>Feature sequence001 962 1672 gene locus_tag LOCUS_00010 962 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2650 1835 gene locus_tag LOCUS_00020 gene larE 2650 1835 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080596.1 protein_id gnl|my_center|LOCUS_00020 3024 2707 gene locus_tag LOCUS_00030 3024 2707 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990605.1 protein_id gnl|my_center|LOCUS_00030 3249 4730 gene locus_tag LOCUS_00040 3249 4730 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990604.1 protein_id gnl|my_center|LOCUS_00040 4727 5149 gene locus_tag LOCUS_00050 4727 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5150 5443 gene locus_tag LOCUS_00060 5150 5443 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023978.1 protein_id gnl|my_center|LOCUS_00060 6307 5507 gene locus_tag LOCUS_00070 6307 5507 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245141.1 protein_id gnl|my_center|LOCUS_00070 6576 7736 gene locus_tag LOCUS_00080 gene nifS 6576 7736 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_00080 7780 8172 gene locus_tag LOCUS_00090 gene nifU 7780 8172 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_00090 8890 8210 gene locus_tag LOCUS_00100 8890 8210 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 protein_id gnl|my_center|LOCUS_00100 9474 9166 gene locus_tag LOCUS_00110 9474 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10248 9535 gene locus_tag LOCUS_00120 10248 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11433 10504 gene locus_tag LOCUS_00130 gene cysK 11433 10504 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022680.1 protein_id gnl|my_center|LOCUS_00130 12555 11656 gene locus_tag LOCUS_00140 gene pdxS 12555 11656 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065155.1 protein_id gnl|my_center|LOCUS_00140 13730 12726 gene locus_tag LOCUS_00150 13730 12726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_00150 14018 13806 gene locus_tag LOCUS_00160 14018 13806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14261 14037 gene locus_tag LOCUS_00170 14261 14037 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015106.1 protein_id gnl|my_center|LOCUS_00170 15085 14258 gene locus_tag LOCUS_00180 gene moeB 15085 14258 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942003.1 protein_id gnl|my_center|LOCUS_00180 15978 15082 gene locus_tag LOCUS_00190 15978 15082 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_00190 17020 16091 gene locus_tag LOCUS_00200 17020 16091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17264 17614 gene locus_tag LOCUS_00210 17264 17614 CDS product DUF2173 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022242.1 protein_id gnl|my_center|LOCUS_00210 18596 17712 gene locus_tag LOCUS_00220 18596 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 18544 18807 gene locus_tag LOCUS_00230 18544 18807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 18849 19043 gene locus_tag LOCUS_00240 18849 19043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 19461 20426 gene locus_tag LOCUS_00250 19461 20426 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_00250 20717 22021 gene locus_tag LOCUS_00260 20717 22021 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022675.1 protein_id gnl|my_center|LOCUS_00260 22511 23014 gene locus_tag LOCUS_00270 22511 23014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00270 23888 23487 gene locus_tag LOCUS_00280 23888 23487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 24431 24132 gene locus_tag LOCUS_00290 24431 24132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 24758 24534 gene locus_tag LOCUS_00300 24758 24534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 24997 25260 gene locus_tag LOCUS_00310 24997 25260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 25471 25292 gene locus_tag LOCUS_00320 25471 25292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 25662 25471 gene locus_tag LOCUS_00330 25662 25471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 25873 26190 gene locus_tag LOCUS_00340 25873 26190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 26725 26210 gene locus_tag LOCUS_00350 26725 26210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 26918 26718 gene locus_tag LOCUS_00360 26918 26718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 27950 27222 gene locus_tag LOCUS_00370 27950 27222 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513090.1 protein_id gnl|my_center|LOCUS_00370 28370 28038 gene locus_tag LOCUS_00380 28370 28038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 28589 29290 gene locus_tag LOCUS_00390 28589 29290 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990768.1 protein_id gnl|my_center|LOCUS_00390 29510 29854 gene locus_tag LOCUS_00400 29510 29854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 31305 29863 gene locus_tag LOCUS_00410 gene cysS 31305 29863 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_00410 31381 31311 gene locus_tag LOCUS_t00010 31381 31311 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 31551 31841 gene locus_tag LOCUS_00420 31551 31841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023825.1 protein_id gnl|my_center|LOCUS_00420 32827 32165 gene locus_tag LOCUS_00430 32827 32165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 33252 33596 gene locus_tag LOCUS_00440 33252 33596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 33593 34777 gene locus_tag LOCUS_00450 33593 34777 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941337.1 protein_id gnl|my_center|LOCUS_00450 34774 35454 gene locus_tag LOCUS_00460 34774 35454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811482.1 protein_id gnl|my_center|LOCUS_00460 35609 36682 gene locus_tag LOCUS_00470 35609 36682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 36829 37821 gene locus_tag LOCUS_00480 36829 37821 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 protein_id gnl|my_center|LOCUS_00480 38520 38335 gene locus_tag LOCUS_00490 38520 38335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 40266 38575 gene locus_tag LOCUS_00500 40266 38575 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272653.1 protein_id gnl|my_center|LOCUS_00500 43399 40253 gene locus_tag LOCUS_00510 43399 40253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 43739 43509 gene locus_tag LOCUS_00520 43739 43509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 43923 43732 gene locus_tag LOCUS_00530 43923 43732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 44077 44574 gene locus_tag LOCUS_00540 44077 44574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 45597 44611 gene locus_tag LOCUS_00550 45597 44611 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022212.1 protein_id gnl|my_center|LOCUS_00550 46097 45594 gene locus_tag LOCUS_00560 46097 45594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 46245 46162 gene locus_tag LOCUS_t00020 46245 46162 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 46900 46352 gene locus_tag LOCUS_00570 46900 46352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 47152 47523 gene locus_tag LOCUS_00580 47152 47523 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990683.1 protein_id gnl|my_center|LOCUS_00580 49502 47826 gene locus_tag LOCUS_00590 49502 47826 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229333.1 protein_id gnl|my_center|LOCUS_00590 50789 50604 gene locus_tag LOCUS_00600 50789 50604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 50851 53526 gene locus_tag LOCUS_00610 50851 53526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 53821 53543 gene locus_tag LOCUS_00620 53821 53543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 54440 53988 gene locus_tag LOCUS_00630 54440 53988 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878403.1 protein_id gnl|my_center|LOCUS_00630 55431 54457 gene locus_tag LOCUS_00640 55431 54457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 56472 55552 gene locus_tag LOCUS_00650 gene purC 56472 55552 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878767.1 protein_id gnl|my_center|LOCUS_00650 58192 56549 gene locus_tag LOCUS_00660 gene thsB 58192 56549 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_00660 59655 58330 gene locus_tag LOCUS_00670 gene glnA 59655 58330 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024100.1 protein_id gnl|my_center|LOCUS_00670 59753 61171 gene locus_tag LOCUS_00680 gene purD 59753 61171 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878654.1 protein_id gnl|my_center|LOCUS_00680 61212 62192 gene locus_tag LOCUS_00690 61212 62192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 62657 62196 gene locus_tag LOCUS_00700 62657 62196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 63299 62694 gene locus_tag LOCUS_00710 63299 62694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 63958 63566 gene locus_tag LOCUS_00720 63958 63566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 65315 64224 gene locus_tag LOCUS_00730 65315 64224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 67143 65398 gene locus_tag LOCUS_00740 67143 65398 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_00740 67976 67140 gene locus_tag LOCUS_00750 67976 67140 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 protein_id gnl|my_center|LOCUS_00750 68212 68694 gene locus_tag LOCUS_00760 68212 68694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 70589 68691 gene locus_tag LOCUS_00770 70589 68691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 72095 70674 gene locus_tag LOCUS_00780 72095 70674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 73458 72106 gene locus_tag LOCUS_00790 gene purH 73458 72106 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_00790 73543 73875 gene locus_tag LOCUS_00800 73543 73875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 73872 74303 gene locus_tag LOCUS_00810 73872 74303 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023990.1 protein_id gnl|my_center|LOCUS_00810 75233 74508 gene locus_tag LOCUS_00820 75233 74508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 75443 75592 gene locus_tag LOCUS_00830 75443 75592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 75576 75848 gene locus_tag LOCUS_00840 75576 75848 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065388.1 protein_id gnl|my_center|LOCUS_00840 75845 76246 gene locus_tag LOCUS_00850 75845 76246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022359.1 protein_id gnl|my_center|LOCUS_00850 76694 76260 gene locus_tag LOCUS_00860 76694 76260 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066543.1 protein_id gnl|my_center|LOCUS_00860 77479 77090 gene locus_tag LOCUS_00870 77479 77090 CDS product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 protein_id gnl|my_center|LOCUS_00870 >Feature sequence002 17 448 gene locus_tag LOCUS_00880 17 448 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811678.1 protein_id gnl|my_center|LOCUS_00880 1680 628 gene locus_tag LOCUS_00890 1680 628 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_00890 3251 1716 gene locus_tag LOCUS_00900 3251 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 3236 4588 gene locus_tag LOCUS_00910 3236 4588 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_00910 4598 5419 gene locus_tag LOCUS_00920 gene pheA 4598 5419 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066451.1 protein_id gnl|my_center|LOCUS_00920 5506 7656 gene locus_tag LOCUS_00930 gene glgP 5506 7656 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_00930 7814 8350 gene locus_tag LOCUS_00940 7814 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 8458 8868 gene locus_tag LOCUS_00950 8458 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 10441 8933 gene locus_tag LOCUS_00960 gene gpmI 10441 8933 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964031.1 protein_id gnl|my_center|LOCUS_00960 11104 10481 gene locus_tag LOCUS_00970 11104 10481 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877550.1 protein_id gnl|my_center|LOCUS_00970 11664 11101 gene locus_tag LOCUS_00980 11664 11101 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020594.1 protein_id gnl|my_center|LOCUS_00980 12277 11690 gene locus_tag LOCUS_00990 12277 11690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 13467 12274 gene locus_tag LOCUS_01000 13467 12274 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061302.1 protein_id gnl|my_center|LOCUS_01000 13576 14040 gene locus_tag LOCUS_01010 13576 14040 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876721.1 protein_id gnl|my_center|LOCUS_01010 14130 14636 gene locus_tag LOCUS_01020 14130 14636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 14655 15407 gene locus_tag LOCUS_01030 14655 15407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 15966 15436 gene locus_tag LOCUS_01040 15966 15436 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022955.1 protein_id gnl|my_center|LOCUS_01040 17153 15963 gene locus_tag LOCUS_01050 17153 15963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 18275 17205 gene locus_tag LOCUS_01060 18275 17205 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 protein_id gnl|my_center|LOCUS_01060 18394 18921 gene locus_tag LOCUS_01070 gene hisB 18394 18921 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496583.1 protein_id gnl|my_center|LOCUS_01070 21479 18918 gene locus_tag LOCUS_01080 21479 18918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 21650 22444 gene locus_tag LOCUS_01090 gene cfbC 21650 22444 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023535.1 protein_id gnl|my_center|LOCUS_01090 22462 23859 gene locus_tag LOCUS_01100 gene cfbB 22462 23859 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_01100 23885 24289 gene locus_tag LOCUS_01110 23885 24289 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065151.1 protein_id gnl|my_center|LOCUS_01110 25689 24775 gene locus_tag LOCUS_01120 25689 24775 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 protein_id gnl|my_center|LOCUS_01120 27170 25692 gene locus_tag LOCUS_01130 gene proS 27170 25692 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023782.1 protein_id gnl|my_center|LOCUS_01130 27733 27167 gene locus_tag LOCUS_01140 27733 27167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 28416 27802 gene locus_tag LOCUS_01150 28416 27802 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064923.1 protein_id gnl|my_center|LOCUS_01150 28560 28488 gene locus_tag LOCUS_t00030 28560 28488 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 29980 28589 gene locus_tag LOCUS_01160 29980 28589 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065134.1 protein_id gnl|my_center|LOCUS_01160 30757 30266 gene locus_tag LOCUS_01170 30757 30266 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020591.1 protein_id gnl|my_center|LOCUS_01170 33971 30810 gene locus_tag LOCUS_01180 gene ileS 33971 30810 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022402.1 protein_id gnl|my_center|LOCUS_01180 34857 34552 gene locus_tag LOCUS_01190 34857 34552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 35961 34975 gene locus_tag LOCUS_01200 35961 34975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 36876 36118 gene locus_tag LOCUS_01210 36876 36118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 37110 37577 gene locus_tag LOCUS_01220 37110 37577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 37626 38096 gene locus_tag LOCUS_01230 37626 38096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 38372 38653 gene locus_tag LOCUS_01240 38372 38653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 39599 38655 gene locus_tag LOCUS_01250 39599 38655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 41655 39706 gene locus_tag LOCUS_01260 gene feoB 41655 39706 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060770.1 protein_id gnl|my_center|LOCUS_01260 42364 41648 gene locus_tag LOCUS_01270 42364 41648 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330364.1 protein_id gnl|my_center|LOCUS_01270 42737 43192 gene locus_tag LOCUS_01280 42737 43192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 43209 43949 gene locus_tag LOCUS_01290 gene rlmJ 43209 43949 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402281.1 protein_id gnl|my_center|LOCUS_01290 43987 45969 gene locus_tag LOCUS_01300 43987 45969 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_01300 46435 45956 gene locus_tag LOCUS_01310 46435 45956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 48733 47570 gene locus_tag LOCUS_01320 48733 47570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 49281 48733 gene locus_tag LOCUS_01330 49281 48733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 49844 50944 gene locus_tag LOCUS_01340 49844 50944 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022968.1 protein_id gnl|my_center|LOCUS_01340 51005 51493 gene locus_tag LOCUS_01350 51005 51493 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021413.1 protein_id gnl|my_center|LOCUS_01350 51500 52078 gene locus_tag LOCUS_01360 51500 52078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 52075 52488 gene locus_tag LOCUS_01370 gene trxA 52075 52488 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173768.1 protein_id gnl|my_center|LOCUS_01370 52902 52507 gene locus_tag LOCUS_01380 52902 52507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 53965 52880 gene locus_tag LOCUS_01390 53965 52880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065646.1 protein_id gnl|my_center|LOCUS_01390 55681 54035 gene locus_tag LOCUS_01400 55681 54035 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878819.1 protein_id gnl|my_center|LOCUS_01400 56314 55772 gene locus_tag LOCUS_01410 56314 55772 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020937.1 protein_id gnl|my_center|LOCUS_01410 57116 56295 gene locus_tag LOCUS_01420 57116 56295 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_01420 57418 57113 gene locus_tag LOCUS_01430 gene eif1A 57418 57113 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064992.1 protein_id gnl|my_center|LOCUS_01430 57623 57550 gene locus_tag LOCUS_t00040 57623 57550 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 57745 58530 gene locus_tag LOCUS_01440 gene uppS 57745 58530 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990666.1 protein_id gnl|my_center|LOCUS_01440 58561 58650 gene locus_tag LOCUS_t00050 58561 58650 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 60323 58620 gene locus_tag LOCUS_01450 60323 58620 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460921.1 protein_id gnl|my_center|LOCUS_01450 61177 60323 gene locus_tag LOCUS_01460 61177 60323 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066027.1 protein_id gnl|my_center|LOCUS_01460 62150 61167 gene locus_tag LOCUS_01470 62150 61167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020886.1 protein_id gnl|my_center|LOCUS_01470 62626 62147 gene locus_tag LOCUS_01480 gene tsaA 62626 62147 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082829.1 protein_id gnl|my_center|LOCUS_01480 64376 62796 gene locus_tag LOCUS_01490 64376 62796 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 protein_id gnl|my_center|LOCUS_01490 65348 64542 gene locus_tag LOCUS_01500 65348 64542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 68826 65446 gene locus_tag LOCUS_01510 68826 65446 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024425.1 protein_id gnl|my_center|LOCUS_01510 >Feature sequence003 8 775 gene locus_tag LOCUS_01520 gene mcrG 8 775 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024420.1 protein_id gnl|my_center|LOCUS_01520 789 2468 gene locus_tag LOCUS_01530 gene mcrA 789 2468 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024419.1 protein_id gnl|my_center|LOCUS_01530 3536 2517 gene locus_tag LOCUS_01540 3536 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 4948 3635 gene locus_tag LOCUS_01550 4948 3635 CDS product methyl-coenzyme M reductase glutamine C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496936.1 protein_id gnl|my_center|LOCUS_01550 5355 6458 gene locus_tag LOCUS_01560 5355 6458 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024465.1 protein_id gnl|my_center|LOCUS_01560 6474 7136 gene locus_tag LOCUS_01570 gene aroD 6474 7136 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_01570 7333 8460 gene locus_tag LOCUS_01580 gene mmp10 7333 8460 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024424.1 protein_id gnl|my_center|LOCUS_01580 8773 8486 gene locus_tag LOCUS_01590 8773 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 8857 8785 gene locus_tag LOCUS_t00060 8857 8785 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9473 9072 gene locus_tag LOCUS_01600 gene nifU 9473 9072 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_01600 9741 10763 gene locus_tag LOCUS_01610 gene rtcA 9741 10763 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024505.1 protein_id gnl|my_center|LOCUS_01610 11483 10776 gene locus_tag LOCUS_01620 11483 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 12173 11487 gene locus_tag LOCUS_01630 12173 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 12296 13111 gene locus_tag LOCUS_01640 12296 13111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 13129 13599 gene locus_tag LOCUS_01650 13129 13599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 14136 13921 gene locus_tag LOCUS_01660 14136 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 14825 14370 gene locus_tag LOCUS_01670 14825 14370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 15825 14911 gene locus_tag LOCUS_01680 15825 14911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 15920 17065 gene locus_tag LOCUS_01690 gene pscS 15920 17065 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020767.1 protein_id gnl|my_center|LOCUS_01690 17052 17621 gene locus_tag LOCUS_01700 17052 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 18317 17640 gene locus_tag LOCUS_01710 18317 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 19033 18314 gene locus_tag LOCUS_01720 19033 18314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 20580 19135 gene locus_tag LOCUS_01730 20580 19135 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_01730 21624 20581 gene locus_tag LOCUS_01740 gene vorB 21624 20581 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060884.1 protein_id gnl|my_center|LOCUS_01740 23524 21626 gene locus_tag LOCUS_01750 23524 21626 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_01750 24086 23538 gene locus_tag LOCUS_01760 24086 23538 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 protein_id gnl|my_center|LOCUS_01760 24451 25104 gene locus_tag LOCUS_01770 24451 25104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 25097 26125 gene locus_tag LOCUS_01780 25097 26125 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879792.1 protein_id gnl|my_center|LOCUS_01780 26162 26686 gene locus_tag LOCUS_01790 26162 26686 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879795.1 protein_id gnl|my_center|LOCUS_01790 26659 27819 gene locus_tag LOCUS_01800 26659 27819 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879796.1 protein_id gnl|my_center|LOCUS_01800 27878 28618 gene locus_tag LOCUS_01810 27878 28618 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066594.1 protein_id gnl|my_center|LOCUS_01810 28625 29014 gene locus_tag LOCUS_01820 28625 29014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 29011 30498 gene locus_tag LOCUS_01830 29011 30498 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023773.1 protein_id gnl|my_center|LOCUS_01830 30527 31384 gene locus_tag LOCUS_01840 30527 31384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 31489 31857 gene locus_tag LOCUS_01850 gene rpl7ae 31489 31857 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053845.1 protein_id gnl|my_center|LOCUS_01850 31868 32080 gene locus_tag LOCUS_01860 31868 32080 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065141.1 protein_id gnl|my_center|LOCUS_01860 32088 32258 gene locus_tag LOCUS_01870 32088 32258 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021537.1 protein_id gnl|my_center|LOCUS_01870 32271 32720 gene locus_tag LOCUS_01880 gene ndk 32271 32720 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065142.1 protein_id gnl|my_center|LOCUS_01880 32818 34626 gene locus_tag LOCUS_01890 gene infB 32818 34626 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065143.1 protein_id gnl|my_center|LOCUS_01890 36081 34666 gene locus_tag LOCUS_01900 gene gatB 36081 34666 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024400.1 protein_id gnl|my_center|LOCUS_01900 37494 36082 gene locus_tag LOCUS_01910 gene gatA 37494 36082 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066007.1 protein_id gnl|my_center|LOCUS_01910 37790 37497 gene locus_tag LOCUS_01920 gene gatC 37790 37497 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024398.1 protein_id gnl|my_center|LOCUS_01920 37961 38953 gene locus_tag LOCUS_01930 37961 38953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 39535 39933 gene locus_tag LOCUS_01940 39535 39933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 40160 40792 gene locus_tag LOCUS_01950 40160 40792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 41249 41413 gene locus_tag LOCUS_01960 41249 41413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 41438 42097 gene locus_tag LOCUS_01970 41438 42097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_01970 42098 42991 gene locus_tag LOCUS_01980 42098 42991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 43009 44229 gene locus_tag LOCUS_01990 43009 44229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_01990 45636 44242 gene locus_tag LOCUS_02000 45636 44242 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_02000 45976 45725 gene locus_tag LOCUS_02010 45976 45725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence004 551 2260 gene locus_tag LOCUS_02020 gene oadA 551 2260 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020719.1 protein_id gnl|my_center|LOCUS_02020 2940 3263 gene locus_tag LOCUS_02030 2940 3263 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060879.1 protein_id gnl|my_center|LOCUS_02030 3689 3423 gene locus_tag LOCUS_02040 3689 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02040 4094 3699 gene locus_tag LOCUS_02050 4094 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 4629 5294 gene locus_tag LOCUS_02060 4629 5294 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064937.1 protein_id gnl|my_center|LOCUS_02060 5314 6624 gene locus_tag LOCUS_02070 5314 6624 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 protein_id gnl|my_center|LOCUS_02070 6769 7062 gene locus_tag LOCUS_02080 6769 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 7326 7102 gene locus_tag LOCUS_02090 7326 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7592 9256 gene locus_tag LOCUS_02100 7592 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 9554 10333 gene locus_tag LOCUS_02110 9554 10333 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022803.1 protein_id gnl|my_center|LOCUS_02110 10335 10766 gene locus_tag LOCUS_02120 10335 10766 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878243.1 protein_id gnl|my_center|LOCUS_02120 13266 10735 gene locus_tag LOCUS_02130 13266 10735 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_02130 13528 14211 gene locus_tag LOCUS_02140 13528 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 14362 16179 gene locus_tag LOCUS_02150 14362 16179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 16202 16402 gene locus_tag LOCUS_02160 16202 16402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 17806 16958 gene locus_tag LOCUS_02170 17806 16958 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_02170 18333 17803 gene locus_tag LOCUS_02180 18333 17803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 19390 18335 gene locus_tag LOCUS_02190 19390 18335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02190 19731 19393 gene locus_tag LOCUS_02200 19731 19393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02200 22100 19749 gene locus_tag LOCUS_02210 gene hdrA2 22100 19749 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022820.1 protein_id gnl|my_center|LOCUS_02210 23552 22335 gene locus_tag LOCUS_02220 gene mmp10 23552 22335 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024424.1 protein_id gnl|my_center|LOCUS_02220 24501 23593 gene locus_tag LOCUS_02230 24501 23593 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081007.1 protein_id gnl|my_center|LOCUS_02230 24727 28242 gene locus_tag LOCUS_02240 gene smc 24727 28242 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_02240 28251 28940 gene locus_tag LOCUS_02250 28251 28940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 29097 30209 gene locus_tag LOCUS_02260 29097 30209 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_02260 31231 30236 gene locus_tag LOCUS_02270 31231 30236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 32313 31228 gene locus_tag LOCUS_02280 gene wecB 32313 31228 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_02280 33512 32313 gene locus_tag LOCUS_02290 33512 32313 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868281.1 protein_id gnl|my_center|LOCUS_02290 34089 33514 gene locus_tag LOCUS_02300 34089 33514 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 protein_id gnl|my_center|LOCUS_02300 35000 34089 gene locus_tag LOCUS_02310 35000 34089 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583191.1 protein_id gnl|my_center|LOCUS_02310 36115 35003 gene locus_tag LOCUS_02320 36115 35003 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_02320 37369 36155 gene locus_tag LOCUS_02330 37369 36155 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022964.1 protein_id gnl|my_center|LOCUS_02330 37467 38117 gene locus_tag LOCUS_02340 37467 38117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 39856 38114 gene locus_tag LOCUS_02350 39856 38114 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022903.1 protein_id gnl|my_center|LOCUS_02350 40323 39871 gene locus_tag LOCUS_02360 40323 39871 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022904.1 protein_id gnl|my_center|LOCUS_02360 41514 40399 gene locus_tag LOCUS_02370 gene fbp 41514 40399 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251114.1 protein_id gnl|my_center|LOCUS_02370 41742 41515 gene locus_tag LOCUS_02380 41742 41515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 42044 42361 gene locus_tag LOCUS_02390 42044 42361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 >Feature sequence005 1935 1069 gene locus_tag LOCUS_02400 1935 1069 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013188.1 protein_id gnl|my_center|LOCUS_02400 3209 1932 gene locus_tag LOCUS_02410 3209 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3527 3210 gene locus_tag LOCUS_02420 3527 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_02420 3579 4250 gene locus_tag LOCUS_02430 3579 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545105.1 protein_id gnl|my_center|LOCUS_02430 5372 4254 gene locus_tag LOCUS_02440 gene ftsZ 5372 4254 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_02440 5996 5601 gene locus_tag LOCUS_02450 5996 5601 CDS product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 protein_id gnl|my_center|LOCUS_02450 6177 7022 gene locus_tag LOCUS_02460 6177 7022 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022219.1 protein_id gnl|my_center|LOCUS_02460 7658 7035 gene locus_tag LOCUS_02470 7658 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 8507 7668 gene locus_tag LOCUS_02480 8507 7668 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902847.1 protein_id gnl|my_center|LOCUS_02480 8701 9927 gene locus_tag LOCUS_02490 8701 9927 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022958.1 protein_id gnl|my_center|LOCUS_02490 9927 10742 gene locus_tag LOCUS_02500 9927 10742 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022957.1 protein_id gnl|my_center|LOCUS_02500 10790 11020 gene locus_tag LOCUS_02510 10790 11020 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021598.1 protein_id gnl|my_center|LOCUS_02510 11040 12875 gene locus_tag LOCUS_02520 11040 12875 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_02520 12878 13960 gene locus_tag LOCUS_02530 12878 13960 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065160.1 protein_id gnl|my_center|LOCUS_02530 14034 14216 gene locus_tag LOCUS_02540 14034 14216 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 protein_id gnl|my_center|LOCUS_02540 14320 15222 gene locus_tag LOCUS_02550 14320 15222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 15225 16829 gene locus_tag LOCUS_02560 gene pyrG 15225 16829 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023212.1 protein_id gnl|my_center|LOCUS_02560 17032 18102 gene locus_tag LOCUS_02570 17032 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 18166 19746 gene locus_tag LOCUS_02580 18166 19746 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 protein_id gnl|my_center|LOCUS_02580 19762 20511 gene locus_tag LOCUS_02590 19762 20511 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065715.1 protein_id gnl|my_center|LOCUS_02590 20541 21116 gene locus_tag LOCUS_02600 20541 21116 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023254.1 protein_id gnl|my_center|LOCUS_02600 21135 21350 gene locus_tag LOCUS_02610 21135 21350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 21422 23698 gene locus_tag LOCUS_02620 21422 23698 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021816.1 protein_id gnl|my_center|LOCUS_02620 24043 23723 gene locus_tag LOCUS_02630 24043 23723 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979305.1 protein_id gnl|my_center|LOCUS_02630 24431 24045 gene locus_tag LOCUS_02640 gene moaE 24431 24045 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705489.1 protein_id gnl|my_center|LOCUS_02640 24717 24439 gene locus_tag LOCUS_02650 24717 24439 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879121.1 protein_id gnl|my_center|LOCUS_02650 25082 24720 gene locus_tag LOCUS_02660 25082 24720 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020188.1 protein_id gnl|my_center|LOCUS_02660 25528 25079 gene locus_tag LOCUS_02670 25528 25079 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020187.1 protein_id gnl|my_center|LOCUS_02670 26317 25553 gene locus_tag LOCUS_02680 26317 25553 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_02680 26504 26310 gene locus_tag LOCUS_02690 26504 26310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 27493 26543 gene locus_tag LOCUS_02700 gene hemB 27493 26543 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020627.1 protein_id gnl|my_center|LOCUS_02700 28749 27490 gene locus_tag LOCUS_02710 gene hemA 28749 27490 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_02710 29386 28679 gene locus_tag LOCUS_02720 29386 28679 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020625.1 protein_id gnl|my_center|LOCUS_02720 29851 29393 gene locus_tag LOCUS_02730 gene ahbB 29851 29393 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 protein_id gnl|my_center|LOCUS_02730 31992 29851 gene locus_tag LOCUS_02740 31992 29851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 32108 33388 gene locus_tag LOCUS_02750 32108 33388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 34572 33577 gene locus_tag LOCUS_02760 gene ilvC 34572 33577 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_02760 35171 34680 gene locus_tag LOCUS_02770 gene ilvN 35171 34680 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_02770 36926 35172 gene locus_tag LOCUS_02780 36926 35172 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_02780 38434 36911 gene locus_tag LOCUS_02790 38434 36911 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 protein_id gnl|my_center|LOCUS_02790 38597 39004 gene locus_tag LOCUS_02800 38597 39004 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876265.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence006 856 23 gene locus_tag LOCUS_02810 856 23 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023915.1 protein_id gnl|my_center|LOCUS_02810 1799 861 gene locus_tag LOCUS_02820 gene cbiQ 1799 861 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023916.1 protein_id gnl|my_center|LOCUS_02820 2035 1811 gene locus_tag LOCUS_02830 2035 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 2179 2622 gene locus_tag LOCUS_02840 2179 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 2703 3350 gene locus_tag LOCUS_02850 2703 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 4276 3362 gene locus_tag LOCUS_02860 4276 3362 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023905.1 protein_id gnl|my_center|LOCUS_02860 4859 5533 gene locus_tag LOCUS_02870 gene pyrH 4859 5533 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020429.1 protein_id gnl|my_center|LOCUS_02870 6386 5520 gene locus_tag LOCUS_02880 6386 5520 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021408.1 protein_id gnl|my_center|LOCUS_02880 7627 6527 gene locus_tag LOCUS_02890 7627 6527 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024301.1 protein_id gnl|my_center|LOCUS_02890 7950 7627 gene locus_tag LOCUS_02900 gene hisI 7950 7627 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020946.1 protein_id gnl|my_center|LOCUS_02900 8001 9179 gene locus_tag LOCUS_02910 8001 9179 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_02910 10377 9205 gene locus_tag LOCUS_02920 10377 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 11696 10485 gene locus_tag LOCUS_02930 gene larA 11696 10485 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_02930 12597 11740 gene locus_tag LOCUS_02940 12597 11740 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023085.1 protein_id gnl|my_center|LOCUS_02940 13566 12610 gene locus_tag LOCUS_02950 13566 12610 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023086.1 protein_id gnl|my_center|LOCUS_02950 14107 13745 gene locus_tag LOCUS_02960 14107 13745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 15021 15434 gene locus_tag LOCUS_02970 15021 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 16013 15633 gene locus_tag LOCUS_02980 16013 15633 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020961.1 protein_id gnl|my_center|LOCUS_02980 17670 16096 gene locus_tag LOCUS_02990 17670 16096 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_02990 18110 17658 gene locus_tag LOCUS_03000 18110 17658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 18919 18356 gene locus_tag LOCUS_03010 18919 18356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 19822 19046 gene locus_tag LOCUS_03020 19822 19046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_03020 20949 19822 gene locus_tag LOCUS_03030 20949 19822 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066493.1 protein_id gnl|my_center|LOCUS_03030 21800 20946 gene locus_tag LOCUS_03040 21800 20946 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_03040 22564 21734 gene locus_tag LOCUS_03050 22564 21734 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021378.1 protein_id gnl|my_center|LOCUS_03050 23714 22575 gene locus_tag LOCUS_03060 23714 22575 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023374.1 protein_id gnl|my_center|LOCUS_03060 24684 23920 gene locus_tag LOCUS_03070 24684 23920 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083333.1 protein_id gnl|my_center|LOCUS_03070 25661 24744 gene locus_tag LOCUS_03080 25661 24744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 27311 25917 gene locus_tag LOCUS_03090 27311 25917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 27575 28858 gene locus_tag LOCUS_03100 gene thiC 27575 28858 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024209.1 protein_id gnl|my_center|LOCUS_03100 29322 28855 gene locus_tag LOCUS_03110 29322 28855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 29441 30544 gene locus_tag LOCUS_03120 29441 30544 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_03120 30551 31438 gene locus_tag LOCUS_03130 30551 31438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875877.1 protein_id gnl|my_center|LOCUS_03130 32552 31443 gene locus_tag LOCUS_03140 32552 31443 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066160.1 protein_id gnl|my_center|LOCUS_03140 33789 32638 gene locus_tag LOCUS_03150 33789 32638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 34712 33882 gene locus_tag LOCUS_03160 gene nadC 34712 33882 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020993.1 protein_id gnl|my_center|LOCUS_03160 34753 35565 gene locus_tag LOCUS_03170 34753 35565 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_03170 35603 36247 gene locus_tag LOCUS_03180 35603 36247 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023336.1 protein_id gnl|my_center|LOCUS_03180 36283 37206 gene locus_tag LOCUS_03190 gene mptN 36283 37206 CDS product tetrahydromethanopterin:alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023202.1 protein_id gnl|my_center|LOCUS_03190 37228 38526 gene locus_tag LOCUS_03200 37228 38526 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024009.1 protein_id gnl|my_center|LOCUS_03200 38644 39123 gene locus_tag LOCUS_03210 38644 39123 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence007 32 1519 gene locus_tag LOCUS_03220 32 1519 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_03220 2134 1508 gene locus_tag LOCUS_03230 gene trmY 2134 1508 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_03230 2291 2935 gene locus_tag LOCUS_03240 2291 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 2949 3596 gene locus_tag LOCUS_03250 gene pyrF 2949 3596 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065013.1 protein_id gnl|my_center|LOCUS_03250 3988 3593 gene locus_tag LOCUS_03260 3988 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 4228 4713 gene locus_tag LOCUS_03270 4228 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 4713 5720 gene locus_tag LOCUS_03280 4713 5720 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_03280 5788 6852 gene locus_tag LOCUS_03290 5788 6852 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287273.1 protein_id gnl|my_center|LOCUS_03290 6948 8240 gene locus_tag LOCUS_03300 6948 8240 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023956.1 protein_id gnl|my_center|LOCUS_03300 8237 8980 gene locus_tag LOCUS_03310 8237 8980 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023957.1 protein_id gnl|my_center|LOCUS_03310 9743 9003 gene locus_tag LOCUS_03320 9743 9003 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392949.1 protein_id gnl|my_center|LOCUS_03320 10503 9751 gene locus_tag LOCUS_03330 10503 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 11254 10490 gene locus_tag LOCUS_03340 11254 10490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_03340 12168 11374 gene locus_tag LOCUS_03350 gene modA 12168 11374 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_03350 13123 12278 gene locus_tag LOCUS_03360 gene modA 13123 12278 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_03360 14426 13239 gene locus_tag LOCUS_03370 14426 13239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 15945 14527 gene locus_tag LOCUS_03380 gene nifE 15945 14527 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023796.1 protein_id gnl|my_center|LOCUS_03380 17313 15955 gene locus_tag LOCUS_03390 gene nifK 17313 15955 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023795.1 protein_id gnl|my_center|LOCUS_03390 18931 17306 gene locus_tag LOCUS_03400 gene nifD 18931 17306 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023794.1 protein_id gnl|my_center|LOCUS_03400 19284 18928 gene locus_tag LOCUS_03410 19284 18928 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877171.1 protein_id gnl|my_center|LOCUS_03410 19618 19286 gene locus_tag LOCUS_03420 19618 19286 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546547.1 protein_id gnl|my_center|LOCUS_03420 20415 19600 gene locus_tag LOCUS_03430 gene nifH 20415 19600 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023791.1 protein_id gnl|my_center|LOCUS_03430 21394 20903 gene locus_tag LOCUS_03440 21394 20903 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020492.1 protein_id gnl|my_center|LOCUS_03440 21525 22289 gene locus_tag LOCUS_03450 21525 22289 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392812.1 protein_id gnl|my_center|LOCUS_03450 22553 22311 gene locus_tag LOCUS_03460 22553 22311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 25788 22621 gene locus_tag LOCUS_03470 25788 22621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 26009 25785 gene locus_tag LOCUS_03480 26009 25785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 26166 27428 gene locus_tag LOCUS_03490 gene aspS 26166 27428 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021688.1 protein_id gnl|my_center|LOCUS_03490 27714 28811 gene locus_tag LOCUS_03500 27714 28811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 28891 29058 gene locus_tag LOCUS_03510 28891 29058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 29345 29073 gene locus_tag LOCUS_03520 29345 29073 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023527.1 protein_id gnl|my_center|LOCUS_03520 30839 29421 gene locus_tag LOCUS_03530 30839 29421 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878569.1 protein_id gnl|my_center|LOCUS_03530 31093 30836 gene locus_tag LOCUS_03540 31093 30836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 31156 32904 gene locus_tag LOCUS_03550 gene iorA 31156 32904 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_03550 32905 33486 gene locus_tag LOCUS_03560 32905 33486 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_03560 33483 34760 gene locus_tag LOCUS_03570 33483 34760 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878570.1 protein_id gnl|my_center|LOCUS_03570 35465 34764 gene locus_tag LOCUS_03580 35465 34764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 35750 37810 gene locus_tag LOCUS_03590 35750 37810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 37919 38110 gene locus_tag LOCUS_03600 37919 38110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence008 1695 157 gene locus_tag LOCUS_03610 1695 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 1870 2094 gene locus_tag LOCUS_03620 1870 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 2582 2361 gene locus_tag LOCUS_03630 2582 2361 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_03630 2735 4075 gene locus_tag LOCUS_03640 gene hmgB 2735 4075 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_03640 4680 4072 gene locus_tag LOCUS_03650 4680 4072 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589510.1 protein_id gnl|my_center|LOCUS_03650 5640 4693 gene locus_tag LOCUS_03660 5640 4693 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020436.1 protein_id gnl|my_center|LOCUS_03660 5760 6290 gene locus_tag LOCUS_03670 5760 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 8123 6363 gene locus_tag LOCUS_03680 8123 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 8726 8301 gene locus_tag LOCUS_03690 8726 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 8941 10338 gene locus_tag LOCUS_03700 8941 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 10424 11362 gene locus_tag LOCUS_03710 10424 11362 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_03710 11395 12504 gene locus_tag LOCUS_03720 11395 12504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 12519 13547 gene locus_tag LOCUS_03730 12519 13547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 14805 13651 gene locus_tag LOCUS_03740 14805 13651 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_03740 16493 14820 gene locus_tag LOCUS_03750 16493 14820 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992488.1 protein_id gnl|my_center|LOCUS_03750 16676 20479 gene locus_tag LOCUS_03760 gene cobN 16676 20479 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932109.1 protein_id gnl|my_center|LOCUS_03760 20497 21555 gene locus_tag LOCUS_03770 20497 21555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 21727 22254 gene locus_tag LOCUS_03780 21727 22254 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 protein_id gnl|my_center|LOCUS_03780 22979 22242 gene locus_tag LOCUS_03790 22979 22242 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583290.1 protein_id gnl|my_center|LOCUS_03790 23192 22986 gene locus_tag LOCUS_03800 23192 22986 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_03800 23793 23194 gene locus_tag LOCUS_03810 23793 23194 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552750.1 protein_id gnl|my_center|LOCUS_03810 24442 24068 gene locus_tag LOCUS_03820 24442 24068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 24628 26673 gene locus_tag LOCUS_03830 24628 26673 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879431.1 protein_id gnl|my_center|LOCUS_03830 27786 26683 gene locus_tag LOCUS_03840 gene ftsY 27786 26683 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024000.1 protein_id gnl|my_center|LOCUS_03840 28237 27779 gene locus_tag LOCUS_03850 gene pfdA 28237 27779 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249956.1 protein_id gnl|my_center|LOCUS_03850 28418 28230 gene locus_tag LOCUS_03860 28418 28230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 29119 28448 gene locus_tag LOCUS_03870 29119 28448 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024003.1 protein_id gnl|my_center|LOCUS_03870 29369 29103 gene locus_tag LOCUS_03880 29369 29103 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024004.1 protein_id gnl|my_center|LOCUS_03880 30122 29463 gene locus_tag LOCUS_03890 30122 29463 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024006.1 protein_id gnl|my_center|LOCUS_03890 30476 30135 gene locus_tag LOCUS_03900 30476 30135 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_03900 30959 30498 gene locus_tag LOCUS_03910 30959 30498 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877224.1 protein_id gnl|my_center|LOCUS_03910 31927 31031 gene locus_tag LOCUS_03920 gene nadA 31927 31031 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583121.1 protein_id gnl|my_center|LOCUS_03920 32665 32006 gene locus_tag LOCUS_03930 32665 32006 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_03930 33764 32619 gene locus_tag LOCUS_03940 33764 32619 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_03940 34288 33872 gene locus_tag LOCUS_03950 34288 33872 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779558.1 protein_id gnl|my_center|LOCUS_03950 34356 34859 gene locus_tag LOCUS_03960 34356 34859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065104.1 protein_id gnl|my_center|LOCUS_03960 34856 35959 gene locus_tag LOCUS_03970 34856 35959 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 protein_id gnl|my_center|LOCUS_03970 35995 36378 gene locus_tag LOCUS_03980 35995 36378 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023881.1 protein_id gnl|my_center|LOCUS_03980 36397 37272 gene locus_tag LOCUS_03990 gene speB 36397 37272 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_03990 37272 37499 gene locus_tag LOCUS_04000 37272 37499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 >Feature sequence009 937 155 gene locus_tag LOCUS_04010 937 155 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021200.1 protein_id gnl|my_center|LOCUS_04010 2045 963 gene locus_tag LOCUS_04020 2045 963 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021199.1 protein_id gnl|my_center|LOCUS_04020 3280 2048 gene locus_tag LOCUS_04030 3280 2048 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763221.1 protein_id gnl|my_center|LOCUS_04030 4702 3455 gene locus_tag LOCUS_04040 4702 3455 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_04040 5259 5546 gene locus_tag LOCUS_04050 5259 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 5830 7509 gene locus_tag LOCUS_04060 gene thsB 5830 7509 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_04060 7800 8360 gene locus_tag LOCUS_04070 7800 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 8332 8907 gene locus_tag LOCUS_04080 8332 8907 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021454.1 protein_id gnl|my_center|LOCUS_04080 9095 9496 gene locus_tag LOCUS_04090 9095 9496 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024057.1 protein_id gnl|my_center|LOCUS_04090 10450 9545 gene locus_tag LOCUS_04100 10450 9545 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 protein_id gnl|my_center|LOCUS_04100 10571 10855 gene locus_tag LOCUS_04110 10571 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 10834 11847 gene locus_tag LOCUS_04120 10834 11847 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_04120 11978 12049 gene locus_tag LOCUS_t00070 11978 12049 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 12204 15788 gene locus_tag LOCUS_04130 12204 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 15797 18190 gene locus_tag LOCUS_04140 gene gyrA 15797 18190 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_04140 19904 18756 gene locus_tag LOCUS_04150 19904 18756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 21123 20365 gene locus_tag LOCUS_04160 21123 20365 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942056.1 protein_id gnl|my_center|LOCUS_04160 21652 21580 gene locus_tag LOCUS_t00080 21652 21580 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21792 22691 gene locus_tag LOCUS_04170 gene trxB 21792 22691 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_04170 22720 23679 gene locus_tag LOCUS_04180 22720 23679 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_04180 24568 23705 gene locus_tag LOCUS_04190 24568 23705 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545447.1 protein_id gnl|my_center|LOCUS_04190 25105 26199 gene locus_tag LOCUS_04200 25105 26199 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_04200 26813 26244 gene locus_tag LOCUS_04210 26813 26244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 27704 27339 gene locus_tag LOCUS_04220 27704 27339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 27962 28981 gene locus_tag LOCUS_04230 27962 28981 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020300.1 protein_id gnl|my_center|LOCUS_04230 29297 28962 gene locus_tag LOCUS_04240 29297 28962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 29399 30913 gene locus_tag LOCUS_04250 29399 30913 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932680.1 protein_id gnl|my_center|LOCUS_04250 33029 30876 gene locus_tag LOCUS_04260 33029 30876 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_04260 33042 33656 gene locus_tag LOCUS_04270 33042 33656 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023175.1 protein_id gnl|my_center|LOCUS_04270 33646 34767 gene locus_tag LOCUS_04280 33646 34767 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023766.1 protein_id gnl|my_center|LOCUS_04280 34829 35026 gene locus_tag LOCUS_04290 34829 35026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 35455 35045 gene locus_tag LOCUS_04300 35455 35045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 35664 35443 gene locus_tag LOCUS_04310 35664 35443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 35887 36219 gene locus_tag LOCUS_04320 35887 36219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 36219 36398 gene locus_tag LOCUS_04330 36219 36398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 36935 36726 gene locus_tag LOCUS_04340 36935 36726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 37290 36925 gene locus_tag LOCUS_04350 37290 36925 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence010 812 123 gene locus_tag LOCUS_04360 gene gpmA 812 123 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_04360 1730 819 gene locus_tag LOCUS_04370 1730 819 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_04370 2668 1727 gene locus_tag LOCUS_04380 gene pfkB 2668 1727 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836910.1 protein_id gnl|my_center|LOCUS_04380 3168 2911 gene locus_tag LOCUS_04390 3168 2911 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011032206.1 protein_id gnl|my_center|LOCUS_04390 3561 4364 gene locus_tag LOCUS_04400 3561 4364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021673.1 protein_id gnl|my_center|LOCUS_04400 4437 5048 gene locus_tag LOCUS_04410 4437 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 5160 5642 gene locus_tag LOCUS_04420 5160 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 5743 6627 gene locus_tag LOCUS_04430 5743 6627 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064299.1 protein_id gnl|my_center|LOCUS_04430 6795 6977 gene locus_tag LOCUS_04440 6795 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 9223 6989 gene locus_tag LOCUS_04450 9223 6989 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_04450 9403 9573 gene locus_tag LOCUS_04460 9403 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 10110 9772 gene locus_tag LOCUS_04470 10110 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 10972 10118 gene locus_tag LOCUS_04480 10972 10118 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_04480 13166 10965 gene locus_tag LOCUS_04490 gene fdhF 13166 10965 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_04490 15061 13157 gene locus_tag LOCUS_04500 gene nuoF 15061 13157 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_04500 15396 15070 gene locus_tag LOCUS_04510 15396 15070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 15908 16855 gene locus_tag LOCUS_04520 15908 16855 CDS product eukaryotic peptide chain release factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021302.1 protein_id gnl|my_center|LOCUS_04520 16894 17664 gene locus_tag LOCUS_04530 16894 17664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 17848 18402 gene locus_tag LOCUS_04540 17848 18402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 18407 19069 gene locus_tag LOCUS_04550 18407 19069 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496756.1 protein_id gnl|my_center|LOCUS_04550 19923 19066 gene locus_tag LOCUS_04560 19923 19066 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496419.1 protein_id gnl|my_center|LOCUS_04560 20765 19920 gene locus_tag LOCUS_04570 20765 19920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 22300 20786 gene locus_tag LOCUS_04580 22300 20786 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023176.1 protein_id gnl|my_center|LOCUS_04580 23244 22312 gene locus_tag LOCUS_04590 23244 22312 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065056.1 protein_id gnl|my_center|LOCUS_04590 23813 23241 gene locus_tag LOCUS_04600 23813 23241 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877299.1 protein_id gnl|my_center|LOCUS_04600 24298 23810 gene locus_tag LOCUS_04610 24298 23810 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065943.1 protein_id gnl|my_center|LOCUS_04610 24362 25579 gene locus_tag LOCUS_04620 gene pan 24362 25579 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_04620 26050 25598 gene locus_tag LOCUS_04630 26050 25598 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902177.1 protein_id gnl|my_center|LOCUS_04630 27115 26150 gene locus_tag LOCUS_04640 gene mer 27115 26150 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_04640 27857 27117 gene locus_tag LOCUS_04650 27857 27117 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024199.1 protein_id gnl|my_center|LOCUS_04650 28250 27873 gene locus_tag LOCUS_04660 28250 27873 CDS product tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065620.1 protein_id gnl|my_center|LOCUS_04660 28507 28325 gene locus_tag LOCUS_04670 28507 28325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 28692 28883 gene locus_tag LOCUS_04680 28692 28883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 28968 29561 gene locus_tag LOCUS_04690 28968 29561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 30542 29595 gene locus_tag LOCUS_04700 30542 29595 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_04700 31294 30566 gene locus_tag LOCUS_04710 31294 30566 CDS product 7,8-dihydropterin-6-methyl-4-(beta-D-ribofuranosyl)-aminobenzene-5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869799.1 protein_id gnl|my_center|LOCUS_04710 31579 32685 gene locus_tag LOCUS_04720 31579 32685 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860356.1 protein_id gnl|my_center|LOCUS_04720 32925 33362 gene locus_tag LOCUS_04730 32925 33362 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279177.1 protein_id gnl|my_center|LOCUS_04730 33512 34021 gene locus_tag LOCUS_04740 33512 34021 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 protein_id gnl|my_center|LOCUS_04740 34023 34589 gene locus_tag LOCUS_04750 34023 34589 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_04750 34582 35187 gene locus_tag LOCUS_04760 34582 35187 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020386.1 protein_id gnl|my_center|LOCUS_04760 36193 35189 gene locus_tag LOCUS_04770 36193 35189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04770 36615 36863 gene locus_tag LOCUS_04780 36615 36863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence011 <1 905 gene locus_tag LOCUS_04790 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924817.1:bi-domain-containing oxidoreductase 2163 832 gene locus_tag LOCUS_04800 2163 832 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869927.1 protein_id gnl|my_center|LOCUS_04800 3161 2160 gene locus_tag LOCUS_04810 gene wecB 3161 2160 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_04810 4001 3528 gene locus_tag LOCUS_04820 4001 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 4437 3994 gene locus_tag LOCUS_04830 4437 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 4857 4594 gene locus_tag LOCUS_04840 4857 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 5348 4911 gene locus_tag LOCUS_04850 5348 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 5545 5273 gene locus_tag LOCUS_04860 5545 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 5874 5644 gene locus_tag LOCUS_04870 5874 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 6288 6073 gene locus_tag LOCUS_04880 6288 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 6535 6272 gene locus_tag LOCUS_04890 6535 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 7808 7362 gene locus_tag LOCUS_04900 7808 7362 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048201672.1 protein_id gnl|my_center|LOCUS_04900 7984 7775 gene locus_tag LOCUS_04910 7984 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 8224 8000 gene locus_tag LOCUS_04920 8224 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 8393 8199 gene locus_tag LOCUS_04930 8393 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 8761 8507 gene locus_tag LOCUS_04940 8761 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 9324 8839 gene locus_tag LOCUS_04950 9324 8839 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 protein_id gnl|my_center|LOCUS_04950 9568 9317 gene locus_tag LOCUS_04960 9568 9317 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_04960 9914 9693 gene locus_tag LOCUS_04970 9914 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 10859 10257 gene locus_tag LOCUS_04980 10859 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 11340 11011 gene locus_tag LOCUS_04990 11340 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 11697 13010 gene locus_tag LOCUS_05000 gene trkA 11697 13010 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021494.1 protein_id gnl|my_center|LOCUS_05000 13113 14681 gene locus_tag LOCUS_05010 13113 14681 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_05010 14790 15488 gene locus_tag LOCUS_05020 14790 15488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 15491 16855 gene locus_tag LOCUS_05030 15491 16855 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_05030 17812 16871 gene locus_tag LOCUS_05040 17812 16871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 17939 18946 gene locus_tag LOCUS_05050 17939 18946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 19204 19965 gene locus_tag LOCUS_05060 19204 19965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 20050 20394 gene locus_tag LOCUS_05070 20050 20394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 21325 20426 gene locus_tag LOCUS_05080 21325 20426 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023914.1 protein_id gnl|my_center|LOCUS_05080 21933 21241 gene locus_tag LOCUS_05090 21933 21241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 22466 22032 gene locus_tag LOCUS_05100 22466 22032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 22855 22469 gene locus_tag LOCUS_05110 22855 22469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 23484 22864 gene locus_tag LOCUS_05120 gene cbiM 23484 22864 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391247.1 protein_id gnl|my_center|LOCUS_05120 24260 23499 gene locus_tag LOCUS_05130 24260 23499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 25030 24491 gene locus_tag LOCUS_05140 25030 24491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 26490 25114 gene locus_tag LOCUS_05150 26490 25114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 27072 26503 gene locus_tag LOCUS_05160 27072 26503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 28402 27104 gene locus_tag LOCUS_05170 gene aroA 28402 27104 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_05170 28601 29995 gene locus_tag LOCUS_05180 28601 29995 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_05180 30081 32039 gene locus_tag LOCUS_05190 gene uvrB 30081 32039 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 protein_id gnl|my_center|LOCUS_05190 32105 32491 gene locus_tag LOCUS_05200 32105 32491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 32605 33222 gene locus_tag LOCUS_05210 32605 33222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 33982 33197 gene locus_tag LOCUS_05220 33982 33197 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021826.1 protein_id gnl|my_center|LOCUS_05220 <35117 34136 gene locus_tag LOCUS_05230 <35117 34136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933174.1:agmatine deiminase family protein >Feature sequence012 285 491 gene locus_tag LOCUS_05240 285 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 580 939 gene locus_tag LOCUS_05250 580 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 975 2345 gene locus_tag LOCUS_05260 gene gvpD 975 2345 CDS product gas vesicle protein GvpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904107.1 protein_id gnl|my_center|LOCUS_05260 2851 2342 gene locus_tag LOCUS_05270 2851 2342 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461828.1 protein_id gnl|my_center|LOCUS_05270 4706 2859 gene locus_tag LOCUS_05280 gene cooS 4706 2859 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_05280 4992 5885 gene locus_tag LOCUS_05290 4992 5885 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_05290 6503 5949 gene locus_tag LOCUS_05300 6503 5949 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880077.1 protein_id gnl|my_center|LOCUS_05300 6746 7579 gene locus_tag LOCUS_05310 gene htpX 6746 7579 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_05310 7581 8141 gene locus_tag LOCUS_05320 7581 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_05320 8248 9027 gene locus_tag LOCUS_05330 8248 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 9068 9730 gene locus_tag LOCUS_05340 9068 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 9849 10859 gene locus_tag LOCUS_05350 gene fen 9849 10859 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023899.1 protein_id gnl|my_center|LOCUS_05350 10828 11847 gene locus_tag LOCUS_05360 gene dph2 10828 11847 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_05360 12468 11854 gene locus_tag LOCUS_05370 12468 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 12546 13271 gene locus_tag LOCUS_05380 12546 13271 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080855.1 protein_id gnl|my_center|LOCUS_05380 13293 13883 gene locus_tag LOCUS_05390 13293 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 14555 13884 gene locus_tag LOCUS_05400 gene radB 14555 13884 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 protein_id gnl|my_center|LOCUS_05400 15148 14552 gene locus_tag LOCUS_05410 15148 14552 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879329.1 protein_id gnl|my_center|LOCUS_05410 15996 15145 gene locus_tag LOCUS_05420 15996 15145 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_05420 16884 16009 gene locus_tag LOCUS_05430 16884 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 17087 17476 gene locus_tag LOCUS_05440 17087 17476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 17489 17980 gene locus_tag LOCUS_05450 17489 17980 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_05450 18747 18028 gene locus_tag LOCUS_05460 18747 18028 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_05460 19982 18729 gene locus_tag LOCUS_05470 gene tgt 19982 18729 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878982.1 protein_id gnl|my_center|LOCUS_05470 20692 20042 gene locus_tag LOCUS_05480 20692 20042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 21337 20759 gene locus_tag LOCUS_05490 21337 20759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 21816 21433 gene locus_tag LOCUS_05500 21816 21433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 23327 21888 gene locus_tag LOCUS_05510 gene gabD 23327 21888 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772866.1 protein_id gnl|my_center|LOCUS_05510 23456 24643 gene locus_tag LOCUS_05520 gene serB 23456 24643 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064533.1 protein_id gnl|my_center|LOCUS_05520 24644 27469 gene locus_tag LOCUS_05530 gene uvrA 24644 27469 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023257.1 protein_id gnl|my_center|LOCUS_05530 27639 28691 gene locus_tag LOCUS_05540 27639 28691 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022844.1 protein_id gnl|my_center|LOCUS_05540 28688 29923 gene locus_tag LOCUS_05550 28688 29923 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064356.1 protein_id gnl|my_center|LOCUS_05550 30100 32091 gene locus_tag LOCUS_05560 gene acs 30100 32091 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 protein_id gnl|my_center|LOCUS_05560 32399 34384 gene locus_tag LOCUS_05570 gene acs 32399 34384 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence013 48 122 gene locus_tag LOCUS_t00090 48 122 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 434 913 gene locus_tag LOCUS_05580 434 913 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_05580 910 2103 gene locus_tag LOCUS_05590 910 2103 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_05590 2108 2710 gene locus_tag LOCUS_05600 gene pgsA 2108 2710 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868695.1 protein_id gnl|my_center|LOCUS_05600 3193 2747 gene locus_tag LOCUS_05610 3193 2747 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022482.1 protein_id gnl|my_center|LOCUS_05610 3952 3278 gene locus_tag LOCUS_05620 3952 3278 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065272.1 protein_id gnl|my_center|LOCUS_05620 4485 4057 gene locus_tag LOCUS_05630 4485 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 4712 5686 gene locus_tag LOCUS_05640 4712 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 5828 6964 gene locus_tag LOCUS_05650 5828 6964 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_05650 6969 8141 gene locus_tag LOCUS_05660 6969 8141 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108945.1 protein_id gnl|my_center|LOCUS_05660 9022 8153 gene locus_tag LOCUS_05670 9022 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 9891 9019 gene locus_tag LOCUS_05680 9891 9019 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024467.1 protein_id gnl|my_center|LOCUS_05680 11087 9861 gene locus_tag LOCUS_05690 11087 9861 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021658.1 protein_id gnl|my_center|LOCUS_05690 11130 11741 gene locus_tag LOCUS_05700 11130 11741 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024281.1 protein_id gnl|my_center|LOCUS_05700 12445 11786 gene locus_tag LOCUS_05710 12445 11786 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877913.1 protein_id gnl|my_center|LOCUS_05710 12545 12769 gene locus_tag LOCUS_05720 12545 12769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 12786 13736 gene locus_tag LOCUS_05730 gene mptA 12786 13736 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 protein_id gnl|my_center|LOCUS_05730 13733 14503 gene locus_tag LOCUS_05740 13733 14503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 15008 16156 gene locus_tag LOCUS_05750 15008 16156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 16246 16875 gene locus_tag LOCUS_05760 16246 16875 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_05760 19099 17303 gene locus_tag LOCUS_05770 19099 17303 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_05770 19728 19303 gene locus_tag LOCUS_05780 19728 19303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 20495 19725 gene locus_tag LOCUS_05790 gene dapB 20495 19725 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024350.1 protein_id gnl|my_center|LOCUS_05790 21367 20492 gene locus_tag LOCUS_05800 gene dapA 21367 20492 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_05800 21578 21360 gene locus_tag LOCUS_05810 21578 21360 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762842.1 protein_id gnl|my_center|LOCUS_05810 22486 21632 gene locus_tag LOCUS_05820 22486 21632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 23038 22487 gene locus_tag LOCUS_05830 23038 22487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 23505 23086 gene locus_tag LOCUS_05840 23505 23086 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870736.1 protein_id gnl|my_center|LOCUS_05840 24756 23560 gene locus_tag LOCUS_05850 24756 23560 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_05850 26127 24763 gene locus_tag LOCUS_05860 26127 24763 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022838.1 protein_id gnl|my_center|LOCUS_05860 27803 26133 gene locus_tag LOCUS_05870 27803 26133 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022839.1 protein_id gnl|my_center|LOCUS_05870 28150 29406 gene locus_tag LOCUS_05880 gene ahcY 28150 29406 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_05880 29414 30505 gene locus_tag LOCUS_05890 29414 30505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 30509 31525 gene locus_tag LOCUS_05900 30509 31525 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_05900 31811 32098 gene locus_tag LOCUS_05910 31811 32098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 32212 32913 gene locus_tag LOCUS_05920 32212 32913 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024276.1 protein_id gnl|my_center|LOCUS_05920 >Feature sequence014 903 1838 gene locus_tag LOCUS_05930 903 1838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020923.1 protein_id gnl|my_center|LOCUS_05930 1829 2548 gene locus_tag LOCUS_05940 1829 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 3376 2549 gene locus_tag LOCUS_05950 3376 2549 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065941.1 protein_id gnl|my_center|LOCUS_05950 4307 3360 gene locus_tag LOCUS_05960 4307 3360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024132.1 protein_id gnl|my_center|LOCUS_05960 5126 4335 gene locus_tag LOCUS_05970 5126 4335 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024130.1 protein_id gnl|my_center|LOCUS_05970 6569 5127 gene locus_tag LOCUS_05980 6569 5127 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990685.1 protein_id gnl|my_center|LOCUS_05980 7109 7924 gene locus_tag LOCUS_05990 7109 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064248.1 protein_id gnl|my_center|LOCUS_05990 8253 8029 gene locus_tag LOCUS_06000 8253 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 10330 9116 gene locus_tag LOCUS_06010 10330 9116 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860356.1 protein_id gnl|my_center|LOCUS_06010 11193 10456 gene locus_tag LOCUS_06020 11193 10456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_06020 12054 11194 gene locus_tag LOCUS_06030 12054 11194 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_06030 14099 12099 gene locus_tag LOCUS_06040 14099 12099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 14687 15766 gene locus_tag LOCUS_06050 14687 15766 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_06050 15896 16681 gene locus_tag LOCUS_06060 15896 16681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_06060 16762 20568 gene locus_tag LOCUS_06070 gene cobN 16762 20568 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870959.1 protein_id gnl|my_center|LOCUS_06070 20757 22031 gene locus_tag LOCUS_06080 20757 22031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 22032 23273 gene locus_tag LOCUS_06090 22032 23273 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_06090 23465 23587 gene locus_tag LOCUS_06100 23465 23587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 24120 23662 gene locus_tag LOCUS_06110 24120 23662 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876052.1 protein_id gnl|my_center|LOCUS_06110 24366 24163 gene locus_tag LOCUS_06120 24366 24163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 25222 24566 gene locus_tag LOCUS_06130 25222 24566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 25748 25440 gene locus_tag LOCUS_06140 25748 25440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 26101 27921 gene locus_tag LOCUS_06150 26101 27921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141300.1 protein_id gnl|my_center|LOCUS_06150 27918 29666 gene locus_tag LOCUS_06160 27918 29666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141301.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence015 465 668 gene locus_tag LOCUS_06170 465 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 685 981 gene locus_tag LOCUS_06180 685 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 988 2439 gene locus_tag LOCUS_06190 988 2439 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023184.1 protein_id gnl|my_center|LOCUS_06190 2444 3124 gene locus_tag LOCUS_06200 2444 3124 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_06200 3121 3672 gene locus_tag LOCUS_06210 3121 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4290 3673 gene locus_tag LOCUS_06220 4290 3673 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458621.1 protein_id gnl|my_center|LOCUS_06220 5087 4305 gene locus_tag LOCUS_06230 gene trpA 5087 4305 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_06230 6267 5074 gene locus_tag LOCUS_06240 gene trpB 6267 5074 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022931.1 protein_id gnl|my_center|LOCUS_06240 6562 6353 gene locus_tag LOCUS_06250 6562 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 7764 6559 gene locus_tag LOCUS_06260 gene xseA 7764 6559 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_06260 9034 8135 gene locus_tag LOCUS_06270 9034 8135 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249816.1 protein_id gnl|my_center|LOCUS_06270 9195 11705 gene locus_tag LOCUS_06280 9195 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 11746 12021 gene locus_tag LOCUS_06290 11746 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 12197 12487 gene locus_tag LOCUS_06300 12197 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 12829 13101 gene locus_tag LOCUS_06310 12829 13101 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024392.1 protein_id gnl|my_center|LOCUS_06310 13193 14173 gene locus_tag LOCUS_06320 gene ala 13193 14173 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_06320 14863 14159 gene locus_tag LOCUS_06330 gene cofC 14863 14159 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879553.1 protein_id gnl|my_center|LOCUS_06330 15608 14871 gene locus_tag LOCUS_06340 gene cofE 15608 14871 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879745.1 protein_id gnl|my_center|LOCUS_06340 15860 15630 gene locus_tag LOCUS_06350 15860 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 16490 15861 gene locus_tag LOCUS_06360 16490 15861 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_06360 16948 16496 gene locus_tag LOCUS_06370 16948 16496 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_06370 18330 17089 gene locus_tag LOCUS_06380 gene gatD 18330 17089 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_06380 18480 19019 gene locus_tag LOCUS_06390 18480 19019 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 protein_id gnl|my_center|LOCUS_06390 19279 19016 gene locus_tag LOCUS_06400 19279 19016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 19393 19644 gene locus_tag LOCUS_06410 19393 19644 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020348.1 protein_id gnl|my_center|LOCUS_06410 19637 21316 gene locus_tag LOCUS_06420 19637 21316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 21761 21327 gene locus_tag LOCUS_06430 21761 21327 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876110.1 protein_id gnl|my_center|LOCUS_06430 22328 21864 gene locus_tag LOCUS_06440 22328 21864 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023461.1 protein_id gnl|my_center|LOCUS_06440 22801 22370 gene locus_tag LOCUS_06450 22801 22370 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_06450 23220 22822 gene locus_tag LOCUS_06460 23220 22822 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066255.1 protein_id gnl|my_center|LOCUS_06460 24131 23232 gene locus_tag LOCUS_06470 24131 23232 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_06470 25680 24196 gene locus_tag LOCUS_06480 25680 24196 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 protein_id gnl|my_center|LOCUS_06480 25834 26085 gene locus_tag LOCUS_06490 25834 26085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 26151 26579 gene locus_tag LOCUS_06500 26151 26579 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022180.1 protein_id gnl|my_center|LOCUS_06500 26580 28052 gene locus_tag LOCUS_06510 26580 28052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence016 261 1268 gene locus_tag LOCUS_06520 261 1268 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022139.1 protein_id gnl|my_center|LOCUS_06520 1314 2414 gene locus_tag LOCUS_06530 1314 2414 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_06530 2408 3199 gene locus_tag LOCUS_06540 2408 3199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_06540 3219 4319 gene locus_tag LOCUS_06550 3219 4319 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496660.1 protein_id gnl|my_center|LOCUS_06550 4346 5206 gene locus_tag LOCUS_06560 4346 5206 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_06560 5208 5951 gene locus_tag LOCUS_06570 5208 5951 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_06570 6976 5957 gene locus_tag LOCUS_06580 6976 5957 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 protein_id gnl|my_center|LOCUS_06580 8229 7006 gene locus_tag LOCUS_06590 8229 7006 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_06590 8860 8216 gene locus_tag LOCUS_06600 8860 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 9923 8991 gene locus_tag LOCUS_06610 9923 8991 CDS product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065984.1 protein_id gnl|my_center|LOCUS_06610 10640 9930 gene locus_tag LOCUS_06620 10640 9930 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_06620 11255 10806 gene locus_tag LOCUS_06630 11255 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 11974 11342 gene locus_tag LOCUS_06640 11974 11342 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023187.1 protein_id gnl|my_center|LOCUS_06640 12462 11971 gene locus_tag LOCUS_06650 12462 11971 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867611.1 protein_id gnl|my_center|LOCUS_06650 13307 12501 gene locus_tag LOCUS_06660 13307 12501 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878595.1 protein_id gnl|my_center|LOCUS_06660 14047 13304 gene locus_tag LOCUS_06670 14047 13304 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024310.1 protein_id gnl|my_center|LOCUS_06670 14093 15430 gene locus_tag LOCUS_06680 14093 15430 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064814.1 protein_id gnl|my_center|LOCUS_06680 15494 15745 gene locus_tag LOCUS_06690 15494 15745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 15926 16579 gene locus_tag LOCUS_06700 15926 16579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 16793 16581 gene locus_tag LOCUS_06710 16793 16581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 17241 16804 gene locus_tag LOCUS_06720 gene rimI 17241 16804 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980152.1 protein_id gnl|my_center|LOCUS_06720 17627 17238 gene locus_tag LOCUS_06730 17627 17238 CDS product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589540.1 protein_id gnl|my_center|LOCUS_06730 18866 17691 gene locus_tag LOCUS_06740 18866 17691 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022128.1 protein_id gnl|my_center|LOCUS_06740 18967 20070 gene locus_tag LOCUS_06750 18967 20070 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020233.1 protein_id gnl|my_center|LOCUS_06750 20124 20762 gene locus_tag LOCUS_06760 20124 20762 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878677.1 protein_id gnl|my_center|LOCUS_06760 20783 21127 gene locus_tag LOCUS_06770 20783 21127 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064681.1 protein_id gnl|my_center|LOCUS_06770 21128 21523 gene locus_tag LOCUS_06780 21128 21523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 21680 21528 gene locus_tag LOCUS_06790 21680 21528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 22114 21716 gene locus_tag LOCUS_06800 22114 21716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 23778 22660 gene locus_tag LOCUS_06810 23778 22660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 24640 23825 gene locus_tag LOCUS_06820 24640 23825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 24838 27093 gene locus_tag LOCUS_06830 24838 27093 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878955.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence017 32 664 gene locus_tag LOCUS_06840 32 664 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024156.1 protein_id gnl|my_center|LOCUS_06840 666 1631 gene locus_tag LOCUS_06850 666 1631 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024157.1 protein_id gnl|my_center|LOCUS_06850 1660 1971 gene locus_tag LOCUS_06860 gene rpl12p 1660 1971 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878989.1 protein_id gnl|my_center|LOCUS_06860 2300 2028 gene locus_tag LOCUS_06870 2300 2028 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023527.1 protein_id gnl|my_center|LOCUS_06870 2463 3008 gene locus_tag LOCUS_06880 gene cysC 2463 3008 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763240.1 protein_id gnl|my_center|LOCUS_06880 3108 4262 gene locus_tag LOCUS_06890 3108 4262 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682815.1 protein_id gnl|my_center|LOCUS_06890 4280 5332 gene locus_tag LOCUS_06900 gene endA 4280 5332 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_06900 5623 5342 gene locus_tag LOCUS_06910 5623 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 6103 5642 gene locus_tag LOCUS_06920 6103 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 protein_id gnl|my_center|LOCUS_06920 6260 6108 gene locus_tag LOCUS_06930 6260 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 7649 6345 gene locus_tag LOCUS_06940 7649 6345 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024066.1 protein_id gnl|my_center|LOCUS_06940 8044 7649 gene locus_tag LOCUS_06950 8044 7649 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024065.1 protein_id gnl|my_center|LOCUS_06950 8844 8050 gene locus_tag LOCUS_06960 8844 8050 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066575.1 protein_id gnl|my_center|LOCUS_06960 10618 8849 gene locus_tag LOCUS_06970 10618 8849 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024063.1 protein_id gnl|my_center|LOCUS_06970 11696 10620 gene locus_tag LOCUS_06980 11696 10620 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020363.1 protein_id gnl|my_center|LOCUS_06980 13776 11737 gene locus_tag LOCUS_06990 gene fdhF 13776 11737 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053768.1 protein_id gnl|my_center|LOCUS_06990 14564 13941 gene locus_tag LOCUS_07000 14564 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 15489 14656 gene locus_tag LOCUS_07010 15489 14656 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061096.1 protein_id gnl|my_center|LOCUS_07010 16754 15486 gene locus_tag LOCUS_07020 16754 15486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 18889 16751 gene locus_tag LOCUS_07030 18889 16751 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_07030 19007 20155 gene locus_tag LOCUS_07040 19007 20155 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546563.1 protein_id gnl|my_center|LOCUS_07040 20214 23057 gene locus_tag LOCUS_07050 gene leuS 20214 23057 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 protein_id gnl|my_center|LOCUS_07050 23204 23407 gene locus_tag LOCUS_07060 23204 23407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 23446 23616 gene locus_tag LOCUS_07070 23446 23616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 24508 24810 gene locus_tag LOCUS_07080 24508 24810 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_07080 24797 25132 gene locus_tag LOCUS_07090 24797 25132 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_07090 25362 26540 gene locus_tag LOCUS_07100 25362 26540 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860356.1 protein_id gnl|my_center|LOCUS_07100 26790 27065 gene locus_tag LOCUS_07110 26790 27065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence018 1425 2024 gene locus_tag LOCUS_07120 1425 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 3945 2038 gene locus_tag LOCUS_07130 3945 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 6040 4019 gene locus_tag LOCUS_07140 6040 4019 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_07140 6405 6130 gene locus_tag LOCUS_07150 6405 6130 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020766.1 protein_id gnl|my_center|LOCUS_07150 6965 6405 gene locus_tag LOCUS_07160 6965 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 7575 6988 gene locus_tag LOCUS_07170 7575 6988 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_07170 9659 7602 gene locus_tag LOCUS_07180 9659 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 10145 11386 gene locus_tag LOCUS_07190 gene prf1 10145 11386 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020101.1 protein_id gnl|my_center|LOCUS_07190 11392 11832 gene locus_tag LOCUS_07200 11392 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 11825 12595 gene locus_tag LOCUS_07210 11825 12595 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_07210 12612 13244 gene locus_tag LOCUS_07220 12612 13244 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020150.1 protein_id gnl|my_center|LOCUS_07220 13278 14891 gene locus_tag LOCUS_07230 gene sepS 13278 14891 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020149.1 protein_id gnl|my_center|LOCUS_07230 14898 15593 gene locus_tag LOCUS_07240 gene rpiA 14898 15593 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_07240 15717 16154 gene locus_tag LOCUS_07250 15717 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 16761 16207 gene locus_tag LOCUS_07260 16761 16207 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_07260 16951 16772 gene locus_tag LOCUS_07270 16951 16772 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875795.1 protein_id gnl|my_center|LOCUS_07270 17822 16968 gene locus_tag LOCUS_07280 17822 16968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 19501 17819 gene locus_tag LOCUS_07290 19501 17819 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878252.1 protein_id gnl|my_center|LOCUS_07290 20003 19575 gene locus_tag LOCUS_07300 20003 19575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 20278 21627 gene locus_tag LOCUS_07310 20278 21627 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_07310 21587 21877 gene locus_tag LOCUS_07320 21587 21877 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 protein_id gnl|my_center|LOCUS_07320 21878 22222 gene locus_tag LOCUS_07330 21878 22222 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 protein_id gnl|my_center|LOCUS_07330 22228 22809 gene locus_tag LOCUS_07340 22228 22809 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065124.1 protein_id gnl|my_center|LOCUS_07340 22806 23537 gene locus_tag LOCUS_07350 gene rsmA 22806 23537 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_07350 23550 24722 gene locus_tag LOCUS_07360 23550 24722 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870834.1 protein_id gnl|my_center|LOCUS_07360 26657 24741 gene locus_tag LOCUS_07370 26657 24741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence019 408 1178 gene locus_tag LOCUS_07380 408 1178 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022865.1 protein_id gnl|my_center|LOCUS_07380 1168 1350 gene locus_tag LOCUS_07390 1168 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 3545 1620 gene locus_tag LOCUS_07400 3545 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 4277 3639 gene locus_tag LOCUS_07410 4277 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 4587 4342 gene locus_tag LOCUS_07420 4587 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 5645 4593 gene locus_tag LOCUS_07430 5645 4593 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868292.1 protein_id gnl|my_center|LOCUS_07430 6847 5759 gene locus_tag LOCUS_07440 6847 5759 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023272.1 protein_id gnl|my_center|LOCUS_07440 7111 8301 gene locus_tag LOCUS_07450 7111 8301 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020274.1 protein_id gnl|my_center|LOCUS_07450 8378 8629 gene locus_tag LOCUS_07460 8378 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 8794 10410 gene locus_tag LOCUS_07470 gene atwA 8794 10410 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023893.1 protein_id gnl|my_center|LOCUS_07470 10412 11938 gene locus_tag LOCUS_07480 10412 11938 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023892.1 protein_id gnl|my_center|LOCUS_07480 11935 12351 gene locus_tag LOCUS_07490 11935 12351 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065869.1 protein_id gnl|my_center|LOCUS_07490 12361 12798 gene locus_tag LOCUS_07500 12361 12798 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066559.1 protein_id gnl|my_center|LOCUS_07500 12795 14021 gene locus_tag LOCUS_07510 12795 14021 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023889.1 protein_id gnl|my_center|LOCUS_07510 14023 14595 gene locus_tag LOCUS_07520 14023 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 14588 15511 gene locus_tag LOCUS_07530 14588 15511 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023887.1 protein_id gnl|my_center|LOCUS_07530 15537 16013 gene locus_tag LOCUS_07540 15537 16013 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065868.1 protein_id gnl|my_center|LOCUS_07540 16050 16343 gene locus_tag LOCUS_07550 16050 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 16431 16877 gene locus_tag LOCUS_07560 gene mscL 16431 16877 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_07560 17914 16946 gene locus_tag LOCUS_07570 17914 16946 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_07570 17997 19091 gene locus_tag LOCUS_07580 17997 19091 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_07580 19104 20279 gene locus_tag LOCUS_07590 19104 20279 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024280.1 protein_id gnl|my_center|LOCUS_07590 20341 20796 gene locus_tag LOCUS_07600 20341 20796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 20877 22454 gene locus_tag LOCUS_07610 gene serA 20877 22454 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_07610 23154 22462 gene locus_tag LOCUS_07620 23154 22462 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_07620 23191 23877 gene locus_tag LOCUS_07630 23191 23877 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024313.1 protein_id gnl|my_center|LOCUS_07630 24788 23910 gene locus_tag LOCUS_07640 gene argB 24788 23910 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024391.1 protein_id gnl|my_center|LOCUS_07640 25238 24858 gene locus_tag LOCUS_07650 25238 24858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 25641 26702 gene locus_tag LOCUS_07660 25641 26702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence020 2086 1586 gene locus_tag LOCUS_07670 2086 1586 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080776.1 protein_id gnl|my_center|LOCUS_07670 3816 2170 gene locus_tag LOCUS_07680 gene thsB 3816 2170 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878948.1 protein_id gnl|my_center|LOCUS_07680 3973 4722 gene locus_tag LOCUS_07690 gene pstB 3973 4722 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_07690 4746 5405 gene locus_tag LOCUS_07700 gene phoU 4746 5405 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_07700 5413 6414 gene locus_tag LOCUS_07710 5413 6414 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021397.1 protein_id gnl|my_center|LOCUS_07710 6906 6466 gene locus_tag LOCUS_07720 6906 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 7433 6903 gene locus_tag LOCUS_07730 7433 6903 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 protein_id gnl|my_center|LOCUS_07730 7657 7729 gene locus_tag LOCUS_t00100 7657 7729 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7995 8870 gene locus_tag LOCUS_07740 7995 8870 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065217.1 protein_id gnl|my_center|LOCUS_07740 9337 9786 gene locus_tag LOCUS_07750 9337 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 10926 10240 gene locus_tag LOCUS_07760 10926 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 11363 10932 gene locus_tag LOCUS_07770 11363 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 11769 11371 gene locus_tag LOCUS_07780 11769 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 13228 12077 gene locus_tag LOCUS_07790 13228 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 13589 13233 gene locus_tag LOCUS_07800 gene cheY 13589 13233 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081049.1 protein_id gnl|my_center|LOCUS_07800 14245 14475 gene locus_tag LOCUS_07810 14245 14475 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904108.1 protein_id gnl|my_center|LOCUS_07810 14512 15318 gene locus_tag LOCUS_07820 14512 15318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 15405 16487 gene locus_tag LOCUS_07830 gene gvpN 15405 16487 CDS product gas vesicle protein GvpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890517.1 protein_id gnl|my_center|LOCUS_07830 16498 16866 gene locus_tag LOCUS_07840 16498 16866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 16898 17185 gene locus_tag LOCUS_07850 16898 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 17190 17876 gene locus_tag LOCUS_07860 gene gvpF 17190 17876 CDS product gas vesicle protein GvpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890522.1 protein_id gnl|my_center|LOCUS_07860 17877 18164 gene locus_tag LOCUS_07870 17877 18164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 18161 18430 gene locus_tag LOCUS_07880 18161 18430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 18450 18692 gene locus_tag LOCUS_07890 18450 18692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 18697 19065 gene locus_tag LOCUS_07900 18697 19065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 19125 19781 gene locus_tag LOCUS_07910 19125 19781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 19805 20119 gene locus_tag LOCUS_07920 19805 20119 CDS product gas vesicle protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904100.1 protein_id gnl|my_center|LOCUS_07920 20116 20913 gene locus_tag LOCUS_07930 gene gvpL 20116 20913 CDS product gas vesicle protein GvpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890528.1 protein_id gnl|my_center|LOCUS_07930 20944 21501 gene locus_tag LOCUS_07940 20944 21501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 22131 21532 gene locus_tag LOCUS_07950 22131 21532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 22746 22558 gene locus_tag LOCUS_07960 22746 22558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 25143 23041 gene locus_tag LOCUS_07970 25143 23041 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence021 1617 175 gene locus_tag LOCUS_07980 gene argH 1617 175 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_07980 2779 1619 gene locus_tag LOCUS_07990 gene argJ 2779 1619 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330363.1 protein_id gnl|my_center|LOCUS_07990 3251 2772 gene locus_tag LOCUS_08000 3251 2772 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_08000 4296 3271 gene locus_tag LOCUS_08010 gene argC 4296 3271 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 protein_id gnl|my_center|LOCUS_08010 5320 4313 gene locus_tag LOCUS_08020 5320 4313 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_08020 5453 5998 gene locus_tag LOCUS_08030 5453 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 6426 6232 gene locus_tag LOCUS_08040 6426 6232 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925387.1 protein_id gnl|my_center|LOCUS_08040 8256 6463 gene locus_tag LOCUS_08050 8256 6463 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022843.1 protein_id gnl|my_center|LOCUS_08050 8915 8583 gene locus_tag LOCUS_08060 8915 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 9073 10032 gene locus_tag LOCUS_08070 9073 10032 CDS product EF-Tu/IF-2/RF-3 family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_08070 10542 10060 gene locus_tag LOCUS_08080 10542 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022230.1 protein_id gnl|my_center|LOCUS_08080 10633 11532 gene locus_tag LOCUS_08090 10633 11532 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066118.1 protein_id gnl|my_center|LOCUS_08090 11533 12303 gene locus_tag LOCUS_08100 11533 12303 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_08100 12323 13024 gene locus_tag LOCUS_08110 12323 13024 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_08110 13515 13285 gene locus_tag LOCUS_08120 13515 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 14428 13640 gene locus_tag LOCUS_08130 14428 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 14743 14928 gene locus_tag LOCUS_08140 14743 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 15674 15495 gene locus_tag LOCUS_08150 15674 15495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 16987 16187 gene locus_tag LOCUS_08160 16987 16187 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_08160 17146 17463 gene locus_tag LOCUS_08170 17146 17463 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065922.1 protein_id gnl|my_center|LOCUS_08170 18572 17475 gene locus_tag LOCUS_08180 18572 17475 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762445.1 protein_id gnl|my_center|LOCUS_08180 18713 19948 gene locus_tag LOCUS_08190 18713 19948 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_08190 21151 20024 gene locus_tag LOCUS_08200 21151 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 23299 22517 gene locus_tag LOCUS_08210 23299 22517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 23533 24207 gene locus_tag LOCUS_08220 23533 24207 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023469.1 protein_id gnl|my_center|LOCUS_08220 24204 24512 gene locus_tag LOCUS_08230 24204 24512 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023468.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence022 864 4 gene locus_tag LOCUS_08240 864 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 1084 1956 gene locus_tag LOCUS_08250 gene hisG 1084 1956 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_08250 2038 1963 gene locus_tag LOCUS_t00110 2038 1963 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2406 2095 gene locus_tag LOCUS_08260 2406 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 3576 2446 gene locus_tag LOCUS_08270 3576 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 4898 3573 gene locus_tag LOCUS_08280 4898 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 5410 6081 gene locus_tag LOCUS_08290 5410 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 6264 7424 gene locus_tag LOCUS_08300 6264 7424 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066055.1 protein_id gnl|my_center|LOCUS_08300 7414 8460 gene locus_tag LOCUS_08310 gene hisC 7414 8460 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_08310 8451 8999 gene locus_tag LOCUS_08320 8451 8999 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877227.1 protein_id gnl|my_center|LOCUS_08320 9214 8954 gene locus_tag LOCUS_08330 9214 8954 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023444.1 protein_id gnl|my_center|LOCUS_08330 11443 9260 gene locus_tag LOCUS_08340 11443 9260 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_08340 11560 13284 gene locus_tag LOCUS_08350 gene ade 11560 13284 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_08350 13494 14219 gene locus_tag LOCUS_08360 13494 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 14944 14468 gene locus_tag LOCUS_08370 14944 14468 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532958.1 protein_id gnl|my_center|LOCUS_08370 15574 14945 gene locus_tag LOCUS_08380 15574 14945 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 protein_id gnl|my_center|LOCUS_08380 16297 15599 gene locus_tag LOCUS_08390 16297 15599 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869613.1 protein_id gnl|my_center|LOCUS_08390 17070 16294 gene locus_tag LOCUS_08400 17070 16294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869614.1 protein_id gnl|my_center|LOCUS_08400 18284 17058 gene locus_tag LOCUS_08410 18284 17058 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_08410 18497 18991 gene locus_tag LOCUS_08420 18497 18991 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_08420 19591 21135 gene locus_tag LOCUS_08430 19591 21135 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 protein_id gnl|my_center|LOCUS_08430 21155 22351 gene locus_tag LOCUS_08440 21155 22351 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066406.1 protein_id gnl|my_center|LOCUS_08440 22407 23618 gene locus_tag LOCUS_08450 22407 23618 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279118.1 protein_id gnl|my_center|LOCUS_08450 23654 24499 gene locus_tag LOCUS_08460 23654 24499 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021378.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence023 <1 652 gene locus_tag LOCUS_08470 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021121.1:30S ribosomal protein S5 655 1110 gene locus_tag LOCUS_08480 655 1110 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021122.1 protein_id gnl|my_center|LOCUS_08480 1117 1494 gene locus_tag LOCUS_08490 1117 1494 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_08490 1491 3104 gene locus_tag LOCUS_08500 gene secY 1491 3104 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_08500 3101 3709 gene locus_tag LOCUS_08510 3101 3709 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021131.1 protein_id gnl|my_center|LOCUS_08510 3711 4229 gene locus_tag LOCUS_08520 3711 4229 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879393.1 protein_id gnl|my_center|LOCUS_08520 4397 5323 gene locus_tag LOCUS_08530 4397 5323 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021133.1 protein_id gnl|my_center|LOCUS_08530 5564 6778 gene locus_tag LOCUS_08540 gene larC 5564 6778 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_08540 6837 8105 gene locus_tag LOCUS_08550 gene hemL 6837 8105 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_08550 8237 9019 gene locus_tag LOCUS_08560 gene hemC 8237 9019 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020631.1 protein_id gnl|my_center|LOCUS_08560 9006 10469 gene locus_tag LOCUS_08570 gene cobA 9006 10469 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_08570 10466 11626 gene locus_tag LOCUS_08580 10466 11626 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878621.1 protein_id gnl|my_center|LOCUS_08580 12352 11864 gene locus_tag LOCUS_08590 12352 11864 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143524.1 protein_id gnl|my_center|LOCUS_08590 12494 14467 gene locus_tag LOCUS_08600 12494 14467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 14622 14449 gene locus_tag LOCUS_08610 14622 14449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 14941 14753 gene locus_tag LOCUS_08620 14941 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 15150 15680 gene locus_tag LOCUS_08630 15150 15680 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_08630 15687 16466 gene locus_tag LOCUS_08640 15687 16466 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_08640 16686 17093 gene locus_tag LOCUS_08650 16686 17093 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024057.1 protein_id gnl|my_center|LOCUS_08650 17921 17124 gene locus_tag LOCUS_08660 17921 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 18461 18003 gene locus_tag LOCUS_08670 18461 18003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 18612 19172 gene locus_tag LOCUS_08680 18612 19172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 19321 19638 gene locus_tag LOCUS_08690 19321 19638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 19881 19645 gene locus_tag LOCUS_08700 19881 19645 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879278.1 protein_id gnl|my_center|LOCUS_08700 20463 19888 gene locus_tag LOCUS_08710 gene hpt 20463 19888 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020762.1 protein_id gnl|my_center|LOCUS_08710 21227 20667 gene locus_tag LOCUS_08720 21227 20667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 22275 21382 gene locus_tag LOCUS_08730 22275 21382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence024 459 761 gene locus_tag LOCUS_08740 459 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1016 3187 gene locus_tag LOCUS_08750 1016 3187 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_08750 4108 3206 gene locus_tag LOCUS_08760 4108 3206 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879092.1 protein_id gnl|my_center|LOCUS_08760 4882 4130 gene locus_tag LOCUS_08770 gene fdhD 4882 4130 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437321.1 protein_id gnl|my_center|LOCUS_08770 6070 4886 gene locus_tag LOCUS_08780 6070 4886 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867356.1 protein_id gnl|my_center|LOCUS_08780 6861 6052 gene locus_tag LOCUS_08790 gene larE 6861 6052 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080596.1 protein_id gnl|my_center|LOCUS_08790 7222 6896 gene locus_tag LOCUS_08800 7222 6896 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990605.1 protein_id gnl|my_center|LOCUS_08800 7412 7768 gene locus_tag LOCUS_08810 7412 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 8950 7865 gene locus_tag LOCUS_08820 8950 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 9199 9951 gene locus_tag LOCUS_08830 9199 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 10182 10006 gene locus_tag LOCUS_08840 10182 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 10280 12142 gene locus_tag LOCUS_08850 10280 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 12169 16323 gene locus_tag LOCUS_08860 12169 16323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 16386 17363 gene locus_tag LOCUS_08870 16386 17363 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_08870 17336 18373 gene locus_tag LOCUS_08880 17336 18373 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 protein_id gnl|my_center|LOCUS_08880 18377 19165 gene locus_tag LOCUS_08890 18377 19165 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 protein_id gnl|my_center|LOCUS_08890 19423 21225 gene locus_tag LOCUS_08900 19423 21225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 22472 21255 gene locus_tag LOCUS_08910 gene maeB 22472 21255 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence025 352 945 gene locus_tag LOCUS_08920 352 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1052 1237 gene locus_tag LOCUS_08930 1052 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1234 1524 gene locus_tag LOCUS_08940 1234 1524 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902003.1 protein_id gnl|my_center|LOCUS_08940 1923 1645 gene locus_tag LOCUS_08950 1923 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 2704 1928 gene locus_tag LOCUS_08960 2704 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 3652 2711 gene locus_tag LOCUS_08970 3652 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 4331 3705 gene locus_tag LOCUS_08980 4331 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 6393 4345 gene locus_tag LOCUS_08990 6393 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 6824 6390 gene locus_tag LOCUS_09000 6824 6390 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846630.1 protein_id gnl|my_center|LOCUS_09000 7324 6821 gene locus_tag LOCUS_09010 7324 6821 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979773.1 protein_id gnl|my_center|LOCUS_09010 8216 7350 gene locus_tag LOCUS_09020 8216 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545127.1 protein_id gnl|my_center|LOCUS_09020 8600 8220 gene locus_tag LOCUS_09030 8600 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546344.1 protein_id gnl|my_center|LOCUS_09030 9574 8597 gene locus_tag LOCUS_09040 gene cmr4 9574 8597 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546538.1 protein_id gnl|my_center|LOCUS_09040 12293 9585 gene locus_tag LOCUS_09050 12293 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 13380 12280 gene locus_tag LOCUS_09060 13380 12280 CDS product CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546434.1 protein_id gnl|my_center|LOCUS_09060 14269 13370 gene locus_tag LOCUS_09070 14269 13370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 15014 14271 gene locus_tag LOCUS_09080 15014 14271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 17925 15004 gene locus_tag LOCUS_09090 17925 15004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 18247 19260 gene locus_tag LOCUS_09100 gene cas1 18247 19260 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258803.1 protein_id gnl|my_center|LOCUS_09100 19280 19558 gene locus_tag LOCUS_09110 19280 19558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 19562 20146 gene locus_tag LOCUS_09120 gene cas4 19562 20146 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879370.1 protein_id gnl|my_center|LOCUS_09120 20241 21176 gene locus_tag LOCUS_09130 gene cas4a 20241 21176 CDS product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977960.1 protein_id gnl|my_center|LOCUS_09130 21175 >22188 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcagttcccttctcatcgggatgtgctttgcgac >Feature sequence026 935 282 gene locus_tag LOCUS_09140 935 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1060 1515 gene locus_tag LOCUS_09150 1060 1515 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869527.1 protein_id gnl|my_center|LOCUS_09150 1512 2822 gene locus_tag LOCUS_09160 1512 2822 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023357.1 protein_id gnl|my_center|LOCUS_09160 2819 3040 gene locus_tag LOCUS_09170 2819 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3037 4536 gene locus_tag LOCUS_09180 gene serS 3037 4536 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876746.1 protein_id gnl|my_center|LOCUS_09180 4555 5469 gene locus_tag LOCUS_09190 4555 5469 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_09190 5469 5921 gene locus_tag LOCUS_09200 5469 5921 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_09200 5926 7353 gene locus_tag LOCUS_09210 5926 7353 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020324.1 protein_id gnl|my_center|LOCUS_09210 7360 8094 gene locus_tag LOCUS_09220 7360 8094 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_09220 8674 8132 gene locus_tag LOCUS_09230 8674 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 8849 9814 gene locus_tag LOCUS_09240 8849 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 11053 9860 gene locus_tag LOCUS_09250 11053 9860 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_09250 12140 11880 gene locus_tag LOCUS_09260 12140 11880 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_09260 12255 12647 gene locus_tag LOCUS_09270 12255 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 13456 13719 gene locus_tag LOCUS_09280 13456 13719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 14355 13762 gene locus_tag LOCUS_09290 14355 13762 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020569.1 protein_id gnl|my_center|LOCUS_09290 15408 14395 gene locus_tag LOCUS_09300 15408 14395 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020570.1 protein_id gnl|my_center|LOCUS_09300 16021 15389 gene locus_tag LOCUS_09310 16021 15389 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 protein_id gnl|my_center|LOCUS_09310 17433 16033 gene locus_tag LOCUS_09320 17433 16033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 18313 17417 gene locus_tag LOCUS_09330 18313 17417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09330 19023 18298 gene locus_tag LOCUS_09340 19023 18298 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024142.1 protein_id gnl|my_center|LOCUS_09340 19628 19020 gene locus_tag LOCUS_09350 19628 19020 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024143.1 protein_id gnl|my_center|LOCUS_09350 20134 19622 gene locus_tag LOCUS_09360 20134 19622 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878235.1 protein_id gnl|my_center|LOCUS_09360 20751 20212 gene locus_tag LOCUS_09370 20751 20212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020868.1 protein_id gnl|my_center|LOCUS_09370 21514 20849 gene locus_tag LOCUS_09380 21514 20849 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878900.1 protein_id gnl|my_center|LOCUS_09380 21575 21895 gene locus_tag LOCUS_09390 21575 21895 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878730.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence027 4350 4 gene locus_tag LOCUS_09400 4350 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 5927 4347 gene locus_tag LOCUS_09410 5927 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 6068 6544 gene locus_tag LOCUS_09420 6068 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 6556 6867 gene locus_tag LOCUS_09430 6556 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 6947 8284 gene locus_tag LOCUS_09440 6947 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 8285 9739 gene locus_tag LOCUS_09450 8285 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 11406 9745 gene locus_tag LOCUS_09460 11406 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 12005 11403 gene locus_tag LOCUS_09470 12005 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 13387 12002 gene locus_tag LOCUS_09480 13387 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 14908 13388 gene locus_tag LOCUS_09490 14908 13388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 16293 15148 gene locus_tag LOCUS_09500 16293 15148 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065228.1 protein_id gnl|my_center|LOCUS_09500 16986 16333 gene locus_tag LOCUS_09510 gene rnhB 16986 16333 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021954.1 protein_id gnl|my_center|LOCUS_09510 17692 17036 gene locus_tag LOCUS_09520 17692 17036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 19400 18228 gene locus_tag LOCUS_09530 19400 18228 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_09530 20821 19451 gene locus_tag LOCUS_09540 20821 19451 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_09540 21575 20823 gene locus_tag LOCUS_09550 21575 20823 CDS product disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064949.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence028 <1 551 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtttcaatccctgtcgggttttcaagtccgctgcaac 929 663 gene locus_tag LOCUS_09560 929 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1966 926 gene locus_tag LOCUS_09570 gene cas1 1966 926 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_09570 2685 1963 gene locus_tag LOCUS_09580 2685 1963 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_09580 3284 2688 gene locus_tag LOCUS_09590 3284 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 5391 3268 gene locus_tag LOCUS_09600 5391 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 5921 5451 gene locus_tag LOCUS_09610 5921 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 6437 5958 gene locus_tag LOCUS_09620 6437 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 7301 6504 gene locus_tag LOCUS_09630 7301 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 8314 7304 gene locus_tag LOCUS_09640 8314 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 8754 8311 gene locus_tag LOCUS_09650 8754 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 11358 8761 gene locus_tag LOCUS_09660 11358 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 12173 11358 gene locus_tag LOCUS_09670 12173 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 12346 12975 gene locus_tag LOCUS_09680 12346 12975 CDS product CRISPR-associated transcriptional regulator Csa3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879362.1 protein_id gnl|my_center|LOCUS_09680 13113 13385 gene locus_tag LOCUS_09690 13113 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 13382 14227 gene locus_tag LOCUS_09700 13382 14227 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 protein_id gnl|my_center|LOCUS_09700 14227 14982 gene locus_tag LOCUS_09710 14227 14982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_09710 14975 15781 gene locus_tag LOCUS_09720 14975 15781 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927154.1 protein_id gnl|my_center|LOCUS_09720 15818 16783 gene locus_tag LOCUS_09730 15818 16783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 16786 17718 gene locus_tag LOCUS_09740 16786 17718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878797.1 protein_id gnl|my_center|LOCUS_09740 17702 18487 gene locus_tag LOCUS_09750 17702 18487 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095630.1 protein_id gnl|my_center|LOCUS_09750 18507 19727 gene locus_tag LOCUS_09760 gene folP 18507 19727 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065738.1 protein_id gnl|my_center|LOCUS_09760 19733 20896 gene locus_tag LOCUS_09770 19733 20896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 20981 20910 gene locus_tag LOCUS_t00120 20981 20910 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 21281 21012 gene locus_tag LOCUS_09780 21281 21012 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021485.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence029 109 2130 gene locus_tag LOCUS_09790 gene fpoL 109 2130 CDS product F420H2 dehydrogenase subunit FpoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021518.1 protein_id gnl|my_center|LOCUS_09790 2127 3629 gene locus_tag LOCUS_09800 gene fpoM 2127 3629 CDS product F(420)H(2) dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_09800 3631 5130 gene locus_tag LOCUS_09810 gene fpoN 3631 5130 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_09810 5421 5624 gene locus_tag LOCUS_09820 5421 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 5898 6704 gene locus_tag LOCUS_09830 5898 6704 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021656.1 protein_id gnl|my_center|LOCUS_09830 6934 7746 gene locus_tag LOCUS_09840 6934 7746 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_09840 8645 7821 gene locus_tag LOCUS_09850 8645 7821 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021156.1 protein_id gnl|my_center|LOCUS_09850 9733 8651 gene locus_tag LOCUS_09860 9733 8651 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065044.1 protein_id gnl|my_center|LOCUS_09860 10064 10468 gene locus_tag LOCUS_09870 10064 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 10513 11538 gene locus_tag LOCUS_09880 10513 11538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 11849 11586 gene locus_tag LOCUS_09890 11849 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 12642 12421 gene locus_tag LOCUS_09900 12642 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 13641 12853 gene locus_tag LOCUS_09910 13641 12853 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_09910 14654 13665 gene locus_tag LOCUS_09920 14654 13665 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_09920 14820 16103 gene locus_tag LOCUS_09930 14820 16103 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 protein_id gnl|my_center|LOCUS_09930 16629 16069 gene locus_tag LOCUS_09940 gene comE 16629 16069 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_09940 17144 16626 gene locus_tag LOCUS_09950 gene comD 17144 16626 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 protein_id gnl|my_center|LOCUS_09950 18741 17194 gene locus_tag LOCUS_09960 gene uvrC 18741 17194 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 protein_id gnl|my_center|LOCUS_09960 19174 19404 gene locus_tag LOCUS_09970 19174 19404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 20423 19455 gene locus_tag LOCUS_09980 20423 19455 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928941.1 protein_id gnl|my_center|LOCUS_09980 21412 20483 gene locus_tag LOCUS_09990 21412 20483 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence030 1098 916 gene locus_tag LOCUS_10000 1098 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1045 2220 gene locus_tag LOCUS_10010 1045 2220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066363.1 protein_id gnl|my_center|LOCUS_10010 2264 3424 gene locus_tag LOCUS_10020 2264 3424 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021679.1 protein_id gnl|my_center|LOCUS_10020 3866 4102 gene locus_tag LOCUS_10030 3866 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 6553 4082 gene locus_tag LOCUS_10040 6553 4082 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877144.1 protein_id gnl|my_center|LOCUS_10040 7106 6582 gene locus_tag LOCUS_10050 7106 6582 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065175.1 protein_id gnl|my_center|LOCUS_10050 7381 7106 gene locus_tag LOCUS_10060 7381 7106 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021663.1 protein_id gnl|my_center|LOCUS_10060 7842 7510 gene locus_tag LOCUS_10070 gene tusB 7842 7510 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023824.1 protein_id gnl|my_center|LOCUS_10070 8178 7855 gene locus_tag LOCUS_10080 8178 7855 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023823.1 protein_id gnl|my_center|LOCUS_10080 8558 8193 gene locus_tag LOCUS_10090 8558 8193 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755961.1 protein_id gnl|my_center|LOCUS_10090 9377 8571 gene locus_tag LOCUS_10100 9377 8571 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066548.1 protein_id gnl|my_center|LOCUS_10100 10468 9392 gene locus_tag LOCUS_10110 gene arsB 10468 9392 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461620.1 protein_id gnl|my_center|LOCUS_10110 11554 10502 gene locus_tag LOCUS_10120 11554 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 12036 11551 gene locus_tag LOCUS_10130 12036 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 12492 13028 gene locus_tag LOCUS_10140 12492 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 13059 14447 gene locus_tag LOCUS_10150 13059 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 14739 14503 gene locus_tag LOCUS_10160 14739 14503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 14911 15252 gene locus_tag LOCUS_10170 14911 15252 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306389.1 protein_id gnl|my_center|LOCUS_10170 15257 16345 gene locus_tag LOCUS_10180 15257 16345 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023833.1 protein_id gnl|my_center|LOCUS_10180 16368 16931 gene locus_tag LOCUS_10190 16368 16931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 17036 18133 gene locus_tag LOCUS_10200 17036 18133 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990787.1 protein_id gnl|my_center|LOCUS_10200 18153 18398 gene locus_tag LOCUS_10210 18153 18398 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_10210 18450 18800 gene locus_tag LOCUS_10220 18450 18800 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990672.1 protein_id gnl|my_center|LOCUS_10220 18827 19204 gene locus_tag LOCUS_10230 18827 19204 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_10230 19201 20280 gene locus_tag LOCUS_10240 19201 20280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence031 1506 238 gene locus_tag LOCUS_10250 1506 238 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978812.1 protein_id gnl|my_center|LOCUS_10250 2384 1704 gene locus_tag LOCUS_10260 2384 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 2798 3211 gene locus_tag LOCUS_10270 2798 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3318 3914 gene locus_tag LOCUS_10280 3318 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5081 3921 gene locus_tag LOCUS_10290 5081 3921 CDS product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 protein_id gnl|my_center|LOCUS_10290 6140 5145 gene locus_tag LOCUS_10300 6140 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 7107 6271 gene locus_tag LOCUS_10310 7107 6271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860221.1 protein_id gnl|my_center|LOCUS_10310 8100 7114 gene locus_tag LOCUS_10320 8100 7114 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022455.1 protein_id gnl|my_center|LOCUS_10320 9736 8138 gene locus_tag LOCUS_10330 9736 8138 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065417.1 protein_id gnl|my_center|LOCUS_10330 10128 10625 gene locus_tag LOCUS_10340 10128 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 10622 11401 gene locus_tag LOCUS_10350 10622 11401 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_10350 11401 11607 gene locus_tag LOCUS_10360 11401 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 13216 11630 gene locus_tag LOCUS_10370 13216 11630 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065417.1 protein_id gnl|my_center|LOCUS_10370 14181 13372 gene locus_tag LOCUS_10380 14181 13372 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022038.1 protein_id gnl|my_center|LOCUS_10380 15253 14189 gene locus_tag LOCUS_10390 15253 14189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 15952 15362 gene locus_tag LOCUS_10400 15952 15362 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496456.1 protein_id gnl|my_center|LOCUS_10400 17334 15991 gene locus_tag LOCUS_10410 gene purB 17334 15991 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066555.1 protein_id gnl|my_center|LOCUS_10410 17482 17781 gene locus_tag LOCUS_10420 17482 17781 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943454.1 protein_id gnl|my_center|LOCUS_10420 18040 17846 gene locus_tag LOCUS_10430 18040 17846 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064461.1 protein_id gnl|my_center|LOCUS_10430 19918 18092 gene locus_tag LOCUS_10440 19918 18092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 20115 19900 gene locus_tag LOCUS_10450 20115 19900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 20495 20971 gene locus_tag LOCUS_10460 20495 20971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence032 95 985 gene locus_tag LOCUS_10470 95 985 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020197.1 protein_id gnl|my_center|LOCUS_10470 982 2652 gene locus_tag LOCUS_10480 982 2652 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020198.1 protein_id gnl|my_center|LOCUS_10480 3686 2688 gene locus_tag LOCUS_10490 3686 2688 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683404.1 protein_id gnl|my_center|LOCUS_10490 4773 3718 gene locus_tag LOCUS_10500 4773 3718 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879224.1 protein_id gnl|my_center|LOCUS_10500 5132 4938 gene locus_tag LOCUS_10510 5132 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 6162 5653 gene locus_tag LOCUS_10520 6162 5653 CDS product DUF2299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270501.1 protein_id gnl|my_center|LOCUS_10520 7125 6235 gene locus_tag LOCUS_10530 gene fhcD 7125 6235 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020069.1 protein_id gnl|my_center|LOCUS_10530 7737 7135 gene locus_tag LOCUS_10540 gene purO 7737 7135 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876651.1 protein_id gnl|my_center|LOCUS_10540 8615 7740 gene locus_tag LOCUS_10550 gene porB 8615 7740 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_10550 9812 8628 gene locus_tag LOCUS_10560 gene porA 9812 8628 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_10560 10072 9812 gene locus_tag LOCUS_10570 gene porD 10072 9812 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020092.1 protein_id gnl|my_center|LOCUS_10570 10605 10069 gene locus_tag LOCUS_10580 10605 10069 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_10580 10776 11459 gene locus_tag LOCUS_10590 10776 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 11504 13312 gene locus_tag LOCUS_10600 11504 13312 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020947.1 protein_id gnl|my_center|LOCUS_10600 14246 13374 gene locus_tag LOCUS_10610 14246 13374 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066525.1 protein_id gnl|my_center|LOCUS_10610 14347 14967 gene locus_tag LOCUS_10620 gene psmB 14347 14967 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_10620 14988 16895 gene locus_tag LOCUS_10630 14988 16895 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_10630 16958 17488 gene locus_tag LOCUS_10640 16958 17488 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022953.1 protein_id gnl|my_center|LOCUS_10640 17488 18288 gene locus_tag LOCUS_10650 17488 18288 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589532.1 protein_id gnl|my_center|LOCUS_10650 18300 20729 gene locus_tag LOCUS_10660 18300 20729 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021427.1 protein_id gnl|my_center|LOCUS_10660 21004 20735 gene locus_tag LOCUS_10670 21004 20735 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055429980.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence033 534 169 gene locus_tag LOCUS_10680 534 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 725 2062 gene locus_tag LOCUS_10690 725 2062 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_10690 2179 2787 gene locus_tag LOCUS_10700 2179 2787 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021808.1 protein_id gnl|my_center|LOCUS_10700 2803 3726 gene locus_tag LOCUS_10710 gene mtrH 2803 3726 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021807.1 protein_id gnl|my_center|LOCUS_10710 3763 4932 gene locus_tag LOCUS_10720 3763 4932 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_10720 4935 5327 gene locus_tag LOCUS_10730 4935 5327 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_10730 6401 5343 gene locus_tag LOCUS_10740 gene hisC 6401 5343 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_10740 6455 7336 gene locus_tag LOCUS_10750 6455 7336 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065986.1 protein_id gnl|my_center|LOCUS_10750 7631 7494 gene locus_tag LOCUS_10760 7631 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 8494 7781 gene locus_tag LOCUS_10770 8494 7781 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021001.1 protein_id gnl|my_center|LOCUS_10770 8590 8814 gene locus_tag LOCUS_10780 8590 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 9749 8841 gene locus_tag LOCUS_10790 gene nifB 9749 8841 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024080.1 protein_id gnl|my_center|LOCUS_10790 9886 10188 gene locus_tag LOCUS_10800 9886 10188 CDS product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066074.1 protein_id gnl|my_center|LOCUS_10800 10561 10244 gene locus_tag LOCUS_10810 10561 10244 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869817.1 protein_id gnl|my_center|LOCUS_10810 10680 11324 gene locus_tag LOCUS_10820 10680 11324 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065077.1 protein_id gnl|my_center|LOCUS_10820 11360 11713 gene locus_tag LOCUS_10830 11360 11713 CDS product DUF2209 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023531.1 protein_id gnl|my_center|LOCUS_10830 11724 12008 gene locus_tag LOCUS_10840 11724 12008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 11993 12727 gene locus_tag LOCUS_10850 11993 12727 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_10850 12786 14651 gene locus_tag LOCUS_10860 12786 14651 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022845.1 protein_id gnl|my_center|LOCUS_10860 14661 15050 gene locus_tag LOCUS_10870 14661 15050 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064993.1 protein_id gnl|my_center|LOCUS_10870 15057 16805 gene locus_tag LOCUS_10880 15057 16805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 17572 16817 gene locus_tag LOCUS_10890 17572 16817 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_10890 18395 17565 gene locus_tag LOCUS_10900 18395 17565 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 protein_id gnl|my_center|LOCUS_10900 19594 18392 gene locus_tag LOCUS_10910 gene coaBC 19594 18392 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065075.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence034 179 637 gene locus_tag LOCUS_10920 179 637 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021715.1 protein_id gnl|my_center|LOCUS_10920 741 668 gene locus_tag LOCUS_t00130 741 668 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 833 1222 gene locus_tag LOCUS_10930 833 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1574 1227 gene locus_tag LOCUS_10940 gene queD 1574 1227 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065925.1 protein_id gnl|my_center|LOCUS_10940 2535 1657 gene locus_tag LOCUS_10950 gene dph5 2535 1657 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_10950 2534 3202 gene locus_tag LOCUS_10960 gene mcrC 2534 3202 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024421.1 protein_id gnl|my_center|LOCUS_10960 3199 4374 gene locus_tag LOCUS_10970 3199 4374 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_10970 6236 4392 gene locus_tag LOCUS_10980 6236 4392 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_10980 7759 6233 gene locus_tag LOCUS_10990 7759 6233 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_10990 7870 8601 gene locus_tag LOCUS_11000 7870 8601 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 protein_id gnl|my_center|LOCUS_11000 8609 10393 gene locus_tag LOCUS_11010 8609 10393 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023586.1 protein_id gnl|my_center|LOCUS_11010 10418 11626 gene locus_tag LOCUS_11020 10418 11626 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_11020 11626 12603 gene locus_tag LOCUS_11030 11626 12603 CDS product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023587.1 protein_id gnl|my_center|LOCUS_11030 12770 13933 gene locus_tag LOCUS_11040 12770 13933 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065771.1 protein_id gnl|my_center|LOCUS_11040 13989 14062 gene locus_tag LOCUS_t00140 13989 14062 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14519 14091 gene locus_tag LOCUS_11050 gene rnhA 14519 14091 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978745.1 protein_id gnl|my_center|LOCUS_11050 14673 15737 gene locus_tag LOCUS_11060 14673 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 16652 15777 gene locus_tag LOCUS_11070 16652 15777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 17461 16715 gene locus_tag LOCUS_11080 17461 16715 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065422.1 protein_id gnl|my_center|LOCUS_11080 18298 17468 gene locus_tag LOCUS_11090 18298 17468 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007204.1 protein_id gnl|my_center|LOCUS_11090 19032 18304 gene locus_tag LOCUS_11100 19032 18304 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458882.1 protein_id gnl|my_center|LOCUS_11100 19481 19029 gene locus_tag LOCUS_11110 19481 19029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 20481 19642 gene locus_tag LOCUS_11120 20481 19642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence035 287 1309 gene locus_tag LOCUS_11130 gene amrS 287 1309 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_11130 1357 2574 gene locus_tag LOCUS_11140 1357 2574 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_11140 3078 2578 gene locus_tag LOCUS_11150 3078 2578 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020192.1 protein_id gnl|my_center|LOCUS_11150 3608 3111 gene locus_tag LOCUS_11160 3608 3111 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_11160 3686 6262 gene locus_tag LOCUS_11170 3686 6262 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022991.1 protein_id gnl|my_center|LOCUS_11170 6259 6786 gene locus_tag LOCUS_11180 gene cyaB 6259 6786 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 protein_id gnl|my_center|LOCUS_11180 6800 7672 gene locus_tag LOCUS_11190 6800 7672 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_11190 7720 7920 gene locus_tag LOCUS_11200 7720 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 7917 9044 gene locus_tag LOCUS_11210 gene acuC 7917 9044 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092826.1 protein_id gnl|my_center|LOCUS_11210 9192 9815 gene locus_tag LOCUS_11220 9192 9815 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_11220 9834 10649 gene locus_tag LOCUS_11230 9834 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 11624 10668 gene locus_tag LOCUS_11240 11624 10668 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066456.1 protein_id gnl|my_center|LOCUS_11240 11915 11643 gene locus_tag LOCUS_11250 gene trxA 11915 11643 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065637.1 protein_id gnl|my_center|LOCUS_11250 12388 11939 gene locus_tag LOCUS_11260 12388 11939 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785477.1 protein_id gnl|my_center|LOCUS_11260 13350 12391 gene locus_tag LOCUS_11270 gene ahbD 13350 12391 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_11270 14378 13350 gene locus_tag LOCUS_11280 gene asd 14378 13350 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020482.1 protein_id gnl|my_center|LOCUS_11280 15018 14449 gene locus_tag LOCUS_11290 15018 14449 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459982.1 protein_id gnl|my_center|LOCUS_11290 16791 15601 gene locus_tag LOCUS_11300 16791 15601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 18015 17161 gene locus_tag LOCUS_11310 18015 17161 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_11310 18887 18012 gene locus_tag LOCUS_11320 18887 18012 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_11320 19141 18884 gene locus_tag LOCUS_11330 19141 18884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 19355 19750 gene locus_tag LOCUS_11340 19355 19750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 20211 19825 gene locus_tag LOCUS_11350 20211 19825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048124573.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence036 1368 2297 gene locus_tag LOCUS_11360 1368 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2340 2966 gene locus_tag LOCUS_11370 2340 2966 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_11370 3620 2973 gene locus_tag LOCUS_11380 gene tmk 3620 2973 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_11380 3950 4921 gene locus_tag LOCUS_11390 3950 4921 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878259.1 protein_id gnl|my_center|LOCUS_11390 8722 4970 gene locus_tag LOCUS_11400 gene bchH 8722 4970 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761986.1 protein_id gnl|my_center|LOCUS_11400 9984 8788 gene locus_tag LOCUS_11410 9984 8788 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_11410 10438 9998 gene locus_tag LOCUS_11420 10438 9998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 11024 11290 gene locus_tag LOCUS_11430 11024 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 11449 11967 gene locus_tag LOCUS_11440 11449 11967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 11985 12476 gene locus_tag LOCUS_11450 11985 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 12480 13301 gene locus_tag LOCUS_11460 12480 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 13306 13884 gene locus_tag LOCUS_11470 13306 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 13891 16854 gene locus_tag LOCUS_11480 13891 16854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 17251 16817 gene locus_tag LOCUS_11490 17251 16817 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023752.1 protein_id gnl|my_center|LOCUS_11490 18570 17266 gene locus_tag LOCUS_11500 18570 17266 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence037 1301 177 gene locus_tag LOCUS_11510 1301 177 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 protein_id gnl|my_center|LOCUS_11510 1807 1298 gene locus_tag LOCUS_11520 1807 1298 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020260.1 protein_id gnl|my_center|LOCUS_11520 1895 2278 gene locus_tag LOCUS_11530 1895 2278 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879421.1 protein_id gnl|my_center|LOCUS_11530 2275 3585 gene locus_tag LOCUS_11540 2275 3585 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020878.1 protein_id gnl|my_center|LOCUS_11540 3589 5295 gene locus_tag LOCUS_11550 3589 5295 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064976.1 protein_id gnl|my_center|LOCUS_11550 5296 6066 gene locus_tag LOCUS_11560 5296 6066 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020876.1 protein_id gnl|my_center|LOCUS_11560 6121 7266 gene locus_tag LOCUS_11570 6121 7266 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023596.1 protein_id gnl|my_center|LOCUS_11570 7269 7688 gene locus_tag LOCUS_11580 7269 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 7688 8143 gene locus_tag LOCUS_11590 7688 8143 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021971.1 protein_id gnl|my_center|LOCUS_11590 8225 8311 gene locus_tag LOCUS_t00150 8225 8311 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8681 8496 gene locus_tag LOCUS_11600 8681 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11600 8772 9644 gene locus_tag LOCUS_11610 8772 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 10858 9728 gene locus_tag LOCUS_11620 gene mfnA 10858 9728 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020065.1 protein_id gnl|my_center|LOCUS_11620 13156 10883 gene locus_tag LOCUS_11630 gene ppsA 13156 10883 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_11630 13457 14443 gene locus_tag LOCUS_11640 13457 14443 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023979.1 protein_id gnl|my_center|LOCUS_11640 14630 15991 gene locus_tag LOCUS_11650 14630 15991 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 protein_id gnl|my_center|LOCUS_11650 15998 17518 gene locus_tag LOCUS_11660 gene crtD 15998 17518 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 protein_id gnl|my_center|LOCUS_11660 17512 18450 gene locus_tag LOCUS_11670 17512 18450 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence038 863 102 gene locus_tag LOCUS_11680 863 102 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020355.1 protein_id gnl|my_center|LOCUS_11680 1668 934 gene locus_tag LOCUS_11690 1668 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1774 1947 gene locus_tag LOCUS_11700 1774 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2454 2032 gene locus_tag LOCUS_11710 2454 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902326.1 protein_id gnl|my_center|LOCUS_11710 3349 2471 gene locus_tag LOCUS_11720 3349 2471 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 protein_id gnl|my_center|LOCUS_11720 3518 3709 gene locus_tag LOCUS_11730 3518 3709 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064798.1 protein_id gnl|my_center|LOCUS_11730 4722 3706 gene locus_tag LOCUS_11740 4722 3706 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064802.1 protein_id gnl|my_center|LOCUS_11740 5095 6228 gene locus_tag LOCUS_11750 5095 6228 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_11750 7039 6254 gene locus_tag LOCUS_11760 7039 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 7194 7697 gene locus_tag LOCUS_11770 7194 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 8460 7738 gene locus_tag LOCUS_11780 8460 7738 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020345.1 protein_id gnl|my_center|LOCUS_11780 8539 9630 gene locus_tag LOCUS_11790 8539 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 9638 10549 gene locus_tag LOCUS_11800 9638 10549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_11800 10546 11604 gene locus_tag LOCUS_11810 10546 11604 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266746.1 protein_id gnl|my_center|LOCUS_11810 12434 11601 gene locus_tag LOCUS_11820 12434 11601 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023273.1 protein_id gnl|my_center|LOCUS_11820 13236 12418 gene locus_tag LOCUS_11830 13236 12418 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_11830 14788 13613 gene locus_tag LOCUS_11840 14788 13613 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023369.1 protein_id gnl|my_center|LOCUS_11840 15062 14793 gene locus_tag LOCUS_11850 15062 14793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 15295 15116 gene locus_tag LOCUS_11860 15295 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 16059 15367 gene locus_tag LOCUS_11870 16059 15367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 16245 17042 gene locus_tag LOCUS_11880 16245 17042 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023894.1 protein_id gnl|my_center|LOCUS_11880 17278 17832 gene locus_tag LOCUS_11890 17278 17832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence039 357 809 gene locus_tag LOCUS_11900 357 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 822 1325 gene locus_tag LOCUS_11910 822 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1795 1322 gene locus_tag LOCUS_11920 1795 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2038 1796 gene locus_tag LOCUS_11930 2038 1796 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969698.1 protein_id gnl|my_center|LOCUS_11930 2916 2317 gene locus_tag LOCUS_11940 2916 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3521 2934 gene locus_tag LOCUS_11950 3521 2934 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021058.1 protein_id gnl|my_center|LOCUS_11950 5305 3518 gene locus_tag LOCUS_11960 gene iorA 5305 3518 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065029.1 protein_id gnl|my_center|LOCUS_11960 5472 6512 gene locus_tag LOCUS_11970 5472 6512 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_11970 6551 6853 gene locus_tag LOCUS_11980 6551 6853 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023626.1 protein_id gnl|my_center|LOCUS_11980 8385 6883 gene locus_tag LOCUS_11990 8385 6883 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052292216.1 protein_id gnl|my_center|LOCUS_11990 8470 9984 gene locus_tag LOCUS_12000 8470 9984 CDS product L-aspartate semialdehyde sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021823.1 protein_id gnl|my_center|LOCUS_12000 9996 10373 gene locus_tag LOCUS_12010 9996 10373 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065229.1 protein_id gnl|my_center|LOCUS_12010 10672 14343 gene locus_tag LOCUS_12020 10672 14343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 14990 14340 gene locus_tag LOCUS_12030 14990 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 15958 15050 gene locus_tag LOCUS_12040 15958 15050 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020979.1 protein_id gnl|my_center|LOCUS_12040 <17109 16185 gene locus_tag LOCUS_12050 <17109 16185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020980.1:threonine-phosphate decarboxylase CobD note possible pseudo, frameshifted >Feature sequence040 917 3169 gene locus_tag LOCUS_12060 917 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3172 4380 gene locus_tag LOCUS_12070 3172 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 4377 9596 gene locus_tag LOCUS_12080 4377 9596 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094228360.1 protein_id gnl|my_center|LOCUS_12080 9684 10376 gene locus_tag LOCUS_12090 9684 10376 CDS product DUF2162 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066038.1 protein_id gnl|my_center|LOCUS_12090 10373 11014 gene locus_tag LOCUS_12100 10373 11014 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013194697.1 protein_id gnl|my_center|LOCUS_12100 11001 11357 gene locus_tag LOCUS_12110 11001 11357 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024510.1 protein_id gnl|my_center|LOCUS_12110 11549 13069 gene locus_tag LOCUS_12120 11549 13069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 13083 14075 gene locus_tag LOCUS_12130 13083 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 14143 15303 gene locus_tag LOCUS_12140 gene nifS 14143 15303 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_12140 15765 15313 gene locus_tag LOCUS_12150 15765 15313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020180.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence041 238 1500 gene locus_tag LOCUS_12160 238 1500 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879245.1 protein_id gnl|my_center|LOCUS_12160 1512 1850 gene locus_tag LOCUS_12170 gene glnB 1512 1850 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_12170 3158 1863 gene locus_tag LOCUS_12180 3158 1863 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065684.1 protein_id gnl|my_center|LOCUS_12180 4421 3234 gene locus_tag LOCUS_12190 4421 3234 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 protein_id gnl|my_center|LOCUS_12190 5618 4488 gene locus_tag LOCUS_12200 5618 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 6227 5664 gene locus_tag LOCUS_12210 6227 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 6368 7807 gene locus_tag LOCUS_12220 6368 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 7834 8904 gene locus_tag LOCUS_12230 7834 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 8916 10409 gene locus_tag LOCUS_12240 8916 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 10422 12290 gene locus_tag LOCUS_12250 10422 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 12298 12843 gene locus_tag LOCUS_12260 12298 12843 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020321.1 protein_id gnl|my_center|LOCUS_12260 12976 14085 gene locus_tag LOCUS_12270 12976 14085 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020066.1 protein_id gnl|my_center|LOCUS_12270 14098 15327 gene locus_tag LOCUS_12280 14098 15327 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020067.1 protein_id gnl|my_center|LOCUS_12280 16166 15510 gene locus_tag LOCUS_12290 gene npdG 16166 15510 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence042 1859 231 gene locus_tag LOCUS_12300 1859 231 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065417.1 protein_id gnl|my_center|LOCUS_12300 2860 2051 gene locus_tag LOCUS_12310 2860 2051 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279195.1 protein_id gnl|my_center|LOCUS_12310 4516 2933 gene locus_tag LOCUS_12320 4516 2933 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022453.1 protein_id gnl|my_center|LOCUS_12320 5671 4763 gene locus_tag LOCUS_12330 gene rfaD 5671 4763 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 protein_id gnl|my_center|LOCUS_12330 6833 5721 gene locus_tag LOCUS_12340 6833 5721 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060795.1 protein_id gnl|my_center|LOCUS_12340 7970 6843 gene locus_tag LOCUS_12350 7970 6843 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_12350 8024 10255 gene locus_tag LOCUS_12360 8024 10255 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023658.1 protein_id gnl|my_center|LOCUS_12360 10280 12490 gene locus_tag LOCUS_12370 10280 12490 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065792.1 protein_id gnl|my_center|LOCUS_12370 13259 12540 gene locus_tag LOCUS_12380 13259 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 14583 13423 gene locus_tag LOCUS_12390 14583 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 15415 14636 gene locus_tag LOCUS_12400 15415 14636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence043 221 790 gene locus_tag LOCUS_12410 221 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1749 832 gene locus_tag LOCUS_12420 gene rnz 1749 832 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_12420 2386 4311 gene locus_tag LOCUS_12430 2386 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 4778 5701 gene locus_tag LOCUS_12440 4778 5701 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868810.1 protein_id gnl|my_center|LOCUS_12440 5725 6204 gene locus_tag LOCUS_12450 5725 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 7503 6253 gene locus_tag LOCUS_12460 7503 6253 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936075.1 protein_id gnl|my_center|LOCUS_12460 7741 8865 gene locus_tag LOCUS_12470 7741 8865 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022139.1 protein_id gnl|my_center|LOCUS_12470 8866 9921 gene locus_tag LOCUS_12480 8866 9921 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_12480 9915 10313 gene locus_tag LOCUS_12490 9915 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 10360 14184 gene locus_tag LOCUS_12500 gene bchH 10360 14184 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272597.1 protein_id gnl|my_center|LOCUS_12500 15630 14242 gene locus_tag LOCUS_12510 15630 14242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence044 <1 889 gene locus_tag LOCUS_12520 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020334.1:tetrahydromethanopterin S-methyltransferase subunit E 886 1575 gene locus_tag LOCUS_12530 gene mtrD 886 1575 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 protein_id gnl|my_center|LOCUS_12530 1579 2406 gene locus_tag LOCUS_12540 gene mtrC 1579 2406 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020332.1 protein_id gnl|my_center|LOCUS_12540 2419 2772 gene locus_tag LOCUS_12550 2419 2772 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876784.1 protein_id gnl|my_center|LOCUS_12550 2776 3507 gene locus_tag LOCUS_12560 gene mtrA 2776 3507 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020330.1 protein_id gnl|my_center|LOCUS_12560 3510 3737 gene locus_tag LOCUS_12570 gene mtrF 3510 3737 CDS product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020329.1 protein_id gnl|my_center|LOCUS_12570 3741 3986 gene locus_tag LOCUS_12580 3741 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 3987 4922 gene locus_tag LOCUS_12590 gene mtrH 3987 4922 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020327.1 protein_id gnl|my_center|LOCUS_12590 5076 5627 gene locus_tag LOCUS_12600 5076 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 5822 5673 gene locus_tag LOCUS_12610 5822 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 6485 6300 gene locus_tag LOCUS_12620 6485 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 7515 6535 gene locus_tag LOCUS_12630 7515 6535 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023754.1 protein_id gnl|my_center|LOCUS_12630 8399 7506 gene locus_tag LOCUS_12640 gene cofD 8399 7506 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066127.1 protein_id gnl|my_center|LOCUS_12640 8970 8401 gene locus_tag LOCUS_12650 8970 8401 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023781.1 protein_id gnl|my_center|LOCUS_12650 9332 8967 gene locus_tag LOCUS_12660 gene sepF 9332 8967 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023780.1 protein_id gnl|my_center|LOCUS_12660 9564 9385 gene locus_tag LOCUS_12670 9564 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 10574 9585 gene locus_tag LOCUS_12680 gene cofG 10574 9585 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755891.1 protein_id gnl|my_center|LOCUS_12680 11024 10575 gene locus_tag LOCUS_12690 11024 10575 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_12690 12096 11065 gene locus_tag LOCUS_12700 12096 11065 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_12700 12937 12179 gene locus_tag LOCUS_12710 12937 12179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_12710 13422 14633 gene locus_tag LOCUS_12720 13422 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 14712 15149 gene locus_tag LOCUS_12730 14712 15149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 15146 15505 gene locus_tag LOCUS_12740 15146 15505 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065940.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence045 1242 178 gene locus_tag LOCUS_12750 1242 178 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023154.1 protein_id gnl|my_center|LOCUS_12750 2044 1313 gene locus_tag LOCUS_12760 2044 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2159 3325 gene locus_tag LOCUS_12770 2159 3325 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061240.1 protein_id gnl|my_center|LOCUS_12770 3775 5040 gene locus_tag LOCUS_12780 3775 5040 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024485.1 protein_id gnl|my_center|LOCUS_12780 5631 4978 gene locus_tag LOCUS_12790 5631 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 5944 6714 gene locus_tag LOCUS_12800 5944 6714 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066032.1 protein_id gnl|my_center|LOCUS_12800 6770 7264 gene locus_tag LOCUS_12810 6770 7264 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065830.1 protein_id gnl|my_center|LOCUS_12810 7286 7909 gene locus_tag LOCUS_12820 7286 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 8062 11394 gene locus_tag LOCUS_12830 8062 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 12253 11429 gene locus_tag LOCUS_12840 gene appC 12253 11429 CDS product oligopeptide ABC transporter permease AppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232961.1 protein_id gnl|my_center|LOCUS_12840 13211 12264 gene locus_tag LOCUS_12850 13211 12264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546375.1 protein_id gnl|my_center|LOCUS_12850 14853 13258 gene locus_tag LOCUS_12860 14853 13258 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence046 2275 80 gene locus_tag LOCUS_12870 2275 80 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021278.1 protein_id gnl|my_center|LOCUS_12870 2453 3832 gene locus_tag LOCUS_12880 2453 3832 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_12880 3829 4824 gene locus_tag LOCUS_12890 gene purM 3829 4824 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_12890 5594 4821 gene locus_tag LOCUS_12900 5594 4821 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088944.1 protein_id gnl|my_center|LOCUS_12900 5682 7712 gene locus_tag LOCUS_12910 5682 7712 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879160.1 protein_id gnl|my_center|LOCUS_12910 10763 7725 gene locus_tag LOCUS_12920 10763 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 11238 11387 gene locus_tag LOCUS_12930 11238 11387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 11574 11500 gene locus_tag LOCUS_t00160 11574 11500 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11751 12449 gene locus_tag LOCUS_12940 11751 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 12446 13108 gene locus_tag LOCUS_12950 12446 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 13389 13129 gene locus_tag LOCUS_12960 13389 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 13571 13867 gene locus_tag LOCUS_12970 13571 13867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence047 80 1909 gene locus_tag LOCUS_12980 80 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1906 3003 gene locus_tag LOCUS_12990 gene cmr3 1906 3003 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155321014.1 protein_id gnl|my_center|LOCUS_12990 3006 3821 gene locus_tag LOCUS_13000 gene cmr4 3006 3821 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221897993.1 protein_id gnl|my_center|LOCUS_13000 3802 4206 gene locus_tag LOCUS_13010 3802 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 4203 5201 gene locus_tag LOCUS_13020 4203 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 5198 6406 gene locus_tag LOCUS_13030 5198 6406 CDS product DUF1887 family CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545976.1 protein_id gnl|my_center|LOCUS_13030 6410 6721 gene locus_tag LOCUS_13040 6410 6721 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_13040 6702 7067 gene locus_tag LOCUS_13050 6702 7067 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869620.1 protein_id gnl|my_center|LOCUS_13050 7069 7344 gene locus_tag LOCUS_13060 7069 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 7912 7484 gene locus_tag LOCUS_13070 7912 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 9159 7909 gene locus_tag LOCUS_13080 9159 7909 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_13080 9794 9213 gene locus_tag LOCUS_13090 9794 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 10488 9778 gene locus_tag LOCUS_13100 10488 9778 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_13100 10505 11608 gene locus_tag LOCUS_13110 10505 11608 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_13110 11618 12055 gene locus_tag LOCUS_13120 11618 12055 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020220.1 protein_id gnl|my_center|LOCUS_13120 12052 12912 gene locus_tag LOCUS_13130 12052 12912 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_13130 14076 12919 gene locus_tag LOCUS_13140 14076 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence048 757 401 gene locus_tag LOCUS_13150 757 401 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061032.1 protein_id gnl|my_center|LOCUS_13150 1524 787 gene locus_tag LOCUS_13160 1524 787 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875742.1 protein_id gnl|my_center|LOCUS_13160 1737 1528 gene locus_tag LOCUS_13170 1737 1528 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064700.1 protein_id gnl|my_center|LOCUS_13170 3278 1761 gene locus_tag LOCUS_13180 3278 1761 CDS product DUF2193 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878925.1 protein_id gnl|my_center|LOCUS_13180 3554 3354 gene locus_tag LOCUS_13190 3554 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 3754 3575 gene locus_tag LOCUS_13200 3754 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 5097 3949 gene locus_tag LOCUS_13210 5097 3949 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065771.1 protein_id gnl|my_center|LOCUS_13210 6204 5290 gene locus_tag LOCUS_13220 6204 5290 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340302.1 protein_id gnl|my_center|LOCUS_13220 7730 6216 gene locus_tag LOCUS_13230 7730 6216 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_13230 8518 7739 gene locus_tag LOCUS_13240 8518 7739 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_13240 8809 8528 gene locus_tag LOCUS_13250 8809 8528 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_13250 9513 8812 gene locus_tag LOCUS_13260 9513 8812 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328512.1 protein_id gnl|my_center|LOCUS_13260 10114 9794 gene locus_tag LOCUS_13270 10114 9794 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_13270 10500 10114 gene locus_tag LOCUS_13280 10500 10114 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926973.1 protein_id gnl|my_center|LOCUS_13280 10772 10497 gene locus_tag LOCUS_13290 10772 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 11889 10690 gene locus_tag LOCUS_13300 gene atpD 11889 10690 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_13300 12174 13082 gene locus_tag LOCUS_13310 12174 13082 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249930.1 protein_id gnl|my_center|LOCUS_13310 13103 13678 gene locus_tag LOCUS_13320 13103 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13320 >Feature sequence049 616 113 gene locus_tag LOCUS_13330 616 113 CDS product NOB1 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066159.1 protein_id gnl|my_center|LOCUS_13330 700 1047 gene locus_tag LOCUS_13340 700 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1057 2817 gene locus_tag LOCUS_13350 1057 2817 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_13350 2823 3902 gene locus_tag LOCUS_13360 2823 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728696.1 protein_id gnl|my_center|LOCUS_13360 3940 4137 gene locus_tag LOCUS_13370 3940 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 5242 4169 gene locus_tag LOCUS_13380 5242 4169 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_13380 6871 5423 gene locus_tag LOCUS_13390 6871 5423 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080443.1 protein_id gnl|my_center|LOCUS_13390 7260 7862 gene locus_tag LOCUS_13400 gene hisH 7260 7862 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_13400 7856 8668 gene locus_tag LOCUS_13410 gene hisF 7856 8668 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061292.1 protein_id gnl|my_center|LOCUS_13410 9118 8729 gene locus_tag LOCUS_13420 9118 8729 CDS product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 protein_id gnl|my_center|LOCUS_13420 9443 10006 gene locus_tag LOCUS_13430 9443 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 11232 10051 gene locus_tag LOCUS_13440 11232 10051 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_13440 11399 11229 gene locus_tag LOCUS_13450 11399 11229 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065133.1 protein_id gnl|my_center|LOCUS_13450 11680 11411 gene locus_tag LOCUS_13460 11680 11411 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545551.1 protein_id gnl|my_center|LOCUS_13460 12345 11677 gene locus_tag LOCUS_13470 gene tpiA 12345 11677 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024480.1 protein_id gnl|my_center|LOCUS_13470 12855 12373 gene locus_tag LOCUS_13480 12855 12373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 13382 12963 gene locus_tag LOCUS_13490 13382 12963 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024057.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence050 995 123 gene locus_tag LOCUS_13500 995 123 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020718.1 protein_id gnl|my_center|LOCUS_13500 1107 3104 gene locus_tag LOCUS_13510 1107 3104 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020139.1 protein_id gnl|my_center|LOCUS_13510 3138 3356 gene locus_tag LOCUS_13520 3138 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 3872 7843 gene locus_tag LOCUS_13530 3872 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 8080 11229 gene locus_tag LOCUS_13540 8080 11229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 12454 11249 gene locus_tag LOCUS_13550 12454 11249 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020688.1 protein_id gnl|my_center|LOCUS_13550 12398 13297 gene locus_tag LOCUS_13560 gene larB 12398 13297 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence051 715 170 gene locus_tag LOCUS_13570 gene pyrE 715 170 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057665.1 protein_id gnl|my_center|LOCUS_13570 1544 771 gene locus_tag LOCUS_13580 1544 771 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_13580 1948 1541 gene locus_tag LOCUS_13590 1948 1541 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023482.1 protein_id gnl|my_center|LOCUS_13590 3468 1963 gene locus_tag LOCUS_13600 gene lysS 3468 1963 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066108.1 protein_id gnl|my_center|LOCUS_13600 3548 4006 gene locus_tag LOCUS_13610 3548 4006 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020196.1 protein_id gnl|my_center|LOCUS_13610 4028 5311 gene locus_tag LOCUS_13620 gene lysA 4028 5311 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878303.1 protein_id gnl|my_center|LOCUS_13620 5320 5958 gene locus_tag LOCUS_13630 5320 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 5982 6584 gene locus_tag LOCUS_13640 5982 6584 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879016.1 protein_id gnl|my_center|LOCUS_13640 6613 7179 gene locus_tag LOCUS_13650 gene afpA 6613 7179 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064401.1 protein_id gnl|my_center|LOCUS_13650 7292 7684 gene locus_tag LOCUS_13660 gene cfbA 7292 7684 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023539.1 protein_id gnl|my_center|LOCUS_13660 7687 8892 gene locus_tag LOCUS_13670 gene cfbE 7687 8892 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023538.1 protein_id gnl|my_center|LOCUS_13670 8900 9994 gene locus_tag LOCUS_13680 gene cfbD 8900 9994 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023536.1 protein_id gnl|my_center|LOCUS_13680 10319 10017 gene locus_tag LOCUS_13690 10319 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 11523 10546 gene locus_tag LOCUS_13700 11523 10546 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023652.1 protein_id gnl|my_center|LOCUS_13700 12323 11496 gene locus_tag LOCUS_13710 12323 11496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023654.1 protein_id gnl|my_center|LOCUS_13710 12808 12329 gene locus_tag LOCUS_13720 gene hacB 12808 12329 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065791.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence052 283 567 gene locus_tag LOCUS_13730 283 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 619 864 gene locus_tag LOCUS_13740 619 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1285 1028 gene locus_tag LOCUS_13750 1285 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1806 1240 gene locus_tag LOCUS_13760 1806 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13760 2072 2221 gene locus_tag LOCUS_13770 2072 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2789 4471 gene locus_tag LOCUS_13780 2789 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 4683 5090 gene locus_tag LOCUS_13790 4683 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 5375 6040 gene locus_tag LOCUS_13800 5375 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 6080 7048 gene locus_tag LOCUS_13810 6080 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 8231 7386 gene locus_tag LOCUS_13820 8231 7386 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_13820 9033 8263 gene locus_tag LOCUS_13830 9033 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 9217 9957 gene locus_tag LOCUS_13840 9217 9957 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530175.1 protein_id gnl|my_center|LOCUS_13840 10730 9978 gene locus_tag LOCUS_13850 10730 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022686.1 protein_id gnl|my_center|LOCUS_13850 10873 11568 gene locus_tag LOCUS_13860 10873 11568 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_13860 11604 12179 gene locus_tag LOCUS_13870 11604 12179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 13100 12183 gene locus_tag LOCUS_13880 13100 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence053 189 371 gene locus_tag LOCUS_13890 189 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 629 1867 gene locus_tag LOCUS_13900 gene dadD 629 1867 CDS product multifunctional 5'-deoxyadenosine/S-adenosyl-L-homocysteine/5'-methylthioadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871065.1 protein_id gnl|my_center|LOCUS_13900 2669 1869 gene locus_tag LOCUS_13910 2669 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3652 2873 gene locus_tag LOCUS_13920 3652 2873 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_13920 3818 4840 gene locus_tag LOCUS_13930 3818 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 5803 4853 gene locus_tag LOCUS_13940 5803 4853 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_13940 5936 6856 gene locus_tag LOCUS_13950 5936 6856 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876118.1 protein_id gnl|my_center|LOCUS_13950 6873 7559 gene locus_tag LOCUS_13960 6873 7559 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060828.1 protein_id gnl|my_center|LOCUS_13960 7563 8270 gene locus_tag LOCUS_13970 7563 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 10518 8293 gene locus_tag LOCUS_13980 10518 8293 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249735.1 protein_id gnl|my_center|LOCUS_13980 10633 11052 gene locus_tag LOCUS_13990 10633 11052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 11069 12283 gene locus_tag LOCUS_14000 11069 12283 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583649.1 protein_id gnl|my_center|LOCUS_14000 12283 12999 gene locus_tag LOCUS_14010 12283 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence054 <1 526 gene locus_tag LOCUS_14020 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065744.1:cobalt ECF transporter T component CbiQ 533 1738 gene locus_tag LOCUS_14030 533 1738 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023466.1 protein_id gnl|my_center|LOCUS_14030 1825 2184 gene locus_tag LOCUS_14040 1825 2184 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021390.1 protein_id gnl|my_center|LOCUS_14040 2254 4656 gene locus_tag LOCUS_14050 2254 4656 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_14050 4881 6359 gene locus_tag LOCUS_14060 4881 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 6401 8473 gene locus_tag LOCUS_14070 6401 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 8512 9819 gene locus_tag LOCUS_14080 8512 9819 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065100.1 protein_id gnl|my_center|LOCUS_14080 9858 11168 gene locus_tag LOCUS_14090 9858 11168 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_14090 11257 12318 gene locus_tag LOCUS_14100 11257 12318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14100 >Feature sequence055 25 206 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgtttcaatggggccacttcttttcagaaatggatag 746 450 gene locus_tag LOCUS_14110 gene cas2 746 450 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387937.1 protein_id gnl|my_center|LOCUS_14110 2427 754 gene locus_tag LOCUS_14120 gene cas1 2427 754 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_14120 2674 3384 gene locus_tag LOCUS_14130 2674 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 4000 3416 gene locus_tag LOCUS_14140 4000 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 4447 4283 gene locus_tag LOCUS_14150 4447 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 4590 4381 gene locus_tag LOCUS_14160 4590 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 4838 5398 gene locus_tag LOCUS_14170 4838 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 5683 6228 gene locus_tag LOCUS_14180 5683 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 7531 6512 gene locus_tag LOCUS_14190 7531 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 8215 7544 gene locus_tag LOCUS_14200 8215 7544 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066013.1 protein_id gnl|my_center|LOCUS_14200 8408 8241 gene locus_tag LOCUS_14210 8408 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 8743 8495 gene locus_tag LOCUS_14220 8743 8495 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064801.1 protein_id gnl|my_center|LOCUS_14220 9099 8764 gene locus_tag LOCUS_14230 9099 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 9467 9697 gene locus_tag LOCUS_14240 gene hpkA 9467 9697 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_14240 9701 11599 gene locus_tag LOCUS_14250 gene gatE 9701 11599 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022814.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence056 1 516 gene locus_tag LOCUS_14260 1 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 498 1712 gene locus_tag LOCUS_14270 498 1712 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876774.1 protein_id gnl|my_center|LOCUS_14270 1757 2602 gene locus_tag LOCUS_14280 1757 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2653 5226 gene locus_tag LOCUS_14290 2653 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 5329 6849 gene locus_tag LOCUS_14300 5329 6849 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024395.1 protein_id gnl|my_center|LOCUS_14300 6852 7565 gene locus_tag LOCUS_14310 6852 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 8229 7570 gene locus_tag LOCUS_14320 8229 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 8380 8661 gene locus_tag LOCUS_14330 8380 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 9621 8647 gene locus_tag LOCUS_14340 9621 8647 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 protein_id gnl|my_center|LOCUS_14340 9753 9914 gene locus_tag LOCUS_14350 9753 9914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 10647 9925 gene locus_tag LOCUS_14360 10647 9925 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_14360 10976 10635 gene locus_tag LOCUS_14370 10976 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 12100 11243 gene locus_tag LOCUS_14380 12100 11243 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023435.1 protein_id gnl|my_center|LOCUS_14380 12564 12094 gene locus_tag LOCUS_14390 12564 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence057 57 515 gene locus_tag LOCUS_14400 57 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 804 1238 gene locus_tag LOCUS_14410 804 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1414 2682 gene locus_tag LOCUS_14420 gene hisS 1414 2682 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 protein_id gnl|my_center|LOCUS_14420 2871 2725 gene locus_tag LOCUS_14430 2871 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3515 2964 gene locus_tag LOCUS_14440 3515 2964 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024211.1 protein_id gnl|my_center|LOCUS_14440 3728 3639 gene locus_tag LOCUS_t00170 3728 3639 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5038 3794 gene locus_tag LOCUS_14450 5038 3794 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878773.1 protein_id gnl|my_center|LOCUS_14450 6153 5032 gene locus_tag LOCUS_14460 6153 5032 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024521.1 protein_id gnl|my_center|LOCUS_14460 6929 6150 gene locus_tag LOCUS_14470 6929 6150 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589511.1 protein_id gnl|my_center|LOCUS_14470 7789 6929 gene locus_tag LOCUS_14480 7789 6929 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024518.1 protein_id gnl|my_center|LOCUS_14480 8667 7786 gene locus_tag LOCUS_14490 8667 7786 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048168954.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14490 9547 8771 gene locus_tag LOCUS_14500 9547 8771 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024516.1 protein_id gnl|my_center|LOCUS_14500 10133 9582 gene locus_tag LOCUS_14510 10133 9582 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878350.1 protein_id gnl|my_center|LOCUS_14510 10737 10261 gene locus_tag LOCUS_14520 10737 10261 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064835.1 protein_id gnl|my_center|LOCUS_14520 10813 11850 gene locus_tag LOCUS_14530 10813 11850 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020242.1 protein_id gnl|my_center|LOCUS_14530 11841 12413 gene locus_tag LOCUS_14540 11841 12413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence058 <1 577 gene locus_tag LOCUS_14550 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020169.1:DNA polymerase sliding clamp 574 1581 gene locus_tag LOCUS_14560 gene priL 574 1581 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_14560 3313 1523 gene locus_tag LOCUS_14570 3313 1523 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024230.1 protein_id gnl|my_center|LOCUS_14570 3433 3831 gene locus_tag LOCUS_14580 3433 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 3828 4040 gene locus_tag LOCUS_14590 3828 4040 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066331.1 protein_id gnl|my_center|LOCUS_14590 5172 4075 gene locus_tag LOCUS_14600 gene aroC 5172 4075 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_14600 6120 5269 gene locus_tag LOCUS_14610 6120 5269 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 protein_id gnl|my_center|LOCUS_14610 7464 6130 gene locus_tag LOCUS_14620 7464 6130 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_14620 8209 7439 gene locus_tag LOCUS_14630 8209 7439 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_14630 9137 8364 gene locus_tag LOCUS_14640 9137 8364 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_14640 9377 9144 gene locus_tag LOCUS_14650 9377 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 9598 9314 gene locus_tag LOCUS_14660 9598 9314 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020693.1 protein_id gnl|my_center|LOCUS_14660 10171 9605 gene locus_tag LOCUS_14670 10171 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 11450 10224 gene locus_tag LOCUS_14680 gene priS 11450 10224 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_14680 12113 11460 gene locus_tag LOCUS_14690 12113 11460 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066008.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence059 <1 526 gene locus_tag LOCUS_14700 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065744.1:cobalt ECF transporter T component CbiQ 533 1726 gene locus_tag LOCUS_14710 533 1726 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023466.1 protein_id gnl|my_center|LOCUS_14710 1825 2184 gene locus_tag LOCUS_14720 1825 2184 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021390.1 protein_id gnl|my_center|LOCUS_14720 2497 3771 gene locus_tag LOCUS_14730 2497 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 3813 4691 gene locus_tag LOCUS_14740 3813 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 4713 6011 gene locus_tag LOCUS_14750 4713 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 6060 6677 gene locus_tag LOCUS_14760 6060 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 8295 6715 gene locus_tag LOCUS_14770 8295 6715 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_14770 8712 9227 gene locus_tag LOCUS_14780 8712 9227 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022806.1 protein_id gnl|my_center|LOCUS_14780 9324 10163 gene locus_tag LOCUS_14790 9324 10163 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879419.1 protein_id gnl|my_center|LOCUS_14790 10164 11168 gene locus_tag LOCUS_14800 gene rpl3p 10164 11168 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_14800 11172 11945 gene locus_tag LOCUS_14810 gene rpl4p 11172 11945 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021102.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence060 71 691 gene locus_tag LOCUS_14820 gene rpsB 71 691 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020649.1 protein_id gnl|my_center|LOCUS_14820 695 1483 gene locus_tag LOCUS_14830 695 1483 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_14830 1496 2455 gene locus_tag LOCUS_14840 1496 2455 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_14840 2452 3201 gene locus_tag LOCUS_14850 2452 3201 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_14850 3198 4286 gene locus_tag LOCUS_14860 gene fni 3198 4286 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 protein_id gnl|my_center|LOCUS_14860 4283 5620 gene locus_tag LOCUS_14870 4283 5620 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_14870 5634 6596 gene locus_tag LOCUS_14880 5634 6596 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066119.1 protein_id gnl|my_center|LOCUS_14880 6631 7848 gene locus_tag LOCUS_14890 6631 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 8690 7878 gene locus_tag LOCUS_14900 8690 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 10391 8709 gene locus_tag LOCUS_14910 gene argS 10391 8709 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_14910 11878 10475 gene locus_tag LOCUS_14920 gene purF 11878 10475 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence061 571 356 gene locus_tag LOCUS_14930 571 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 992 1369 gene locus_tag LOCUS_14940 992 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2133 1378 gene locus_tag LOCUS_14950 gene mtnP 2133 1378 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021425.1 protein_id gnl|my_center|LOCUS_14950 3399 2149 gene locus_tag LOCUS_14960 gene eno 3399 2149 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065179.1 protein_id gnl|my_center|LOCUS_14960 3497 3949 gene locus_tag LOCUS_14970 3497 3949 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_14970 4516 4061 gene locus_tag LOCUS_14980 4516 4061 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_14980 5622 4654 gene locus_tag LOCUS_14990 5622 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 6140 5703 gene locus_tag LOCUS_15000 6140 5703 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_15000 6234 8993 gene locus_tag LOCUS_15010 6234 8993 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_15010 9990 9007 gene locus_tag LOCUS_15020 9990 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 10771 10337 gene locus_tag LOCUS_15030 10771 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 11555 10878 gene locus_tag LOCUS_15040 11555 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 11652 11900 gene locus_tag LOCUS_15050 11652 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence062 23 98 gene locus_tag LOCUS_t00180 23 98 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1120 101 gene locus_tag LOCUS_15060 1120 101 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877309.1 protein_id gnl|my_center|LOCUS_15060 1234 2502 gene locus_tag LOCUS_15070 1234 2502 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_15070 2499 4361 gene locus_tag LOCUS_15080 2499 4361 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_15080 4408 5661 gene locus_tag LOCUS_15090 gene hacA 4408 5661 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_15090 5665 6309 gene locus_tag LOCUS_15100 5665 6309 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_15100 6312 6788 gene locus_tag LOCUS_15110 gene rlmH 6312 6788 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458513.1 protein_id gnl|my_center|LOCUS_15110 7152 6826 gene locus_tag LOCUS_15120 7152 6826 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 protein_id gnl|my_center|LOCUS_15120 7799 7131 gene locus_tag LOCUS_15130 7799 7131 CDS product archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020175.1 protein_id gnl|my_center|LOCUS_15130 8383 7796 gene locus_tag LOCUS_15140 8383 7796 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020174.1 protein_id gnl|my_center|LOCUS_15140 9159 8380 gene locus_tag LOCUS_15150 gene artA 9159 8380 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064816.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence063 264 88 gene locus_tag LOCUS_15160 264 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 799 1722 gene locus_tag LOCUS_15170 799 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2298 1723 gene locus_tag LOCUS_15180 gene engB 2298 1723 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022535.1 protein_id gnl|my_center|LOCUS_15180 2391 2981 gene locus_tag LOCUS_15190 2391 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3926 2982 gene locus_tag LOCUS_15200 3926 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 4034 4954 gene locus_tag LOCUS_15210 4034 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 5109 5897 gene locus_tag LOCUS_15220 gene surE 5109 5897 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_15220 6517 5957 gene locus_tag LOCUS_15230 gene hisB 6517 5957 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 protein_id gnl|my_center|LOCUS_15230 7248 6514 gene locus_tag LOCUS_15240 gene hisA 7248 6514 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020276.1 protein_id gnl|my_center|LOCUS_15240 7599 7871 gene locus_tag LOCUS_15250 7599 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 8502 9215 gene locus_tag LOCUS_15260 gene panE 8502 9215 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208656.1 protein_id gnl|my_center|LOCUS_15260 9205 10032 gene locus_tag LOCUS_15270 9205 10032 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_15270 10941 10039 gene locus_tag LOCUS_15280 10941 10039 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583429.1 protein_id gnl|my_center|LOCUS_15280 <11594 11087 gene locus_tag LOCUS_15290 <11594 11087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941764.1:AMP-binding protein >Feature sequence064 582 328 gene locus_tag LOCUS_15300 582 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 3842 726 gene locus_tag LOCUS_15310 3842 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 4735 3839 gene locus_tag LOCUS_15320 4735 3839 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_15320 5430 4840 gene locus_tag LOCUS_15330 5430 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 5929 5456 gene locus_tag LOCUS_15340 5929 5456 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496415.1 protein_id gnl|my_center|LOCUS_15340 6329 5916 gene locus_tag LOCUS_15350 6329 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 7265 6345 gene locus_tag LOCUS_15360 7265 6345 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_15360 7626 8510 gene locus_tag LOCUS_15370 7626 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 8650 9348 gene locus_tag LOCUS_15380 8650 9348 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021837.1 protein_id gnl|my_center|LOCUS_15380 9345 9866 gene locus_tag LOCUS_15390 9345 9866 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943250.1 protein_id gnl|my_center|LOCUS_15390 9920 10810 gene locus_tag LOCUS_15400 9920 10810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 11373 10819 gene locus_tag LOCUS_15410 11373 10819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence065 1524 553 gene locus_tag LOCUS_15420 1524 553 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024160.1 protein_id gnl|my_center|LOCUS_15420 1708 1550 gene locus_tag LOCUS_15430 1708 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 2629 2378 gene locus_tag LOCUS_15440 2629 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2854 3207 gene locus_tag LOCUS_15450 2854 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 3200 4234 gene locus_tag LOCUS_15460 3200 4234 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496935.1 protein_id gnl|my_center|LOCUS_15460 4736 4239 gene locus_tag LOCUS_15470 4736 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 5269 5009 gene locus_tag LOCUS_15480 5269 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 5945 5346 gene locus_tag LOCUS_15490 5945 5346 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941409.1 protein_id gnl|my_center|LOCUS_15490 6587 6099 gene locus_tag LOCUS_15500 6587 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 7158 6634 gene locus_tag LOCUS_15510 7158 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 7765 7325 gene locus_tag LOCUS_15520 7765 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 8516 7776 gene locus_tag LOCUS_15530 8516 7776 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890732.1 protein_id gnl|my_center|LOCUS_15530 8758 8513 gene locus_tag LOCUS_15540 8758 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 8962 9540 gene locus_tag LOCUS_15550 8962 9540 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088841.1 protein_id gnl|my_center|LOCUS_15550 11387 9555 gene locus_tag LOCUS_15560 11387 9555 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024488.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence066 307 116 gene locus_tag LOCUS_15570 307 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 456 1382 gene locus_tag LOCUS_15580 456 1382 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081632.1 protein_id gnl|my_center|LOCUS_15580 1379 2131 gene locus_tag LOCUS_15590 1379 2131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763735.1 protein_id gnl|my_center|LOCUS_15590 2693 2151 gene locus_tag LOCUS_15600 2693 2151 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 protein_id gnl|my_center|LOCUS_15600 2878 2711 gene locus_tag LOCUS_15610 2878 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2828 3286 gene locus_tag LOCUS_15620 2828 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3351 7040 gene locus_tag LOCUS_15630 gene cobN 3351 7040 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020916.1 protein_id gnl|my_center|LOCUS_15630 7037 7798 gene locus_tag LOCUS_15640 7037 7798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_15640 8900 8145 gene locus_tag LOCUS_15650 8900 8145 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022767.1 protein_id gnl|my_center|LOCUS_15650 9444 8944 gene locus_tag LOCUS_15660 gene pyrI 9444 8944 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_15660 10367 9444 gene locus_tag LOCUS_15670 gene pyrB 10367 9444 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024378.1 protein_id gnl|my_center|LOCUS_15670 <11343 10419 gene locus_tag LOCUS_15680 <11343 10419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943960.1:multidrug effflux MFS transporter >Feature sequence067 740 1069 gene locus_tag LOCUS_15690 740 1069 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020159.1 protein_id gnl|my_center|LOCUS_15690 1066 1443 gene locus_tag LOCUS_15700 1066 1443 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_15700 1452 5801 gene locus_tag LOCUS_15710 1452 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5818 8712 gene locus_tag LOCUS_15720 5818 8712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 8906 10798 gene locus_tag LOCUS_15730 gene brxL 8906 10798 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942749.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence068 726 103 gene locus_tag LOCUS_15740 726 103 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023903.1 protein_id gnl|my_center|LOCUS_15740 1584 1120 gene locus_tag LOCUS_15750 1584 1120 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 protein_id gnl|my_center|LOCUS_15750 1649 3565 gene locus_tag LOCUS_15760 gene rqcH 1649 3565 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061171.1 protein_id gnl|my_center|LOCUS_15760 4382 3588 gene locus_tag LOCUS_15770 4382 3588 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887476.1 protein_id gnl|my_center|LOCUS_15770 6293 4551 gene locus_tag LOCUS_15780 gene arcS 6293 4551 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_15780 7710 6301 gene locus_tag LOCUS_15790 gene tgtA 7710 6301 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024298.1 protein_id gnl|my_center|LOCUS_15790 8161 7958 gene locus_tag LOCUS_15800 8161 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 10270 8312 gene locus_tag LOCUS_15810 10270 8312 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881159.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence069 <1 1090 gene locus_tag LOCUS_15820 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022130.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit 1087 4311 gene locus_tag LOCUS_15830 gene carB 1087 4311 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022129.1 protein_id gnl|my_center|LOCUS_15830 4421 4495 gene locus_tag LOCUS_t00190 4421 4495 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4500 4572 gene locus_tag LOCUS_t00200 4500 4572 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4770 5960 gene locus_tag LOCUS_15840 4770 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 5926 6687 gene locus_tag LOCUS_15850 5926 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15850 7079 6855 gene locus_tag LOCUS_15860 7079 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 7413 7072 gene locus_tag LOCUS_15870 7413 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 8172 8008 gene locus_tag LOCUS_15880 8172 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 8427 8185 gene locus_tag LOCUS_15890 8427 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 9298 8642 gene locus_tag LOCUS_15900 9298 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 9514 9332 gene locus_tag LOCUS_15910 9514 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 10115 10591 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatggggccacttcttttcagaaatggataga >Feature sequence070 76 675 gene locus_tag LOCUS_15920 76 675 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_15920 2017 743 gene locus_tag LOCUS_15930 2017 743 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023306.1 protein_id gnl|my_center|LOCUS_15930 2321 4510 gene locus_tag LOCUS_15940 gene glgP 2321 4510 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880430.1 protein_id gnl|my_center|LOCUS_15940 4782 5540 gene locus_tag LOCUS_15950 gene zupT 4782 5540 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020444.1 protein_id gnl|my_center|LOCUS_15950 6850 6056 gene locus_tag LOCUS_15960 6850 6056 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_15960 7863 6847 gene locus_tag LOCUS_15970 7863 6847 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_15970 9845 7860 gene locus_tag LOCUS_15980 gene fdhF 9845 7860 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence071 240 488 gene locus_tag LOCUS_15990 240 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 604 1263 gene locus_tag LOCUS_16000 604 1263 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_16000 2158 1241 gene locus_tag LOCUS_16010 2158 1241 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545320.1 protein_id gnl|my_center|LOCUS_16010 3123 2221 gene locus_tag LOCUS_16020 3123 2221 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_16020 3414 3211 gene locus_tag LOCUS_16030 3414 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3979 3710 gene locus_tag LOCUS_16040 3979 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 4399 4701 gene locus_tag LOCUS_16050 4399 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4698 5078 gene locus_tag LOCUS_16060 4698 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 5113 5907 gene locus_tag LOCUS_16070 5113 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 5930 6745 gene locus_tag LOCUS_16080 5930 6745 CDS product IS5-like element ISMac22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022661.1 protein_id gnl|my_center|LOCUS_16080 7062 8333 gene locus_tag LOCUS_16090 7062 8333 CDS product acyl-CoA thioesterase/bile acid-CoA:amino acid N-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966677.1 protein_id gnl|my_center|LOCUS_16090 8383 8658 gene locus_tag LOCUS_16100 8383 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 8662 9096 gene locus_tag LOCUS_16110 8662 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 9735 9175 gene locus_tag LOCUS_16120 9735 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence072 136 64 gene locus_tag LOCUS_t00210 136 64 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 229 1221 gene locus_tag LOCUS_16130 229 1221 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065980.1 protein_id gnl|my_center|LOCUS_16130 1293 1691 gene locus_tag LOCUS_16140 1293 1691 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021540.1 protein_id gnl|my_center|LOCUS_16140 2968 1817 gene locus_tag LOCUS_16150 2968 1817 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_16150 4866 2965 gene locus_tag LOCUS_16160 4866 2965 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020337.1 protein_id gnl|my_center|LOCUS_16160 4956 6617 gene locus_tag LOCUS_16170 gene ilvD 4956 6617 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021805.1 protein_id gnl|my_center|LOCUS_16170 6614 7159 gene locus_tag LOCUS_16180 gene thpR 6614 7159 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066123.1 protein_id gnl|my_center|LOCUS_16180 7173 8486 gene locus_tag LOCUS_16190 gene cca 7173 8486 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 protein_id gnl|my_center|LOCUS_16190 9505 8489 gene locus_tag LOCUS_16200 9505 8489 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence073 1152 388 gene locus_tag LOCUS_16210 gene psmA 1152 388 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_16210 1621 1124 gene locus_tag LOCUS_16220 1621 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2337 1660 gene locus_tag LOCUS_16230 2337 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2750 2334 gene locus_tag LOCUS_16240 2750 2334 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755897.1 protein_id gnl|my_center|LOCUS_16240 3338 2751 gene locus_tag LOCUS_16250 3338 2751 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 protein_id gnl|my_center|LOCUS_16250 4078 3464 gene locus_tag LOCUS_16260 gene thiE 4078 3464 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022682.1 protein_id gnl|my_center|LOCUS_16260 4866 4075 gene locus_tag LOCUS_16270 gene thiM 4866 4075 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022683.1 protein_id gnl|my_center|LOCUS_16270 5870 4929 gene locus_tag LOCUS_16280 5870 4929 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023218.1 protein_id gnl|my_center|LOCUS_16280 8603 5934 gene locus_tag LOCUS_16290 8603 5934 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064990.1 protein_id gnl|my_center|LOCUS_16290 9366 8662 gene locus_tag LOCUS_16300 9366 8662 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence074 1039 461 gene locus_tag LOCUS_16310 1039 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1341 2444 gene locus_tag LOCUS_16320 1341 2444 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496792.1 protein_id gnl|my_center|LOCUS_16320 2958 4268 gene locus_tag LOCUS_16330 2958 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 4415 5404 gene locus_tag LOCUS_16340 gene guaA 4415 5404 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024387.1 protein_id gnl|my_center|LOCUS_16340 6046 5498 gene locus_tag LOCUS_16350 6046 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 7242 6070 gene locus_tag LOCUS_16360 7242 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 7577 7359 gene locus_tag LOCUS_16370 7577 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 8187 7588 gene locus_tag LOCUS_16380 8187 7588 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_16380 8493 8218 gene locus_tag LOCUS_16390 8493 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 9488 8532 gene locus_tag LOCUS_16400 9488 8532 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence075 <1 5206 gene locus_tag LOCUS_16410 <1 5206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256318.1:SdrD B-like domain-containing protein 5736 6062 gene locus_tag LOCUS_16420 5736 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 6218 6496 gene locus_tag LOCUS_16430 6218 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 6493 6699 gene locus_tag LOCUS_16440 6493 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 7103 6849 gene locus_tag LOCUS_16450 7103 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 7696 8325 gene locus_tag LOCUS_16460 7696 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 8860 8435 gene locus_tag LOCUS_16470 8860 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 9468 9112 gene locus_tag LOCUS_16480 9468 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence076 728 192 gene locus_tag LOCUS_16490 728 192 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023239.1 protein_id gnl|my_center|LOCUS_16490 861 951 gene locus_tag LOCUS_t00220 861 951 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1033 1752 gene locus_tag LOCUS_16500 1033 1752 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023933.1 protein_id gnl|my_center|LOCUS_16500 1759 2796 gene locus_tag LOCUS_16510 1759 2796 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023934.1 protein_id gnl|my_center|LOCUS_16510 2793 3956 gene locus_tag LOCUS_16520 2793 3956 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_16520 3975 4382 gene locus_tag LOCUS_16530 3975 4382 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_16530 4676 4392 gene locus_tag LOCUS_16540 4676 4392 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021598.1 protein_id gnl|my_center|LOCUS_16540 5422 5141 gene locus_tag LOCUS_16550 5422 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 8083 5624 gene locus_tag LOCUS_16560 8083 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 8774 8226 gene locus_tag LOCUS_16570 8774 8226 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879241.1 protein_id gnl|my_center|LOCUS_16570 9043 9543 gene locus_tag LOCUS_16580 9043 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence077 36 1376 gene locus_tag LOCUS_16590 36 1376 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_16590 1860 1402 gene locus_tag LOCUS_16600 gene moaC 1860 1402 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066185.1 protein_id gnl|my_center|LOCUS_16600 3239 1863 gene locus_tag LOCUS_16610 3239 1863 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 protein_id gnl|my_center|LOCUS_16610 3583 3338 gene locus_tag LOCUS_16620 3583 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 4155 3595 gene locus_tag LOCUS_16630 4155 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 protein_id gnl|my_center|LOCUS_16630 4292 4714 gene locus_tag LOCUS_16640 gene nikR 4292 4714 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 protein_id gnl|my_center|LOCUS_16640 4726 5388 gene locus_tag LOCUS_16650 4726 5388 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020399.1 protein_id gnl|my_center|LOCUS_16650 6164 5352 gene locus_tag LOCUS_16660 6164 5352 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_16660 6206 7702 gene locus_tag LOCUS_16670 6206 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 7964 8401 gene locus_tag LOCUS_16680 7964 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 8435 8998 gene locus_tag LOCUS_16690 8435 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence078 187 633 gene locus_tag LOCUS_16700 187 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024361.1 protein_id gnl|my_center|LOCUS_16700 737 1411 gene locus_tag LOCUS_16710 737 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 2678 3145 gene locus_tag LOCUS_16720 2678 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 6211 3161 gene locus_tag LOCUS_16730 6211 3161 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022778.1 protein_id gnl|my_center|LOCUS_16730 6621 6208 gene locus_tag LOCUS_16740 6621 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 7982 6699 gene locus_tag LOCUS_16750 7982 6699 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 protein_id gnl|my_center|LOCUS_16750 8830 7997 gene locus_tag LOCUS_16760 8830 7997 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_16760 9078 8902 gene locus_tag LOCUS_16770 9078 8902 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878609.1 protein_id gnl|my_center|LOCUS_16770 9387 9079 gene locus_tag LOCUS_16780 9387 9079 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023602.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence079 813 190 gene locus_tag LOCUS_16790 813 190 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064573.1 protein_id gnl|my_center|LOCUS_16790 2591 846 gene locus_tag LOCUS_16800 gene glyS 2591 846 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061155.1 protein_id gnl|my_center|LOCUS_16800 2885 2730 gene locus_tag LOCUS_16810 2885 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3301 3861 gene locus_tag LOCUS_16820 3301 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4772 4185 gene locus_tag LOCUS_16830 4772 4185 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762292.1 protein_id gnl|my_center|LOCUS_16830 4817 5227 gene locus_tag LOCUS_16840 4817 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 5319 5246 gene locus_tag LOCUS_t00230 5319 5246 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5910 5353 gene locus_tag LOCUS_16850 5910 5353 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_16850 7068 6034 gene locus_tag LOCUS_16860 7068 6034 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022056.1 protein_id gnl|my_center|LOCUS_16860 8209 7040 gene locus_tag LOCUS_16870 8209 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence080 <1 712 gene locus_tag LOCUS_16880 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928586.1:ATP-binding protein 729 1532 gene locus_tag LOCUS_16890 729 1532 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_16890 4749 1570 gene locus_tag LOCUS_16900 gene rad50 4749 1570 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878532.1 protein_id gnl|my_center|LOCUS_16900 5881 4736 gene locus_tag LOCUS_16910 5881 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 7537 5894 gene locus_tag LOCUS_16920 7537 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16920 >Feature sequence081 209 553 gene locus_tag LOCUS_16930 209 553 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021428.1 protein_id gnl|my_center|LOCUS_16930 560 1030 gene locus_tag LOCUS_16940 560 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1093 1326 gene locus_tag LOCUS_16950 1093 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1338 2531 gene locus_tag LOCUS_16960 1338 2531 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871084.1 protein_id gnl|my_center|LOCUS_16960 2614 5232 gene locus_tag LOCUS_16970 gene mutS 2614 5232 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_16970 5219 6940 gene locus_tag LOCUS_16980 gene mutL 5219 6940 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583440.1 protein_id gnl|my_center|LOCUS_16980 6971 8281 gene locus_tag LOCUS_16990 6971 8281 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066157.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence082 3478 1472 gene locus_tag LOCUS_17000 gene metG 3478 1472 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065884.1 protein_id gnl|my_center|LOCUS_17000 3761 3576 gene locus_tag LOCUS_17010 3761 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 4235 5071 gene locus_tag LOCUS_17020 4235 5071 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020999.1 protein_id gnl|my_center|LOCUS_17020 6755 5076 gene locus_tag LOCUS_17030 6755 5076 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064918.1 protein_id gnl|my_center|LOCUS_17030 7202 6789 gene locus_tag LOCUS_17040 7202 6789 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020172.1 protein_id gnl|my_center|LOCUS_17040 7402 8052 gene locus_tag LOCUS_17050 7402 8052 CDS product amino acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021487.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence083 2812 626 gene locus_tag LOCUS_17060 2812 626 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_17060 3447 2800 gene locus_tag LOCUS_17070 3447 2800 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024449.1 protein_id gnl|my_center|LOCUS_17070 3759 3520 gene locus_tag LOCUS_17080 3759 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 4259 3855 gene locus_tag LOCUS_17090 4259 3855 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868764.1 protein_id gnl|my_center|LOCUS_17090 4401 4330 gene locus_tag LOCUS_t00240 4401 4330 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5749 4418 gene locus_tag LOCUS_17100 5749 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 6638 5862 gene locus_tag LOCUS_17110 6638 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 7888 6635 gene locus_tag LOCUS_17120 7888 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 8095 8169 gene locus_tag LOCUS_t00250 8095 8169 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence084 249 1580 gene locus_tag LOCUS_17130 gene dnaG 249 1580 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250361.1 protein_id gnl|my_center|LOCUS_17130 1620 1973 gene locus_tag LOCUS_17140 gene pth2 1620 1973 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146590.1 protein_id gnl|my_center|LOCUS_17140 1989 3305 gene locus_tag LOCUS_17150 gene truD 1989 3305 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_17150 3296 4195 gene locus_tag LOCUS_17160 3296 4195 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021976.1 protein_id gnl|my_center|LOCUS_17160 4192 5634 gene locus_tag LOCUS_17170 4192 5634 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021977.1 protein_id gnl|my_center|LOCUS_17170 5649 6821 gene locus_tag LOCUS_17180 5649 6821 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927165.1 protein_id gnl|my_center|LOCUS_17180 6896 7189 gene locus_tag LOCUS_17190 6896 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 7322 7708 gene locus_tag LOCUS_17200 7322 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence085 361 278 gene locus_tag LOCUS_t00260 361 278 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1350 448 gene locus_tag LOCUS_17210 gene argF 1350 448 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 protein_id gnl|my_center|LOCUS_17210 1736 1347 gene locus_tag LOCUS_17220 1736 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2907 1738 gene locus_tag LOCUS_17230 2907 1738 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065549.1 protein_id gnl|my_center|LOCUS_17230 3384 2923 gene locus_tag LOCUS_17240 3384 2923 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022827.1 protein_id gnl|my_center|LOCUS_17240 3489 5234 gene locus_tag LOCUS_17250 3489 5234 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023084.1 protein_id gnl|my_center|LOCUS_17250 5231 7594 gene locus_tag LOCUS_17260 5231 7594 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023083.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence086 316 8 gene locus_tag LOCUS_17270 316 8 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065070.1 protein_id gnl|my_center|LOCUS_17270 1483 326 gene locus_tag LOCUS_17280 gene rpoA2 1483 326 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066196.1 protein_id gnl|my_center|LOCUS_17280 4107 1480 gene locus_tag LOCUS_17290 4107 1480 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021284.1 protein_id gnl|my_center|LOCUS_17290 5945 4116 gene locus_tag LOCUS_17300 gene rpoB 5945 4116 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021285.1 protein_id gnl|my_center|LOCUS_17300 7428 5938 gene locus_tag LOCUS_17310 7428 5938 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence087 187 363 gene locus_tag LOCUS_17320 187 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 448 633 gene locus_tag LOCUS_17330 448 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 647 1408 gene locus_tag LOCUS_17340 647 1408 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023761.1 protein_id gnl|my_center|LOCUS_17340 1420 2772 gene locus_tag LOCUS_17350 gene cdhD 1420 2772 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021047.1 protein_id gnl|my_center|LOCUS_17350 2769 4190 gene locus_tag LOCUS_17360 gene acsC 2769 4190 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021046.1 protein_id gnl|my_center|LOCUS_17360 4265 4654 gene locus_tag LOCUS_17370 4265 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 5766 4729 gene locus_tag LOCUS_17380 5766 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 6880 5972 gene locus_tag LOCUS_17390 6880 5972 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence088 1245 274 gene locus_tag LOCUS_17400 1245 274 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023765.1 protein_id gnl|my_center|LOCUS_17400 1640 1314 gene locus_tag LOCUS_17410 1640 1314 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250247.1 protein_id gnl|my_center|LOCUS_17410 3725 1641 gene locus_tag LOCUS_17420 3725 1641 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_17420 5051 3789 gene locus_tag LOCUS_17430 5051 3789 CDS product ADP-dependent glucokinase/phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023476.1 protein_id gnl|my_center|LOCUS_17430 5777 5073 gene locus_tag LOCUS_17440 5777 5073 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_17440 6009 5752 gene locus_tag LOCUS_17450 6009 5752 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020862.1 protein_id gnl|my_center|LOCUS_17450 6184 6771 gene locus_tag LOCUS_17460 6184 6771 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023516.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence089 <1 528 gene locus_tag LOCUS_17470 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876976.1:DUF169 domain-containing protein 594 896 gene locus_tag LOCUS_17480 594 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1003 1254 gene locus_tag LOCUS_17490 1003 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1387 1776 gene locus_tag LOCUS_17500 1387 1776 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023042.1 protein_id gnl|my_center|LOCUS_17500 2063 1788 gene locus_tag LOCUS_17510 2063 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2383 2066 gene locus_tag LOCUS_17520 2383 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 3067 2438 gene locus_tag LOCUS_17530 3067 2438 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024475.1 protein_id gnl|my_center|LOCUS_17530 3266 4411 gene locus_tag LOCUS_17540 3266 4411 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020990.1 protein_id gnl|my_center|LOCUS_17540 4466 5545 gene locus_tag LOCUS_17550 4466 5545 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020989.1 protein_id gnl|my_center|LOCUS_17550 5542 6315 gene locus_tag LOCUS_17560 5542 6315 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065008.1 protein_id gnl|my_center|LOCUS_17560 <7240 6448 gene locus_tag LOCUS_17570 <7240 6448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107120.1:permease >Feature sequence090 1506 1 gene locus_tag LOCUS_17580 1506 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17580 3542 1545 gene locus_tag LOCUS_17590 3542 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 4801 3539 gene locus_tag LOCUS_17600 4801 3539 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065100.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17600 5829 4840 gene locus_tag LOCUS_17610 5829 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17610 6778 5867 gene locus_tag LOCUS_17620 6778 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17620 >Feature sequence091 149 1660 gene locus_tag LOCUS_17630 149 1660 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_17630 1671 3302 gene locus_tag LOCUS_17640 gene pheT 1671 3302 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021951.1 protein_id gnl|my_center|LOCUS_17640 3384 3764 gene locus_tag LOCUS_17650 3384 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 5482 3773 gene locus_tag LOCUS_17660 5482 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17660 6469 5516 gene locus_tag LOCUS_17670 6469 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17670 6686 6771 gene locus_tag LOCUS_t00270 6686 6771 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence092 52 462 gene locus_tag LOCUS_17680 52 462 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021105.1 protein_id gnl|my_center|LOCUS_17680 525 935 gene locus_tag LOCUS_17690 gene rplV 525 935 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875649.1 protein_id gnl|my_center|LOCUS_17690 935 1741 gene locus_tag LOCUS_17700 935 1741 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021107.1 protein_id gnl|my_center|LOCUS_17700 1748 1948 gene locus_tag LOCUS_17710 gene rpmC 1748 1948 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021108.1 protein_id gnl|my_center|LOCUS_17710 1945 2238 gene locus_tag LOCUS_17720 1945 2238 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021109.1 protein_id gnl|my_center|LOCUS_17720 2235 2555 gene locus_tag LOCUS_17730 2235 2555 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011696863.1 protein_id gnl|my_center|LOCUS_17730 2552 2950 gene locus_tag LOCUS_17740 gene rpl14p 2552 2950 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 protein_id gnl|my_center|LOCUS_17740 2956 3315 gene locus_tag LOCUS_17750 gene rplX 2956 3315 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 protein_id gnl|my_center|LOCUS_17750 3312 4016 gene locus_tag LOCUS_17760 3312 4016 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021113.1 protein_id gnl|my_center|LOCUS_17760 4013 4528 gene locus_tag LOCUS_17770 4013 4528 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021114.1 protein_id gnl|my_center|LOCUS_17770 4525 4677 gene locus_tag LOCUS_17780 4525 4677 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879404.1 protein_id gnl|my_center|LOCUS_17780 4691 5077 gene locus_tag LOCUS_17790 4691 5077 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021116.1 protein_id gnl|my_center|LOCUS_17790 5087 5617 gene locus_tag LOCUS_17800 5087 5617 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250476.1 protein_id gnl|my_center|LOCUS_17800 5623 5997 gene locus_tag LOCUS_17810 5623 5997 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879401.1 protein_id gnl|my_center|LOCUS_17810 5999 6460 gene locus_tag LOCUS_17820 5999 6460 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_17820 6453 6971 gene locus_tag LOCUS_17830 6453 6971 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021120.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence093 1115 696 gene locus_tag LOCUS_17840 1115 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1550 1119 gene locus_tag LOCUS_17850 1550 1119 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868595.1 protein_id gnl|my_center|LOCUS_17850 3596 1551 gene locus_tag LOCUS_17860 gene fdhF 3596 1551 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_17860 4361 3606 gene locus_tag LOCUS_17870 4361 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878454.1 protein_id gnl|my_center|LOCUS_17870 5943 4429 gene locus_tag LOCUS_17880 5943 4429 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878453.1 protein_id gnl|my_center|LOCUS_17880 <6976 5956 gene locus_tag LOCUS_17890 <6976 5956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878452.1:glutamine amidotransferase family protein >Feature sequence094 417 211 gene locus_tag LOCUS_17900 417 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 947 2398 gene locus_tag LOCUS_17910 947 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 2872 3849 gene locus_tag LOCUS_17920 2872 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4004 4981 gene locus_tag LOCUS_17930 4004 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 5791 5018 gene locus_tag LOCUS_17940 5791 5018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020890.1 protein_id gnl|my_center|LOCUS_17940 6837 5788 gene locus_tag LOCUS_17950 6837 5788 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066146.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence095 1261 122 gene locus_tag LOCUS_17960 1261 122 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065913.1 protein_id gnl|my_center|LOCUS_17960 2103 1234 gene locus_tag LOCUS_17970 2103 1234 CDS product geranylfarnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024038.1 protein_id gnl|my_center|LOCUS_17970 2569 2153 gene locus_tag LOCUS_17980 2569 2153 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 protein_id gnl|my_center|LOCUS_17980 3210 2746 gene locus_tag LOCUS_17990 3210 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 4516 3227 gene locus_tag LOCUS_18000 4516 3227 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_18000 4982 4500 gene locus_tag LOCUS_18010 4982 4500 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545207.1 protein_id gnl|my_center|LOCUS_18010 5273 4992 gene locus_tag LOCUS_18020 5273 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 6163 5267 gene locus_tag LOCUS_18030 6163 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021970.1 protein_id gnl|my_center|LOCUS_18030 6689 6165 gene locus_tag LOCUS_18040 6689 6165 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023779.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence096 1 729 gene locus_tag LOCUS_18050 1 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 810 1952 gene locus_tag LOCUS_18060 810 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1952 4489 gene locus_tag LOCUS_18070 1952 4489 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419149.1 protein_id gnl|my_center|LOCUS_18070 4511 5515 gene locus_tag LOCUS_18080 4511 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 <6745 5563 gene locus_tag LOCUS_18090 <6745 5563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021201.1:ABC transporter ATP-binding protein >Feature sequence097 1312 1637 gene locus_tag LOCUS_tm00010 1312 1637 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1564 1637 gene locus_tag LOCUS_t00280 1564 1637 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2892 1645 gene locus_tag LOCUS_18100 2892 1645 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_18100 4004 2958 gene locus_tag LOCUS_18110 gene scpB 4004 2958 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065962.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence098 <1 720 gene locus_tag LOCUS_18120 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024335.1:UDP-glucose/GDP-mannose dehydrogenase family protein 690 1523 gene locus_tag LOCUS_18130 690 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1646 2599 gene locus_tag LOCUS_18140 1646 2599 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_18140 2616 3641 gene locus_tag LOCUS_18150 2616 3641 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 protein_id gnl|my_center|LOCUS_18150 3638 4516 gene locus_tag LOCUS_18160 3638 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 4573 5619 gene locus_tag LOCUS_18170 4573 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 5803 6639 gene locus_tag LOCUS_18180 5803 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence099 355 1065 gene locus_tag LOCUS_18190 355 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1890 1120 gene locus_tag LOCUS_18200 1890 1120 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224893.1 protein_id gnl|my_center|LOCUS_18200 2872 1877 gene locus_tag LOCUS_18210 2872 1877 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 protein_id gnl|my_center|LOCUS_18210 3183 4070 gene locus_tag LOCUS_18220 3183 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 4087 4584 gene locus_tag LOCUS_18230 4087 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 5434 4586 gene locus_tag LOCUS_18240 5434 4586 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 protein_id gnl|my_center|LOCUS_18240 6624 5437 gene locus_tag LOCUS_18250 6624 5437 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence100 553 1806 gene locus_tag LOCUS_18260 553 1806 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_18260 2279 1881 gene locus_tag LOCUS_18270 2279 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2598 3317 gene locus_tag LOCUS_18280 2598 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 3536 4744 gene locus_tag LOCUS_18290 3536 4744 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879245.1 protein_id gnl|my_center|LOCUS_18290 4762 5091 gene locus_tag LOCUS_18300 4762 5091 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064662.1 protein_id gnl|my_center|LOCUS_18300 6251 5100 gene locus_tag LOCUS_18310 6251 5100 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064950.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence101 1261 236 gene locus_tag LOCUS_18320 1261 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023363.1 protein_id gnl|my_center|LOCUS_18320 1424 3961 gene locus_tag LOCUS_18330 1424 3961 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877365.1 protein_id gnl|my_center|LOCUS_18330 5047 3998 gene locus_tag LOCUS_18340 5047 3998 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence102 557 629 gene locus_tag LOCUS_t00290 557 629 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 685 1686 gene locus_tag LOCUS_18350 685 1686 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020662.1 protein_id gnl|my_center|LOCUS_18350 2876 1713 gene locus_tag LOCUS_18360 gene thiI 2876 1713 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021480.1 protein_id gnl|my_center|LOCUS_18360 3052 2873 gene locus_tag LOCUS_18370 3052 2873 CDS product DUF5350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879682.1 protein_id gnl|my_center|LOCUS_18370 3710 3201 gene locus_tag LOCUS_18380 3710 3201 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249124.1 protein_id gnl|my_center|LOCUS_18380 3791 6112 gene locus_tag LOCUS_18390 3791 6112 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020344.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence103 25 207 gene locus_tag LOCUS_18400 25 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 760 1002 gene locus_tag LOCUS_18410 760 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2375 1401 gene locus_tag LOCUS_18420 gene cas6 2375 1401 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258802.1 protein_id gnl|my_center|LOCUS_18420 2795 2517 gene locus_tag LOCUS_18430 2795 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021475.1 protein_id gnl|my_center|LOCUS_18430 3487 2792 gene locus_tag LOCUS_18440 3487 2792 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_18440 3540 4037 gene locus_tag LOCUS_18450 3540 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 4107 5525 gene locus_tag LOCUS_18460 4107 5525 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_18460 5963 5544 gene locus_tag LOCUS_18470 5963 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence104 <1 618 gene locus_tag LOCUS_18480 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792905.1:biosynthetic arginine decarboxylase 2387 1248 gene locus_tag LOCUS_18490 2387 1248 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_18490 2828 2391 gene locus_tag LOCUS_18500 gene ribH 2828 2391 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021820.1 protein_id gnl|my_center|LOCUS_18500 3087 3659 gene locus_tag LOCUS_18510 3087 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 3798 4325 gene locus_tag LOCUS_18520 3798 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 4493 5671 gene locus_tag LOCUS_18530 gene cmr1 4493 5671 CDS product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229142.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence105 330 1205 gene locus_tag LOCUS_18540 330 1205 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860221.1 protein_id gnl|my_center|LOCUS_18540 2105 1272 gene locus_tag LOCUS_18550 2105 1272 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_18550 2261 3592 gene locus_tag LOCUS_18560 2261 3592 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022225.1 protein_id gnl|my_center|LOCUS_18560 4176 3838 gene locus_tag LOCUS_18570 4176 3838 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024093.1 protein_id gnl|my_center|LOCUS_18570 5624 4173 gene locus_tag LOCUS_18580 5624 4173 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879242.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence106 124 1701 gene locus_tag LOCUS_18590 124 1701 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020746.1 protein_id gnl|my_center|LOCUS_18590 1865 2833 gene locus_tag LOCUS_18600 1865 2833 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020745.1 protein_id gnl|my_center|LOCUS_18600 2833 3714 gene locus_tag LOCUS_18610 2833 3714 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020744.1 protein_id gnl|my_center|LOCUS_18610 3711 4670 gene locus_tag LOCUS_18620 3711 4670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020743.1 protein_id gnl|my_center|LOCUS_18620 4655 5353 gene locus_tag LOCUS_18630 4655 5353 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990743.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence107 1277 3478 gene locus_tag LOCUS_18640 1277 3478 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022481.1 protein_id gnl|my_center|LOCUS_18640 3569 3495 gene locus_tag LOCUS_t00300 3569 3495 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3730 4776 gene locus_tag LOCUS_18650 3730 4776 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020699.1 protein_id gnl|my_center|LOCUS_18650 4816 5532 gene locus_tag LOCUS_18660 4816 5532 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_18660 5587 5661 gene locus_tag LOCUS_t00310 5587 5661 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence108 808 17 gene locus_tag LOCUS_18670 808 17 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980142.1 protein_id gnl|my_center|LOCUS_18670 1201 812 gene locus_tag LOCUS_18680 1201 812 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 protein_id gnl|my_center|LOCUS_18680 1740 1204 gene locus_tag LOCUS_18690 1740 1204 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021137.1 protein_id gnl|my_center|LOCUS_18690 2167 1751 gene locus_tag LOCUS_18700 2167 1751 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_18700 2690 2439 gene locus_tag LOCUS_18710 2690 2439 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895070.1 protein_id gnl|my_center|LOCUS_18710 3636 2710 gene locus_tag LOCUS_18720 3636 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 3709 4635 gene locus_tag LOCUS_18730 gene thiL 3709 4635 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_18730 5546 4632 gene locus_tag LOCUS_18740 gene moaA 5546 4632 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020164.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence109 270 2075 gene locus_tag LOCUS_18750 gene glmS 270 2075 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022962.1 protein_id gnl|my_center|LOCUS_18750 3431 2094 gene locus_tag LOCUS_18760 gene gltA 3431 2094 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_18760 4101 5111 gene locus_tag LOCUS_18770 4101 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence110 56 1276 gene locus_tag LOCUS_18780 gene pgk 56 1276 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022629.1 protein_id gnl|my_center|LOCUS_18780 2211 1273 gene locus_tag LOCUS_18790 2211 1273 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023750.1 protein_id gnl|my_center|LOCUS_18790 2344 3012 gene locus_tag LOCUS_18800 2344 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3217 3705 gene locus_tag LOCUS_18810 3217 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4956 3709 gene locus_tag LOCUS_18820 4956 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 <5484 4957 gene locus_tag LOCUS_18830 <5484 4957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020932.1:phosphate ABC transporter permease subunit PstC >Feature sequence111 367 621 gene locus_tag LOCUS_18840 367 621 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249868.1 protein_id gnl|my_center|LOCUS_18840 1078 668 gene locus_tag LOCUS_18850 1078 668 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868296.1 protein_id gnl|my_center|LOCUS_18850 1284 1078 gene locus_tag LOCUS_18860 1284 1078 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877811.1 protein_id gnl|my_center|LOCUS_18860 4478 1776 gene locus_tag LOCUS_18870 gene alaS 4478 1776 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_18870 5212 4595 gene locus_tag LOCUS_18880 5212 4595 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020957.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence112 <1 1107 gene locus_tag LOCUS_18890 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990611.1:ABC transporter substrate-binding protein 1126 1938 gene locus_tag LOCUS_18900 1126 1938 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066550.1 protein_id gnl|my_center|LOCUS_18900 1946 2920 gene locus_tag LOCUS_18910 1946 2920 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022455.1 protein_id gnl|my_center|LOCUS_18910 4922 2964 gene locus_tag LOCUS_18920 4922 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence113 212 652 gene locus_tag LOCUS_18930 212 652 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870899.1 protein_id gnl|my_center|LOCUS_18930 701 1855 gene locus_tag LOCUS_18940 701 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2077 2556 gene locus_tag LOCUS_18950 2077 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2553 3683 gene locus_tag LOCUS_18960 2553 3683 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_18960 4000 4608 gene locus_tag LOCUS_18970 4000 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18970 >Feature sequence114 576 100 gene locus_tag LOCUS_18980 576 100 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867125.1 protein_id gnl|my_center|LOCUS_18980 1044 589 gene locus_tag LOCUS_18990 1044 589 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065945.1 protein_id gnl|my_center|LOCUS_18990 1521 1985 gene locus_tag LOCUS_19000 1521 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2179 3225 gene locus_tag LOCUS_19010 2179 3225 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 protein_id gnl|my_center|LOCUS_19010 4040 3243 gene locus_tag LOCUS_19020 gene mtxX 4040 3243 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065223.1 protein_id gnl|my_center|LOCUS_19020 5017 4055 gene locus_tag LOCUS_19030 5017 4055 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence115 <1 1504 gene locus_tag LOCUS_19040 <1 1504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023222.1:ATP-dependent protease LonB 1512 2828 gene locus_tag LOCUS_19050 1512 2828 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990640.1 protein_id gnl|my_center|LOCUS_19050 2894 3619 gene locus_tag LOCUS_19060 2894 3619 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020866.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence116 103 1350 gene locus_tag LOCUS_19070 103 1350 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 protein_id gnl|my_center|LOCUS_19070 1693 2481 gene locus_tag LOCUS_19080 1693 2481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence117 191 391 gene locus_tag LOCUS_19090 191 391 CDS product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868316.1 protein_id gnl|my_center|LOCUS_19090 394 831 gene locus_tag LOCUS_19100 394 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1964 978 gene locus_tag LOCUS_19110 1964 978 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023816.1 protein_id gnl|my_center|LOCUS_19110 3085 2000 gene locus_tag LOCUS_19120 3085 2000 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065845.1 protein_id gnl|my_center|LOCUS_19120 3620 3069 gene locus_tag LOCUS_19130 3620 3069 CDS product AraC family ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065846.1 protein_id gnl|my_center|LOCUS_19130 4740 3664 gene locus_tag LOCUS_19140 4740 3664 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860356.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence118 46 765 gene locus_tag LOCUS_19150 46 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19150 775 1089 gene locus_tag LOCUS_19160 775 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19160 2075 1230 gene locus_tag LOCUS_19170 gene arsM 2075 1230 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_19170 2232 2107 gene locus_tag LOCUS_19180 2232 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2953 2294 gene locus_tag LOCUS_19190 2953 2294 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_19190 4317 2980 gene locus_tag LOCUS_19200 4317 2980 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104497.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence119 520 1677 gene locus_tag LOCUS_19210 gene dnaJ 520 1677 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021493.1 protein_id gnl|my_center|LOCUS_19210 2281 1658 gene locus_tag LOCUS_19220 2281 1658 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902169.1 protein_id gnl|my_center|LOCUS_19220 2823 2278 gene locus_tag LOCUS_19230 2823 2278 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024463.1 protein_id gnl|my_center|LOCUS_19230 2941 3447 gene locus_tag LOCUS_19240 gene fae 2941 3447 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022945.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence120 919 1431 gene locus_tag LOCUS_19250 919 1431 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_19250 1823 2224 gene locus_tag LOCUS_19260 gene ribC 1823 2224 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870697.1 protein_id gnl|my_center|LOCUS_19260 2776 2261 gene locus_tag LOCUS_19270 2776 2261 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_19270 3621 2842 gene locus_tag LOCUS_19280 3621 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 4002 4355 gene locus_tag LOCUS_19290 4002 4355 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022005.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence121 82 4407 gene locus_tag LOCUS_19300 82 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence122 56 496 gene locus_tag LOCUS_19310 56 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 497 871 gene locus_tag LOCUS_19320 497 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 939 1994 gene locus_tag LOCUS_19330 939 1994 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860356.1 protein_id gnl|my_center|LOCUS_19330 2024 2152 gene locus_tag LOCUS_19340 2024 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2170 2364 gene locus_tag LOCUS_19350 2170 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2357 2722 gene locus_tag LOCUS_19360 2357 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2805 3047 gene locus_tag LOCUS_19370 2805 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 3303 3617 gene locus_tag LOCUS_19380 3303 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 4183 3986 gene locus_tag LOCUS_19390 4183 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence123 1162 179 gene locus_tag LOCUS_19400 1162 179 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020113.1 protein_id gnl|my_center|LOCUS_19400 2533 1184 gene locus_tag LOCUS_19410 gene thrC 2533 1184 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_19410 3883 2621 gene locus_tag LOCUS_19420 3883 2621 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021968.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence124 2518 191 gene locus_tag LOCUS_19430 2518 191 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209617549.1 protein_id gnl|my_center|LOCUS_19430 2620 3132 gene locus_tag LOCUS_19440 2620 3132 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249124.1 protein_id gnl|my_center|LOCUS_19440 3211 3834 gene locus_tag LOCUS_19450 3211 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence125 76 2 gene locus_tag LOCUS_t00320 76 2 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 767 105 gene locus_tag LOCUS_19460 767 105 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889063.1 protein_id gnl|my_center|LOCUS_19460 1911 871 gene locus_tag LOCUS_19470 gene corA 1911 871 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_19470 2409 2047 gene locus_tag LOCUS_19480 2409 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990763.1 protein_id gnl|my_center|LOCUS_19480 2993 2406 gene locus_tag LOCUS_19490 2993 2406 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020976.1 protein_id gnl|my_center|LOCUS_19490 3748 2993 gene locus_tag LOCUS_19500 gene cobS 3748 2993 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020977.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence126 47 451 gene locus_tag LOCUS_19510 gene fpoA 47 451 CDS product F420H2 dehydrogenase subunit FpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021509.1 protein_id gnl|my_center|LOCUS_19510 442 1014 gene locus_tag LOCUS_19520 gene fpoB 442 1014 CDS product F(420)H(2) dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021510.1 protein_id gnl|my_center|LOCUS_19520 1030 2742 gene locus_tag LOCUS_19530 1030 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2755 3804 gene locus_tag LOCUS_19540 gene fpoH 2755 3804 CDS product F420H2 dehydrogenase subunit FpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065137.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence127 562 173 gene locus_tag LOCUS_19550 562 173 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021394.1 protein_id gnl|my_center|LOCUS_19550 883 602 gene locus_tag LOCUS_19560 883 602 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021395.1 protein_id gnl|my_center|LOCUS_19560 1731 883 gene locus_tag LOCUS_19570 1731 883 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021396.1 protein_id gnl|my_center|LOCUS_19570 2266 1742 gene locus_tag LOCUS_19580 2266 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 3572 2367 gene locus_tag LOCUS_19590 3572 2367 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024300.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence128 1792 83 gene locus_tag LOCUS_19600 1792 83 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_19600 1947 3281 gene locus_tag LOCUS_19610 gene glnA 1947 3281 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence129 692 1624 gene locus_tag LOCUS_19620 692 1624 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_19620 1628 2377 gene locus_tag LOCUS_19630 1628 2377 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 protein_id gnl|my_center|LOCUS_19630 2571 2858 gene locus_tag LOCUS_19640 2571 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2914 3339 gene locus_tag LOCUS_19650 2914 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence130 481 1323 gene locus_tag LOCUS_19660 481 1323 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_19660 2235 1561 gene locus_tag LOCUS_19670 2235 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 3053 2247 gene locus_tag LOCUS_19680 3053 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence131 285 683 gene locus_tag LOCUS_19690 285 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 747 1319 gene locus_tag LOCUS_19700 747 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 3315 1324 gene locus_tag LOCUS_19710 3315 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence132 117 1016 gene locus_tag LOCUS_19720 117 1016 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023152.1 protein_id gnl|my_center|LOCUS_19720 2053 1013 gene locus_tag LOCUS_19730 2053 1013 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023783.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence133 602 1318 gene locus_tag LOCUS_19740 602 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 1380 2009 gene locus_tag LOCUS_19750 1380 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2401 2045 gene locus_tag LOCUS_19760 2401 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2984 2403 gene locus_tag LOCUS_19770 gene pdxT 2984 2403 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021577.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence134 344 718 gene locus_tag LOCUS_19780 344 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1355 765 gene locus_tag LOCUS_19790 1355 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19790 2738 1395 gene locus_tag LOCUS_19800 2738 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19800 >Feature sequence135 344 985 gene locus_tag LOCUS_19810 344 985 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_19810 1154 1522 gene locus_tag LOCUS_19820 1154 1522 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731060.1 protein_id gnl|my_center|LOCUS_19820 2368 1514 gene locus_tag LOCUS_19830 2368 1514 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_19830 2911 2558 gene locus_tag LOCUS_19840 2911 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 3273 3199 gene locus_tag LOCUS_t00330 3273 3199 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence136 2210 1704 gene locus_tag LOCUS_19850 2210 1704 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948618.1 protein_id gnl|my_center|LOCUS_19850 2930 2265 gene locus_tag LOCUS_19860 2930 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence137 1509 124 gene locus_tag LOCUS_19870 1509 124 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_19870 <2981 1522 gene locus_tag LOCUS_19880 <2981 1522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024046.1:ATP synthase subunit A >Feature sequence138 722 1333 gene locus_tag LOCUS_19890 722 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2382 1387 gene locus_tag LOCUS_19900 2382 1387 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867675.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence139 358 2073 gene locus_tag LOCUS_19910 358 2073 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932359.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence140 1340 177 gene locus_tag LOCUS_19920 gene rbcL 1340 177 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024428.1 protein_id gnl|my_center|LOCUS_19920 1812 1405 gene locus_tag LOCUS_19930 1812 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence141 173 550 gene locus_tag LOCUS_19940 173 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 869 1900 gene locus_tag LOCUS_19950 869 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2331 2516 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaaagcacatcccgatgagaagggaactgaaag >Feature sequence142 2338 890 gene locus_tag LOCUS_19960 2338 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence143 >Feature sequence144 933 25 gene locus_tag LOCUS_19970 gene dapF 933 25 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_19970 1056 2261 gene locus_tag LOCUS_19980 1056 2261 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860554.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence145 677 282 gene locus_tag LOCUS_19990 677 282 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589516.1 protein_id gnl|my_center|LOCUS_19990 914 690 gene locus_tag LOCUS_20000 914 690 CDS product Sm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021429.1 protein_id gnl|my_center|LOCUS_20000 1170 943 gene locus_tag LOCUS_20010 1170 943 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791779.1 protein_id gnl|my_center|LOCUS_20010 1530 1177 gene locus_tag LOCUS_20020 1530 1177 CDS product MJ1244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060970.1 protein_id gnl|my_center|LOCUS_20020 1592 2056 gene locus_tag LOCUS_20030 gene cobZ 1592 2056 CDS product alpha-ribazole phosphatase CobZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065005.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence146 408 917 gene locus_tag LOCUS_20040 gene cgi121 408 917 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021174.1 protein_id gnl|my_center|LOCUS_20040 941 1540 gene locus_tag LOCUS_20050 941 1540 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023591.1 protein_id gnl|my_center|LOCUS_20050 <2224 1537 gene locus_tag LOCUS_20060 <2224 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020270.1:type II methionyl aminopeptidase >Feature sequence147 <2094 165 gene locus_tag LOCUS_20070 <2094 165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202319494.1:acetate--CoA ligase >Feature sequence148 201 1328 gene locus_tag LOCUS_20080 201 1328 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_20080 1387 1731 gene locus_tag LOCUS_20090 1387 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence149 1668 580 gene locus_tag LOCUS_20100 1668 580 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence150 1 381 gene locus_tag LOCUS_20110 1 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 387 1511 gene locus_tag LOCUS_20120 387 1511 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024513.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence151 101 532 gene locus_tag LOCUS_20130 101 532 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021281.1 protein_id gnl|my_center|LOCUS_20130 563 991 gene locus_tag LOCUS_20140 563 991 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064744.1 protein_id gnl|my_center|LOCUS_20140 988 1554 gene locus_tag LOCUS_20150 988 1554 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence152 <1 855 gene locus_tag LOCUS_20160 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066029.1:iron ABC transporter substrate-binding protein >Feature sequence153 <1 714 gene locus_tag LOCUS_20170 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065134.1:radical SAM protein 994 1755 gene locus_tag LOCUS_20180 994 1755 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 protein_id gnl|my_center|LOCUS_20180