS_80010 2282 2683 gene locus_tag LOCUS_80020 2282 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80020 2680 2877 gene locus_tag LOCUS_80030 2680 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80030 >Feature sequence498 1668 55 gene locus_tag LOCUS_80040 1668 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122727.1 protein_id gnl|my_center|LOCUS_80040 1852 3273 gene locus_tag LOCUS_80050 1852 3273 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121489.1 protein_id gnl|my_center|LOCUS_80050 >Feature sequence499 1211 285 gene locus_tag LOCUS_80060 1211 285 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_80060 2078 1221 gene locus_tag LOCUS_80070 2078 1221 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_80070 3022 2078 gene locus_tag LOCUS_80080 3022 2078 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 protein_id gnl|my_center|LOCUS_80080 3386 3024 gene locus_tag LOCUS_80090 3386 3024 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_80090 >Feature sequence500 758 402 gene locus_tag LOCUS_80100 758 402 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_80100 1477 2169 gene locus_tag LOCUS_80110 1477 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80110 2344 3357 gene locus_tag LOCUS_80120 2344 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80120 >Feature sequence501 1436 351 gene locus_tag LOCUS_80130 1436 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257685.1 protein_id gnl|my_center|LOCUS_80130 1947 1444 gene locus_tag LOCUS_80140 1947 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038870.1 protein_id gnl|my_center|LOCUS_80140 2963 1944 gene locus_tag LOCUS_80150 2963 1944 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939306.1 protein_id gnl|my_center|LOCUS_80150 <3523 2960 gene locus_tag LOCUS_80160 <3523 2960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207280509.1:DNA methyltransferase >Feature sequence502 239 487 gene locus_tag LOCUS_80170 239 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80170 1213 824 gene locus_tag LOCUS_80180 1213 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80180 1721 1338 gene locus_tag LOCUS_80190 1721 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80190 2217 1876 gene locus_tag LOCUS_80200 2217 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80200 <3517 2493 gene locus_tag LOCUS_80210 <3517 2493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123424.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence503 >Feature sequence504 2441 378 gene locus_tag LOCUS_80220 2441 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80220 3064 2438 gene locus_tag LOCUS_80230 3064 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80230 3466 3224 gene locus_tag LOCUS_80240 3466 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80240 >Feature sequence505 727 131 gene locus_tag LOCUS_80250 727 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80250 1008 1223 gene locus_tag LOCUS_80260 1008 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80260 2769 1372 gene locus_tag LOCUS_80270 2769 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80270 >Feature sequence506 379 236 gene locus_tag LOCUS_80280 379 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80280 1790 903 gene locus_tag LOCUS_80290 1790 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80290 <3456 2099 gene locus_tag LOCUS_80300 <3456 2099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922371.1:RHS repeat-associated core domain-containing protein >Feature sequence507 1132 656 gene locus_tag LOCUS_80310 1132 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80310 1427 1110 gene locus_tag LOCUS_80320 1427 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80320 2149 1586 gene locus_tag LOCUS_80330 2149 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80330 >Feature sequence508 625 1659 gene locus_tag LOCUS_80340 625 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80340 <3427 2135 gene locus_tag LOCUS_80350 <3427 2135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038821.1:autotransporter BatB >Feature sequence509 407 48 gene locus_tag LOCUS_80360 407 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80360 1280 579 gene locus_tag LOCUS_80370 1280 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80370 1914 1285 gene locus_tag LOCUS_80380 1914 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80380 >Feature sequence510 546 310 gene locus_tag LOCUS_80390 546 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80390 1471 2010 gene locus_tag LOCUS_80400 1471 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80400 2063 2434 gene locus_tag LOCUS_80410 2063 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80410 2431 2619 gene locus_tag LOCUS_80420 2431 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80420 >Feature sequence511 1094 2587 gene locus_tag LOCUS_80430 1094 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80430 >Feature sequence512 871 1323 gene locus_tag LOCUS_80440 871 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80440 2129 1893 gene locus_tag LOCUS_80450 2129 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80450 >Feature sequence513 3332 3054 gene locus_tag LOCUS_80460 3332 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80460 >Feature sequence514 154 1617 gene locus_tag LOCUS_80470 154 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80470 1550 2203 gene locus_tag LOCUS_80480 1550 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80480 2366 2950 gene locus_tag LOCUS_80490 2366 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80490 >Feature sequence515 <1 636 gene locus_tag LOCUS_80500 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808616.1:nicotinate phosphoribosyltransferase 611 1285 gene locus_tag LOCUS_80510 gene pncA 611 1285 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_80510 1862 2998 gene locus_tag LOCUS_80520 1862 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80520 >Feature sequence516 1906 326 gene locus_tag LOCUS_80530 1906 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80530 >Feature sequence517 95 406 gene locus_tag LOCUS_80540 95 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80540 899 477 gene locus_tag LOCUS_80550 899 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80550 2093 1095 gene locus_tag LOCUS_80560 2093 1095 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_80560 2798 3190 gene locus_tag LOCUS_80570 2798 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80570 >Feature sequence518 179 1444 gene locus_tag LOCUS_80580 179 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_80580 1546 1746 gene locus_tag LOCUS_80590 1546 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80590 2737 1841 gene locus_tag LOCUS_80600 2737 1841 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122454.1 protein_id gnl|my_center|LOCUS_80600 >Feature sequence519 1021 578 gene locus_tag LOCUS_80610 1021 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80610 1752 1018 gene locus_tag LOCUS_80620 1752 1018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_80620 2513 1752 gene locus_tag LOCUS_80630 gene livG 2513 1752 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704139.1 protein_id gnl|my_center|LOCUS_80630 <3281 2510 gene locus_tag LOCUS_80640 <3281 2510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948215.1:branched-chain amino acid ABC transporter permease >Feature sequence520 <1 2561 gene locus_tag LOCUS_80650 <1 2561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145098967.1:leucine-rich repeat domain-containing protein >Feature sequence521 25 3117 gene locus_tag LOCUS_80660 25 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80660 >Feature sequence522 <1 743 gene locus_tag LOCUS_80670 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007334456.1:formylmethanofuran--tetrahydromethanopterin N-formyltransferase 761 1603 gene locus_tag LOCUS_80680 761 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80680 >Feature sequence523 >Feature sequence524 >Feature sequence525 1424 1044 gene locus_tag LOCUS_80690 gene arsD 1424 1044 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461626.1 protein_id gnl|my_center|LOCUS_80690 2054 1512 gene locus_tag LOCUS_80700 2054 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80700 2367 2029 gene locus_tag LOCUS_80710 2367 2029 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948466.1 protein_id gnl|my_center|LOCUS_80710 2616 2446 gene locus_tag LOCUS_80720 2616 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80720 >Feature sequence526 2884 1799 gene locus_tag LOCUS_80730 gene rlmN 2884 1799 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922584.1 protein_id gnl|my_center|LOCUS_80730 >Feature sequence527 155 646 gene locus_tag LOCUS_80740 155 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80740 723 1130 gene locus_tag LOCUS_80750 723 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80750 1146 2138 gene locus_tag LOCUS_80760 1146 2138 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142395.1 protein_id gnl|my_center|LOCUS_80760 2426 2653 gene locus_tag LOCUS_80770 2426 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80770 2726 2965 gene locus_tag LOCUS_80780 2726 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80780 >Feature sequence528 418 852 gene locus_tag LOCUS_80790 418 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80790 906 1000 gene locus_tag LOCUS_t01000 906 1000 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2749 3042 gene locus_tag LOCUS_80800 2749 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80800 >Feature sequence529 <1 1025 gene locus_tag LOCUS_80810 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123442.1:DNA translocase FtsK 1595 1074 gene locus_tag LOCUS_80820 1595 1074 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967173.1 protein_id gnl|my_center|LOCUS_80820 2332 1799 gene locus_tag LOCUS_80830 2332 1799 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226992699.1 protein_id gnl|my_center|LOCUS_80830 >Feature sequence530 2181 1762 gene locus_tag LOCUS_80840 2181 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80840 2402 2187 gene locus_tag LOCUS_80850 2402 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80850 >Feature sequence531 >Feature sequence532 415 705 gene locus_tag LOCUS_80860 415 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80860 1279 980 gene locus_tag LOCUS_80870 1279 980 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_80870 1493 1269 gene locus_tag LOCUS_80880 1493 1269 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_80880 1843 2925 gene locus_tag LOCUS_80890 1843 2925 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397899.1 protein_id gnl|my_center|LOCUS_80890 >Feature sequence533 <1 536 gene locus_tag LOCUS_80900 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121095.1:sulfatase-like hydrolase/transferase 923 579 gene locus_tag LOCUS_80910 gene mazF9 923 579 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_80910 1155 904 gene locus_tag LOCUS_80920 1155 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80920 2346 1288 gene locus_tag LOCUS_80930 2346 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80930 >Feature sequence534 519 196 gene locus_tag LOCUS_80940 519 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80940 960 676 gene locus_tag LOCUS_80950 960 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80950 1031 1639 gene locus_tag LOCUS_80960 1031 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80960 2995 1901 gene locus_tag LOCUS_80970 2995 1901 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921817.1 protein_id gnl|my_center|LOCUS_80970 >Feature sequence535 1272 565 gene locus_tag LOCUS_80980 1272 565 CDS product IS5-like element ISMac11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020489.1 protein_id gnl|my_center|LOCUS_80980 2187 2447 gene locus_tag LOCUS_80990 2187 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80990 >Feature sequence536 <3090 59 gene locus_tag LOCUS_81000 <3090 59 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118422.1:secretin N-terminal domain-containing protein >Feature sequence537 1082 327 gene locus_tag LOCUS_81010 1082 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81010 1796 1954 gene locus_tag LOCUS_81020 1796 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81020 >Feature sequence538 805 77 gene locus_tag LOCUS_81030 805 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81030 1197 1018 gene locus_tag LOCUS_81040 1197 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81040 1640 1284 gene locus_tag LOCUS_81050 1640 1284 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_81050 1941 1630 gene locus_tag LOCUS_81060 1941 1630 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669612.1 protein_id gnl|my_center|LOCUS_81060 2337 2155 gene locus_tag LOCUS_81070 2337 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81070 2609 2854 gene locus_tag LOCUS_81080 2609 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81080 >Feature sequence539 <3054 2308 gene locus_tag LOCUS_81090 <3054 2308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117849.1:HlyD family efflux transporter periplasmic adaptor subunit >Feature sequence540 >Feature sequence541 1052 1891 gene locus_tag LOCUS_81100 1052 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81100 2305 2478 gene locus_tag LOCUS_81110 2305 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81110 2736 2479 gene locus_tag LOCUS_81120 2736 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81120 >Feature sequence542 493 335 gene locus_tag LOCUS_81130 493 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81130 613 2361 gene locus_tag LOCUS_81140 613 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81140 >Feature sequence543 106 1296 gene locus_tag LOCUS_81150 106 1296 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926638.1 protein_id gnl|my_center|LOCUS_81150 1470 1676 gene locus_tag LOCUS_81160 1470 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81160 1865 2077 gene locus_tag LOCUS_81170 1865 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81170 2074 2304 gene locus_tag LOCUS_81180 2074 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81180 >Feature sequence544 >Feature sequence545 837 613 gene locus_tag LOCUS_81190 837 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81190 1251 2966 gene locus_tag LOCUS_81200 1251 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81200 >Feature sequence546 346 897 gene locus_tag LOCUS_81210 346 897 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054768.1 protein_id gnl|my_center|LOCUS_81210 964 1977 gene locus_tag LOCUS_81220 964 1977 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427765.1 protein_id gnl|my_center|LOCUS_81220 >Feature sequence547 154 333 gene locus_tag LOCUS_81230 154 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81230 1435 800 gene locus_tag LOCUS_81240 1435 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81240 2187 1414 gene locus_tag LOCUS_81250 2187 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81250 >Feature sequence548 >Feature sequence549 419 856 gene locus_tag LOCUS_81260 419 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81260 1882 1199 gene locus_tag LOCUS_81270 1882 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81270 2579 2415 gene locus_tag LOCUS_81280 2579 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81280 >Feature sequence550 685 533 gene locus_tag LOCUS_81290 685 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81290 1159 725 gene locus_tag LOCUS_81300 1159 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81300 1398 2681 gene locus_tag LOCUS_81310 1398 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81310 >Feature sequence551 1118 654 gene locus_tag LOCUS_81320 1118 654 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943903.1 protein_id gnl|my_center|LOCUS_81320 <2918 1384 gene locus_tag LOCUS_81330 <2918 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083435015.1:RNA polymerase factor sigma-54 >Feature sequence552 511 47 gene locus_tag LOCUS_81340 511 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81340 1307 690 gene locus_tag LOCUS_81350 1307 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81350 >Feature sequence553 426 127 gene locus_tag LOCUS_81360 426 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81360 1212 514 gene locus_tag LOCUS_81370 1212 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81370 >Feature sequence554 2884 1910 gene locus_tag LOCUS_81380 2884 1910 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_81380 >Feature sequence555 540 190 gene locus_tag LOCUS_81390 540 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81390 1894 929 gene locus_tag LOCUS_81400 1894 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81400 >Feature sequence556 208 561 gene locus_tag LOCUS_81410 208 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81410 620 2698 gene locus_tag LOCUS_81420 620 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81420 >Feature sequence557 2467 758 gene locus_tag LOCUS_81430 2467 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_81430 >Feature sequence558 350 919 gene locus_tag LOCUS_81440 350 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81440 912 1589 gene locus_tag LOCUS_81450 912 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81450 1586 1969 gene locus_tag LOCUS_81460 1586 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81460 >Feature sequence559 1288 680 gene locus_tag LOCUS_81470 1288 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81470 <2830 1704 gene locus_tag LOCUS_81480 <2830 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001033221.1:trimeric autotransporter adhesin EhaG >Feature sequence560 522 1640 gene locus_tag LOCUS_81490 522 1640 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325404.1 protein_id gnl|my_center|LOCUS_81490 1784 2281 gene locus_tag LOCUS_81500 1784 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81500 >Feature sequence561 937 668 gene locus_tag LOCUS_81510 937 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81510 2075 969 gene locus_tag LOCUS_81520 2075 969 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_81520 <2808 2072 gene locus_tag LOCUS_81530 <2808 2072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964929.1:radical SAM protein >Feature sequence562 151 1161 gene locus_tag LOCUS_81540 151 1161 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_81540 2519 2710 gene locus_tag LOCUS_81550 2519 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81550 >Feature sequence563 1598 459 gene locus_tag LOCUS_81560 gene wecB 1598 459 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942885.1 protein_id gnl|my_center|LOCUS_81560 2675 1614 gene locus_tag LOCUS_81570 2675 1614 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390551.1 protein_id gnl|my_center|LOCUS_81570 >Feature sequence564 170 1324 gene locus_tag LOCUS_81580 gene cas1 170 1324 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_81580 1335 1610 gene locus_tag LOCUS_81590 gene cas2 1335 1610 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174371.1 protein_id gnl|my_center|LOCUS_81590 1884 2738 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcctgaagaagcgccctggcatcgaagggattgaaac >Feature sequence565 676 254 gene locus_tag LOCUS_81600 676 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81600 1609 905 gene locus_tag LOCUS_81610 1609 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81610 2285 1578 gene locus_tag LOCUS_81620 2285 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81620 2581 2390 gene locus_tag LOCUS_81630 2581 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81630 >Feature sequence566 1701 190 gene locus_tag LOCUS_81640 gene csb2 1701 190 CDS product type I-U CRISPR-associated protein Csb2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940732.1 protein_id gnl|my_center|LOCUS_81640 <2770 1698 gene locus_tag LOCUS_81650 <2770 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940731.1:type I-U CRISPR-associated RAMP protein Csb1/Cas7u >Feature sequence567 1889 108 gene locus_tag LOCUS_81660 1889 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81660 >Feature sequence568 800 1783 gene locus_tag LOCUS_81670 800 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81670 >Feature sequence569 214 1359 gene locus_tag LOCUS_81680 214 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81680 >Feature sequence570 301 1416 gene locus_tag LOCUS_81690 301 1416 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876574.1 protein_id gnl|my_center|LOCUS_81690 >Feature sequence571 1508 801 gene locus_tag LOCUS_81700 1508 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81700 2373 1510 gene locus_tag LOCUS_81710 2373 1510 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227916.1 protein_id gnl|my_center|LOCUS_81710 >Feature sequence572 <2737 1751 gene locus_tag LOCUS_81720 <2737 1751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391405.1:glycosyltransferase family 4 protein >Feature sequence573 181 606 gene locus_tag LOCUS_81730 181 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81730 701 1654 gene locus_tag LOCUS_81740 701 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81740 1864 2073 gene locus_tag LOCUS_81750 1864 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81750 2345 1962 gene locus_tag LOCUS_81760 2345 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81760 >Feature sequence574 >Feature sequence575 1009 788 gene locus_tag LOCUS_81770 1009 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81770 1422 1048 gene locus_tag LOCUS_81780 1422 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81780 1709 1422 gene locus_tag LOCUS_81790 1709 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81790 1969 1706 gene locus_tag LOCUS_81800 1969 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81800 2505 2038 gene locus_tag LOCUS_81810 2505 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81810 >Feature sequence576 174 974 gene locus_tag LOCUS_81820 174 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81820 978 2009 gene locus_tag LOCUS_81830 gene cas1c 978 2009 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_81830 2048 2338 gene locus_tag LOCUS_81840 gene cas2 2048 2338 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626042.1 protein_id gnl|my_center|LOCUS_81840 2522 >2692 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcccgcacgcgtgcgggcgtggattgaaaca >Feature sequence577 1484 1107 gene locus_tag LOCUS_81850 1484 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81850 >Feature sequence578 194 1987 gene locus_tag LOCUS_81860 194 1987 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123069.1 protein_id gnl|my_center|LOCUS_81860 2184 2483 gene locus_tag LOCUS_81870 2184 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81870 >Feature sequence579 193 387 gene locus_tag LOCUS_81880 193 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81880 427 651 gene locus_tag LOCUS_81890 427 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81890 665 862 gene locus_tag LOCUS_81900 665 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81900 866 1129 gene locus_tag LOCUS_81910 866 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81910 1126 1530 gene locus_tag LOCUS_81920 1126 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81920 1543 1848 gene locus_tag LOCUS_81930 1543 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81930 >Feature sequence580 <1 1117 gene locus_tag LOCUS_81940 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870579.1:UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase 1186 1806 gene locus_tag LOCUS_81950 1186 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81950 >Feature sequence581 >Feature sequence582 1674 1186 gene locus_tag LOCUS_81960 1674 1186 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870236.1 protein_id gnl|my_center|LOCUS_81960 1911 1702 gene locus_tag LOCUS_81970 1911 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81970 >Feature sequence583 1577 1777 gene locus_tag LOCUS_81980 1577 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81980 2490 1984 gene locus_tag LOCUS_81990 2490 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81990 >Feature sequence584 373 582 gene locus_tag LOCUS_82000 373 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82000 1932 595 gene locus_tag LOCUS_82010 1932 595 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582827.1 protein_id gnl|my_center|LOCUS_82010 >Feature sequence585 55 128 gene locus_tag LOCUS_t01010 55 128 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 229 438 gene locus_tag LOCUS_82020 229 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82020 535 738 gene locus_tag LOCUS_82030 535 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82030 735 1238 gene locus_tag LOCUS_82040 735 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82040 1240 1521 gene locus_tag LOCUS_82050 1240 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82050 1478 2206 gene locus_tag LOCUS_82060 1478 2206 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_82060 >Feature sequence586 249 121 gene locus_tag LOCUS_82070 249 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82070 965 246 gene locus_tag LOCUS_82080 965 246 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_82080 1203 955 gene locus_tag LOCUS_82090 1203 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82090 1635 1222 gene locus_tag LOCUS_82100 1635 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82100 1928 1629 gene locus_tag LOCUS_82110 1928 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82110 2181 1993 gene locus_tag LOCUS_82120 2181 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82120 2484 2206 gene locus_tag LOCUS_82130 2484 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82130 >Feature sequence587 2182 698 gene locus_tag LOCUS_82140 2182 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82140 >Feature sequence588 529 2577 gene locus_tag LOCUS_82150 529 2577 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967414.1 protein_id gnl|my_center|LOCUS_82150 >Feature sequence589 111 1013 gene locus_tag LOCUS_82160 111 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82160 916 1815 gene locus_tag LOCUS_82170 916 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82170 1960 2175 gene locus_tag LOCUS_82180 1960 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82180 >Feature sequence590 390 2327 gene locus_tag LOCUS_82190 390 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82190 >Feature sequence591 664 233 gene locus_tag LOCUS_82200 664 233 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_82200 962 2263 gene locus_tag LOCUS_82210 962 2263 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_82210 >Feature sequence592 575 823 gene locus_tag LOCUS_82220 575 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82220 826 1176 gene locus_tag LOCUS_82230 826 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82230 >Feature sequence593 190 1080 gene locus_tag LOCUS_82240 190 1080 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526412.1 protein_id gnl|my_center|LOCUS_82240 1077 1970 gene locus_tag LOCUS_82250 gene ligD 1077 1970 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879221.1 protein_id gnl|my_center|LOCUS_82250 >Feature sequence594 1 2067 gene locus_tag LOCUS_82260 1 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82260 2139 2453 gene locus_tag LOCUS_82270 2139 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82270 >Feature sequence595 998 786 gene locus_tag LOCUS_82280 998 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82280 >Feature sequence596 240 1919 gene locus_tag LOCUS_82290 240 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82290 >Feature sequence597 465 995 gene locus_tag LOCUS_82300 465 995 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120964.1 protein_id gnl|my_center|LOCUS_82300 >Feature sequence598 225 722 gene locus_tag LOCUS_82310 225 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82310 1507 1226 gene locus_tag LOCUS_82320 1507 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82320 >Feature sequence599 1109 204 gene locus_tag LOCUS_82330 1109 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82330 2281 1217 gene locus_tag LOCUS_82340 2281 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82340 >Feature sequence600 >Feature sequence601 501 205 gene locus_tag LOCUS_82350 501 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82350 1799 696 gene locus_tag LOCUS_82360 1799 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82360 >Feature sequence602 1236 2045 gene locus_tag LOCUS_82370 1236 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82370 >Feature sequence603 >Feature sequence604 928 1359 gene locus_tag LOCUS_82380 gene ndk 928 1359 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831235.1 protein_id gnl|my_center|LOCUS_82380 1839 2279 gene locus_tag LOCUS_82390 1839 2279 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123553.1 protein_id gnl|my_center|LOCUS_82390 >Feature sequence605 >Feature sequence606 817 1368 gene locus_tag LOCUS_82400 817 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82400 1365 2027 gene locus_tag LOCUS_82410 1365 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82410 >Feature sequence607 1859 39 gene locus_tag LOCUS_82420 1859 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82420 >Feature sequence608 1278 796 gene locus_tag LOCUS_82430 1278 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82430 <2282 1359 gene locus_tag LOCUS_82440 <2282 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144273.1:AAA family ATPase >Feature sequence609 533 1054 gene locus_tag LOCUS_82450 533 1054 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_82450 >Feature sequence610 >Feature sequence611 591 1829 gene locus_tag LOCUS_82460 591 1829 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972561.1 protein_id gnl|my_center|LOCUS_82460 >Feature sequence612 >Feature sequence613 766 467 gene locus_tag LOCUS_82470 766 467 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118081.1 protein_id gnl|my_center|LOCUS_82470 1085 1336 gene locus_tag LOCUS_82480 1085 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82480 >Feature sequence614 343 1299 gene locus_tag LOCUS_82490 343 1299 CDS product IS1595-like element ISSod11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071113.1 protein_id gnl|my_center|LOCUS_82490 1448 1305 gene locus_tag LOCUS_82500 1448 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82500 1589 1786 gene locus_tag LOCUS_82510 1589 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82510 >Feature sequence615 927 394 gene locus_tag LOCUS_82520 927 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82520 2164 1193 gene locus_tag LOCUS_82530 2164 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_82530 >Feature sequence616 536 225 gene locus_tag LOCUS_82540 536 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82540 994 533 gene locus_tag LOCUS_82550 994 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82550 1550 1026 gene locus_tag LOCUS_82560 1550 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82560 2118 1483 gene locus_tag LOCUS_82570 2118 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82570 >Feature sequence617 326 808 gene locus_tag LOCUS_82580 326 808 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 protein_id gnl|my_center|LOCUS_82580 <2197 942 gene locus_tag LOCUS_82590 <2197 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942744.1:catalase/peroxidase HPI >Feature sequence618 >Feature sequence619 810 598 gene locus_tag LOCUS_82600 810 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82600 >Feature sequence620 183 854 gene locus_tag LOCUS_82610 183 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82610 1848 955 gene locus_tag LOCUS_82620 1848 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82620 2128 1856 gene locus_tag LOCUS_82630 2128 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82630 >Feature sequence621 502 1263 gene locus_tag LOCUS_82640 502 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82640 1605 1841 gene locus_tag LOCUS_82650 1605 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82650 >Feature sequence622 652 1359 gene locus_tag LOCUS_82660 652 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82660 >Feature sequence623 1101 166 gene locus_tag LOCUS_82670 1101 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82670 1789 1127 gene locus_tag LOCUS_82680 1789 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82680 >Feature sequence624 918 1745 gene locus_tag LOCUS_82690 918 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82690 >Feature sequence625 >Feature sequence626 1675 1133 gene locus_tag LOCUS_82700 1675 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82700 >Feature sequence627 749 72 gene locus_tag LOCUS_82710 749 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82710 1050 736 gene locus_tag LOCUS_82720 1050 736 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583104.1 protein_id gnl|my_center|LOCUS_82720 1307 1459 gene locus_tag LOCUS_82730 1307 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82730 1438 1662 gene locus_tag LOCUS_82740 1438 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82740 >Feature sequence628 1437 262 gene locus_tag LOCUS_82750 1437 262 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_82750 <2109 1565 gene locus_tag LOCUS_82760 <2109 1565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391806.1:type I glyceraldehyde-3-phosphate dehydrogenase >Feature sequence629 402 82 gene locus_tag LOCUS_82770 402 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82770 777 565 gene locus_tag LOCUS_82780 777 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82780 861 1274 gene locus_tag LOCUS_82790 861 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82790 1686 1387 gene locus_tag LOCUS_82800 1686 1387 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140812.1 protein_id gnl|my_center|LOCUS_82800 1871 1683 gene locus_tag LOCUS_82810 1871 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82810 >Feature sequence630 >Feature sequence631 <2101 509 gene locus_tag LOCUS_82820 <2101 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence632 >Feature sequence633 162 1730 gene locus_tag LOCUS_82830 162 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82830 1811 1999 gene locus_tag LOCUS_82840 1811 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82840 >Feature sequence634 1255 191 gene locus_tag LOCUS_82850 1255 191 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118199.1 protein_id gnl|my_center|LOCUS_82850 2058 1252 gene locus_tag LOCUS_82860 2058 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82860 >Feature sequence635 1329 562 gene locus_tag LOCUS_82870 1329 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922454.1 protein_id gnl|my_center|LOCUS_82870 1718 1461 gene locus_tag LOCUS_82880 1718 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82880 >Feature sequence636 817 395 gene locus_tag LOCUS_82890 817 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82890 1044 814 gene locus_tag LOCUS_82900 1044 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82900 >Feature sequence637 1719 457 gene locus_tag LOCUS_82910 1719 457 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372834.1 protein_id gnl|my_center|LOCUS_82910 >Feature sequence638 1672 341 gene locus_tag LOCUS_82920 1672 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82920 >Feature sequence639 219 1838 gene locus_tag LOCUS_82930 219 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82930 >Feature sequence640 911 90 gene locus_tag LOCUS_82940 911 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82940 1809 1000 gene locus_tag LOCUS_82950 1809 1000 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104155.1 protein_id gnl|my_center|LOCUS_82950 >Feature sequence641 83 9 gene locus_tag LOCUS_t01020 83 9 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1354 155 gene locus_tag LOCUS_82960 1354 155 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 protein_id gnl|my_center|LOCUS_82960 >Feature sequence642 338 1624 gene locus_tag LOCUS_82970 338 1624 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_82970 >Feature sequence643 559 248 gene locus_tag LOCUS_82980 559 248 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461287.1 protein_id gnl|my_center|LOCUS_82980 831 556 gene locus_tag LOCUS_82990 831 556 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213496.1 protein_id gnl|my_center|LOCUS_82990 <1996 891 gene locus_tag LOCUS_83000 <1996 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286502.1:phage tail tape measure protein >Feature sequence644 1088 804 gene locus_tag LOCUS_83010 1088 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83010 1687 1166 gene locus_tag LOCUS_83020 1687 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83020 >Feature sequence645 1738 536 gene locus_tag LOCUS_83030 1738 536 CDS product ISH3-like element ISH27-3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289728.1 protein_id gnl|my_center|LOCUS_83030 >Feature sequence646 >Feature sequence647 967 407 gene locus_tag LOCUS_83040 967 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83040 1891 1004 gene locus_tag LOCUS_83050 1891 1004 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922006.1 protein_id gnl|my_center|LOCUS_83050 >Feature sequence648 <1939 538 gene locus_tag LOCUS_83060 <1939 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020313.1:HesA/MoeB/ThiF family protein >Feature sequence649 >Feature sequence650 1260 346 gene locus_tag LOCUS_83070 1260 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_83070 1893 1321 gene locus_tag LOCUS_83080 1893 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_83080 >Feature sequence651 1529 657 gene locus_tag LOCUS_83090 1529 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83090 >Feature sequence652 1840 470 gene locus_tag LOCUS_83100 1840 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_83100 >Feature sequence653 1915 125 gene locus_tag LOCUS_83110 1915 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83110 >Feature sequence654 284 1708 gene locus_tag LOCUS_83120 284 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83120 >Feature sequence655 923 519 gene locus_tag LOCUS_83130 923 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83130 1177 914 gene locus_tag LOCUS_83140 1177 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83140 >Feature sequence656 1553 381 gene locus_tag LOCUS_83150 1553 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83150 >Feature sequence657 436 1122 gene locus_tag LOCUS_83160 436 1122 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528893.1 protein_id gnl|my_center|LOCUS_83160 >Feature sequence658 178 339 gene locus_tag LOCUS_83170 178 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83170 1271 465 gene locus_tag LOCUS_83180 1271 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83180 1902 1624 gene locus_tag LOCUS_83190 1902 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83190 >Feature sequence659 <1 1727 gene locus_tag LOCUS_83200 <1 1727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286502.1:phage tail tape measure protein >Feature sequence660 >Feature sequence661 1341 625 gene locus_tag LOCUS_83210 1341 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83210 >Feature sequence662 303 1442 gene locus_tag LOCUS_83220 gene wecB 303 1442 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250181.1 protein_id gnl|my_center|LOCUS_83220 >Feature sequence663 <1 590 gene locus_tag LOCUS_83230 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785074.1:alpha-L-fucosidase 617 1870 gene locus_tag LOCUS_83240 617 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83240 >Feature sequence664 3 1244 gene locus_tag LOCUS_83250 3 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83250 >Feature sequence665 >Feature sequence666 1261 32 gene locus_tag LOCUS_83260 1261 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_83260 >Feature sequence667 1756 470 gene locus_tag LOCUS_83270 1756 470 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_83270 >Feature sequence668 648 316 gene locus_tag LOCUS_83280 648 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83280 >Feature sequence669 1506 538 gene locus_tag LOCUS_83290 1506 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83290 >Feature sequence670 1147 323 gene locus_tag LOCUS_83300 1147 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83300 1381 1725 gene locus_tag LOCUS_83310 1381 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83310 >Feature sequence671 690 364 gene locus_tag LOCUS_83320 gene rpsJ 690 364 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_83320 1229 1612 gene locus_tag LOCUS_83330 1229 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83330 >Feature sequence672 >Feature sequence673 >Feature sequence674 834 370 gene locus_tag LOCUS_83340 834 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83340 >Feature sequence675 207 1487 gene locus_tag LOCUS_83350 207 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83350 >Feature sequence676 >Feature sequence677 1030 722 gene locus_tag LOCUS_83360 1030 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83360 >Feature sequence678 >Feature sequence679 3 377 gene locus_tag LOCUS_83370 3 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83370 498 863 gene locus_tag LOCUS_83380 498 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83380 866 1528 gene locus_tag LOCUS_83390 866 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83390 >Feature sequence680 1755 1306 gene locus_tag LOCUS_83400 1755 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83400 >Feature sequence681 >Feature sequence682 <1 1176 gene locus_tag LOCUS_83410 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence683 >Feature sequence684 1020 334 gene locus_tag LOCUS_83420 1020 334 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_83420 >Feature sequence685 1511 840 gene locus_tag LOCUS_83430 1511 840 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814050.1 protein_id gnl|my_center|LOCUS_83430 >Feature sequence686 1560 181 gene locus_tag LOCUS_83440 1560 181 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_83440 >Feature sequence687 >Feature sequence688 1517 516 gene locus_tag LOCUS_83450 1517 516 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674809.1 protein_id gnl|my_center|LOCUS_83450 >Feature sequence689 >Feature sequence690 237 1127 gene locus_tag LOCUS_83460 237 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83460 >Feature sequence691 >Feature sequence692 188 736 gene locus_tag LOCUS_83470 188 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83470 733 1389 gene locus_tag LOCUS_83480 733 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83480 >Feature sequence693 >Feature sequence694 1347 85 gene locus_tag LOCUS_83490 1347 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83490 1607 1522 gene locus_tag LOCUS_t01030 1607 1522 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence695 >Feature sequence696 <1661 192 gene locus_tag LOCUS_83500 <1661 192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460998.1:IS1634 family transposase >Feature sequence697 1402 209 gene locus_tag LOCUS_83510 1402 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83510 >Feature sequence698 >Feature sequence699 >Feature sequence700 7 1095 gene locus_tag LOCUS_83520 gene dpaL 7 1095 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812104.1 protein_id gnl|my_center|LOCUS_83520 >Feature sequence701 430 897 gene locus_tag LOCUS_83530 430 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83530 >Feature sequence702 185 481 gene locus_tag LOCUS_83540 185 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_83540 625 1332 gene locus_tag LOCUS_83550 625 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_83550 >Feature sequence703 628 410 gene locus_tag LOCUS_83560 628 410 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_83560 884 618 gene locus_tag LOCUS_83570 884 618 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_83570 >Feature sequence704 >Feature sequence705 >Feature sequence706 170 27 gene locus_tag LOCUS_83580 170 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83580 607 392 gene locus_tag LOCUS_83590 607 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83590 <1612 764 gene locus_tag LOCUS_83600 <1612 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181406033.1:ATP-dependent protease ATPase subunit HslU >Feature sequence707 >Feature sequence708 868 683 gene locus_tag LOCUS_83610 868 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83610 >Feature sequence709 >Feature sequence710 528 761 gene locus_tag LOCUS_83620 528 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83620 >Feature sequence711 1316 501 gene locus_tag LOCUS_83630 1316 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83630 >Feature sequence712 >Feature sequence713 >Feature sequence714 180 734 gene locus_tag LOCUS_83640 180 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83640 867 1028 gene locus_tag LOCUS_83650 867 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83650 >Feature sequence715 <1553 264 gene locus_tag LOCUS_83660 <1553 264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033043268.1:Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain >Feature sequence716 421 107 gene locus_tag LOCUS_83670 421 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83670 796 422 gene locus_tag LOCUS_83680 796 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83680 1277 993 gene locus_tag LOCUS_83690 1277 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83690 >Feature sequence717 1451 1239 gene locus_tag LOCUS_83700 1451 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83700 >Feature sequence718 >Feature sequence719 466 780 gene locus_tag LOCUS_83710 466 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83710 722 1081 gene locus_tag LOCUS_83720 722 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83720 >Feature sequence720 >Feature sequence721 190 438 gene locus_tag LOCUS_83730 190 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83730 686 1330 gene locus_tag LOCUS_83740 686 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83740