>Feature sequence01 1521 106 gene locus_tag LOCUS_00010 1521 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1796 3049 gene locus_tag LOCUS_00020 1796 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3166 3807 gene locus_tag LOCUS_00030 gene coaE 3166 3807 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_00030 3800 4684 gene locus_tag LOCUS_00040 gene cdaA 3800 4684 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115697.1 protein_id gnl|my_center|LOCUS_00040 4692 5921 gene locus_tag LOCUS_00050 4692 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5946 7307 gene locus_tag LOCUS_00060 gene der 5946 7307 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_00060 8074 7385 gene locus_tag LOCUS_00070 gene deoC 8074 7385 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 protein_id gnl|my_center|LOCUS_00070 8899 8177 gene locus_tag LOCUS_00080 8899 8177 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_00080 9118 10425 gene locus_tag LOCUS_00090 9118 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10495 11772 gene locus_tag LOCUS_00100 gene mtaB 10495 11772 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_00100 12768 11812 gene locus_tag LOCUS_00110 12768 11812 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257547.1 protein_id gnl|my_center|LOCUS_00110 12964 13197 gene locus_tag LOCUS_00120 12964 13197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13207 14232 gene locus_tag LOCUS_00130 13207 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14375 15244 gene locus_tag LOCUS_00140 gene panB 14375 15244 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_00140 15246 16145 gene locus_tag LOCUS_00150 15246 16145 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948817.1 protein_id gnl|my_center|LOCUS_00150 16158 17033 gene locus_tag LOCUS_00160 gene panC 16158 17033 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_00160 17159 19111 gene locus_tag LOCUS_00170 17159 19111 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_00170 19123 19788 gene locus_tag LOCUS_00180 19123 19788 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262971.1 protein_id gnl|my_center|LOCUS_00180 19790 20476 gene locus_tag LOCUS_00190 19790 20476 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262970.1 protein_id gnl|my_center|LOCUS_00190 20847 21194 gene locus_tag LOCUS_00200 20847 21194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21187 21480 gene locus_tag LOCUS_00210 21187 21480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21514 22602 gene locus_tag LOCUS_00220 21514 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22611 23384 gene locus_tag LOCUS_00230 22611 23384 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429300.1 protein_id gnl|my_center|LOCUS_00230 23406 24152 gene locus_tag LOCUS_00240 23406 24152 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393997.1 protein_id gnl|my_center|LOCUS_00240 24177 25520 gene locus_tag LOCUS_00250 24177 25520 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243952.1 protein_id gnl|my_center|LOCUS_00250 25530 26414 gene locus_tag LOCUS_00260 25530 26414 CDS product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444280.1 protein_id gnl|my_center|LOCUS_00260 26517 27641 gene locus_tag LOCUS_00270 26517 27641 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285230.1 protein_id gnl|my_center|LOCUS_00270 28678 27737 gene locus_tag LOCUS_00280 28678 27737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29005 30915 gene locus_tag LOCUS_00290 29005 30915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31188 31583 gene locus_tag LOCUS_00300 31188 31583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31947 35096 gene locus_tag LOCUS_00310 gene ileS 31947 35096 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258550.1 protein_id gnl|my_center|LOCUS_00310 35373 35909 gene locus_tag LOCUS_00320 gene lspA 35373 35909 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364048.1 protein_id gnl|my_center|LOCUS_00320 35919 36839 gene locus_tag LOCUS_00330 35919 36839 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_00330 36854 37894 gene locus_tag LOCUS_00340 gene ltaE 36854 37894 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258446.1 protein_id gnl|my_center|LOCUS_00340 37962 38801 gene locus_tag LOCUS_00350 37962 38801 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174269896.1 protein_id gnl|my_center|LOCUS_00350 38903 39586 gene locus_tag LOCUS_00360 38903 39586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 39602 40153 gene locus_tag LOCUS_00370 39602 40153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 40158 42065 gene locus_tag LOCUS_00380 40158 42065 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258668.1 protein_id gnl|my_center|LOCUS_00380 42149 43093 gene locus_tag LOCUS_00390 42149 43093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 43093 45321 gene locus_tag LOCUS_00400 43093 45321 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257113.1 protein_id gnl|my_center|LOCUS_00400 45413 46039 gene locus_tag LOCUS_00410 gene pgsA 45413 46039 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249014.1 protein_id gnl|my_center|LOCUS_00410 46068 46937 gene locus_tag LOCUS_00420 gene lgt 46068 46937 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257228.1 protein_id gnl|my_center|LOCUS_00420 46974 47906 gene locus_tag LOCUS_00430 46974 47906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257461.1 protein_id gnl|my_center|LOCUS_00430 47899 49314 gene locus_tag LOCUS_00440 47899 49314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 49821 49318 gene locus_tag LOCUS_00450 49821 49318 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_00450 50674 49877 gene locus_tag LOCUS_00460 50674 49877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 52365 50680 gene locus_tag LOCUS_00470 52365 50680 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723060.1 protein_id gnl|my_center|LOCUS_00470 52750 52397 gene locus_tag LOCUS_00480 52750 52397 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 protein_id gnl|my_center|LOCUS_00480 53776 53117 gene locus_tag LOCUS_00490 gene rpe 53776 53117 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_00490 54860 53787 gene locus_tag LOCUS_00500 54860 53787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 54900 56015 gene locus_tag LOCUS_00510 gene cax 54900 56015 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_00510 56033 56491 gene locus_tag LOCUS_00520 56033 56491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 56683 56501 gene locus_tag LOCUS_00530 56683 56501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 57089 58855 gene locus_tag LOCUS_00540 57089 58855 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259648.1 protein_id gnl|my_center|LOCUS_00540 58891 59775 gene locus_tag LOCUS_00550 58891 59775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 59790 61265 gene locus_tag LOCUS_00560 59790 61265 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259646.1 protein_id gnl|my_center|LOCUS_00560 61258 61713 gene locus_tag LOCUS_00570 61258 61713 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259645.1 protein_id gnl|my_center|LOCUS_00570 61701 61940 gene locus_tag LOCUS_00580 61701 61940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259644.1 protein_id gnl|my_center|LOCUS_00580 61944 62693 gene locus_tag LOCUS_00590 61944 62693 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_00590 62912 63352 gene locus_tag LOCUS_00600 62912 63352 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_00600 63499 63855 gene locus_tag LOCUS_00610 gene trxA 63499 63855 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258400.1 protein_id gnl|my_center|LOCUS_00610 65190 63907 gene locus_tag LOCUS_00620 gene murA 65190 63907 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083644.1 protein_id gnl|my_center|LOCUS_00620 65341 66840 gene locus_tag LOCUS_00630 65341 66840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 66863 67648 gene locus_tag LOCUS_00640 66863 67648 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114813.1 protein_id gnl|my_center|LOCUS_00640 67728 69395 gene locus_tag LOCUS_00650 gene atpA 67728 69395 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_00650 69419 70327 gene locus_tag LOCUS_00660 gene atpG 69419 70327 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_00660 70351 71748 gene locus_tag LOCUS_00670 gene atpD 70351 71748 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082059.1 protein_id gnl|my_center|LOCUS_00670 71757 72182 gene locus_tag LOCUS_00680 71757 72182 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_00680 72208 73215 gene locus_tag LOCUS_00690 72208 73215 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_00690 73851 73234 gene locus_tag LOCUS_00700 73851 73234 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_00700 73938 74669 gene locus_tag LOCUS_00710 73938 74669 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902031.1 protein_id gnl|my_center|LOCUS_00710 75395 74679 gene locus_tag LOCUS_00720 75395 74679 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_00720 75539 76237 gene locus_tag LOCUS_00730 75539 76237 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_00730 76240 77643 gene locus_tag LOCUS_00740 76240 77643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 77743 79416 gene locus_tag LOCUS_00750 77743 79416 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339151.1 protein_id gnl|my_center|LOCUS_00750 79554 80687 gene locus_tag LOCUS_00760 79554 80687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 81326 82129 gene locus_tag LOCUS_00770 81326 82129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 82343 82699 gene locus_tag LOCUS_00780 82343 82699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 84296 82908 gene locus_tag LOCUS_00790 84296 82908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 85019 84297 gene locus_tag LOCUS_00800 85019 84297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 85125 85051 gene locus_tag LOCUS_t00010 85125 85051 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 85826 85134 gene locus_tag LOCUS_00810 85826 85134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00810 87735 85828 gene locus_tag LOCUS_00820 87735 85828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00820 88575 87784 gene locus_tag LOCUS_00830 88575 87784 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_00830 88869 88585 gene locus_tag LOCUS_00840 88869 88585 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075541644.1 protein_id gnl|my_center|LOCUS_00840 88987 89325 gene locus_tag LOCUS_00850 88987 89325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 89346 89831 gene locus_tag LOCUS_00860 89346 89831 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258099.1 protein_id gnl|my_center|LOCUS_00860 89839 90705 gene locus_tag LOCUS_00870 89839 90705 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_00870 90702 91490 gene locus_tag LOCUS_00880 90702 91490 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_00880 91503 92348 gene locus_tag LOCUS_00890 91503 92348 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_00890 92407 93450 gene locus_tag LOCUS_00900 92407 93450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 93484 94686 gene locus_tag LOCUS_00910 93484 94686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 94703 95425 gene locus_tag LOCUS_00920 94703 95425 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_00920 95425 95724 gene locus_tag LOCUS_00930 95425 95724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 95721 97034 gene locus_tag LOCUS_00940 95721 97034 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258273.1 protein_id gnl|my_center|LOCUS_00940 97038 97946 gene locus_tag LOCUS_00950 97038 97946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 97950 98486 gene locus_tag LOCUS_00960 97950 98486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 98494 99390 gene locus_tag LOCUS_00970 98494 99390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 99543 100214 gene locus_tag LOCUS_00980 99543 100214 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258880.1 protein_id gnl|my_center|LOCUS_00980 100988 100281 gene locus_tag LOCUS_00990 100988 100281 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878743.1 protein_id gnl|my_center|LOCUS_00990 101545 100985 gene locus_tag LOCUS_01000 101545 100985 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240066.1 protein_id gnl|my_center|LOCUS_01000 102090 101542 gene locus_tag LOCUS_01010 102090 101542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 103812 102118 gene locus_tag LOCUS_01020 103812 102118 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_01020 104119 103895 gene locus_tag LOCUS_01030 104119 103895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 104178 105272 gene locus_tag LOCUS_01040 104178 105272 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_01040 105262 105747 gene locus_tag LOCUS_01050 105262 105747 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259311.1 protein_id gnl|my_center|LOCUS_01050 105847 106626 gene locus_tag LOCUS_01060 105847 106626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 106668 107048 gene locus_tag LOCUS_01070 106668 107048 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257857.1 protein_id gnl|my_center|LOCUS_01070 107826 107035 gene locus_tag LOCUS_01080 107826 107035 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114948346.1 protein_id gnl|my_center|LOCUS_01080 107929 108801 gene locus_tag LOCUS_01090 gene mtnP 107929 108801 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_01090 108798 111404 gene locus_tag LOCUS_01100 108798 111404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 112636 111419 gene locus_tag LOCUS_01110 gene tyrS 112636 111419 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081488.1 protein_id gnl|my_center|LOCUS_01110 113670 112750 gene locus_tag LOCUS_01120 113670 112750 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_01120 113782 116418 gene locus_tag LOCUS_01130 gene recG 113782 116418 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141278.1 protein_id gnl|my_center|LOCUS_01130 116419 116943 gene locus_tag LOCUS_01140 gene coaD 116419 116943 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459625.1 protein_id gnl|my_center|LOCUS_01140 117020 117481 gene locus_tag LOCUS_01150 117020 117481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 118350 117571 gene locus_tag LOCUS_01160 118350 117571 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228359.1 protein_id gnl|my_center|LOCUS_01160 119269 118343 gene locus_tag LOCUS_01170 119269 118343 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064981.1 protein_id gnl|my_center|LOCUS_01170 119928 119299 gene locus_tag LOCUS_01180 119928 119299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 122639 120117 gene locus_tag LOCUS_01190 gene lon 122639 120117 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255996.1 protein_id gnl|my_center|LOCUS_01190 124054 122663 gene locus_tag LOCUS_01200 124054 122663 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256342.1 protein_id gnl|my_center|LOCUS_01200 124159 124869 gene locus_tag LOCUS_01210 gene radC 124159 124869 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_01210 126051 124894 gene locus_tag LOCUS_01220 126051 124894 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 protein_id gnl|my_center|LOCUS_01220 128429 126048 gene locus_tag LOCUS_01230 128429 126048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 128733 130385 gene locus_tag LOCUS_01240 128733 130385 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_01240 130503 131645 gene locus_tag LOCUS_01250 130503 131645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 131690 131764 gene locus_tag LOCUS_t00020 131690 131764 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 131885 132874 gene locus_tag LOCUS_01260 131885 132874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 132981 134639 gene locus_tag LOCUS_01270 132981 134639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 134641 135666 gene locus_tag LOCUS_01280 134641 135666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 135687 136595 gene locus_tag LOCUS_01290 135687 136595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 136651 136917 gene locus_tag LOCUS_01300 136651 136917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 137080 137643 gene locus_tag LOCUS_01310 137080 137643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 137640 138497 gene locus_tag LOCUS_01320 137640 138497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 138504 139661 gene locus_tag LOCUS_01330 138504 139661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 139806 141701 gene locus_tag LOCUS_01340 139806 141701 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_01340 144813 141823 gene locus_tag LOCUS_01350 144813 141823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 146721 144910 gene locus_tag LOCUS_01360 146721 144910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_01360 148522 146708 gene locus_tag LOCUS_01370 148522 146708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_01370 148670 149362 gene locus_tag LOCUS_01380 148670 149362 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109943.1 protein_id gnl|my_center|LOCUS_01380 149394 150080 gene locus_tag LOCUS_01390 149394 150080 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_01390 150254 150844 gene locus_tag LOCUS_01400 150254 150844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 150940 151137 gene locus_tag LOCUS_01410 gene rpmF 150940 151137 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631660.1 protein_id gnl|my_center|LOCUS_01410 152570 151188 gene locus_tag LOCUS_01420 gene hflX 152570 151188 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_01420 153752 152574 gene locus_tag LOCUS_01430 153752 152574 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_01430 153823 154674 gene locus_tag LOCUS_01440 153823 154674 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940312.1 protein_id gnl|my_center|LOCUS_01440 154691 155263 gene locus_tag LOCUS_01450 154691 155263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 155288 155860 gene locus_tag LOCUS_01460 155288 155860 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329137.1 protein_id gnl|my_center|LOCUS_01460 156563 155910 gene locus_tag LOCUS_01470 156563 155910 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_01470 157169 156642 gene locus_tag LOCUS_01480 157169 156642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 157617 157240 gene locus_tag LOCUS_01490 157617 157240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 158007 157621 gene locus_tag LOCUS_01500 158007 157621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 158744 158004 gene locus_tag LOCUS_01510 158744 158004 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939943.1 protein_id gnl|my_center|LOCUS_01510 159919 158741 gene locus_tag LOCUS_01520 159919 158741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 161420 159921 gene locus_tag LOCUS_01530 gene glpK 161420 159921 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_01530 162549 161446 gene locus_tag LOCUS_01540 162549 161446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 163319 162675 gene locus_tag LOCUS_01550 163319 162675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 164054 163341 gene locus_tag LOCUS_01560 164054 163341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 164841 164026 gene locus_tag LOCUS_01570 164841 164026 CDS product DUF692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965760.1 protein_id gnl|my_center|LOCUS_01570 164955 166658 gene locus_tag LOCUS_01580 164955 166658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 168040 166790 gene locus_tag LOCUS_01590 168040 166790 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444448.1 protein_id gnl|my_center|LOCUS_01590 168720 168085 gene locus_tag LOCUS_01600 168720 168085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 169788 168994 gene locus_tag LOCUS_01610 169788 168994 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_01610 169902 171308 gene locus_tag LOCUS_01620 169902 171308 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 protein_id gnl|my_center|LOCUS_01620 171921 171358 gene locus_tag LOCUS_01630 gene raiA 171921 171358 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_01630 172447 171962 gene locus_tag LOCUS_01640 172447 171962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 173685 172723 gene locus_tag LOCUS_01650 173685 172723 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_01650 174672 173707 gene locus_tag LOCUS_01660 174672 173707 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_01660 176140 174716 gene locus_tag LOCUS_01670 176140 174716 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_01670 177412 176171 gene locus_tag LOCUS_01680 177412 176171 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939398.1 protein_id gnl|my_center|LOCUS_01680 178548 177442 gene locus_tag LOCUS_01690 178548 177442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 178885 178739 gene locus_tag LOCUS_01700 178885 178739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 179098 179619 gene locus_tag LOCUS_01710 179098 179619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 179670 180731 gene locus_tag LOCUS_01720 179670 180731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 181051 182190 gene locus_tag LOCUS_01730 gene sucC 181051 182190 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_01730 182192 183058 gene locus_tag LOCUS_01740 gene sucD 182192 183058 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765646.1 protein_id gnl|my_center|LOCUS_01740 183352 183116 gene locus_tag LOCUS_01750 gene acpP 183352 183116 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873663.1 protein_id gnl|my_center|LOCUS_01750 183507 184550 gene locus_tag LOCUS_01760 gene fni 183507 184550 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_01760 184547 185554 gene locus_tag LOCUS_01770 184547 185554 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257726.1 protein_id gnl|my_center|LOCUS_01770 185665 186297 gene locus_tag LOCUS_01780 gene folE 185665 186297 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390685.1 protein_id gnl|my_center|LOCUS_01780 186803 186294 gene locus_tag LOCUS_01790 gene folK 186803 186294 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_01790 187166 186813 gene locus_tag LOCUS_01800 gene folB 187166 186813 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465889.1 protein_id gnl|my_center|LOCUS_01800 187905 187180 gene locus_tag LOCUS_01810 187905 187180 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_01810 189876 188047 gene locus_tag LOCUS_01820 189876 188047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 190630 189944 gene locus_tag LOCUS_01830 190630 189944 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263627.1 protein_id gnl|my_center|LOCUS_01830 190757 191911 gene locus_tag LOCUS_01840 190757 191911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477770.1 protein_id gnl|my_center|LOCUS_01840 191920 192639 gene locus_tag LOCUS_01850 191920 192639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202582.1 protein_id gnl|my_center|LOCUS_01850 193926 192718 gene locus_tag LOCUS_01860 193926 192718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 194917 194027 gene locus_tag LOCUS_01870 194917 194027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 >Feature sequence02 1584 736 gene locus_tag LOCUS_01880 1584 736 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_01880 2619 1645 gene locus_tag LOCUS_01890 gene corA 2619 1645 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_01890 4371 2686 gene locus_tag LOCUS_01900 4371 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 4821 4474 gene locus_tag LOCUS_01910 4821 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 5447 4818 gene locus_tag LOCUS_01920 5447 4818 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259317.1 protein_id gnl|my_center|LOCUS_01920 5642 6859 gene locus_tag LOCUS_01930 5642 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 7017 7793 gene locus_tag LOCUS_01940 gene sufC 7017 7793 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_01940 7818 9230 gene locus_tag LOCUS_01950 gene sufB 7818 9230 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888737.1 protein_id gnl|my_center|LOCUS_01950 9340 10605 gene locus_tag LOCUS_01960 gene sufD 9340 10605 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_01960 10660 10962 gene locus_tag LOCUS_01970 10660 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 10967 12190 gene locus_tag LOCUS_01980 10967 12190 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_01980 12203 12595 gene locus_tag LOCUS_01990 12203 12595 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_01990 12599 12925 gene locus_tag LOCUS_02000 12599 12925 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_02000 13608 12955 gene locus_tag LOCUS_02010 13608 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 14412 13612 gene locus_tag LOCUS_02020 14412 13612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 15567 14491 gene locus_tag LOCUS_02030 gene hypE 15567 14491 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_02030 16688 15564 gene locus_tag LOCUS_02040 gene hypD 16688 15564 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_02040 16942 16685 gene locus_tag LOCUS_02050 16942 16685 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_02050 19240 16943 gene locus_tag LOCUS_02060 gene hypF 19240 16943 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_02060 19910 19242 gene locus_tag LOCUS_02070 gene hypB 19910 19242 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_02070 20261 19917 gene locus_tag LOCUS_02080 gene hypA 20261 19917 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393668.1 protein_id gnl|my_center|LOCUS_02080 21454 20351 gene locus_tag LOCUS_02090 21454 20351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 22074 21538 gene locus_tag LOCUS_02100 22074 21538 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582503.1 protein_id gnl|my_center|LOCUS_02100 23526 22099 gene locus_tag LOCUS_02110 23526 22099 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_02110 24092 23550 gene locus_tag LOCUS_02120 24092 23550 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_02120 26063 24120 gene locus_tag LOCUS_02130 26063 24120 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582500.1 protein_id gnl|my_center|LOCUS_02130 27727 26087 gene locus_tag LOCUS_02140 gene nuoF 27727 26087 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_02140 28225 27737 gene locus_tag LOCUS_02150 gene nuoE 28225 27737 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584034.1 protein_id gnl|my_center|LOCUS_02150 30025 28316 gene locus_tag LOCUS_02160 gene nuoF 30025 28316 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_02160 30511 30143 gene locus_tag LOCUS_02170 30511 30143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 protein_id gnl|my_center|LOCUS_02170 31087 30539 gene locus_tag LOCUS_02180 31087 30539 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_02180 31615 31100 gene locus_tag LOCUS_02190 gene nuoE 31615 31100 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583281.1 protein_id gnl|my_center|LOCUS_02190 32591 31830 gene locus_tag LOCUS_02200 32591 31830 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_02200 32932 32588 gene locus_tag LOCUS_02210 32932 32588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 33935 32934 gene locus_tag LOCUS_02220 33935 32934 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583276.1 protein_id gnl|my_center|LOCUS_02220 34332 33949 gene locus_tag LOCUS_02230 34332 33949 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_02230 34505 35773 gene locus_tag LOCUS_02240 gene hisS 34505 35773 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_02240 35821 35895 gene locus_tag LOCUS_t00030 35821 35895 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 36968 35949 gene locus_tag LOCUS_02250 36968 35949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 37425 39149 gene locus_tag LOCUS_02260 37425 39149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 39743 41251 gene locus_tag LOCUS_02270 39743 41251 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584014.1 protein_id gnl|my_center|LOCUS_02270 41335 43131 gene locus_tag LOCUS_02280 41335 43131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 43311 44231 gene locus_tag LOCUS_02290 gene rbsB 43311 44231 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175185.1 protein_id gnl|my_center|LOCUS_02290 45285 44296 gene locus_tag LOCUS_02300 45285 44296 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530992.1 protein_id gnl|my_center|LOCUS_02300 46466 45417 gene locus_tag LOCUS_02310 46466 45417 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530994.1 protein_id gnl|my_center|LOCUS_02310 47251 46469 gene locus_tag LOCUS_02320 47251 46469 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530993.1 protein_id gnl|my_center|LOCUS_02320 49614 47479 gene locus_tag LOCUS_02330 49614 47479 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_02330 51090 49735 gene locus_tag LOCUS_02340 51090 49735 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190374.1 protein_id gnl|my_center|LOCUS_02340 51246 52196 gene locus_tag LOCUS_02350 51246 52196 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101033.1 protein_id gnl|my_center|LOCUS_02350 52226 52630 gene locus_tag LOCUS_02360 52226 52630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 52893 54308 gene locus_tag LOCUS_02370 52893 54308 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897455.1 protein_id gnl|my_center|LOCUS_02370 54369 54833 gene locus_tag LOCUS_02380 54369 54833 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161552.1 protein_id gnl|my_center|LOCUS_02380 54922 55233 gene locus_tag LOCUS_02390 54922 55233 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861509.1 protein_id gnl|my_center|LOCUS_02390 55325 55786 gene locus_tag LOCUS_02400 55325 55786 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729238.1 protein_id gnl|my_center|LOCUS_02400 55907 56968 gene locus_tag LOCUS_02410 55907 56968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 57920 57024 gene locus_tag LOCUS_02420 gene lysX 57920 57024 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_02420 58955 57939 gene locus_tag LOCUS_02430 58955 57939 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173431.1 protein_id gnl|my_center|LOCUS_02430 59452 58958 gene locus_tag LOCUS_02440 59452 58958 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256237.1 protein_id gnl|my_center|LOCUS_02440 60694 59462 gene locus_tag LOCUS_02450 60694 59462 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926083.1 protein_id gnl|my_center|LOCUS_02450 61883 60723 gene locus_tag LOCUS_02460 gene lysS 61883 60723 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173924.1 protein_id gnl|my_center|LOCUS_02460 63138 62080 gene locus_tag LOCUS_02470 63138 62080 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_02470 64364 63138 gene locus_tag LOCUS_02480 64364 63138 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909458.1 protein_id gnl|my_center|LOCUS_02480 65186 64383 gene locus_tag LOCUS_02490 65186 64383 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_02490 66242 65211 gene locus_tag LOCUS_02500 gene argC 66242 65211 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_02500 67206 66244 gene locus_tag LOCUS_02510 gene lysX 67206 66244 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_02510 67385 67209 gene locus_tag LOCUS_02520 gene lysW 67385 67209 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229005.1 protein_id gnl|my_center|LOCUS_02520 67820 68815 gene locus_tag LOCUS_02530 67820 68815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 69066 68845 gene locus_tag LOCUS_02540 69066 68845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 70023 70235 gene locus_tag LOCUS_02550 70023 70235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 72435 71449 gene locus_tag LOCUS_02560 gene hepT 72435 71449 CDS product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776082.1 protein_id gnl|my_center|LOCUS_02560 73220 72417 gene locus_tag LOCUS_02570 73220 72417 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_02570 74648 73227 gene locus_tag LOCUS_02580 74648 73227 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_02580 74750 75901 gene locus_tag LOCUS_02590 gene nifS 74750 75901 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_02590 75898 76986 gene locus_tag LOCUS_02600 gene mnmA 75898 76986 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_02600 76983 77255 gene locus_tag LOCUS_02610 76983 77255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 77517 77308 gene locus_tag LOCUS_02620 77517 77308 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_02620 78273 77722 gene locus_tag LOCUS_02630 78273 77722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 79967 78606 gene locus_tag LOCUS_02640 gene trmFO 79967 78606 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001991958.1 protein_id gnl|my_center|LOCUS_02640 80069 81478 gene locus_tag LOCUS_02650 gene rpoN 80069 81478 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809045.1 protein_id gnl|my_center|LOCUS_02650 81475 83421 gene locus_tag LOCUS_02660 81475 83421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 83425 84594 gene locus_tag LOCUS_02670 83425 84594 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546113.1 protein_id gnl|my_center|LOCUS_02670 84653 84973 gene locus_tag LOCUS_02680 84653 84973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 85002 87356 gene locus_tag LOCUS_02690 85002 87356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 87423 90425 gene locus_tag LOCUS_02700 87423 90425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 90422 93223 gene locus_tag LOCUS_02710 90422 93223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 93331 96066 gene locus_tag LOCUS_02720 gene alaS 93331 96066 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_02720 97561 96122 gene locus_tag LOCUS_02730 97561 96122 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_02730 98712 97558 gene locus_tag LOCUS_02740 98712 97558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 99266 98709 gene locus_tag LOCUS_02750 99266 98709 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404467.1 protein_id gnl|my_center|LOCUS_02750 100788 99322 gene locus_tag LOCUS_02760 gene gcvPB 100788 99322 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393440.1 protein_id gnl|my_center|LOCUS_02760 102130 100781 gene locus_tag LOCUS_02770 gene gcvPA 102130 100781 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909428.1 protein_id gnl|my_center|LOCUS_02770 102522 102130 gene locus_tag LOCUS_02780 gene gcvH 102522 102130 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_02780 102954 104807 gene locus_tag LOCUS_02790 gene typA 102954 104807 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256721.1 protein_id gnl|my_center|LOCUS_02790 105059 104865 gene locus_tag LOCUS_02800 105059 104865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 105413 107257 gene locus_tag LOCUS_02810 gene glmS 105413 107257 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256373.1 protein_id gnl|my_center|LOCUS_02810 107508 108818 gene locus_tag LOCUS_02820 107508 108818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 109644 108844 gene locus_tag LOCUS_02830 109644 108844 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259459.1 protein_id gnl|my_center|LOCUS_02830 110279 109656 gene locus_tag LOCUS_02840 110279 109656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 110503 111066 gene locus_tag LOCUS_02850 110503 111066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 111066 112808 gene locus_tag LOCUS_02860 111066 112808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 112823 113470 gene locus_tag LOCUS_02870 112823 113470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 113463 113786 gene locus_tag LOCUS_02880 113463 113786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 113794 114870 gene locus_tag LOCUS_02890 113794 114870 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_02890 114881 115732 gene locus_tag LOCUS_02900 114881 115732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 115716 116447 gene locus_tag LOCUS_02910 115716 116447 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_02910 116550 117239 gene locus_tag LOCUS_02920 116550 117239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 117253 119055 gene locus_tag LOCUS_02930 117253 119055 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_02930 119058 120104 gene locus_tag LOCUS_02940 119058 120104 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_02940 121619 120168 gene locus_tag LOCUS_02950 gene pyk 121619 120168 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143313.1 protein_id gnl|my_center|LOCUS_02950 122936 121623 gene locus_tag LOCUS_02960 122936 121623 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_02960 124152 122950 gene locus_tag LOCUS_02970 gene rocD 124152 122950 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391213.1 protein_id gnl|my_center|LOCUS_02970 125084 124161 gene locus_tag LOCUS_02980 gene argF 125084 124161 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_02980 125530 126663 gene locus_tag LOCUS_02990 125530 126663 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787777.1 protein_id gnl|my_center|LOCUS_02990 126781 127557 gene locus_tag LOCUS_03000 gene phnC 126781 127557 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078092.1 protein_id gnl|my_center|LOCUS_03000 127558 129384 gene locus_tag LOCUS_03010 127558 129384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 129419 130021 gene locus_tag LOCUS_03020 129419 130021 CDS product VUT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479579.1 protein_id gnl|my_center|LOCUS_03020 130155 131417 gene locus_tag LOCUS_03030 gene noeA 130155 131417 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127582344.1 protein_id gnl|my_center|LOCUS_03030 131441 132286 gene locus_tag LOCUS_03040 131441 132286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204824.1 protein_id gnl|my_center|LOCUS_03040 132364 133074 gene locus_tag LOCUS_03050 132364 133074 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403622.1 protein_id gnl|my_center|LOCUS_03050 133074 134621 gene locus_tag LOCUS_03060 133074 134621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936280.1 protein_id gnl|my_center|LOCUS_03060 135690 134704 gene locus_tag LOCUS_03070 135690 134704 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678705.1 protein_id gnl|my_center|LOCUS_03070 135852 135703 gene locus_tag LOCUS_03080 135852 135703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 136224 136871 gene locus_tag LOCUS_03090 136224 136871 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860823.1 protein_id gnl|my_center|LOCUS_03090 136873 138132 gene locus_tag LOCUS_03100 gene larA 136873 138132 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393426.1 protein_id gnl|my_center|LOCUS_03100 138129 138917 gene locus_tag LOCUS_03110 138129 138917 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_03110 138981 139334 gene locus_tag LOCUS_03120 138981 139334 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206139.1 protein_id gnl|my_center|LOCUS_03120 139342 139791 gene locus_tag LOCUS_03130 gene nusB 139342 139791 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_03130 139907 142261 gene locus_tag LOCUS_03140 139907 142261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 142280 143896 gene locus_tag LOCUS_03150 gene pckA 142280 143896 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_03150 144391 143906 gene locus_tag LOCUS_03160 144391 143906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 145226 144945 gene locus_tag LOCUS_03170 145226 144945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 145988 147241 gene locus_tag LOCUS_03180 145988 147241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 147247 148494 gene locus_tag LOCUS_03190 gene mrfB 147247 148494 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_03190 148487 149068 gene locus_tag LOCUS_03200 148487 149068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 149085 149357 gene locus_tag LOCUS_03210 149085 149357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 150127 149360 gene locus_tag LOCUS_03220 150127 149360 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869010.1 protein_id gnl|my_center|LOCUS_03220 150761 150213 gene locus_tag LOCUS_03230 150761 150213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 152173 150821 gene locus_tag LOCUS_03240 152173 150821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 152988 152170 gene locus_tag LOCUS_03250 gene yqeB 152988 152170 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_03250 155221 152993 gene locus_tag LOCUS_03260 gene xdh 155221 152993 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_03260 155543 155265 gene locus_tag LOCUS_03270 155543 155265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 157045 155627 gene locus_tag LOCUS_03280 157045 155627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence03 1707 2930 gene locus_tag LOCUS_03290 gene rlmD 1707 2930 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_03290 3197 2931 gene locus_tag LOCUS_03300 3197 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 3359 4384 gene locus_tag LOCUS_03310 3359 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 4622 5446 gene locus_tag LOCUS_03320 4622 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 6330 5503 gene locus_tag LOCUS_03330 gene trxA 6330 5503 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379146.1 protein_id gnl|my_center|LOCUS_03330 6810 6385 gene locus_tag LOCUS_03340 6810 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 8090 6879 gene locus_tag LOCUS_03350 8090 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 8833 8090 gene locus_tag LOCUS_03360 8833 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 9087 9533 gene locus_tag LOCUS_03370 9087 9533 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229065.1 protein_id gnl|my_center|LOCUS_03370 9530 10102 gene locus_tag LOCUS_03380 9530 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 10767 10108 gene locus_tag LOCUS_03390 10767 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 11058 10792 gene locus_tag LOCUS_03400 11058 10792 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631989.1 protein_id gnl|my_center|LOCUS_03400 11376 11062 gene locus_tag LOCUS_03410 11376 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 11986 11645 gene locus_tag LOCUS_03420 11986 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 12045 14798 gene locus_tag LOCUS_03430 12045 14798 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_03430 14812 16122 gene locus_tag LOCUS_03440 14812 16122 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030679.1 protein_id gnl|my_center|LOCUS_03440 16122 17033 gene locus_tag LOCUS_03450 16122 17033 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_03450 17466 17044 gene locus_tag LOCUS_03460 17466 17044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 18886 17459 gene locus_tag LOCUS_03470 18886 17459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 19804 18890 gene locus_tag LOCUS_03480 19804 18890 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937757.1 protein_id gnl|my_center|LOCUS_03480 20722 19811 gene locus_tag LOCUS_03490 gene truB 20722 19811 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_03490 21738 20776 gene locus_tag LOCUS_03500 21738 20776 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_03500 22102 21722 gene locus_tag LOCUS_03510 22102 21722 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114836.1 protein_id gnl|my_center|LOCUS_03510 23921 22137 gene locus_tag LOCUS_03520 23921 22137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 24368 24045 gene locus_tag LOCUS_03530 24368 24045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 26247 24388 gene locus_tag LOCUS_03540 26247 24388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 26497 27339 gene locus_tag LOCUS_03550 26497 27339 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974406.1 protein_id gnl|my_center|LOCUS_03550 27421 28599 gene locus_tag LOCUS_03560 27421 28599 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_03560 28599 29978 gene locus_tag LOCUS_03570 28599 29978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 31545 30373 gene locus_tag LOCUS_03580 31545 30373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 31817 31542 gene locus_tag LOCUS_03590 gene hisE 31817 31542 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949117.1 protein_id gnl|my_center|LOCUS_03590 32163 31831 gene locus_tag LOCUS_03600 gene hisI 32163 31831 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646591.1 protein_id gnl|my_center|LOCUS_03600 32981 32211 gene locus_tag LOCUS_03610 gene hisF 32981 32211 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_03610 33733 32984 gene locus_tag LOCUS_03620 gene hisA 33733 32984 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531989.1 protein_id gnl|my_center|LOCUS_03620 34387 33770 gene locus_tag LOCUS_03630 gene hisH 34387 33770 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_03630 35022 34384 gene locus_tag LOCUS_03640 gene hisB 35022 34384 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970622.1 protein_id gnl|my_center|LOCUS_03640 36116 35019 gene locus_tag LOCUS_03650 gene hisC 36116 35019 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257801.1 protein_id gnl|my_center|LOCUS_03650 37129 36113 gene locus_tag LOCUS_03660 gene hisG 37129 36113 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257147.1 protein_id gnl|my_center|LOCUS_03660 37561 37403 gene locus_tag LOCUS_03670 37561 37403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 37589 38371 gene locus_tag LOCUS_03680 37589 38371 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_03680 38559 40031 gene locus_tag LOCUS_03690 38559 40031 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066679.1 protein_id gnl|my_center|LOCUS_03690 40114 41052 gene locus_tag LOCUS_03700 40114 41052 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066678.1 protein_id gnl|my_center|LOCUS_03700 41063 41923 gene locus_tag LOCUS_03710 41063 41923 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 protein_id gnl|my_center|LOCUS_03710 41936 42136 gene locus_tag LOCUS_03720 41936 42136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 42148 43287 gene locus_tag LOCUS_03730 42148 43287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066675.1 protein_id gnl|my_center|LOCUS_03730 43274 44371 gene locus_tag LOCUS_03740 43274 44371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066674.1 protein_id gnl|my_center|LOCUS_03740 44511 45653 gene locus_tag LOCUS_03750 44511 45653 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095763.1 protein_id gnl|my_center|LOCUS_03750 45643 47145 gene locus_tag LOCUS_03760 gene gntK 45643 47145 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255195.1 protein_id gnl|my_center|LOCUS_03760 47169 48098 gene locus_tag LOCUS_03770 47169 48098 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289156.1 protein_id gnl|my_center|LOCUS_03770 48142 48645 gene locus_tag LOCUS_03780 48142 48645 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_03780 50155 48725 gene locus_tag LOCUS_03790 50155 48725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 50720 50148 gene locus_tag LOCUS_03800 50720 50148 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964817.1 protein_id gnl|my_center|LOCUS_03800 51978 51028 gene locus_tag LOCUS_03810 51978 51028 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066688.1 protein_id gnl|my_center|LOCUS_03810 52649 51999 gene locus_tag LOCUS_03820 52649 51999 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906064.1 protein_id gnl|my_center|LOCUS_03820 53614 52670 gene locus_tag LOCUS_03830 53614 52670 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_03830 54219 53641 gene locus_tag LOCUS_03840 gene pgiA 54219 53641 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147196.1 protein_id gnl|my_center|LOCUS_03840 55173 54232 gene locus_tag LOCUS_03850 55173 54232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 55372 56088 gene locus_tag LOCUS_03860 gene deoC 55372 56088 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066692.1 protein_id gnl|my_center|LOCUS_03860 56081 57649 gene locus_tag LOCUS_03870 56081 57649 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970032.1 protein_id gnl|my_center|LOCUS_03870 57664 58389 gene locus_tag LOCUS_03880 57664 58389 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089765.1 protein_id gnl|my_center|LOCUS_03880 58566 59300 gene locus_tag LOCUS_03890 58566 59300 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_03890 59590 60339 gene locus_tag LOCUS_03900 59590 60339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 60339 60890 gene locus_tag LOCUS_03910 60339 60890 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144143.1 protein_id gnl|my_center|LOCUS_03910 62361 60901 gene locus_tag LOCUS_03920 62361 60901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 63055 62342 gene locus_tag LOCUS_03930 63055 62342 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_03930 63230 63682 gene locus_tag LOCUS_03940 63230 63682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 63815 64894 gene locus_tag LOCUS_03950 63815 64894 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762418.1 protein_id gnl|my_center|LOCUS_03950 65760 65050 gene locus_tag LOCUS_03960 65760 65050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 65949 66638 gene locus_tag LOCUS_03970 65949 66638 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 protein_id gnl|my_center|LOCUS_03970 66638 68224 gene locus_tag LOCUS_03980 66638 68224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 68302 69795 gene locus_tag LOCUS_03990 68302 69795 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257833.1 protein_id gnl|my_center|LOCUS_03990 69792 70847 gene locus_tag LOCUS_04000 gene asd 69792 70847 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_04000 70975 72363 gene locus_tag LOCUS_04010 gene secD 70975 72363 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258879.1 protein_id gnl|my_center|LOCUS_04010 72373 73302 gene locus_tag LOCUS_04020 gene secF 72373 73302 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_04020 74293 73538 gene locus_tag LOCUS_04030 74293 73538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 74516 74304 gene locus_tag LOCUS_04040 74516 74304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 74751 74533 gene locus_tag LOCUS_04050 74751 74533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 75981 74773 gene locus_tag LOCUS_04060 gene ftsZ 75981 74773 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888987.1 protein_id gnl|my_center|LOCUS_04060 77343 75985 gene locus_tag LOCUS_04070 77343 75985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 77438 78325 gene locus_tag LOCUS_04080 77438 78325 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143624.1 protein_id gnl|my_center|LOCUS_04080 78334 79761 gene locus_tag LOCUS_04090 78334 79761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 83180 79725 gene locus_tag LOCUS_04100 83180 79725 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957290.1 protein_id gnl|my_center|LOCUS_04100 83814 83254 gene locus_tag LOCUS_04110 83814 83254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 85274 84117 gene locus_tag LOCUS_04120 85274 84117 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_04120 85762 85400 gene locus_tag LOCUS_04130 85762 85400 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_04130 85934 87397 gene locus_tag LOCUS_04140 85934 87397 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926839.1 protein_id gnl|my_center|LOCUS_04140 87419 88054 gene locus_tag LOCUS_04150 87419 88054 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_04150 88243 89196 gene locus_tag LOCUS_04160 gene trxB 88243 89196 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_04160 90385 89231 gene locus_tag LOCUS_04170 90385 89231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 90465 91697 gene locus_tag LOCUS_04180 gene hemW 90465 91697 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143078.1 protein_id gnl|my_center|LOCUS_04180 92752 91703 gene locus_tag LOCUS_04190 92752 91703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 92846 93664 gene locus_tag LOCUS_04200 92846 93664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 93786 94307 gene locus_tag LOCUS_04210 93786 94307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 95492 94353 gene locus_tag LOCUS_04220 95492 94353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 95762 97513 gene locus_tag LOCUS_04230 95762 97513 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_04230 97697 98443 gene locus_tag LOCUS_04240 97697 98443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 99626 99342 gene locus_tag LOCUS_04250 99626 99342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 101613 102617 gene locus_tag LOCUS_04260 101613 102617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 104736 105353 gene locus_tag LOCUS_04270 104736 105353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 106381 106193 gene locus_tag LOCUS_04280 106381 106193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 107442 108290 gene locus_tag LOCUS_04290 107442 108290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 108497 109282 gene locus_tag LOCUS_04300 108497 109282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 >Feature sequence04 3695 765 gene locus_tag LOCUS_04310 gene purL 3695 765 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678781.1 protein_id gnl|my_center|LOCUS_04310 5229 3820 gene locus_tag LOCUS_04320 gene purB 5229 3820 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_04320 6037 5387 gene locus_tag LOCUS_04330 6037 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 6665 7708 gene locus_tag LOCUS_04340 6665 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 7771 8151 gene locus_tag LOCUS_04350 7771 8151 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687566.1 protein_id gnl|my_center|LOCUS_04350 8210 9250 gene locus_tag LOCUS_04360 8210 9250 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258698.1 protein_id gnl|my_center|LOCUS_04360 9258 10070 gene locus_tag LOCUS_04370 9258 10070 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258699.1 protein_id gnl|my_center|LOCUS_04370 10067 10882 gene locus_tag LOCUS_04380 10067 10882 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258699.1 protein_id gnl|my_center|LOCUS_04380 10875 12347 gene locus_tag LOCUS_04390 gene rsmF 10875 12347 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927794.1 protein_id gnl|my_center|LOCUS_04390 13028 12342 gene locus_tag LOCUS_04400 13028 12342 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080236.1 protein_id gnl|my_center|LOCUS_04400 13822 13052 gene locus_tag LOCUS_04410 13822 13052 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257708.1 protein_id gnl|my_center|LOCUS_04410 14493 13819 gene locus_tag LOCUS_04420 14493 13819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 15850 14615 gene locus_tag LOCUS_04430 gene metK 15850 14615 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_04430 17878 16268 gene locus_tag LOCUS_04440 17878 16268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 18050 18733 gene locus_tag LOCUS_04450 18050 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 18785 19525 gene locus_tag LOCUS_04460 18785 19525 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660871.1 protein_id gnl|my_center|LOCUS_04460 19522 21618 gene locus_tag LOCUS_04470 19522 21618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 21721 22176 gene locus_tag LOCUS_04480 21721 22176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 22181 23239 gene locus_tag LOCUS_04490 22181 23239 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_04490 23241 24311 gene locus_tag LOCUS_04500 23241 24311 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811665.1 protein_id gnl|my_center|LOCUS_04500 24345 25340 gene locus_tag LOCUS_04510 24345 25340 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_04510 25341 26624 gene locus_tag LOCUS_04520 25341 26624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 26643 26957 gene locus_tag LOCUS_04530 26643 26957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 27069 28475 gene locus_tag LOCUS_04540 27069 28475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 29596 28538 gene locus_tag LOCUS_04550 29596 28538 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_04550 29916 30431 gene locus_tag LOCUS_04560 29916 30431 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228008.1 protein_id gnl|my_center|LOCUS_04560 31485 30439 gene locus_tag LOCUS_04570 31485 30439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 32615 31482 gene locus_tag LOCUS_04580 gene wecB 32615 31482 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942883.1 protein_id gnl|my_center|LOCUS_04580 33918 32641 gene locus_tag LOCUS_04590 33918 32641 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869927.1 protein_id gnl|my_center|LOCUS_04590 34046 34552 gene locus_tag LOCUS_04600 34046 34552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 34600 36813 gene locus_tag LOCUS_04610 34600 36813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 36861 39656 gene locus_tag LOCUS_04620 gene polA 36861 39656 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256248.1 protein_id gnl|my_center|LOCUS_04620 39681 41957 gene locus_tag LOCUS_04630 39681 41957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 42031 42104 gene locus_tag LOCUS_t00040 42031 42104 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 43620 43267 gene locus_tag LOCUS_04640 43620 43267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 43850 43659 gene locus_tag LOCUS_04650 43850 43659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 44579 43878 gene locus_tag LOCUS_04660 gene tatC 44579 43878 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259255.1 protein_id gnl|my_center|LOCUS_04660 45399 44638 gene locus_tag LOCUS_04670 45399 44638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 46389 45505 gene locus_tag LOCUS_04680 46389 45505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 47180 46386 gene locus_tag LOCUS_04690 47180 46386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 48065 47538 gene locus_tag LOCUS_04700 48065 47538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 48598 48080 gene locus_tag LOCUS_04710 48598 48080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 49415 48627 gene locus_tag LOCUS_04720 49415 48627 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359187.1 protein_id gnl|my_center|LOCUS_04720 50484 49417 gene locus_tag LOCUS_04730 50484 49417 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878541.1 protein_id gnl|my_center|LOCUS_04730 50845 50489 gene locus_tag LOCUS_04740 50845 50489 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870063.1 protein_id gnl|my_center|LOCUS_04740 51364 50867 gene locus_tag LOCUS_04750 51364 50867 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868668.1 protein_id gnl|my_center|LOCUS_04750 51981 51361 gene locus_tag LOCUS_04760 51981 51361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 54126 51988 gene locus_tag LOCUS_04770 54126 51988 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392263.1 protein_id gnl|my_center|LOCUS_04770 54727 54395 gene locus_tag LOCUS_04780 54727 54395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 55035 54736 gene locus_tag LOCUS_04790 55035 54736 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392518.1 protein_id gnl|my_center|LOCUS_04790 56384 55038 gene locus_tag LOCUS_04800 56384 55038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 58007 56421 gene locus_tag LOCUS_04810 58007 56421 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817180.1 protein_id gnl|my_center|LOCUS_04810 58492 58082 gene locus_tag LOCUS_04820 58492 58082 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_04820 58942 58502 gene locus_tag LOCUS_04830 58942 58502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 60234 58954 gene locus_tag LOCUS_04840 60234 58954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 60640 60239 gene locus_tag LOCUS_04850 gene flgB 60640 60239 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_04850 61197 60655 gene locus_tag LOCUS_04860 61197 60655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 61663 61178 gene locus_tag LOCUS_04870 61663 61178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 62993 61653 gene locus_tag LOCUS_04880 gene fliI 62993 61653 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_04880 63943 62990 gene locus_tag LOCUS_04890 63943 62990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 64946 63924 gene locus_tag LOCUS_04900 gene fliG 64946 63924 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_04900 66594 64939 gene locus_tag LOCUS_04910 gene fliF 66594 64939 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870079.1 protein_id gnl|my_center|LOCUS_04910 66937 66632 gene locus_tag LOCUS_04920 gene fliE 66937 66632 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420363.1 protein_id gnl|my_center|LOCUS_04920 67409 66957 gene locus_tag LOCUS_04930 gene flgC 67409 66957 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986962.1 protein_id gnl|my_center|LOCUS_04930 67978 67619 gene locus_tag LOCUS_04940 67978 67619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 68368 68075 gene locus_tag LOCUS_04950 68368 68075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 68844 68554 gene locus_tag LOCUS_04960 68844 68554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 69335 69045 gene locus_tag LOCUS_04970 69335 69045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 71144 69408 gene locus_tag LOCUS_04980 71144 69408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 72492 71248 gene locus_tag LOCUS_04990 72492 71248 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405342.1 protein_id gnl|my_center|LOCUS_04990 72813 74219 gene locus_tag LOCUS_05000 72813 74219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 74206 75273 gene locus_tag LOCUS_05010 74206 75273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 75278 76636 gene locus_tag LOCUS_05020 75278 76636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 77559 76684 gene locus_tag LOCUS_05030 77559 76684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 77661 78641 gene locus_tag LOCUS_05040 77661 78641 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_05040 79502 78678 gene locus_tag LOCUS_05050 79502 78678 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258680.1 protein_id gnl|my_center|LOCUS_05050 80122 79547 gene locus_tag LOCUS_05060 80122 79547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 81267 80119 gene locus_tag LOCUS_05070 81267 80119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 82955 81264 gene locus_tag LOCUS_05080 82955 81264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 83362 83069 gene locus_tag LOCUS_05090 gene csrA 83362 83069 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965507.1 protein_id gnl|my_center|LOCUS_05090 84404 83436 gene locus_tag LOCUS_05100 84404 83436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 86219 84420 gene locus_tag LOCUS_05110 gene flgK 86219 84420 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545686.1 protein_id gnl|my_center|LOCUS_05110 86764 86231 gene locus_tag LOCUS_05120 86764 86231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 87133 86828 gene locus_tag LOCUS_05130 87133 86828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 87939 87199 gene locus_tag LOCUS_05140 gene flgG 87939 87199 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405355.1 protein_id gnl|my_center|LOCUS_05140 88747 87956 gene locus_tag LOCUS_05150 gene flgF 88747 87956 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937818.1 protein_id gnl|my_center|LOCUS_05150 89136 88744 gene locus_tag LOCUS_05160 89136 88744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 90019 89150 gene locus_tag LOCUS_05170 90019 89150 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223860.1 protein_id gnl|my_center|LOCUS_05170 90389 90027 gene locus_tag LOCUS_05180 90389 90027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 91810 90389 gene locus_tag LOCUS_05190 91810 90389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 93936 91807 gene locus_tag LOCUS_05200 gene flhA 93936 91807 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_05200 95022 93949 gene locus_tag LOCUS_05210 95022 93949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05210 95787 95026 gene locus_tag LOCUS_05220 gene fliR 95787 95026 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816212.1 protein_id gnl|my_center|LOCUS_05220 96285 95902 gene locus_tag LOCUS_05230 96285 95902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 97169 96294 gene locus_tag LOCUS_05240 97169 96294 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_05240 97454 97185 gene locus_tag LOCUS_05250 gene fliQ 97454 97185 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392308.1 protein_id gnl|my_center|LOCUS_05250 98277 97459 gene locus_tag LOCUS_05260 gene fliP 98277 97459 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_05260 98776 98264 gene locus_tag LOCUS_05270 98776 98264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 99191 98781 gene locus_tag LOCUS_05280 99191 98781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 100240 99188 gene locus_tag LOCUS_05290 gene fliM 100240 99188 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220879.1 protein_id gnl|my_center|LOCUS_05290 100987 100259 gene locus_tag LOCUS_05300 100987 100259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 101784 100984 gene locus_tag LOCUS_05310 101784 100984 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_05310 102602 101781 gene locus_tag LOCUS_05320 102602 101781 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_05320 102819 102604 gene locus_tag LOCUS_05330 102819 102604 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816224.1 protein_id gnl|my_center|LOCUS_05330 105008 102933 gene locus_tag LOCUS_05340 105008 102933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 105841 105053 gene locus_tag LOCUS_05350 105841 105053 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_05350 >Feature sequence05 560 1597 gene locus_tag LOCUS_05360 560 1597 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_05360 1674 3173 gene locus_tag LOCUS_05370 gene xylB 1674 3173 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_05370 3203 5344 gene locus_tag LOCUS_05380 3203 5344 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_05380 5718 6749 gene locus_tag LOCUS_05390 5718 6749 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311173.1 protein_id gnl|my_center|LOCUS_05390 6845 8140 gene locus_tag LOCUS_05400 6845 8140 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310853.1 protein_id gnl|my_center|LOCUS_05400 8326 9270 gene locus_tag LOCUS_05410 8326 9270 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_05410 9284 10153 gene locus_tag LOCUS_05420 9284 10153 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226353.1 protein_id gnl|my_center|LOCUS_05420 10239 11732 gene locus_tag LOCUS_05430 10239 11732 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975886.1 protein_id gnl|my_center|LOCUS_05430 12773 11781 gene locus_tag LOCUS_05440 12773 11781 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704926.1 protein_id gnl|my_center|LOCUS_05440 13940 12792 gene locus_tag LOCUS_05450 13940 12792 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339534.1 protein_id gnl|my_center|LOCUS_05450 14858 13953 gene locus_tag LOCUS_05460 14858 13953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869315.1 protein_id gnl|my_center|LOCUS_05460 15918 14842 gene locus_tag LOCUS_05470 15918 14842 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_05470 17432 15918 gene locus_tag LOCUS_05480 17432 15918 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865052.1 protein_id gnl|my_center|LOCUS_05480 18625 17513 gene locus_tag LOCUS_05490 18625 17513 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969290.1 protein_id gnl|my_center|LOCUS_05490 19587 18751 gene locus_tag LOCUS_05500 19587 18751 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142640.1 protein_id gnl|my_center|LOCUS_05500 20430 19600 gene locus_tag LOCUS_05510 20430 19600 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 protein_id gnl|my_center|LOCUS_05510 21244 20483 gene locus_tag LOCUS_05520 gene nagR 21244 20483 CDS product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 protein_id gnl|my_center|LOCUS_05520 22007 21495 gene locus_tag LOCUS_05530 22007 21495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 22868 22077 gene locus_tag LOCUS_05540 22868 22077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 24079 22865 gene locus_tag LOCUS_05550 24079 22865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 24328 25086 gene locus_tag LOCUS_05560 24328 25086 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057760.1 protein_id gnl|my_center|LOCUS_05560 25441 25755 gene locus_tag LOCUS_05570 25441 25755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 26464 25892 gene locus_tag LOCUS_05580 26464 25892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 26676 26588 gene locus_tag LOCUS_t00050 26676 26588 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 26801 26715 gene locus_tag LOCUS_t00060 26801 26715 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28731 26890 gene locus_tag LOCUS_05590 28731 26890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 29742 28759 gene locus_tag LOCUS_05600 29742 28759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 31314 29761 gene locus_tag LOCUS_05610 gene guaA 31314 29761 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256861.1 protein_id gnl|my_center|LOCUS_05610 31407 32297 gene locus_tag LOCUS_05620 31407 32297 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_05620 32301 33206 gene locus_tag LOCUS_05630 gene pstC 32301 33206 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_05630 33216 34076 gene locus_tag LOCUS_05640 gene pstA 33216 34076 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538554.1 protein_id gnl|my_center|LOCUS_05640 34080 34835 gene locus_tag LOCUS_05650 gene pstB 34080 34835 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_05650 35782 34847 gene locus_tag LOCUS_05660 35782 34847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 36188 37231 gene locus_tag LOCUS_05670 gene cobT 36188 37231 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_05670 37228 37956 gene locus_tag LOCUS_05680 gene cobS 37228 37956 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943638.1 protein_id gnl|my_center|LOCUS_05680 37943 38740 gene locus_tag LOCUS_05690 gene cbiR 37943 38740 CDS product cobamide remodeling phosphodiesterase CbiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932624.1 protein_id gnl|my_center|LOCUS_05690 38746 39288 gene locus_tag LOCUS_05700 gene cobU 38746 39288 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_05700 39416 39724 gene locus_tag LOCUS_05710 39416 39724 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896874.1 protein_id gnl|my_center|LOCUS_05710 39820 39951 gene locus_tag LOCUS_05720 39820 39951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 40009 41007 gene locus_tag LOCUS_05730 40009 41007 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_05730 41004 42305 gene locus_tag LOCUS_05740 41004 42305 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_05740 42734 44092 gene locus_tag LOCUS_05750 gene dnaA 42734 44092 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_05750 44293 45549 gene locus_tag LOCUS_05760 44293 45549 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_05760 45559 46926 gene locus_tag LOCUS_05770 gene argH 45559 46926 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529410.1 protein_id gnl|my_center|LOCUS_05770 47442 47032 gene locus_tag LOCUS_05780 47442 47032 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861328.1 protein_id gnl|my_center|LOCUS_05780 48092 49090 gene locus_tag LOCUS_05790 48092 49090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05790 49196 49369 gene locus_tag LOCUS_05800 49196 49369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 49375 50118 gene locus_tag LOCUS_05810 49375 50118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05810 50190 50645 gene locus_tag LOCUS_05820 50190 50645 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_05820 52334 50733 gene locus_tag LOCUS_05830 52334 50733 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_05830 53140 52433 gene locus_tag LOCUS_05840 53140 52433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 54144 53137 gene locus_tag LOCUS_05850 54144 53137 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259106.1 protein_id gnl|my_center|LOCUS_05850 54546 55463 gene locus_tag LOCUS_05860 gene metA 54546 55463 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_05860 55598 56890 gene locus_tag LOCUS_05870 55598 56890 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_05870 57141 57890 gene locus_tag LOCUS_05880 57141 57890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 57900 59144 gene locus_tag LOCUS_05890 57900 59144 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_05890 59174 59491 gene locus_tag LOCUS_05900 59174 59491 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808391.1 protein_id gnl|my_center|LOCUS_05900 59529 60029 gene locus_tag LOCUS_05910 59529 60029 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_05910 60165 60968 gene locus_tag LOCUS_05920 60165 60968 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933215.1 protein_id gnl|my_center|LOCUS_05920 60965 61762 gene locus_tag LOCUS_05930 60965 61762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 61765 63378 gene locus_tag LOCUS_05940 61765 63378 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_05940 63516 64067 gene locus_tag LOCUS_05950 63516 64067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 64133 65011 gene locus_tag LOCUS_05960 64133 65011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 65661 65017 gene locus_tag LOCUS_05970 65661 65017 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_05970 65975 67222 gene locus_tag LOCUS_05980 65975 67222 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529685.1 protein_id gnl|my_center|LOCUS_05980 67353 68279 gene locus_tag LOCUS_05990 67353 68279 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529194.1 protein_id gnl|my_center|LOCUS_05990 68276 69070 gene locus_tag LOCUS_06000 68276 69070 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388257.1 protein_id gnl|my_center|LOCUS_06000 69096 70145 gene locus_tag LOCUS_06010 69096 70145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972096.1 protein_id gnl|my_center|LOCUS_06010 71039 70203 gene locus_tag LOCUS_06020 71039 70203 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703877.1 protein_id gnl|my_center|LOCUS_06020 72196 71075 gene locus_tag LOCUS_06030 gene phnW 72196 71075 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507026.1 protein_id gnl|my_center|LOCUS_06030 73380 72343 gene locus_tag LOCUS_06040 73380 72343 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_06040 74868 73513 gene locus_tag LOCUS_06050 gene gdhA 74868 73513 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094817.1 protein_id gnl|my_center|LOCUS_06050 76624 74975 gene locus_tag LOCUS_06060 76624 74975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 77996 76707 gene locus_tag LOCUS_06070 77996 76707 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_06070 78718 78008 gene locus_tag LOCUS_06080 78718 78008 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_06080 80382 78895 gene locus_tag LOCUS_06090 80382 78895 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_06090 85048 80399 gene locus_tag LOCUS_06100 gene gltB 85048 80399 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_06100 85773 86699 gene locus_tag LOCUS_06110 85773 86699 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_06110 86701 87369 gene locus_tag LOCUS_06120 86701 87369 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255947.1 protein_id gnl|my_center|LOCUS_06120 87876 87379 gene locus_tag LOCUS_06130 gene nrdG 87876 87379 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_06130 89976 87889 gene locus_tag LOCUS_06140 89976 87889 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963802.1 protein_id gnl|my_center|LOCUS_06140 92362 90050 gene locus_tag LOCUS_06150 gene metE 92362 90050 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216166.1 protein_id gnl|my_center|LOCUS_06150 94149 92713 gene locus_tag LOCUS_06160 94149 92713 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_06160 94832 94146 gene locus_tag LOCUS_06170 94832 94146 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259684.1 protein_id gnl|my_center|LOCUS_06170 95059 95565 gene locus_tag LOCUS_06180 95059 95565 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257468.1 protein_id gnl|my_center|LOCUS_06180 95582 95920 gene locus_tag LOCUS_06190 95582 95920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 96316 96005 gene locus_tag LOCUS_06200 96316 96005 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 protein_id gnl|my_center|LOCUS_06200 97275 96313 gene locus_tag LOCUS_06210 97275 96313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 98430 97312 gene locus_tag LOCUS_06220 98430 97312 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259270.1 protein_id gnl|my_center|LOCUS_06220 98875 98441 gene locus_tag LOCUS_06230 98875 98441 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_06230 99235 98879 gene locus_tag LOCUS_06240 99235 98879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 100808 99258 gene locus_tag LOCUS_06250 100808 99258 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_06250 103462 101015 gene locus_tag LOCUS_06260 103462 101015 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_06260 104678 103731 gene locus_tag LOCUS_06270 104678 103731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080075.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence06 1830 799 gene locus_tag LOCUS_06280 1830 799 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598716.1 protein_id gnl|my_center|LOCUS_06280 2121 1924 gene locus_tag LOCUS_06290 2121 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 2590 2147 gene locus_tag LOCUS_06300 2590 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3777 2623 gene locus_tag LOCUS_06310 gene rffA 3777 2623 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211981.1 protein_id gnl|my_center|LOCUS_06310 4418 3777 gene locus_tag LOCUS_06320 4418 3777 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902091.1 protein_id gnl|my_center|LOCUS_06320 5119 4427 gene locus_tag LOCUS_06330 5119 4427 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390554.1 protein_id gnl|my_center|LOCUS_06330 6066 5116 gene locus_tag LOCUS_06340 6066 5116 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_06340 8117 6063 gene locus_tag LOCUS_06350 8117 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 8762 8208 gene locus_tag LOCUS_06360 8762 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 9425 8787 gene locus_tag LOCUS_06370 gene udk 9425 8787 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257573.1 protein_id gnl|my_center|LOCUS_06370 9529 12486 gene locus_tag LOCUS_06380 9529 12486 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022840.1 protein_id gnl|my_center|LOCUS_06380 12558 12485 gene locus_tag LOCUS_t00070 12558 12485 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12606 13892 gene locus_tag LOCUS_06390 12606 13892 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257201.1 protein_id gnl|my_center|LOCUS_06390 15101 13914 gene locus_tag LOCUS_06400 gene dinB 15101 13914 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_06400 15743 17479 gene locus_tag LOCUS_06410 15743 17479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 17788 17600 gene locus_tag LOCUS_06420 17788 17600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 18186 17803 gene locus_tag LOCUS_06430 18186 17803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 19253 18183 gene locus_tag LOCUS_06440 19253 18183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 20160 19537 gene locus_tag LOCUS_06450 20160 19537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 21118 20411 gene locus_tag LOCUS_06460 21118 20411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_06460 21905 21108 gene locus_tag LOCUS_06470 21905 21108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_06470 23289 21922 gene locus_tag LOCUS_06480 23289 21922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 24431 23301 gene locus_tag LOCUS_06490 24431 23301 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_06490 25696 24521 gene locus_tag LOCUS_06500 25696 24521 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_06500 26083 26484 gene locus_tag LOCUS_06510 26083 26484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 27269 26595 gene locus_tag LOCUS_06520 27269 26595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 27797 28132 gene locus_tag LOCUS_06530 27797 28132 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883149.1 protein_id gnl|my_center|LOCUS_06530 28138 28569 gene locus_tag LOCUS_06540 28138 28569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 28566 32366 gene locus_tag LOCUS_06550 28566 32366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 32400 33056 gene locus_tag LOCUS_06560 32400 33056 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080009.1 protein_id gnl|my_center|LOCUS_06560 33454 33053 gene locus_tag LOCUS_06570 33454 33053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 33637 33551 gene locus_tag LOCUS_t00080 33637 33551 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33765 34481 gene locus_tag LOCUS_06580 gene ubiE 33765 34481 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_06580 37605 34498 gene locus_tag LOCUS_06590 37605 34498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 38704 37799 gene locus_tag LOCUS_06600 gene rarD 38704 37799 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535539.1 protein_id gnl|my_center|LOCUS_06600 38937 39857 gene locus_tag LOCUS_06610 gene ppk2 38937 39857 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460167.1 protein_id gnl|my_center|LOCUS_06610 41347 40079 gene locus_tag LOCUS_06620 41347 40079 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769298.1 protein_id gnl|my_center|LOCUS_06620 41937 41344 gene locus_tag LOCUS_06630 41937 41344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 42433 42729 gene locus_tag LOCUS_06640 42433 42729 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920707.1 protein_id gnl|my_center|LOCUS_06640 42983 43432 gene locus_tag LOCUS_06650 42983 43432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 43804 43514 gene locus_tag LOCUS_06660 43804 43514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 43930 43852 gene locus_tag LOCUS_t00090 43930 43852 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 44811 43912 gene locus_tag LOCUS_06670 44811 43912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 44902 45504 gene locus_tag LOCUS_06680 44902 45504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 45845 45600 gene locus_tag LOCUS_06690 45845 45600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 46060 45854 gene locus_tag LOCUS_06700 46060 45854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 46392 46057 gene locus_tag LOCUS_06710 46392 46057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 47625 47553 gene locus_tag LOCUS_t00100 47625 47553 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 47800 47979 gene locus_tag LOCUS_06720 47800 47979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 47976 48962 gene locus_tag LOCUS_06730 gene trpS 47976 48962 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_06730 48966 49406 gene locus_tag LOCUS_06740 gene dtd 48966 49406 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_06740 50178 49432 gene locus_tag LOCUS_06750 50178 49432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 50852 50178 gene locus_tag LOCUS_06760 50852 50178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 50914 51945 gene locus_tag LOCUS_06770 50914 51945 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904083.1 protein_id gnl|my_center|LOCUS_06770 51950 53317 gene locus_tag LOCUS_06780 51950 53317 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403748.1 protein_id gnl|my_center|LOCUS_06780 53321 53974 gene locus_tag LOCUS_06790 53321 53974 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014086.1 protein_id gnl|my_center|LOCUS_06790 55483 53999 gene locus_tag LOCUS_06800 55483 53999 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258467.1 protein_id gnl|my_center|LOCUS_06800 55680 57449 gene locus_tag LOCUS_06810 55680 57449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 57577 58647 gene locus_tag LOCUS_06820 gene gmd 57577 58647 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546080.1 protein_id gnl|my_center|LOCUS_06820 59495 58680 gene locus_tag LOCUS_06830 59495 58680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 protein_id gnl|my_center|LOCUS_06830 60682 59492 gene locus_tag LOCUS_06840 60682 59492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 62951 60699 gene locus_tag LOCUS_06850 62951 60699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 63646 62969 gene locus_tag LOCUS_06860 63646 62969 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643709.1 protein_id gnl|my_center|LOCUS_06860 64494 63727 gene locus_tag LOCUS_06870 64494 63727 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 protein_id gnl|my_center|LOCUS_06870 67991 64920 gene locus_tag LOCUS_06880 67991 64920 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 protein_id gnl|my_center|LOCUS_06880 68636 71098 gene locus_tag LOCUS_06890 68636 71098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 72294 71089 gene locus_tag LOCUS_06900 72294 71089 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_06900 72891 72310 gene locus_tag LOCUS_06910 72891 72310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 72941 73216 gene locus_tag LOCUS_06920 72941 73216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 75944 73254 gene locus_tag LOCUS_06930 gene acnA 75944 73254 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888355.1 protein_id gnl|my_center|LOCUS_06930 77249 75954 gene locus_tag LOCUS_06940 77249 75954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 77376 78164 gene locus_tag LOCUS_06950 77376 78164 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_06950 78168 79496 gene locus_tag LOCUS_06960 78168 79496 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_06960 79502 80635 gene locus_tag LOCUS_06970 gene proB 79502 80635 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909083.1 protein_id gnl|my_center|LOCUS_06970 80640 81908 gene locus_tag LOCUS_06980 80640 81908 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483082.1 protein_id gnl|my_center|LOCUS_06980 82263 82087 gene locus_tag LOCUS_06990 82263 82087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 82418 84280 gene locus_tag LOCUS_07000 82418 84280 CDS product DUF4914 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583124.1 protein_id gnl|my_center|LOCUS_07000 85060 84284 gene locus_tag LOCUS_07010 85060 84284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 85264 86082 gene locus_tag LOCUS_07020 85264 86082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 86063 86707 gene locus_tag LOCUS_07030 86063 86707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 87733 86750 gene locus_tag LOCUS_07040 87733 86750 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_07040 88256 88083 gene locus_tag LOCUS_07050 88256 88083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 88491 88246 gene locus_tag LOCUS_07060 88491 88246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 89212 88556 gene locus_tag LOCUS_07070 89212 88556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 89728 89228 gene locus_tag LOCUS_07080 89728 89228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 89893 90273 gene locus_tag LOCUS_07090 89893 90273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 91130 90339 gene locus_tag LOCUS_07100 91130 90339 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259154.1 protein_id gnl|my_center|LOCUS_07100 91923 91132 gene locus_tag LOCUS_07110 91923 91132 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259153.1 protein_id gnl|my_center|LOCUS_07110 92912 91920 gene locus_tag LOCUS_07120 92912 91920 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259152.1 protein_id gnl|my_center|LOCUS_07120 95581 93041 gene locus_tag LOCUS_07130 95581 93041 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814441.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence07 1325 405 gene locus_tag LOCUS_07140 1325 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1775 1897 gene locus_tag LOCUS_07150 1775 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2909 1989 gene locus_tag LOCUS_07160 2909 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3685 5118 gene locus_tag LOCUS_07170 3685 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 5133 7379 gene locus_tag LOCUS_07180 5133 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 7637 7562 gene locus_tag LOCUS_t00110 7637 7562 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7873 8823 gene locus_tag LOCUS_07190 gene gldA 7873 8823 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_07190 8841 9572 gene locus_tag LOCUS_07200 8841 9572 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_07200 9572 11116 gene locus_tag LOCUS_07210 9572 11116 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_07210 11121 11708 gene locus_tag LOCUS_07220 11121 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 11819 13033 gene locus_tag LOCUS_07230 gene rpoD 11819 13033 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_07230 13150 16686 gene locus_tag LOCUS_07240 13150 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 16719 17174 gene locus_tag LOCUS_07250 gene ndk 16719 17174 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_07250 17290 19152 gene locus_tag LOCUS_07260 gene ftsH 17290 19152 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_07260 20123 19200 gene locus_tag LOCUS_07270 gene miaA 20123 19200 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_07270 20500 20120 gene locus_tag LOCUS_07280 20500 20120 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_07280 21399 20497 gene locus_tag LOCUS_07290 21399 20497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 21720 22868 gene locus_tag LOCUS_07300 21720 22868 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257079.1 protein_id gnl|my_center|LOCUS_07300 22888 24867 gene locus_tag LOCUS_07310 22888 24867 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257772.1 protein_id gnl|my_center|LOCUS_07310 24893 26374 gene locus_tag LOCUS_07320 gene glgA 24893 26374 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697284.1 protein_id gnl|my_center|LOCUS_07320 26497 28017 gene locus_tag LOCUS_07330 gene malQ 26497 28017 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_07330 28986 28024 gene locus_tag LOCUS_07340 28986 28024 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_07340 29074 29673 gene locus_tag LOCUS_07350 29074 29673 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295401.1 protein_id gnl|my_center|LOCUS_07350 29704 30114 gene locus_tag LOCUS_07360 29704 30114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 30242 31684 gene locus_tag LOCUS_07370 30242 31684 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909061.1 protein_id gnl|my_center|LOCUS_07370 32474 31695 gene locus_tag LOCUS_07380 32474 31695 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_07380 33645 32491 gene locus_tag LOCUS_07390 gene mltG 33645 32491 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_07390 34061 33651 gene locus_tag LOCUS_07400 gene ruvX 34061 33651 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186163.1 protein_id gnl|my_center|LOCUS_07400 35566 34058 gene locus_tag LOCUS_07410 35566 34058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 36153 35563 gene locus_tag LOCUS_07420 36153 35563 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_07420 36203 37018 gene locus_tag LOCUS_07430 36203 37018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 37115 39220 gene locus_tag LOCUS_07440 37115 39220 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920752.1 protein_id gnl|my_center|LOCUS_07440 39210 41441 gene locus_tag LOCUS_07450 39210 41441 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143631.1 protein_id gnl|my_center|LOCUS_07450 41425 42252 gene locus_tag LOCUS_07460 41425 42252 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056927.1 protein_id gnl|my_center|LOCUS_07460 42256 44589 gene locus_tag LOCUS_07470 42256 44589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 44745 45029 gene locus_tag LOCUS_07480 gene rpsF 44745 45029 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_07480 45073 45477 gene locus_tag LOCUS_07490 45073 45477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 45490 45774 gene locus_tag LOCUS_07500 45490 45774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 45849 47153 gene locus_tag LOCUS_07510 45849 47153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 50822 47214 gene locus_tag LOCUS_07520 gene smc 50822 47214 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258775.1 protein_id gnl|my_center|LOCUS_07520 51638 50832 gene locus_tag LOCUS_07530 gene rnc 51638 50832 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_07530 52743 51649 gene locus_tag LOCUS_07540 52743 51649 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 protein_id gnl|my_center|LOCUS_07540 52877 53644 gene locus_tag LOCUS_07550 52877 53644 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259072.1 protein_id gnl|my_center|LOCUS_07550 53687 54337 gene locus_tag LOCUS_07560 53687 54337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559189.1 protein_id gnl|my_center|LOCUS_07560 54346 56940 gene locus_tag LOCUS_07570 gene mutS 54346 56940 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583439.1 protein_id gnl|my_center|LOCUS_07570 57952 56927 gene locus_tag LOCUS_07580 57952 56927 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257871.1 protein_id gnl|my_center|LOCUS_07580 58872 57955 gene locus_tag LOCUS_07590 gene fmt 58872 57955 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004473.1 protein_id gnl|my_center|LOCUS_07590 59093 59431 gene locus_tag LOCUS_07600 59093 59431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 60555 59479 gene locus_tag LOCUS_07610 60555 59479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 60693 60956 gene locus_tag LOCUS_07620 60693 60956 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257693.1 protein_id gnl|my_center|LOCUS_07620 61222 60953 gene locus_tag LOCUS_07630 61222 60953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 62079 61228 gene locus_tag LOCUS_07640 62079 61228 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_07640 62633 62076 gene locus_tag LOCUS_07650 62633 62076 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964817.1 protein_id gnl|my_center|LOCUS_07650 65111 62697 gene locus_tag LOCUS_07660 65111 62697 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257474.1 protein_id gnl|my_center|LOCUS_07660 65190 66026 gene locus_tag LOCUS_07670 65190 66026 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_07670 66239 69373 gene locus_tag LOCUS_07680 66239 69373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 69397 70617 gene locus_tag LOCUS_07690 69397 70617 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806995.1 protein_id gnl|my_center|LOCUS_07690 72406 70673 gene locus_tag LOCUS_07700 72406 70673 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_07700 73232 72534 gene locus_tag LOCUS_07710 73232 72534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 73453 74019 gene locus_tag LOCUS_07720 73453 74019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 74016 74597 gene locus_tag LOCUS_07730 74016 74597 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815839.1 protein_id gnl|my_center|LOCUS_07730 74616 75701 gene locus_tag LOCUS_07740 74616 75701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 80022 75790 gene locus_tag LOCUS_07750 gene rpoC 80022 75790 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773568.1 protein_id gnl|my_center|LOCUS_07750 83384 80163 gene locus_tag LOCUS_07760 83384 80163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 84700 83447 gene locus_tag LOCUS_07770 84700 83447 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 protein_id gnl|my_center|LOCUS_07770 85405 84704 gene locus_tag LOCUS_07780 gene cmk 85405 84704 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_07780 87140 85413 gene locus_tag LOCUS_07790 87140 85413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 89761 87152 gene locus_tag LOCUS_07800 89761 87152 CDS product DUF2298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141612405.1 protein_id gnl|my_center|LOCUS_07800 90111 89767 gene locus_tag LOCUS_07810 90111 89767 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886888.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence08 53 292 gene locus_tag LOCUS_07820 53 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 993 2837 gene locus_tag LOCUS_07830 993 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 2957 3589 gene locus_tag LOCUS_07840 2957 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 3665 4177 gene locus_tag LOCUS_07850 3665 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 4247 4612 gene locus_tag LOCUS_07860 4247 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 4642 5046 gene locus_tag LOCUS_07870 4642 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 5122 6399 gene locus_tag LOCUS_07880 5122 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 10049 6450 gene locus_tag LOCUS_07890 10049 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 11700 10504 gene locus_tag LOCUS_07900 11700 10504 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869039.1 protein_id gnl|my_center|LOCUS_07900 11929 13011 gene locus_tag LOCUS_07910 11929 13011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 13237 14886 gene locus_tag LOCUS_07920 13237 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 15006 15473 gene locus_tag LOCUS_07930 15006 15473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 16447 15551 gene locus_tag LOCUS_07940 gene fakB2 16447 15551 CDS product fatty acid kinase binding subunit FakB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166063.1 protein_id gnl|my_center|LOCUS_07940 16660 17778 gene locus_tag LOCUS_07950 16660 17778 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_07950 17908 18114 gene locus_tag LOCUS_07960 17908 18114 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_07960 18863 18228 gene locus_tag LOCUS_07970 18863 18228 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_07970 20126 18873 gene locus_tag LOCUS_07980 gene hutI 20126 18873 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256863.1 protein_id gnl|my_center|LOCUS_07980 21244 20210 gene locus_tag LOCUS_07990 21244 20210 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259731.1 protein_id gnl|my_center|LOCUS_07990 21210 21419 gene locus_tag LOCUS_08000 21210 21419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 22035 21628 gene locus_tag LOCUS_08010 22035 21628 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_08010 22221 22649 gene locus_tag LOCUS_08020 gene mscL 22221 22649 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_08020 22751 23080 gene locus_tag LOCUS_08030 22751 23080 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193399.1 protein_id gnl|my_center|LOCUS_08030 23213 25219 gene locus_tag LOCUS_08040 23213 25219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 25333 26166 gene locus_tag LOCUS_08050 gene surE 25333 26166 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_08050 27335 26268 gene locus_tag LOCUS_08060 gene ychF 27335 26268 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_08060 27389 27473 gene locus_tag LOCUS_t00120 27389 27473 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28092 27517 gene locus_tag LOCUS_08070 28092 27517 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977283.1 protein_id gnl|my_center|LOCUS_08070 29220 28105 gene locus_tag LOCUS_08080 29220 28105 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256684.1 protein_id gnl|my_center|LOCUS_08080 30074 29400 gene locus_tag LOCUS_08090 30074 29400 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255947.1 protein_id gnl|my_center|LOCUS_08090 30742 30071 gene locus_tag LOCUS_08100 30742 30071 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_08100 32040 30826 gene locus_tag LOCUS_08110 32040 30826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 32803 32180 gene locus_tag LOCUS_08120 gene tmk 32803 32180 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258097.1 protein_id gnl|my_center|LOCUS_08120 34440 32800 gene locus_tag LOCUS_08130 34440 32800 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258096.1 protein_id gnl|my_center|LOCUS_08130 35488 34562 gene locus_tag LOCUS_08140 35488 34562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 36111 35515 gene locus_tag LOCUS_08150 gene pdxT 36111 35515 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_08150 37006 36119 gene locus_tag LOCUS_08160 gene pdxS 37006 36119 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391558.1 protein_id gnl|my_center|LOCUS_08160 37605 37102 gene locus_tag LOCUS_08170 37605 37102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 38372 37596 gene locus_tag LOCUS_08180 38372 37596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065064.1 protein_id gnl|my_center|LOCUS_08180 39376 38369 gene locus_tag LOCUS_08190 39376 38369 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_08190 40065 39496 gene locus_tag LOCUS_08200 40065 39496 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258349.1 protein_id gnl|my_center|LOCUS_08200 40182 41405 gene locus_tag LOCUS_08210 40182 41405 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392878.1 protein_id gnl|my_center|LOCUS_08210 41407 43212 gene locus_tag LOCUS_08220 41407 43212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 43252 43827 gene locus_tag LOCUS_08230 43252 43827 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869658.1 protein_id gnl|my_center|LOCUS_08230 43943 45217 gene locus_tag LOCUS_08240 43943 45217 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_08240 45293 47197 gene locus_tag LOCUS_08250 45293 47197 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_08250 47264 48364 gene locus_tag LOCUS_08260 gene amrS 47264 48364 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409338.1 protein_id gnl|my_center|LOCUS_08260 48506 49285 gene locus_tag LOCUS_08270 48506 49285 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_08270 49282 50394 gene locus_tag LOCUS_08280 49282 50394 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722128.1 protein_id gnl|my_center|LOCUS_08280 50387 52171 gene locus_tag LOCUS_08290 50387 52171 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_08290 53258 52236 gene locus_tag LOCUS_08300 53258 52236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 53487 53299 gene locus_tag LOCUS_08310 53487 53299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 54494 53808 gene locus_tag LOCUS_08320 54494 53808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878142.1 protein_id gnl|my_center|LOCUS_08320 55225 54479 gene locus_tag LOCUS_08330 55225 54479 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082869.1 protein_id gnl|my_center|LOCUS_08330 56250 55222 gene locus_tag LOCUS_08340 56250 55222 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082867.1 protein_id gnl|my_center|LOCUS_08340 56428 58056 gene locus_tag LOCUS_08350 gene nuoF 56428 58056 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_08350 58110 60029 gene locus_tag LOCUS_08360 58110 60029 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_08360 60064 60810 gene locus_tag LOCUS_08370 60064 60810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 63056 60933 gene locus_tag LOCUS_08380 63056 60933 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990677.1 protein_id gnl|my_center|LOCUS_08380 63650 63156 gene locus_tag LOCUS_08390 63650 63156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 64448 63702 gene locus_tag LOCUS_08400 64448 63702 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722392.1 protein_id gnl|my_center|LOCUS_08400 65194 64529 gene locus_tag LOCUS_08410 65194 64529 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605277.1 protein_id gnl|my_center|LOCUS_08410 66763 65237 gene locus_tag LOCUS_08420 gene xylB 66763 65237 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_08420 67199 67543 gene locus_tag LOCUS_08430 67199 67543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 67704 68867 gene locus_tag LOCUS_08440 67704 68867 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_08440 69043 69945 gene locus_tag LOCUS_08450 69043 69945 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_08450 69945 70952 gene locus_tag LOCUS_08460 69945 70952 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940008.1 protein_id gnl|my_center|LOCUS_08460 70957 71733 gene locus_tag LOCUS_08470 70957 71733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869436.1 protein_id gnl|my_center|LOCUS_08470 71733 72488 gene locus_tag LOCUS_08480 71733 72488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_08480 72842 76279 gene locus_tag LOCUS_08490 72842 76279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 77298 76327 gene locus_tag LOCUS_08500 77298 76327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 78568 77477 gene locus_tag LOCUS_08510 78568 77477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 79676 78972 gene locus_tag LOCUS_08520 79676 78972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 80751 79678 gene locus_tag LOCUS_08530 80751 79678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 80875 81144 gene locus_tag LOCUS_08540 80875 81144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 81137 81577 gene locus_tag LOCUS_08550 81137 81577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 81902 81594 gene locus_tag LOCUS_08560 81902 81594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 81924 82121 gene locus_tag LOCUS_08570 81924 82121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 82593 82135 gene locus_tag LOCUS_08580 82593 82135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08580 82773 82627 gene locus_tag LOCUS_08590 82773 82627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence09 1362 337 gene locus_tag LOCUS_08600 1362 337 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_08600 1587 2597 gene locus_tag LOCUS_08610 1587 2597 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_08610 2713 3552 gene locus_tag LOCUS_08620 2713 3552 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_08620 3579 4703 gene locus_tag LOCUS_08630 3579 4703 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931321.1 protein_id gnl|my_center|LOCUS_08630 4709 6166 gene locus_tag LOCUS_08640 4709 6166 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_08640 6166 8508 gene locus_tag LOCUS_08650 6166 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 8505 9662 gene locus_tag LOCUS_08660 8505 9662 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931321.1 protein_id gnl|my_center|LOCUS_08660 9835 11802 gene locus_tag LOCUS_08670 gene asnB 9835 11802 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_08670 11805 12932 gene locus_tag LOCUS_08680 11805 12932 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957841.1 protein_id gnl|my_center|LOCUS_08680 12929 13981 gene locus_tag LOCUS_08690 12929 13981 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_08690 14046 16517 gene locus_tag LOCUS_08700 14046 16517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 16529 19102 gene locus_tag LOCUS_08710 16529 19102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 19191 19736 gene locus_tag LOCUS_08720 19191 19736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 19733 20698 gene locus_tag LOCUS_08730 19733 20698 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_08730 20715 21575 gene locus_tag LOCUS_08740 20715 21575 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_08740 21579 22844 gene locus_tag LOCUS_08750 21579 22844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_08750 22847 24478 gene locus_tag LOCUS_08760 22847 24478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 24475 25341 gene locus_tag LOCUS_08770 24475 25341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 25370 26377 gene locus_tag LOCUS_08780 gene pseB 25370 26377 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163498402.1 protein_id gnl|my_center|LOCUS_08780 26383 27291 gene locus_tag LOCUS_08790 26383 27291 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_08790 27314 28384 gene locus_tag LOCUS_08800 27314 28384 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015754.1 protein_id gnl|my_center|LOCUS_08800 28407 29495 gene locus_tag LOCUS_08810 28407 29495 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964099.1 protein_id gnl|my_center|LOCUS_08810 29492 31450 gene locus_tag LOCUS_08820 29492 31450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 31450 32223 gene locus_tag LOCUS_08830 31450 32223 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_08830 32220 33131 gene locus_tag LOCUS_08840 32220 33131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 33172 34137 gene locus_tag LOCUS_08850 33172 34137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 34152 35612 gene locus_tag LOCUS_08860 34152 35612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 35609 36598 gene locus_tag LOCUS_08870 35609 36598 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465709.1 protein_id gnl|my_center|LOCUS_08870 36718 38388 gene locus_tag LOCUS_08880 36718 38388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 38385 39989 gene locus_tag LOCUS_08890 38385 39989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 41004 40090 gene locus_tag LOCUS_08900 41004 40090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_08900 41091 42701 gene locus_tag LOCUS_08910 41091 42701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 42701 43522 gene locus_tag LOCUS_08920 42701 43522 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_08920 43516 44748 gene locus_tag LOCUS_08930 43516 44748 CDS product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029924.1 protein_id gnl|my_center|LOCUS_08930 44757 45632 gene locus_tag LOCUS_08940 44757 45632 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 protein_id gnl|my_center|LOCUS_08940 45661 45888 gene locus_tag LOCUS_08950 45661 45888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 45906 47495 gene locus_tag LOCUS_08960 45906 47495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 47504 49120 gene locus_tag LOCUS_08970 47504 49120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 49117 50178 gene locus_tag LOCUS_08980 49117 50178 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143763.1 protein_id gnl|my_center|LOCUS_08980 50175 50843 gene locus_tag LOCUS_08990 50175 50843 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461004.1 protein_id gnl|my_center|LOCUS_08990 50923 51927 gene locus_tag LOCUS_09000 50923 51927 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143765.1 protein_id gnl|my_center|LOCUS_09000 51932 52696 gene locus_tag LOCUS_09010 51932 52696 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_09010 52693 53511 gene locus_tag LOCUS_09020 52693 53511 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143772.1 protein_id gnl|my_center|LOCUS_09020 53513 54505 gene locus_tag LOCUS_09030 53513 54505 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545486.1 protein_id gnl|my_center|LOCUS_09030 54492 56039 gene locus_tag LOCUS_09040 54492 56039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 56036 57547 gene locus_tag LOCUS_09050 56036 57547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 57547 58341 gene locus_tag LOCUS_09060 57547 58341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 58387 58770 gene locus_tag LOCUS_09070 58387 58770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 58916 59134 gene locus_tag LOCUS_09080 58916 59134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 60547 59168 gene locus_tag LOCUS_09090 60547 59168 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_09090 61156 60578 gene locus_tag LOCUS_09100 61156 60578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 62435 61251 gene locus_tag LOCUS_09110 62435 61251 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_09110 64209 62527 gene locus_tag LOCUS_09120 64209 62527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 65972 64362 gene locus_tag LOCUS_09130 65972 64362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 66903 65989 gene locus_tag LOCUS_09140 66903 65989 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_09140 67016 67831 gene locus_tag LOCUS_09150 67016 67831 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256562.1 protein_id gnl|my_center|LOCUS_09150 67835 68389 gene locus_tag LOCUS_09160 67835 68389 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256561.1 protein_id gnl|my_center|LOCUS_09160 69399 68491 gene locus_tag LOCUS_09170 69399 68491 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228840.1 protein_id gnl|my_center|LOCUS_09170 70187 69432 gene locus_tag LOCUS_09180 70187 69432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 71227 70205 gene locus_tag LOCUS_09190 71227 70205 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_09190 71991 71224 gene locus_tag LOCUS_09200 71991 71224 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_09200 72880 71978 gene locus_tag LOCUS_09210 72880 71978 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406329.1 protein_id gnl|my_center|LOCUS_09210 74475 72889 gene locus_tag LOCUS_09220 gene pruA 74475 72889 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 protein_id gnl|my_center|LOCUS_09220 74911 74570 gene locus_tag LOCUS_09230 74911 74570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 75012 75749 gene locus_tag LOCUS_09240 75012 75749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 76565 75789 gene locus_tag LOCUS_09250 76565 75789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258540.1 protein_id gnl|my_center|LOCUS_09250 77236 76781 gene locus_tag LOCUS_09260 77236 76781 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence10 2276 3775 gene locus_tag LOCUS_09270 2276 3775 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062419932.1 protein_id gnl|my_center|LOCUS_09270 6730 3866 gene locus_tag LOCUS_09280 6730 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 7003 6785 gene locus_tag LOCUS_09290 7003 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 7875 7177 gene locus_tag LOCUS_09300 7875 7177 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763963.1 protein_id gnl|my_center|LOCUS_09300 8333 9805 gene locus_tag LOCUS_09310 8333 9805 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294624.1 protein_id gnl|my_center|LOCUS_09310 10890 9856 gene locus_tag LOCUS_09320 10890 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 11041 11913 gene locus_tag LOCUS_09330 11041 11913 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597670.1 protein_id gnl|my_center|LOCUS_09330 11917 13071 gene locus_tag LOCUS_09340 11917 13071 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_09340 13064 14020 gene locus_tag LOCUS_09350 13064 14020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 14017 14982 gene locus_tag LOCUS_09360 14017 14982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 14989 16197 gene locus_tag LOCUS_09370 14989 16197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 16194 16481 gene locus_tag LOCUS_09380 16194 16481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 16575 17786 gene locus_tag LOCUS_09390 16575 17786 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_09390 17783 18811 gene locus_tag LOCUS_09400 17783 18811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 19191 20126 gene locus_tag LOCUS_09410 19191 20126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 20123 21283 gene locus_tag LOCUS_09420 20123 21283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 21317 21907 gene locus_tag LOCUS_09430 21317 21907 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 protein_id gnl|my_center|LOCUS_09430 24360 21904 gene locus_tag LOCUS_09440 24360 21904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 25260 24406 gene locus_tag LOCUS_09450 25260 24406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 26738 25257 gene locus_tag LOCUS_09460 26738 25257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 28625 26775 gene locus_tag LOCUS_09470 28625 26775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 29376 28588 gene locus_tag LOCUS_09480 29376 28588 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516556.1 protein_id gnl|my_center|LOCUS_09480 30527 29409 gene locus_tag LOCUS_09490 30527 29409 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_09490 31549 30533 gene locus_tag LOCUS_09500 31549 30533 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_09500 32016 32936 gene locus_tag LOCUS_09510 32016 32936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 33084 33734 gene locus_tag LOCUS_09520 33084 33734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 34012 33818 gene locus_tag LOCUS_09530 34012 33818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 34111 35466 gene locus_tag LOCUS_09540 34111 35466 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870580.1 protein_id gnl|my_center|LOCUS_09540 35567 36577 gene locus_tag LOCUS_09550 35567 36577 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083903.1 protein_id gnl|my_center|LOCUS_09550 37685 36705 gene locus_tag LOCUS_09560 gene yjfF 37685 36705 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212021.1 protein_id gnl|my_center|LOCUS_09560 38745 37669 gene locus_tag LOCUS_09570 38745 37669 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_09570 40259 38742 gene locus_tag LOCUS_09580 40259 38742 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_09580 41389 40400 gene locus_tag LOCUS_09590 41389 40400 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_09590 42070 43131 gene locus_tag LOCUS_09600 42070 43131 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_09600 43333 45006 gene locus_tag LOCUS_09610 gene araB 43333 45006 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_09610 45023 45664 gene locus_tag LOCUS_09620 45023 45664 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226246.1 protein_id gnl|my_center|LOCUS_09620 45683 47188 gene locus_tag LOCUS_09630 gene araA 45683 47188 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368279.1 protein_id gnl|my_center|LOCUS_09630 49259 47325 gene locus_tag LOCUS_09640 49259 47325 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_09640 49390 50040 gene locus_tag LOCUS_09650 49390 50040 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_09650 52147 50063 gene locus_tag LOCUS_09660 52147 50063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 52530 52165 gene locus_tag LOCUS_09670 52530 52165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 55529 52527 gene locus_tag LOCUS_09680 55529 52527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 56517 56155 gene locus_tag LOCUS_09690 56517 56155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 57720 56578 gene locus_tag LOCUS_09700 57720 56578 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_09700 58835 57864 gene locus_tag LOCUS_09710 58835 57864 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940211.1 protein_id gnl|my_center|LOCUS_09710 60571 58961 gene locus_tag LOCUS_09720 60571 58961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 61087 60923 gene locus_tag LOCUS_09730 61087 60923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 62069 61185 gene locus_tag LOCUS_09740 62069 61185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 62480 62145 gene locus_tag LOCUS_09750 62480 62145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 63301 62477 gene locus_tag LOCUS_09760 63301 62477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 64979 63594 gene locus_tag LOCUS_09770 64979 63594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 66028 64979 gene locus_tag LOCUS_09780 66028 64979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 66106 66333 gene locus_tag LOCUS_09790 66106 66333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 66509 66730 gene locus_tag LOCUS_09800 66509 66730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 66872 67084 gene locus_tag LOCUS_09810 66872 67084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 67081 67455 gene locus_tag LOCUS_09820 67081 67455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 68237 67815 gene locus_tag LOCUS_09830 68237 67815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 69000 68230 gene locus_tag LOCUS_09840 69000 68230 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229054.1 protein_id gnl|my_center|LOCUS_09840 69560 69321 gene locus_tag LOCUS_09850 69560 69321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 71493 70042 gene locus_tag LOCUS_09860 71493 70042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 72029 71625 gene locus_tag LOCUS_09870 72029 71625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 72567 72088 gene locus_tag LOCUS_09880 72567 72088 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 protein_id gnl|my_center|LOCUS_09880 72749 73141 gene locus_tag LOCUS_09890 72749 73141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 73360 74646 gene locus_tag LOCUS_09900 73360 74646 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence11 2023 980 gene locus_tag LOCUS_09910 2023 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2079 3149 gene locus_tag LOCUS_09920 2079 3149 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023745.1 protein_id gnl|my_center|LOCUS_09920 3709 4251 gene locus_tag LOCUS_09930 3709 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 4253 5749 gene locus_tag LOCUS_09940 4253 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 7731 5761 gene locus_tag LOCUS_09950 7731 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 8516 7728 gene locus_tag LOCUS_09960 8516 7728 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965816.1 protein_id gnl|my_center|LOCUS_09960 9516 8509 gene locus_tag LOCUS_09970 9516 8509 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_09970 10600 9557 gene locus_tag LOCUS_09980 gene wecB 10600 9557 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_09980 10676 13165 gene locus_tag LOCUS_09990 10676 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 13165 14058 gene locus_tag LOCUS_10000 13165 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 14055 15299 gene locus_tag LOCUS_10010 14055 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 17368 15305 gene locus_tag LOCUS_10020 17368 15305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 19434 17365 gene locus_tag LOCUS_10030 19434 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 19537 21423 gene locus_tag LOCUS_10040 19537 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 23411 21420 gene locus_tag LOCUS_10050 23411 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 24242 23421 gene locus_tag LOCUS_10060 24242 23421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 25258 24239 gene locus_tag LOCUS_10070 25258 24239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 27798 25264 gene locus_tag LOCUS_10080 27798 25264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 29821 27800 gene locus_tag LOCUS_10090 29821 27800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 30932 29814 gene locus_tag LOCUS_10100 30932 29814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064737.1 protein_id gnl|my_center|LOCUS_10100 32071 30938 gene locus_tag LOCUS_10110 32071 30938 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_10110 32851 32090 gene locus_tag LOCUS_10120 32851 32090 CDS product AglZ/HisF2 family acetamidino modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113421.1 protein_id gnl|my_center|LOCUS_10120 33475 32855 gene locus_tag LOCUS_10130 gene hisH 33475 32855 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113422.1 protein_id gnl|my_center|LOCUS_10130 33615 35939 gene locus_tag LOCUS_10140 33615 35939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 35947 36603 gene locus_tag LOCUS_10150 35947 36603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 36685 37611 gene locus_tag LOCUS_10160 36685 37611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 39004 37553 gene locus_tag LOCUS_10170 gene tilS 39004 37553 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_10170 39185 40324 gene locus_tag LOCUS_10180 39185 40324 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_10180 40321 41091 gene locus_tag LOCUS_10190 gene cobB 40321 41091 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846381.1 protein_id gnl|my_center|LOCUS_10190 42830 41088 gene locus_tag LOCUS_10200 gene mutL 42830 41088 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_10200 42908 43576 gene locus_tag LOCUS_10210 42908 43576 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391090.1 protein_id gnl|my_center|LOCUS_10210 43573 43845 gene locus_tag LOCUS_10220 43573 43845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 43857 45095 gene locus_tag LOCUS_10230 43857 45095 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257707.1 protein_id gnl|my_center|LOCUS_10230 45287 46120 gene locus_tag LOCUS_10240 45287 46120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 46268 47896 gene locus_tag LOCUS_10250 46268 47896 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257008.1 protein_id gnl|my_center|LOCUS_10250 48465 49223 gene locus_tag LOCUS_10260 gene tpiA 48465 49223 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_10260 49957 49331 gene locus_tag LOCUS_10270 gene upp 49957 49331 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_10270 50002 51027 gene locus_tag LOCUS_10280 gene ruvB 50002 51027 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258937.1 protein_id gnl|my_center|LOCUS_10280 51031 52050 gene locus_tag LOCUS_10290 gene queA 51031 52050 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019178.1 protein_id gnl|my_center|LOCUS_10290 52663 52052 gene locus_tag LOCUS_10300 52663 52052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 53616 52660 gene locus_tag LOCUS_10310 53616 52660 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_10310 53716 54561 gene locus_tag LOCUS_10320 53716 54561 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172618.1 protein_id gnl|my_center|LOCUS_10320 54583 55269 gene locus_tag LOCUS_10330 54583 55269 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_10330 55283 56053 gene locus_tag LOCUS_10340 55283 56053 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890403.1 protein_id gnl|my_center|LOCUS_10340 56064 56234 gene locus_tag LOCUS_10350 56064 56234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 56253 56591 gene locus_tag LOCUS_10360 56253 56591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 57944 56655 gene locus_tag LOCUS_10370 gene eno 57944 56655 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_10370 58312 58157 gene locus_tag LOCUS_10380 58312 58157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 58713 58399 gene locus_tag LOCUS_10390 58713 58399 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_10390 60802 58730 gene locus_tag LOCUS_10400 60802 58730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 60910 61416 gene locus_tag LOCUS_10410 60910 61416 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085038.1 protein_id gnl|my_center|LOCUS_10410 62317 61487 gene locus_tag LOCUS_10420 62317 61487 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937487.1 protein_id gnl|my_center|LOCUS_10420 62521 65109 gene locus_tag LOCUS_10430 gene clpB 62521 65109 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_10430 65143 65739 gene locus_tag LOCUS_10440 65143 65739 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_10440 65753 65992 gene locus_tag LOCUS_10450 65753 65992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 66076 66270 gene locus_tag LOCUS_10460 66076 66270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 66414 67463 gene locus_tag LOCUS_10470 66414 67463 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861334.1 protein_id gnl|my_center|LOCUS_10470 67619 68476 gene locus_tag LOCUS_10480 67619 68476 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812594.1 protein_id gnl|my_center|LOCUS_10480 68607 69476 gene locus_tag LOCUS_10490 68607 69476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 70340 69489 gene locus_tag LOCUS_10500 70340 69489 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052303786.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence12 592 1164 gene locus_tag LOCUS_10510 592 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2376 1150 gene locus_tag LOCUS_10520 2376 1150 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_10520 3053 2376 gene locus_tag LOCUS_10530 3053 2376 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_10530 4476 3076 gene locus_tag LOCUS_10540 4476 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 6475 4487 gene locus_tag LOCUS_10550 6475 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 7887 6481 gene locus_tag LOCUS_10560 7887 6481 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_10560 8088 9320 gene locus_tag LOCUS_10570 8088 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 9735 9325 gene locus_tag LOCUS_10580 9735 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 9881 10528 gene locus_tag LOCUS_10590 9881 10528 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_10590 10525 11325 gene locus_tag LOCUS_10600 10525 11325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 15251 11328 gene locus_tag LOCUS_10610 15251 11328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 15459 16688 gene locus_tag LOCUS_10620 15459 16688 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_10620 17600 16689 gene locus_tag LOCUS_10630 17600 16689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 17916 17683 gene locus_tag LOCUS_10640 17916 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 18049 17843 gene locus_tag LOCUS_10650 18049 17843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 19470 18172 gene locus_tag LOCUS_10660 19470 18172 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_10660 20055 19483 gene locus_tag LOCUS_10670 gene hpt 20055 19483 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073575.1 protein_id gnl|my_center|LOCUS_10670 20862 20716 gene locus_tag LOCUS_10680 20862 20716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 22392 22177 gene locus_tag LOCUS_10690 22392 22177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 22346 22900 gene locus_tag LOCUS_10700 22346 22900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 24209 23256 gene locus_tag LOCUS_10710 24209 23256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 25440 24472 gene locus_tag LOCUS_10720 25440 24472 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046798190.1 protein_id gnl|my_center|LOCUS_10720 26003 27049 gene locus_tag LOCUS_10730 26003 27049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 27182 28672 gene locus_tag LOCUS_10740 27182 28672 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_10740 28700 29698 gene locus_tag LOCUS_10750 28700 29698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389117.1 protein_id gnl|my_center|LOCUS_10750 29724 30809 gene locus_tag LOCUS_10760 29724 30809 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 protein_id gnl|my_center|LOCUS_10760 30828 31796 gene locus_tag LOCUS_10770 30828 31796 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_10770 31833 32075 gene locus_tag LOCUS_10780 31833 32075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 32068 32718 gene locus_tag LOCUS_10790 32068 32718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 32757 34232 gene locus_tag LOCUS_10800 gene glpK 32757 34232 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_10800 34442 34368 gene locus_tag LOCUS_t00130 34442 34368 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 35057 34494 gene locus_tag LOCUS_10810 35057 34494 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948983.1 protein_id gnl|my_center|LOCUS_10810 35828 35166 gene locus_tag LOCUS_10820 35828 35166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 36251 35832 gene locus_tag LOCUS_10830 36251 35832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 37405 36266 gene locus_tag LOCUS_10840 37405 36266 CDS product 5-methylthioribulose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 protein_id gnl|my_center|LOCUS_10840 38537 37437 gene locus_tag LOCUS_10850 gene mtnA 38537 37437 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025237.1 protein_id gnl|my_center|LOCUS_10850 40167 38659 gene locus_tag LOCUS_10860 40167 38659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 40389 41048 gene locus_tag LOCUS_10870 40389 41048 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701679.1 protein_id gnl|my_center|LOCUS_10870 41038 43287 gene locus_tag LOCUS_10880 gene feoB 41038 43287 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583918.1 protein_id gnl|my_center|LOCUS_10880 43284 43544 gene locus_tag LOCUS_10890 43284 43544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 43548 44330 gene locus_tag LOCUS_10900 43548 44330 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_10900 44623 45228 gene locus_tag LOCUS_10910 44623 45228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 48615 45229 gene locus_tag LOCUS_10920 gene mfd 48615 45229 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_10920 49237 48617 gene locus_tag LOCUS_10930 gene pth 49237 48617 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_10930 49892 49254 gene locus_tag LOCUS_10940 49892 49254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 50103 50465 gene locus_tag LOCUS_10950 50103 50465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 50518 50856 gene locus_tag LOCUS_10960 50518 50856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 52558 50921 gene locus_tag LOCUS_10970 52558 50921 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_10970 52681 54234 gene locus_tag LOCUS_10980 52681 54234 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_10980 54231 54896 gene locus_tag LOCUS_10990 54231 54896 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881332.1 protein_id gnl|my_center|LOCUS_10990 56162 54954 gene locus_tag LOCUS_11000 56162 54954 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880318.1 protein_id gnl|my_center|LOCUS_11000 57370 56258 gene locus_tag LOCUS_11010 57370 56258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_11010 58638 57526 gene locus_tag LOCUS_11020 58638 57526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 58909 59769 gene locus_tag LOCUS_11030 58909 59769 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529656.1 protein_id gnl|my_center|LOCUS_11030 59875 61494 gene locus_tag LOCUS_11040 59875 61494 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389949.1 protein_id gnl|my_center|LOCUS_11040 63129 61528 gene locus_tag LOCUS_11050 gene treS 63129 61528 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888668.1 protein_id gnl|my_center|LOCUS_11050 64595 63162 gene locus_tag LOCUS_11060 64595 63162 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_11060 65647 64604 gene locus_tag LOCUS_11070 65647 64604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 66230 65676 gene locus_tag LOCUS_11080 gene dcd 66230 65676 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_11080 67803 66256 gene locus_tag LOCUS_11090 67803 66256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence13 23 1051 gene locus_tag LOCUS_11100 23 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1089 1412 gene locus_tag LOCUS_11110 1089 1412 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135500.1 protein_id gnl|my_center|LOCUS_11110 1452 2216 gene locus_tag LOCUS_11120 1452 2216 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_11120 2242 2709 gene locus_tag LOCUS_11130 2242 2709 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887487.1 protein_id gnl|my_center|LOCUS_11130 2730 3311 gene locus_tag LOCUS_11140 2730 3311 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_11140 3381 3626 gene locus_tag LOCUS_11150 3381 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 3623 4033 gene locus_tag LOCUS_11160 3623 4033 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549313.1 protein_id gnl|my_center|LOCUS_11160 4085 4975 gene locus_tag LOCUS_11170 4085 4975 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242763.1 protein_id gnl|my_center|LOCUS_11170 5091 5837 gene locus_tag LOCUS_11180 5091 5837 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969126.1 protein_id gnl|my_center|LOCUS_11180 5893 6588 gene locus_tag LOCUS_11190 gene yycF 5893 6588 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262930.1 protein_id gnl|my_center|LOCUS_11190 6778 6575 gene locus_tag LOCUS_11200 6778 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 6759 8165 gene locus_tag LOCUS_11210 6759 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 8255 9718 gene locus_tag LOCUS_11220 8255 9718 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751431.1 protein_id gnl|my_center|LOCUS_11220 9736 10527 gene locus_tag LOCUS_11230 9736 10527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 10540 11442 gene locus_tag LOCUS_11240 10540 11442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128974497.1 protein_id gnl|my_center|LOCUS_11240 11457 12218 gene locus_tag LOCUS_11250 11457 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 12259 20421 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgctcccgcgaggggagcgac 20879 20589 gene locus_tag LOCUS_11260 gene cas2 20879 20589 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 protein_id gnl|my_center|LOCUS_11260 21933 20890 gene locus_tag LOCUS_11270 gene cas1c 21933 20890 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388588.1 protein_id gnl|my_center|LOCUS_11270 22510 21923 gene locus_tag LOCUS_11280 gene cas4 22510 21923 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_11280 23498 22614 gene locus_tag LOCUS_11290 gene cas7c 23498 22614 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_11290 25428 23539 gene locus_tag LOCUS_11300 25428 23539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 26149 25439 gene locus_tag LOCUS_11310 gene cas5c 26149 25439 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922512.1 protein_id gnl|my_center|LOCUS_11310 28633 26159 gene locus_tag LOCUS_11320 28633 26159 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_11320 29621 28623 gene locus_tag LOCUS_11330 29621 28623 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258178.1 protein_id gnl|my_center|LOCUS_11330 29757 30455 gene locus_tag LOCUS_11340 29757 30455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 30486 30812 gene locus_tag LOCUS_11350 gene cutA 30486 30812 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160791.1 protein_id gnl|my_center|LOCUS_11350 30933 31853 gene locus_tag LOCUS_11360 30933 31853 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245561.1 protein_id gnl|my_center|LOCUS_11360 31930 32745 gene locus_tag LOCUS_11370 31930 32745 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358274.1 protein_id gnl|my_center|LOCUS_11370 32772 33419 gene locus_tag LOCUS_11380 32772 33419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 33514 34002 gene locus_tag LOCUS_11390 33514 34002 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438486.1 protein_id gnl|my_center|LOCUS_11390 34610 34209 gene locus_tag LOCUS_11400 34610 34209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 34702 35775 gene locus_tag LOCUS_11410 34702 35775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 35849 36259 gene locus_tag LOCUS_11420 35849 36259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 36855 36523 gene locus_tag LOCUS_11430 36855 36523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 37375 37046 gene locus_tag LOCUS_11440 37375 37046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 37582 38109 gene locus_tag LOCUS_11450 37582 38109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 38063 38242 gene locus_tag LOCUS_11460 38063 38242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 38239 39276 gene locus_tag LOCUS_11470 38239 39276 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402005.1 protein_id gnl|my_center|LOCUS_11470 39327 40136 gene locus_tag LOCUS_11480 39327 40136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228097.1 protein_id gnl|my_center|LOCUS_11480 40274 41128 gene locus_tag LOCUS_11490 40274 41128 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459581.1 protein_id gnl|my_center|LOCUS_11490 41164 41622 gene locus_tag LOCUS_11500 41164 41622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 41701 42432 gene locus_tag LOCUS_11510 41701 42432 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_11510 42449 43465 gene locus_tag LOCUS_11520 42449 43465 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142257.1 protein_id gnl|my_center|LOCUS_11520 43453 44076 gene locus_tag LOCUS_11530 43453 44076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 44783 44100 gene locus_tag LOCUS_11540 44783 44100 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_11540 44917 45546 gene locus_tag LOCUS_11550 44917 45546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 45566 46468 gene locus_tag LOCUS_11560 45566 46468 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_11560 46465 46926 gene locus_tag LOCUS_11570 gene rimI 46465 46926 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251164.1 protein_id gnl|my_center|LOCUS_11570 47314 46904 gene locus_tag LOCUS_11580 47314 46904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 48380 47331 gene locus_tag LOCUS_11590 48380 47331 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681095.1 protein_id gnl|my_center|LOCUS_11590 49241 48384 gene locus_tag LOCUS_11600 49241 48384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 50838 49264 gene locus_tag LOCUS_11610 50838 49264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 51621 50908 gene locus_tag LOCUS_11620 51621 50908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 51792 53387 gene locus_tag LOCUS_11630 gene murJ 51792 53387 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_11630 53424 54155 gene locus_tag LOCUS_11640 53424 54155 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044966.1 protein_id gnl|my_center|LOCUS_11640 54782 54168 gene locus_tag LOCUS_11650 54782 54168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 55221 54769 gene locus_tag LOCUS_11660 55221 54769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 57440 55218 gene locus_tag LOCUS_11670 57440 55218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015935.1 protein_id gnl|my_center|LOCUS_11670 57579 58640 gene locus_tag LOCUS_11680 57579 58640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 58889 61138 gene locus_tag LOCUS_11690 58889 61138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 61330 62961 gene locus_tag LOCUS_11700 61330 62961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 63057 63377 gene locus_tag LOCUS_11710 63057 63377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 63380 64981 gene locus_tag LOCUS_11720 gene gatA 63380 64981 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_11720 64991 66439 gene locus_tag LOCUS_11730 gene gatB 64991 66439 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_11730 66555 66896 gene locus_tag LOCUS_11740 66555 66896 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991882.1 protein_id gnl|my_center|LOCUS_11740 66893 67414 gene locus_tag LOCUS_11750 66893 67414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 68395 67454 gene locus_tag LOCUS_11760 68395 67454 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263651.1 protein_id gnl|my_center|LOCUS_11760 69236 68460 gene locus_tag LOCUS_11770 gene ygiD 69236 68460 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920795.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence14 2211 1966 gene locus_tag LOCUS_11780 2211 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 4028 2355 gene locus_tag LOCUS_11790 4028 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 4256 4693 gene locus_tag LOCUS_11800 4256 4693 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_11800 4793 5374 gene locus_tag LOCUS_11810 4793 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 5396 6400 gene locus_tag LOCUS_11820 5396 6400 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066138.1 protein_id gnl|my_center|LOCUS_11820 6422 6793 gene locus_tag LOCUS_11830 6422 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 7299 6817 gene locus_tag LOCUS_11840 7299 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 8430 7426 gene locus_tag LOCUS_11850 8430 7426 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456725.1 protein_id gnl|my_center|LOCUS_11850 8578 10038 gene locus_tag LOCUS_11860 8578 10038 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298365.1 protein_id gnl|my_center|LOCUS_11860 10479 10105 gene locus_tag LOCUS_11870 10479 10105 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_11870 13709 10497 gene locus_tag LOCUS_11880 gene carB 13709 10497 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257643.1 protein_id gnl|my_center|LOCUS_11880 14853 13693 gene locus_tag LOCUS_11890 gene carA 14853 13693 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143532.1 protein_id gnl|my_center|LOCUS_11890 16050 15085 gene locus_tag LOCUS_11900 16050 15085 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_11900 16313 16080 gene locus_tag LOCUS_11910 16313 16080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 16983 16339 gene locus_tag LOCUS_11920 16983 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 18026 17010 gene locus_tag LOCUS_11930 18026 17010 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_11930 18681 18136 gene locus_tag LOCUS_11940 18681 18136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 19592 18720 gene locus_tag LOCUS_11950 19592 18720 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060859.1 protein_id gnl|my_center|LOCUS_11950 19937 19635 gene locus_tag LOCUS_11960 19937 19635 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440932.1 protein_id gnl|my_center|LOCUS_11960 20560 19967 gene locus_tag LOCUS_11970 20560 19967 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990841.1 protein_id gnl|my_center|LOCUS_11970 21658 20885 gene locus_tag LOCUS_11980 21658 20885 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837376.1 protein_id gnl|my_center|LOCUS_11980 22287 21757 gene locus_tag LOCUS_11990 22287 21757 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279113.1 protein_id gnl|my_center|LOCUS_11990 23024 22416 gene locus_tag LOCUS_12000 23024 22416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 23578 23030 gene locus_tag LOCUS_12010 23578 23030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 24045 23737 gene locus_tag LOCUS_12020 24045 23737 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721441.1 protein_id gnl|my_center|LOCUS_12020 24912 24094 gene locus_tag LOCUS_12030 24912 24094 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242610.1 protein_id gnl|my_center|LOCUS_12030 26315 25032 gene locus_tag LOCUS_12040 26315 25032 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861808.1 protein_id gnl|my_center|LOCUS_12040 27804 26389 gene locus_tag LOCUS_12050 27804 26389 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726689.1 protein_id gnl|my_center|LOCUS_12050 28100 27801 gene locus_tag LOCUS_12060 28100 27801 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_12060 28481 28131 gene locus_tag LOCUS_12070 28481 28131 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420747.1 protein_id gnl|my_center|LOCUS_12070 29163 28540 gene locus_tag LOCUS_12080 29163 28540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 30610 29312 gene locus_tag LOCUS_12090 30610 29312 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_12090 32218 30716 gene locus_tag LOCUS_12100 32218 30716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 32429 32806 gene locus_tag LOCUS_12110 32429 32806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 33669 32842 gene locus_tag LOCUS_12120 33669 32842 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438284.1 protein_id gnl|my_center|LOCUS_12120 34631 33795 gene locus_tag LOCUS_12130 34631 33795 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015137.1 protein_id gnl|my_center|LOCUS_12130 35476 34631 gene locus_tag LOCUS_12140 35476 34631 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567523.1 protein_id gnl|my_center|LOCUS_12140 36911 35580 gene locus_tag LOCUS_12150 36911 35580 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 protein_id gnl|my_center|LOCUS_12150 37629 37195 gene locus_tag LOCUS_12160 37629 37195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 38147 37626 gene locus_tag LOCUS_12170 38147 37626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531831.1 protein_id gnl|my_center|LOCUS_12170 39090 38233 gene locus_tag LOCUS_12180 39090 38233 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947915.1 protein_id gnl|my_center|LOCUS_12180 40137 39175 gene locus_tag LOCUS_12190 40137 39175 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786931.1 protein_id gnl|my_center|LOCUS_12190 40354 41091 gene locus_tag LOCUS_12200 40354 41091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 41104 41643 gene locus_tag LOCUS_12210 41104 41643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 41716 42480 gene locus_tag LOCUS_12220 41716 42480 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896974.1 protein_id gnl|my_center|LOCUS_12220 43779 42613 gene locus_tag LOCUS_12230 43779 42613 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650945.1 protein_id gnl|my_center|LOCUS_12230 44704 43991 gene locus_tag LOCUS_12240 44704 43991 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_12240 45161 44721 gene locus_tag LOCUS_12250 45161 44721 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289542.1 protein_id gnl|my_center|LOCUS_12250 45509 47080 gene locus_tag LOCUS_12260 45509 47080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 47253 47726 gene locus_tag LOCUS_12270 47253 47726 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525695.1 protein_id gnl|my_center|LOCUS_12270 47911 47714 gene locus_tag LOCUS_12280 47911 47714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 48074 50296 gene locus_tag LOCUS_12290 48074 50296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 50363 50620 gene locus_tag LOCUS_12300 50363 50620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 51148 51834 gene locus_tag LOCUS_12310 51148 51834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 53225 51954 gene locus_tag LOCUS_12320 53225 51954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 53602 53381 gene locus_tag LOCUS_12330 53602 53381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 53487 54653 gene locus_tag LOCUS_12340 53487 54653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 54752 55528 gene locus_tag LOCUS_12350 54752 55528 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_12350 55580 56122 gene locus_tag LOCUS_12360 55580 56122 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_12360 56125 56787 gene locus_tag LOCUS_12370 56125 56787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 56906 57130 gene locus_tag LOCUS_12380 56906 57130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 57282 57452 gene locus_tag LOCUS_12390 57282 57452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 57570 57944 gene locus_tag LOCUS_12400 57570 57944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 58810 57953 gene locus_tag LOCUS_12410 58810 57953 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272317.1 protein_id gnl|my_center|LOCUS_12410 59178 59852 gene locus_tag LOCUS_12420 59178 59852 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105364.1 protein_id gnl|my_center|LOCUS_12420 59877 60710 gene locus_tag LOCUS_12430 59877 60710 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528434.1 protein_id gnl|my_center|LOCUS_12430 60734 61072 gene locus_tag LOCUS_12440 60734 61072 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123088.1 protein_id gnl|my_center|LOCUS_12440 61477 63222 gene locus_tag LOCUS_12450 61477 63222 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869365.1 protein_id gnl|my_center|LOCUS_12450 63388 64512 gene locus_tag LOCUS_12460 63388 64512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 64649 65572 gene locus_tag LOCUS_12470 64649 65572 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860663.1 protein_id gnl|my_center|LOCUS_12470 65722 66960 gene locus_tag LOCUS_12480 65722 66960 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence15 1370 966 gene locus_tag LOCUS_12490 1370 966 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_12490 1498 1962 gene locus_tag LOCUS_12500 1498 1962 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_12500 1974 2657 gene locus_tag LOCUS_12510 gene phoP 1974 2657 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229442.1 protein_id gnl|my_center|LOCUS_12510 2657 4081 gene locus_tag LOCUS_12520 2657 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4078 5070 gene locus_tag LOCUS_12530 4078 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 5094 6518 gene locus_tag LOCUS_12540 5094 6518 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_12540 6515 8410 gene locus_tag LOCUS_12550 6515 8410 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_12550 8410 9408 gene locus_tag LOCUS_12560 8410 9408 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_12560 9405 10490 gene locus_tag LOCUS_12570 9405 10490 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_12570 12457 10487 gene locus_tag LOCUS_12580 12457 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 14610 12454 gene locus_tag LOCUS_12590 14610 12454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 14717 15727 gene locus_tag LOCUS_12600 14717 15727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 16724 15795 gene locus_tag LOCUS_12610 16724 15795 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975675.1 protein_id gnl|my_center|LOCUS_12610 16888 17556 gene locus_tag LOCUS_12620 16888 17556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 17614 17698 gene locus_tag LOCUS_t00140 17614 17698 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19275 20024 gene locus_tag LOCUS_12630 19275 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 20080 20835 gene locus_tag LOCUS_12640 20080 20835 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933329.1 protein_id gnl|my_center|LOCUS_12640 20842 21342 gene locus_tag LOCUS_12650 gene ruvC 20842 21342 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_12650 21339 22166 gene locus_tag LOCUS_12660 21339 22166 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 protein_id gnl|my_center|LOCUS_12660 22163 22741 gene locus_tag LOCUS_12670 gene ruvA 22163 22741 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_12670 22775 24913 gene locus_tag LOCUS_12680 22775 24913 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_12680 24926 26896 gene locus_tag LOCUS_12690 24926 26896 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222484.1 protein_id gnl|my_center|LOCUS_12690 26906 28147 gene locus_tag LOCUS_12700 26906 28147 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_12700 28116 28832 gene locus_tag LOCUS_12710 28116 28832 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_12710 28836 30593 gene locus_tag LOCUS_12720 gene phoR 28836 30593 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_12720 30756 31796 gene locus_tag LOCUS_12730 30756 31796 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_12730 31884 32849 gene locus_tag LOCUS_12740 gene pstC 31884 32849 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_12740 32846 34078 gene locus_tag LOCUS_12750 32846 34078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 34075 34857 gene locus_tag LOCUS_12760 gene pstB 34075 34857 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_12760 34888 35565 gene locus_tag LOCUS_12770 gene phoU 34888 35565 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_12770 35624 36334 gene locus_tag LOCUS_12780 gene tmk 35624 36334 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_12780 36345 37040 gene locus_tag LOCUS_12790 gene tmk 36345 37040 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_12790 37089 38105 gene locus_tag LOCUS_12800 37089 38105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 38102 39010 gene locus_tag LOCUS_12810 38102 39010 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_12810 39007 39624 gene locus_tag LOCUS_12820 39007 39624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 39627 40433 gene locus_tag LOCUS_12830 39627 40433 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_12830 40593 41720 gene locus_tag LOCUS_12840 40593 41720 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_12840 43001 41754 gene locus_tag LOCUS_12850 43001 41754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 42973 44691 gene locus_tag LOCUS_12860 42973 44691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 44688 46235 gene locus_tag LOCUS_12870 44688 46235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 46331 47560 gene locus_tag LOCUS_12880 46331 47560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 47535 49046 gene locus_tag LOCUS_12890 47535 49046 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764195.1 protein_id gnl|my_center|LOCUS_12890 49043 50638 gene locus_tag LOCUS_12900 49043 50638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 50635 52113 gene locus_tag LOCUS_12910 50635 52113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257117.1 protein_id gnl|my_center|LOCUS_12910 52204 53097 gene locus_tag LOCUS_12920 52204 53097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 53189 54283 gene locus_tag LOCUS_12930 53189 54283 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257187.1 protein_id gnl|my_center|LOCUS_12930 54315 55484 gene locus_tag LOCUS_12940 54315 55484 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_12940 55525 56943 gene locus_tag LOCUS_12950 55525 56943 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546190.1 protein_id gnl|my_center|LOCUS_12950 57128 57568 gene locus_tag LOCUS_12960 57128 57568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 58147 57581 gene locus_tag LOCUS_12970 gene rsmD 58147 57581 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_12970 58643 58191 gene locus_tag LOCUS_12980 58643 58191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 59599 58640 gene locus_tag LOCUS_12990 59599 58640 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_12990 61147 59630 gene locus_tag LOCUS_13000 61147 59630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 61703 61245 gene locus_tag LOCUS_13010 61703 61245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 61861 62433 gene locus_tag LOCUS_13020 gene scpB 61861 62433 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_13020 62440 63489 gene locus_tag LOCUS_13030 62440 63489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 64255 63539 gene locus_tag LOCUS_13040 64255 63539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 65307 64282 gene locus_tag LOCUS_13050 gene plsX 65307 64282 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_13050 65377 65459 gene locus_tag LOCUS_t00150 65377 65459 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence16 <1 841 gene locus_tag LOCUS_13060 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867222.1:amidohydrolase family protein 828 1502 gene locus_tag LOCUS_13070 828 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1531 2547 gene locus_tag LOCUS_13080 1531 2547 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_13080 2550 3611 gene locus_tag LOCUS_13090 2550 3611 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646211.1 protein_id gnl|my_center|LOCUS_13090 3613 4860 gene locus_tag LOCUS_13100 3613 4860 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436698.1 protein_id gnl|my_center|LOCUS_13100 4872 5894 gene locus_tag LOCUS_13110 4872 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 5931 6974 gene locus_tag LOCUS_13120 5931 6974 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_13120 7016 8332 gene locus_tag LOCUS_13130 gene gabT 7016 8332 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964736.1 protein_id gnl|my_center|LOCUS_13130 8359 9414 gene locus_tag LOCUS_13140 8359 9414 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_13140 9664 11307 gene locus_tag LOCUS_13150 9664 11307 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313842.1 protein_id gnl|my_center|LOCUS_13150 11412 12365 gene locus_tag LOCUS_13160 11412 12365 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_13160 12539 13333 gene locus_tag LOCUS_13170 12539 13333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867268.1 protein_id gnl|my_center|LOCUS_13170 13367 14149 gene locus_tag LOCUS_13180 13367 14149 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966609.1 protein_id gnl|my_center|LOCUS_13180 14151 14906 gene locus_tag LOCUS_13190 14151 14906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 14913 15923 gene locus_tag LOCUS_13200 14913 15923 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 protein_id gnl|my_center|LOCUS_13200 15962 16624 gene locus_tag LOCUS_13210 15962 16624 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727134.1 protein_id gnl|my_center|LOCUS_13210 16646 17650 gene locus_tag LOCUS_13220 16646 17650 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257499.1 protein_id gnl|my_center|LOCUS_13220 17714 18718 gene locus_tag LOCUS_13230 17714 18718 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_13230 18935 19621 gene locus_tag LOCUS_13240 18935 19621 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_13240 19802 20638 gene locus_tag LOCUS_13250 19802 20638 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867466.1 protein_id gnl|my_center|LOCUS_13250 20746 21741 gene locus_tag LOCUS_13260 20746 21741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 21788 22468 gene locus_tag LOCUS_13270 21788 22468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973996.1 protein_id gnl|my_center|LOCUS_13270 22465 23163 gene locus_tag LOCUS_13280 22465 23163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 23186 23743 gene locus_tag LOCUS_13290 23186 23743 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_13290 23736 25613 gene locus_tag LOCUS_13300 23736 25613 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986412.1 protein_id gnl|my_center|LOCUS_13300 25625 27364 gene locus_tag LOCUS_13310 25625 27364 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986411.1 protein_id gnl|my_center|LOCUS_13310 27965 28906 gene locus_tag LOCUS_13320 27965 28906 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090797.1 protein_id gnl|my_center|LOCUS_13320 30347 28971 gene locus_tag LOCUS_13330 30347 28971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 30543 31346 gene locus_tag LOCUS_13340 30543 31346 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933543.1 protein_id gnl|my_center|LOCUS_13340 31986 31393 gene locus_tag LOCUS_13350 31986 31393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 33017 31983 gene locus_tag LOCUS_13360 33017 31983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 34513 33026 gene locus_tag LOCUS_13370 34513 33026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 34717 36018 gene locus_tag LOCUS_13380 34717 36018 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015207390.1 protein_id gnl|my_center|LOCUS_13380 36002 36787 gene locus_tag LOCUS_13390 36002 36787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 37223 37047 gene locus_tag LOCUS_13400 37223 37047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 37242 38312 gene locus_tag LOCUS_13410 37242 38312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 39252 38380 gene locus_tag LOCUS_13420 39252 38380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 39842 39426 gene locus_tag LOCUS_13430 39842 39426 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_13430 40147 41034 gene locus_tag LOCUS_13440 40147 41034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 41241 41474 gene locus_tag LOCUS_13450 41241 41474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 44461 41507 gene locus_tag LOCUS_13460 44461 41507 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_13460 44655 44479 gene locus_tag LOCUS_13470 44655 44479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 45085 44636 gene locus_tag LOCUS_13480 45085 44636 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792733.1 protein_id gnl|my_center|LOCUS_13480 45439 45191 gene locus_tag LOCUS_13490 45439 45191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13490 46591 45791 gene locus_tag LOCUS_13500 46591 45791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 47042 46776 gene locus_tag LOCUS_13510 47042 46776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 47076 47255 gene locus_tag LOCUS_13520 47076 47255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 48262 47417 gene locus_tag LOCUS_13530 48262 47417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 48560 48488 gene locus_tag LOCUS_t00160 48560 48488 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 49326 48628 gene locus_tag LOCUS_13540 49326 48628 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_13540 50864 49734 gene locus_tag LOCUS_13550 50864 49734 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223543.1 protein_id gnl|my_center|LOCUS_13550 51838 50864 gene locus_tag LOCUS_13560 51838 50864 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_13560 53631 51835 gene locus_tag LOCUS_13570 53631 51835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 54015 55769 gene locus_tag LOCUS_13580 54015 55769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 55872 56483 gene locus_tag LOCUS_13590 55872 56483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 56420 56803 gene locus_tag LOCUS_13600 56420 56803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 57679 59499 gene locus_tag LOCUS_13610 57679 59499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 59859 60212 gene locus_tag LOCUS_13620 59859 60212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 61110 60256 gene locus_tag LOCUS_13630 61110 60256 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_13630 61542 62705 gene locus_tag LOCUS_13640 61542 62705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence17 <1 871 gene locus_tag LOCUS_13650 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943573.1:methyl-accepting chemotaxis protein 1009 923 gene locus_tag LOCUS_t00170 1009 923 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1144 1220 gene locus_tag LOCUS_t00180 1144 1220 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1347 7439 gene locus_tag LOCUS_13660 1347 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 7645 8439 gene locus_tag LOCUS_13670 7645 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 8668 8522 gene locus_tag LOCUS_13680 8668 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 9887 8841 gene locus_tag LOCUS_13690 9887 8841 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 protein_id gnl|my_center|LOCUS_13690 10334 9927 gene locus_tag LOCUS_13700 10334 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 10842 10564 gene locus_tag LOCUS_13710 10842 10564 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660651.1 protein_id gnl|my_center|LOCUS_13710 11254 10853 gene locus_tag LOCUS_13720 11254 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 12750 11353 gene locus_tag LOCUS_13730 12750 11353 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530221.1 protein_id gnl|my_center|LOCUS_13730 13087 12797 gene locus_tag LOCUS_13740 13087 12797 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530219.1 protein_id gnl|my_center|LOCUS_13740 13586 13125 gene locus_tag LOCUS_13750 13586 13125 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530220.1 protein_id gnl|my_center|LOCUS_13750 13579 13779 gene locus_tag LOCUS_13760 13579 13779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 13850 14365 gene locus_tag LOCUS_13770 13850 14365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 14439 14666 gene locus_tag LOCUS_13780 14439 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 14750 15100 gene locus_tag LOCUS_13790 gene rplT 14750 15100 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 protein_id gnl|my_center|LOCUS_13790 15181 15729 gene locus_tag LOCUS_13800 15181 15729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 15734 16525 gene locus_tag LOCUS_13810 15734 16525 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_13810 16557 16856 gene locus_tag LOCUS_13820 16557 16856 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890723.1 protein_id gnl|my_center|LOCUS_13820 17557 16859 gene locus_tag LOCUS_13830 17557 16859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 18315 17569 gene locus_tag LOCUS_13840 18315 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 18287 18508 gene locus_tag LOCUS_13850 18287 18508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 20187 18556 gene locus_tag LOCUS_13860 gene groL 20187 18556 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_13860 20515 20222 gene locus_tag LOCUS_13870 gene groES 20515 20222 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441664.1 protein_id gnl|my_center|LOCUS_13870 21997 20648 gene locus_tag LOCUS_13880 21997 20648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 23325 22006 gene locus_tag LOCUS_13890 23325 22006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 23386 24087 gene locus_tag LOCUS_13900 gene trmD 23386 24087 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829466.1 protein_id gnl|my_center|LOCUS_13900 24192 25253 gene locus_tag LOCUS_13910 24192 25253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 25427 26566 gene locus_tag LOCUS_13920 25427 26566 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_13920 26576 27646 gene locus_tag LOCUS_13930 26576 27646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 27674 29200 gene locus_tag LOCUS_13940 27674 29200 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_13940 29348 30520 gene locus_tag LOCUS_13950 29348 30520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 30768 30842 gene locus_tag LOCUS_t00190 30768 30842 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30872 31390 gene locus_tag LOCUS_13960 gene tpx 30872 31390 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024529.1 protein_id gnl|my_center|LOCUS_13960 31438 31815 gene locus_tag LOCUS_13970 31438 31815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 31823 34384 gene locus_tag LOCUS_13980 gene lon 31823 34384 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_13980 34389 34751 gene locus_tag LOCUS_13990 34389 34751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 34772 36550 gene locus_tag LOCUS_14000 34772 36550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 36574 37041 gene locus_tag LOCUS_14010 36574 37041 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098209.1 protein_id gnl|my_center|LOCUS_14010 38381 37089 gene locus_tag LOCUS_14020 38381 37089 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259028.1 protein_id gnl|my_center|LOCUS_14020 39336 38362 gene locus_tag LOCUS_14030 39336 38362 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_14030 41699 39333 gene locus_tag LOCUS_14040 41699 39333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933858.1 protein_id gnl|my_center|LOCUS_14040 43284 41689 gene locus_tag LOCUS_14050 43284 41689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 45391 43277 gene locus_tag LOCUS_14060 45391 43277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 46923 45388 gene locus_tag LOCUS_14070 46923 45388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 46995 47696 gene locus_tag LOCUS_14080 46995 47696 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_14080 48009 47749 gene locus_tag LOCUS_14090 48009 47749 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644609.1 protein_id gnl|my_center|LOCUS_14090 48756 48016 gene locus_tag LOCUS_14100 48756 48016 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_14100 49546 48749 gene locus_tag LOCUS_14110 gene pgeF 49546 48749 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_14110 50553 49549 gene locus_tag LOCUS_14120 50553 49549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 51113 50547 gene locus_tag LOCUS_14130 51113 50547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 51838 51110 gene locus_tag LOCUS_14140 51838 51110 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546387.1 protein_id gnl|my_center|LOCUS_14140 52930 51845 gene locus_tag LOCUS_14150 52930 51845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 54486 52957 gene locus_tag LOCUS_14160 gene hutH 54486 52957 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925153.1 protein_id gnl|my_center|LOCUS_14160 55207 54494 gene locus_tag LOCUS_14170 55207 54494 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057874.1 protein_id gnl|my_center|LOCUS_14170 55672 55217 gene locus_tag LOCUS_14180 gene smpB 55672 55217 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421925.1 protein_id gnl|my_center|LOCUS_14180 56934 55690 gene locus_tag LOCUS_14190 56934 55690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909244.1 protein_id gnl|my_center|LOCUS_14190 57049 57999 gene locus_tag LOCUS_14200 57049 57999 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583274.1 protein_id gnl|my_center|LOCUS_14200 57986 58213 gene locus_tag LOCUS_14210 57986 58213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 58194 58847 gene locus_tag LOCUS_14220 58194 58847 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_14220 59476 58844 gene locus_tag LOCUS_14230 59476 58844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 59567 60160 gene locus_tag LOCUS_14240 59567 60160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 61662 60157 gene locus_tag LOCUS_14250 gene zwf 61662 60157 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence18 979 1764 gene locus_tag LOCUS_14260 979 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1824 2603 gene locus_tag LOCUS_14270 1824 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4039 2600 gene locus_tag LOCUS_14280 4039 2600 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_14280 4170 5138 gene locus_tag LOCUS_14290 4170 5138 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107361.1 protein_id gnl|my_center|LOCUS_14290 5193 6977 gene locus_tag LOCUS_14300 gene metG 5193 6977 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259302.1 protein_id gnl|my_center|LOCUS_14300 7436 6996 gene locus_tag LOCUS_14310 7436 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 7552 8988 gene locus_tag LOCUS_14320 7552 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 10890 8989 gene locus_tag LOCUS_14330 10890 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 12449 10995 gene locus_tag LOCUS_14340 12449 10995 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258761.1 protein_id gnl|my_center|LOCUS_14340 13964 12456 gene locus_tag LOCUS_14350 13964 12456 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_14350 15969 13978 gene locus_tag LOCUS_14360 gene nuoL 15969 13978 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258759.1 protein_id gnl|my_center|LOCUS_14360 16285 15983 gene locus_tag LOCUS_14370 gene nuoK 16285 15983 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_14370 16825 16289 gene locus_tag LOCUS_14380 16825 16289 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_14380 17330 16839 gene locus_tag LOCUS_14390 gene nuoI 17330 16839 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258756.1 protein_id gnl|my_center|LOCUS_14390 18339 17335 gene locus_tag LOCUS_14400 gene nuoH 18339 17335 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_14400 20827 18341 gene locus_tag LOCUS_14410 gene nuoG 20827 18341 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258754.1 protein_id gnl|my_center|LOCUS_14410 22115 20862 gene locus_tag LOCUS_14420 gene nuoF 22115 20862 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909320.1 protein_id gnl|my_center|LOCUS_14420 22633 22112 gene locus_tag LOCUS_14430 22633 22112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 23871 22630 gene locus_tag LOCUS_14440 gene nuoD 23871 22630 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_14440 24818 23868 gene locus_tag LOCUS_14450 24818 23868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 25386 24874 gene locus_tag LOCUS_14460 25386 24874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 25906 25424 gene locus_tag LOCUS_14470 25906 25424 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258749.1 protein_id gnl|my_center|LOCUS_14470 26253 25897 gene locus_tag LOCUS_14480 gene ndhC 26253 25897 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258748.1 protein_id gnl|my_center|LOCUS_14480 28131 26476 gene locus_tag LOCUS_14490 28131 26476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 30091 28154 gene locus_tag LOCUS_14500 gene dnaG 30091 28154 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258766.1 protein_id gnl|my_center|LOCUS_14500 33428 30420 gene locus_tag LOCUS_14510 33428 30420 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725349.1 protein_id gnl|my_center|LOCUS_14510 33552 34091 gene locus_tag LOCUS_14520 33552 34091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 34880 34110 gene locus_tag LOCUS_14530 gene recO 34880 34110 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_14530 35294 34884 gene locus_tag LOCUS_14540 gene cdd 35294 34884 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_14540 36547 35297 gene locus_tag LOCUS_14550 36547 35297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 37904 36540 gene locus_tag LOCUS_14560 gene glmU 37904 36540 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073770.1 protein_id gnl|my_center|LOCUS_14560 38040 37969 gene locus_tag LOCUS_t00200 38040 37969 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 39276 38116 gene locus_tag LOCUS_14570 39276 38116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 40297 39302 gene locus_tag LOCUS_14580 40297 39302 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_14580 41332 40310 gene locus_tag LOCUS_14590 41332 40310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257499.1 protein_id gnl|my_center|LOCUS_14590 43315 41342 gene locus_tag LOCUS_14600 43315 41342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 45860 43437 gene locus_tag LOCUS_14610 45860 43437 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257113.1 protein_id gnl|my_center|LOCUS_14610 47070 46021 gene locus_tag LOCUS_14620 47070 46021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 47628 47143 gene locus_tag LOCUS_14630 47628 47143 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088110.1 protein_id gnl|my_center|LOCUS_14630 48695 47670 gene locus_tag LOCUS_14640 48695 47670 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533209.1 protein_id gnl|my_center|LOCUS_14640 50667 48790 gene locus_tag LOCUS_14650 50667 48790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 52471 50675 gene locus_tag LOCUS_14660 52471 50675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 53282 52500 gene locus_tag LOCUS_14670 53282 52500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 53568 53897 gene locus_tag LOCUS_14680 53568 53897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 54063 54362 gene locus_tag LOCUS_14690 54063 54362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 54362 55897 gene locus_tag LOCUS_14700 54362 55897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 55897 57258 gene locus_tag LOCUS_14710 55897 57258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 57312 59267 gene locus_tag LOCUS_14720 57312 59267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 59422 59625 gene locus_tag LOCUS_14730 59422 59625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence19 532 1293 gene locus_tag LOCUS_14740 532 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1310 1969 gene locus_tag LOCUS_14750 1310 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2053 3246 gene locus_tag LOCUS_14760 gene queG 2053 3246 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397385.1 protein_id gnl|my_center|LOCUS_14760 4583 3192 gene locus_tag LOCUS_14770 4583 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 5370 4612 gene locus_tag LOCUS_14780 5370 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 8389 5501 gene locus_tag LOCUS_14790 gene uvrA 8389 5501 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045572.1 protein_id gnl|my_center|LOCUS_14790 8535 9878 gene locus_tag LOCUS_14800 8535 9878 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964893.1 protein_id gnl|my_center|LOCUS_14800 10765 9869 gene locus_tag LOCUS_14810 10765 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 11205 10789 gene locus_tag LOCUS_14820 gene mce 11205 10789 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_14820 12866 11217 gene locus_tag LOCUS_14830 12866 11217 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_14830 12933 14183 gene locus_tag LOCUS_14840 12933 14183 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899806.1 protein_id gnl|my_center|LOCUS_14840 14184 14534 gene locus_tag LOCUS_14850 14184 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 14640 15203 gene locus_tag LOCUS_14860 gene rplI 14640 15203 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391680.1 protein_id gnl|my_center|LOCUS_14860 15296 16693 gene locus_tag LOCUS_14870 15296 16693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 16693 18021 gene locus_tag LOCUS_14880 gene rimO 16693 18021 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257724.1 protein_id gnl|my_center|LOCUS_14880 18303 18839 gene locus_tag LOCUS_14890 18303 18839 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889452.1 protein_id gnl|my_center|LOCUS_14890 18931 20082 gene locus_tag LOCUS_14900 18931 20082 CDS product acyl-CoA thioesterase/bile acid-CoA:amino acid N-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435280.1 protein_id gnl|my_center|LOCUS_14900 21533 20283 gene locus_tag LOCUS_14910 21533 20283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 23099 21555 gene locus_tag LOCUS_14920 23099 21555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 23239 24030 gene locus_tag LOCUS_14930 gene mntB 23239 24030 CDS product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 protein_id gnl|my_center|LOCUS_14930 24027 24854 gene locus_tag LOCUS_14940 24027 24854 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_14940 24851 25552 gene locus_tag LOCUS_14950 24851 25552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 27440 25542 gene locus_tag LOCUS_14960 gene selB 27440 25542 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_14960 28622 27444 gene locus_tag LOCUS_14970 28622 27444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 30055 28667 gene locus_tag LOCUS_14980 30055 28667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 30636 30052 gene locus_tag LOCUS_14990 30636 30052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 32259 30637 gene locus_tag LOCUS_15000 32259 30637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 33661 32243 gene locus_tag LOCUS_15010 gene hydA 33661 32243 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_15010 34261 33680 gene locus_tag LOCUS_15020 34261 33680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 35771 34299 gene locus_tag LOCUS_15030 35771 34299 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_15030 36670 35786 gene locus_tag LOCUS_15040 36670 35786 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_15040 38006 36759 gene locus_tag LOCUS_15050 38006 36759 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_15050 39069 38068 gene locus_tag LOCUS_15060 39069 38068 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259700.1 protein_id gnl|my_center|LOCUS_15060 40120 39080 gene locus_tag LOCUS_15070 40120 39080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259701.1 protein_id gnl|my_center|LOCUS_15070 41606 40134 gene locus_tag LOCUS_15080 41606 40134 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259702.1 protein_id gnl|my_center|LOCUS_15080 42900 41698 gene locus_tag LOCUS_15090 42900 41698 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259703.1 protein_id gnl|my_center|LOCUS_15090 44834 42999 gene locus_tag LOCUS_15100 gene ade 44834 42999 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948084.1 protein_id gnl|my_center|LOCUS_15100 45641 44991 gene locus_tag LOCUS_15110 45641 44991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 46724 45777 gene locus_tag LOCUS_15120 gene arcC 46724 45777 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393607.1 protein_id gnl|my_center|LOCUS_15120 47726 46746 gene locus_tag LOCUS_15130 gene argF 47726 46746 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_15130 49699 47780 gene locus_tag LOCUS_15140 49699 47780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 51713 49704 gene locus_tag LOCUS_15150 51713 49704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 52668 51718 gene locus_tag LOCUS_15160 gene pyrB 52668 51718 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_15160 53478 52714 gene locus_tag LOCUS_15170 53478 52714 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640897.1 protein_id gnl|my_center|LOCUS_15170 53825 53553 gene locus_tag LOCUS_15180 gene rsfS 53825 53553 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257176.1 protein_id gnl|my_center|LOCUS_15180 54520 53948 gene locus_tag LOCUS_15190 gene thpR 54520 53948 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_15190 56148 54847 gene locus_tag LOCUS_15200 56148 54847 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_15200 56300 57178 gene locus_tag LOCUS_15210 gene folD 56300 57178 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_15210 57191 58573 gene locus_tag LOCUS_15220 57191 58573 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence20 807 301 gene locus_tag LOCUS_15230 807 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2020 899 gene locus_tag LOCUS_15240 2020 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2742 2017 gene locus_tag LOCUS_15250 2742 2017 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377368.1 protein_id gnl|my_center|LOCUS_15250 2947 3597 gene locus_tag LOCUS_15260 2947 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3799 4221 gene locus_tag LOCUS_15270 3799 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 6384 4273 gene locus_tag LOCUS_15280 6384 4273 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_15280 6563 7909 gene locus_tag LOCUS_15290 6563 7909 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_15290 9771 7906 gene locus_tag LOCUS_15300 gene htpG 9771 7906 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257066.1 protein_id gnl|my_center|LOCUS_15300 9915 10832 gene locus_tag LOCUS_15310 9915 10832 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_15310 10933 11748 gene locus_tag LOCUS_15320 10933 11748 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_15320 11855 12616 gene locus_tag LOCUS_15330 11855 12616 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531971.1 protein_id gnl|my_center|LOCUS_15330 12613 13842 gene locus_tag LOCUS_15340 12613 13842 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_15340 13851 15071 gene locus_tag LOCUS_15350 13851 15071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021679.1 protein_id gnl|my_center|LOCUS_15350 15084 15788 gene locus_tag LOCUS_15360 15084 15788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_15360 15789 17024 gene locus_tag LOCUS_15370 15789 17024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 18268 17249 gene locus_tag LOCUS_15380 18268 17249 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_15380 18742 18371 gene locus_tag LOCUS_15390 18742 18371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 19553 18789 gene locus_tag LOCUS_15400 19553 18789 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909121.1 protein_id gnl|my_center|LOCUS_15400 20266 19601 gene locus_tag LOCUS_15410 20266 19601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 20387 21823 gene locus_tag LOCUS_15420 20387 21823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 23152 21836 gene locus_tag LOCUS_15430 23152 21836 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_15430 24051 23194 gene locus_tag LOCUS_15440 24051 23194 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_15440 24200 25522 gene locus_tag LOCUS_15450 gene ffh 24200 25522 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_15450 25630 25977 gene locus_tag LOCUS_15460 25630 25977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 26029 26265 gene locus_tag LOCUS_15470 26029 26265 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941305.1 protein_id gnl|my_center|LOCUS_15470 26276 26824 gene locus_tag LOCUS_15480 gene rimM 26276 26824 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699991.1 protein_id gnl|my_center|LOCUS_15480 26836 27954 gene locus_tag LOCUS_15490 gene dprA 26836 27954 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_15490 27947 29041 gene locus_tag LOCUS_15500 27947 29041 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_15500 29061 31436 gene locus_tag LOCUS_15510 gene topA 29061 31436 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_15510 31538 32671 gene locus_tag LOCUS_15520 31538 32671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 33190 32723 gene locus_tag LOCUS_15530 gene greA 33190 32723 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102591.1 protein_id gnl|my_center|LOCUS_15530 34425 33274 gene locus_tag LOCUS_15540 34425 33274 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_15540 35251 34448 gene locus_tag LOCUS_15550 35251 34448 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_15550 36213 35248 gene locus_tag LOCUS_15560 gene mvk 36213 35248 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_15560 37085 36216 gene locus_tag LOCUS_15570 37085 36216 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_15570 37161 37910 gene locus_tag LOCUS_15580 37161 37910 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_15580 37926 38561 gene locus_tag LOCUS_15590 37926 38561 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258777.1 protein_id gnl|my_center|LOCUS_15590 39428 38562 gene locus_tag LOCUS_15600 39428 38562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 40088 39432 gene locus_tag LOCUS_15610 40088 39432 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_15610 41320 40085 gene locus_tag LOCUS_15620 41320 40085 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256557.1 protein_id gnl|my_center|LOCUS_15620 41456 42949 gene locus_tag LOCUS_15630 41456 42949 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933561.1 protein_id gnl|my_center|LOCUS_15630 43024 44823 gene locus_tag LOCUS_15640 gene lepA 43024 44823 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_15640 44820 45848 gene locus_tag LOCUS_15650 44820 45848 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868892.1 protein_id gnl|my_center|LOCUS_15650 45867 46892 gene locus_tag LOCUS_15660 45867 46892 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909115.1 protein_id gnl|my_center|LOCUS_15660 46908 48083 gene locus_tag LOCUS_15670 46908 48083 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259312.1 protein_id gnl|my_center|LOCUS_15670 48073 48879 gene locus_tag LOCUS_15680 48073 48879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 48944 51109 gene locus_tag LOCUS_15690 48944 51109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 51117 56621 gene locus_tag LOCUS_15700 51117 56621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence21 1974 1051 gene locus_tag LOCUS_15710 1974 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 3484 1964 gene locus_tag LOCUS_15720 3484 1964 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463565.1 protein_id gnl|my_center|LOCUS_15720 4820 3498 gene locus_tag LOCUS_15730 4820 3498 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062390429.1 protein_id gnl|my_center|LOCUS_15730 5997 4993 gene locus_tag LOCUS_15740 5997 4993 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259623.1 protein_id gnl|my_center|LOCUS_15740 7083 6001 gene locus_tag LOCUS_15750 7083 6001 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_15750 7685 7080 gene locus_tag LOCUS_15760 7685 7080 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259738.1 protein_id gnl|my_center|LOCUS_15760 8565 7834 gene locus_tag LOCUS_15770 8565 7834 CDS product cephalosporin hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395953.1 protein_id gnl|my_center|LOCUS_15770 8735 9661 gene locus_tag LOCUS_15780 gene galE 8735 9661 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404514.1 protein_id gnl|my_center|LOCUS_15780 10166 9615 gene locus_tag LOCUS_15790 gene rfbC 10166 9615 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_15790 11214 10222 gene locus_tag LOCUS_15800 11214 10222 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546520.1 protein_id gnl|my_center|LOCUS_15800 11969 11196 gene locus_tag LOCUS_15810 gene rfbF 11969 11196 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435696.1 protein_id gnl|my_center|LOCUS_15810 12113 13342 gene locus_tag LOCUS_15820 12113 13342 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_15820 13364 14020 gene locus_tag LOCUS_15830 13364 14020 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255949.1 protein_id gnl|my_center|LOCUS_15830 14096 14024 gene locus_tag LOCUS_t00210 14096 14024 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14201 15121 gene locus_tag LOCUS_15840 14201 15121 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258871.1 protein_id gnl|my_center|LOCUS_15840 15243 18692 gene locus_tag LOCUS_15850 15243 18692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 19699 18701 gene locus_tag LOCUS_15860 19699 18701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 19818 22295 gene locus_tag LOCUS_15870 19818 22295 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_15870 22385 22891 gene locus_tag LOCUS_15880 gene def 22385 22891 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_15880 22895 24079 gene locus_tag LOCUS_15890 gene recF 22895 24079 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_15890 24773 24063 gene locus_tag LOCUS_15900 gene rsmG 24773 24063 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019628.1 protein_id gnl|my_center|LOCUS_15900 25053 25631 gene locus_tag LOCUS_15910 25053 25631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 25640 26185 gene locus_tag LOCUS_15920 25640 26185 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948772.1 protein_id gnl|my_center|LOCUS_15920 26314 26937 gene locus_tag LOCUS_15930 26314 26937 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081157.1 protein_id gnl|my_center|LOCUS_15930 27993 28382 gene locus_tag LOCUS_15940 27993 28382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 29616 28525 gene locus_tag LOCUS_15950 29616 28525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 29859 30929 gene locus_tag LOCUS_15960 29859 30929 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_15960 32156 30960 gene locus_tag LOCUS_15970 32156 30960 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_15970 32293 33288 gene locus_tag LOCUS_15980 32293 33288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 33292 34035 gene locus_tag LOCUS_15990 33292 34035 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_15990 34056 34739 gene locus_tag LOCUS_16000 34056 34739 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839987.1 protein_id gnl|my_center|LOCUS_16000 34859 35695 gene locus_tag LOCUS_16010 34859 35695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 35814 36230 gene locus_tag LOCUS_16020 35814 36230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 36438 37049 gene locus_tag LOCUS_16030 36438 37049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 37086 37559 gene locus_tag LOCUS_16040 37086 37559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 38661 37588 gene locus_tag LOCUS_16050 38661 37588 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049747239.1 protein_id gnl|my_center|LOCUS_16050 39650 38691 gene locus_tag LOCUS_16060 39650 38691 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886703.1 protein_id gnl|my_center|LOCUS_16060 40600 39806 gene locus_tag LOCUS_16070 40600 39806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 42337 40697 gene locus_tag LOCUS_16080 42337 40697 CDS product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096407.1 protein_id gnl|my_center|LOCUS_16080 43183 42485 gene locus_tag LOCUS_16090 43183 42485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 44129 43371 gene locus_tag LOCUS_16100 44129 43371 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_16100 44516 45145 gene locus_tag LOCUS_16110 44516 45145 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_16110 45155 46141 gene locus_tag LOCUS_16120 45155 46141 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_16120 46599 46805 gene locus_tag LOCUS_16130 46599 46805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 46787 47185 gene locus_tag LOCUS_16140 46787 47185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 48635 47247 gene locus_tag LOCUS_16150 48635 47247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 49140 53063 gene locus_tag LOCUS_16160 49140 53063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 53237 53650 gene locus_tag LOCUS_16170 gene rpsL 53237 53650 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_16170 53683 54153 gene locus_tag LOCUS_16180 gene rpsG 53683 54153 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088154.1 protein_id gnl|my_center|LOCUS_16180 54204 56273 gene locus_tag LOCUS_16190 gene fusA 54204 56273 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence22 1994 648 gene locus_tag LOCUS_16200 1994 648 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393891.1 protein_id gnl|my_center|LOCUS_16200 5019 2008 gene locus_tag LOCUS_16210 5019 2008 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_16210 5792 5016 gene locus_tag LOCUS_16220 5792 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 6842 5844 gene locus_tag LOCUS_16230 gene mer 6842 5844 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_16230 7498 6884 gene locus_tag LOCUS_16240 7498 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 8460 7495 gene locus_tag LOCUS_16250 gene cofD 8460 7495 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_16250 9224 8676 gene locus_tag LOCUS_16260 9224 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 9995 9228 gene locus_tag LOCUS_16270 gene cofE 9995 9228 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_16270 10678 10007 gene locus_tag LOCUS_16280 gene npdG 10678 10007 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_16280 12048 10699 gene locus_tag LOCUS_16290 gene ssnA 12048 10699 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_16290 12203 13582 gene locus_tag LOCUS_16300 12203 13582 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203446.1 protein_id gnl|my_center|LOCUS_16300 13589 14500 gene locus_tag LOCUS_16310 13589 14500 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480077.1 protein_id gnl|my_center|LOCUS_16310 14616 15059 gene locus_tag LOCUS_16320 14616 15059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 15090 15536 gene locus_tag LOCUS_16330 15090 15536 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_16330 15543 17690 gene locus_tag LOCUS_16340 15543 17690 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_16340 17687 18142 gene locus_tag LOCUS_16350 gene ybeY 17687 18142 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_16350 18143 18517 gene locus_tag LOCUS_16360 18143 18517 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_16360 18532 19374 gene locus_tag LOCUS_16370 18532 19374 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023463.1 protein_id gnl|my_center|LOCUS_16370 20063 19371 gene locus_tag LOCUS_16380 20063 19371 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_16380 20176 20562 gene locus_tag LOCUS_16390 20176 20562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 20584 20952 gene locus_tag LOCUS_16400 20584 20952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 20945 22339 gene locus_tag LOCUS_16410 20945 22339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 22428 23996 gene locus_tag LOCUS_16420 22428 23996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 23998 24429 gene locus_tag LOCUS_16430 23998 24429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 24491 24703 gene locus_tag LOCUS_16440 24491 24703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 25270 24716 gene locus_tag LOCUS_16450 25270 24716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 25465 25539 gene locus_tag LOCUS_t00220 25465 25539 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25571 26608 gene locus_tag LOCUS_16460 25571 26608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 27500 26610 gene locus_tag LOCUS_16470 27500 26610 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482188.1 protein_id gnl|my_center|LOCUS_16470 28066 27509 gene locus_tag LOCUS_16480 28066 27509 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243361.1 protein_id gnl|my_center|LOCUS_16480 29424 28153 gene locus_tag LOCUS_16490 29424 28153 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922239.1 protein_id gnl|my_center|LOCUS_16490 30432 29428 gene locus_tag LOCUS_16500 30432 29428 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_16500 31460 30429 gene locus_tag LOCUS_16510 31460 30429 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257219.1 protein_id gnl|my_center|LOCUS_16510 32429 31506 gene locus_tag LOCUS_16520 32429 31506 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312892.1 protein_id gnl|my_center|LOCUS_16520 33139 32624 gene locus_tag LOCUS_16530 33139 32624 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_16530 33825 33151 gene locus_tag LOCUS_16540 33825 33151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 35162 34086 gene locus_tag LOCUS_16550 35162 34086 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583224.1 protein_id gnl|my_center|LOCUS_16550 36954 35275 gene locus_tag LOCUS_16560 36954 35275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 37185 38108 gene locus_tag LOCUS_16570 37185 38108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173196.1 protein_id gnl|my_center|LOCUS_16570 38108 38920 gene locus_tag LOCUS_16580 38108 38920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 39964 41451 gene locus_tag LOCUS_16590 39964 41451 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875981.1 protein_id gnl|my_center|LOCUS_16590 42702 41500 gene locus_tag LOCUS_16600 42702 41500 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257004.1 protein_id gnl|my_center|LOCUS_16600 42826 42730 gene locus_tag LOCUS_t00230 42826 42730 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 43035 44243 gene locus_tag LOCUS_16610 43035 44243 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090946.1 protein_id gnl|my_center|LOCUS_16610 44429 45187 gene locus_tag LOCUS_16620 44429 45187 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944017.1 protein_id gnl|my_center|LOCUS_16620 46586 45474 gene locus_tag LOCUS_16630 46586 45474 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156275681.1 protein_id gnl|my_center|LOCUS_16630 47365 46613 gene locus_tag LOCUS_16640 47365 46613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392974.1 protein_id gnl|my_center|LOCUS_16640 48432 47362 gene locus_tag LOCUS_16650 48432 47362 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095240.1 protein_id gnl|my_center|LOCUS_16650 48869 48429 gene locus_tag LOCUS_16660 gene tsaA 48869 48429 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082829.1 protein_id gnl|my_center|LOCUS_16660 49483 48884 gene locus_tag LOCUS_16670 49483 48884 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545142.1 protein_id gnl|my_center|LOCUS_16670 49683 50076 gene locus_tag LOCUS_tm00010 49683 50076 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 51336 50137 gene locus_tag LOCUS_16680 gene rlmI 51336 50137 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116288.1 protein_id gnl|my_center|LOCUS_16680 53366 51333 gene locus_tag LOCUS_16690 gene ligA 53366 51333 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_16690 53798 53376 gene locus_tag LOCUS_16700 53798 53376 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071672.1 protein_id gnl|my_center|LOCUS_16700 53848 54210 gene locus_tag LOCUS_16710 53848 54210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence23 170 802 gene locus_tag LOCUS_16720 170 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1525 812 gene locus_tag LOCUS_16730 1525 812 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548940.1 protein_id gnl|my_center|LOCUS_16730 2510 1692 gene locus_tag LOCUS_16740 2510 1692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728488.1 protein_id gnl|my_center|LOCUS_16740 3493 2507 gene locus_tag LOCUS_16750 3493 2507 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_16750 4323 3490 gene locus_tag LOCUS_16760 4323 3490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256708.1 protein_id gnl|my_center|LOCUS_16760 5485 4625 gene locus_tag LOCUS_16770 5485 4625 CDS product NgoMIV family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951140.1 protein_id gnl|my_center|LOCUS_16770 6839 5490 gene locus_tag LOCUS_16780 6839 5490 CDS product DNA methyltransferase C1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545124.1 protein_id gnl|my_center|LOCUS_16780 7812 6997 gene locus_tag LOCUS_16790 7812 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 8476 8183 gene locus_tag LOCUS_16800 8476 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 8735 9796 gene locus_tag LOCUS_16810 8735 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 10483 9809 gene locus_tag LOCUS_16820 10483 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 11307 10501 gene locus_tag LOCUS_16830 11307 10501 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868514.1 protein_id gnl|my_center|LOCUS_16830 11869 11456 gene locus_tag LOCUS_16840 11869 11456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 12196 12627 gene locus_tag LOCUS_16850 12196 12627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 12700 13386 gene locus_tag LOCUS_16860 12700 13386 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_16860 13383 14507 gene locus_tag LOCUS_16870 13383 14507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 14953 14516 gene locus_tag LOCUS_16880 14953 14516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 15452 14994 gene locus_tag LOCUS_16890 15452 14994 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086355.1 protein_id gnl|my_center|LOCUS_16890 16231 15479 gene locus_tag LOCUS_16900 16231 15479 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063673.1 protein_id gnl|my_center|LOCUS_16900 16755 16240 gene locus_tag LOCUS_16910 16755 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 17768 16890 gene locus_tag LOCUS_16920 17768 16890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 18974 18045 gene locus_tag LOCUS_16930 18974 18045 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989862.1 protein_id gnl|my_center|LOCUS_16930 19640 21013 gene locus_tag LOCUS_16940 19640 21013 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254855.1 protein_id gnl|my_center|LOCUS_16940 21172 22035 gene locus_tag LOCUS_16950 21172 22035 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243671.1 protein_id gnl|my_center|LOCUS_16950 22057 22944 gene locus_tag LOCUS_16960 22057 22944 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331590.1 protein_id gnl|my_center|LOCUS_16960 22970 24085 gene locus_tag LOCUS_16970 gene ugpC 22970 24085 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_16970 24087 25202 gene locus_tag LOCUS_16980 gene ugpC 24087 25202 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_16980 25230 25811 gene locus_tag LOCUS_16990 25230 25811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16990 25839 26798 gene locus_tag LOCUS_17000 25839 26798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17000 26835 27479 gene locus_tag LOCUS_17010 26835 27479 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584081.1 protein_id gnl|my_center|LOCUS_17010 28574 27624 gene locus_tag LOCUS_17020 28574 27624 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257220.1 protein_id gnl|my_center|LOCUS_17020 28754 29614 gene locus_tag LOCUS_17030 gene lsrF 28754 29614 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219772.1 protein_id gnl|my_center|LOCUS_17030 29781 30665 gene locus_tag LOCUS_17040 29781 30665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 31399 30644 gene locus_tag LOCUS_17050 31399 30644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 33129 31450 gene locus_tag LOCUS_17060 33129 31450 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080372.1 protein_id gnl|my_center|LOCUS_17060 33252 33890 gene locus_tag LOCUS_17070 33252 33890 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_17070 34658 33894 gene locus_tag LOCUS_17080 34658 33894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 34748 35620 gene locus_tag LOCUS_17090 34748 35620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 35672 38032 gene locus_tag LOCUS_17100 35672 38032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 38536 38120 gene locus_tag LOCUS_17110 38536 38120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 38698 39054 gene locus_tag LOCUS_17120 38698 39054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 39057 40322 gene locus_tag LOCUS_17130 39057 40322 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528423.1 protein_id gnl|my_center|LOCUS_17130 40505 40432 gene locus_tag LOCUS_t00240 40505 40432 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 41541 40624 gene locus_tag LOCUS_17140 41541 40624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 43249 42035 gene locus_tag LOCUS_17150 43249 42035 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459075.1 protein_id gnl|my_center|LOCUS_17150 43393 44076 gene locus_tag LOCUS_17160 43393 44076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 44207 48016 gene locus_tag LOCUS_17170 44207 48016 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_17170 48009 48830 gene locus_tag LOCUS_17180 48009 48830 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_17180 50824 48884 gene locus_tag LOCUS_17190 50824 48884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 51631 50957 gene locus_tag LOCUS_17200 51631 50957 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence24 745 1971 gene locus_tag LOCUS_17210 745 1971 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_17210 1977 2705 gene locus_tag LOCUS_17220 1977 2705 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_17220 2782 3762 gene locus_tag LOCUS_17230 2782 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3872 5746 gene locus_tag LOCUS_17240 3872 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 5764 8562 gene locus_tag LOCUS_17250 5764 8562 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_17250 9869 8565 gene locus_tag LOCUS_17260 gene lysA 9869 8565 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 protein_id gnl|my_center|LOCUS_17260 10987 9893 gene locus_tag LOCUS_17270 10987 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 13287 10984 gene locus_tag LOCUS_17280 13287 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 14829 13417 gene locus_tag LOCUS_17290 gene glnA 14829 13417 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_17290 16589 14979 gene locus_tag LOCUS_17300 16589 14979 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986845.1 protein_id gnl|my_center|LOCUS_17300 18143 16842 gene locus_tag LOCUS_17310 18143 16842 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437980.1 protein_id gnl|my_center|LOCUS_17310 18562 21960 gene locus_tag LOCUS_17320 18562 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 23917 22013 gene locus_tag LOCUS_17330 23917 22013 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070900.1 protein_id gnl|my_center|LOCUS_17330 24268 25686 gene locus_tag LOCUS_17340 24268 25686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 25717 27165 gene locus_tag LOCUS_17350 25717 27165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 27201 28619 gene locus_tag LOCUS_17360 27201 28619 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214102.1 protein_id gnl|my_center|LOCUS_17360 28619 29374 gene locus_tag LOCUS_17370 28619 29374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_17370 29383 30621 gene locus_tag LOCUS_17380 29383 30621 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_17380 30662 31333 gene locus_tag LOCUS_17390 30662 31333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 31652 32497 gene locus_tag LOCUS_17400 31652 32497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 protein_id gnl|my_center|LOCUS_17400 32639 33709 gene locus_tag LOCUS_17410 32639 33709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 33706 36114 gene locus_tag LOCUS_17420 33706 36114 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 protein_id gnl|my_center|LOCUS_17420 36263 37372 gene locus_tag LOCUS_17430 36263 37372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 37369 38601 gene locus_tag LOCUS_17440 37369 38601 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256713.1 protein_id gnl|my_center|LOCUS_17440 38598 39131 gene locus_tag LOCUS_17450 38598 39131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 41212 39179 gene locus_tag LOCUS_17460 41212 39179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 42650 41214 gene locus_tag LOCUS_17470 42650 41214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 43177 42773 gene locus_tag LOCUS_17480 43177 42773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 44103 43366 gene locus_tag LOCUS_17490 44103 43366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 45138 44350 gene locus_tag LOCUS_17500 45138 44350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 45310 47568 gene locus_tag LOCUS_17510 45310 47568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 47644 48360 gene locus_tag LOCUS_17520 47644 48360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 48445 49476 gene locus_tag LOCUS_17530 48445 49476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 49517 51388 gene locus_tag LOCUS_17540 49517 51388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence25 2304 1348 gene locus_tag LOCUS_17550 2304 1348 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547856.1 protein_id gnl|my_center|LOCUS_17550 2501 2674 gene locus_tag LOCUS_17560 2501 2674 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_17560 2787 3440 gene locus_tag LOCUS_17570 2787 3440 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_17570 3707 3447 gene locus_tag LOCUS_17580 3707 3447 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 protein_id gnl|my_center|LOCUS_17580 5089 3911 gene locus_tag LOCUS_17590 gene galK 5089 3911 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053399.1 protein_id gnl|my_center|LOCUS_17590 6171 5131 gene locus_tag LOCUS_17600 6171 5131 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909272.1 protein_id gnl|my_center|LOCUS_17600 6428 6634 gene locus_tag LOCUS_17610 6428 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 7688 6678 gene locus_tag LOCUS_17620 7688 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 8379 7741 gene locus_tag LOCUS_17630 8379 7741 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_17630 8521 9531 gene locus_tag LOCUS_17640 gene galE 8521 9531 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992438.1 protein_id gnl|my_center|LOCUS_17640 10552 9521 gene locus_tag LOCUS_17650 gene holA 10552 9521 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125956.1 protein_id gnl|my_center|LOCUS_17650 11051 10563 gene locus_tag LOCUS_17660 11051 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 12394 11054 gene locus_tag LOCUS_17670 gene radA 12394 11054 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_17670 15116 12600 gene locus_tag LOCUS_17680 15116 12600 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258333.1 protein_id gnl|my_center|LOCUS_17680 16871 15366 gene locus_tag LOCUS_17690 gene lysS 16871 15366 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257111.1 protein_id gnl|my_center|LOCUS_17690 17409 16945 gene locus_tag LOCUS_17700 gene greA 17409 16945 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_17700 17761 18573 gene locus_tag LOCUS_17710 17761 18573 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679291.1 protein_id gnl|my_center|LOCUS_17710 20968 18599 gene locus_tag LOCUS_17720 20968 18599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 21310 21726 gene locus_tag LOCUS_17730 gene ytrA 21310 21726 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_17730 21723 22718 gene locus_tag LOCUS_17740 21723 22718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 22737 23387 gene locus_tag LOCUS_17750 22737 23387 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065619.1 protein_id gnl|my_center|LOCUS_17750 25996 23630 gene locus_tag LOCUS_17760 25996 23630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 27190 26063 gene locus_tag LOCUS_17770 gene dnaN 27190 26063 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_17770 29120 27366 gene locus_tag LOCUS_17780 29120 27366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 29174 29593 gene locus_tag LOCUS_17790 29174 29593 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903023.1 protein_id gnl|my_center|LOCUS_17790 29590 30651 gene locus_tag LOCUS_17800 29590 30651 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930034.1 protein_id gnl|my_center|LOCUS_17800 30652 32139 gene locus_tag LOCUS_17810 30652 32139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 32230 32484 gene locus_tag LOCUS_17820 32230 32484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 32471 32623 gene locus_tag LOCUS_17830 32471 32623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 33671 33177 gene locus_tag LOCUS_17840 33671 33177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 33863 34465 gene locus_tag LOCUS_17850 33863 34465 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942571.1 protein_id gnl|my_center|LOCUS_17850 34485 36779 gene locus_tag LOCUS_17860 34485 36779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 36766 37155 gene locus_tag LOCUS_17870 36766 37155 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099935.1 protein_id gnl|my_center|LOCUS_17870 37244 38314 gene locus_tag LOCUS_17880 37244 38314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 38341 39534 gene locus_tag LOCUS_17890 38341 39534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 39573 39806 gene locus_tag LOCUS_17900 39573 39806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 39751 40206 gene locus_tag LOCUS_17910 39751 40206 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_17910 40305 40379 gene locus_tag LOCUS_t00250 40305 40379 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 41207 40647 gene locus_tag LOCUS_17920 41207 40647 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816077.1 protein_id gnl|my_center|LOCUS_17920 41640 41239 gene locus_tag LOCUS_17930 41640 41239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 42145 41654 gene locus_tag LOCUS_17940 42145 41654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272655.1 protein_id gnl|my_center|LOCUS_17940 42696 42959 gene locus_tag LOCUS_17950 42696 42959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 43823 43542 gene locus_tag LOCUS_17960 43823 43542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 43831 45363 gene locus_tag LOCUS_17970 43831 45363 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_17970 45360 46856 gene locus_tag LOCUS_17980 45360 46856 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_17980 47598 49088 gene locus_tag LOCUS_17990 47598 49088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 49342 49923 gene locus_tag LOCUS_18000 49342 49923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 49934 50797 gene locus_tag LOCUS_18010 49934 50797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence26 1143 220 gene locus_tag LOCUS_18020 1143 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2668 1175 gene locus_tag LOCUS_18030 gene gntK 2668 1175 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906368.1 protein_id gnl|my_center|LOCUS_18030 3620 2856 gene locus_tag LOCUS_18040 gene fabG 3620 2856 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143495.1 protein_id gnl|my_center|LOCUS_18040 4429 3641 gene locus_tag LOCUS_18050 4429 3641 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_18050 5386 4439 gene locus_tag LOCUS_18060 5386 4439 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080917.1 protein_id gnl|my_center|LOCUS_18060 6557 5472 gene locus_tag LOCUS_18070 6557 5472 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529471.1 protein_id gnl|my_center|LOCUS_18070 7613 6660 gene locus_tag LOCUS_18080 gene rbsC 7613 6660 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419501.1 protein_id gnl|my_center|LOCUS_18080 9172 7664 gene locus_tag LOCUS_18090 gene gguA 9172 7664 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583992.1 protein_id gnl|my_center|LOCUS_18090 9423 10253 gene locus_tag LOCUS_18100 9423 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 10578 11021 gene locus_tag LOCUS_18110 10578 11021 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_18110 12014 11046 gene locus_tag LOCUS_18120 12014 11046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18120 13126 12029 gene locus_tag LOCUS_18130 13126 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18130 13324 13749 gene locus_tag LOCUS_18140 13324 13749 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_18140 13767 14816 gene locus_tag LOCUS_18150 gene meaB 13767 14816 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_18150 14847 16166 gene locus_tag LOCUS_18160 gene aspS 14847 16166 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_18160 16290 17285 gene locus_tag LOCUS_18170 16290 17285 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_18170 17295 18125 gene locus_tag LOCUS_18180 gene mutM 17295 18125 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288323.1 protein_id gnl|my_center|LOCUS_18180 18125 18991 gene locus_tag LOCUS_18190 18125 18991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 19544 18993 gene locus_tag LOCUS_18200 19544 18993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 19621 20016 gene locus_tag LOCUS_18210 19621 20016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 20307 20059 gene locus_tag LOCUS_18220 20307 20059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 20790 20317 gene locus_tag LOCUS_18230 20790 20317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 20815 20979 gene locus_tag LOCUS_18240 20815 20979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 22392 20956 gene locus_tag LOCUS_18250 22392 20956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 23444 22467 gene locus_tag LOCUS_18260 23444 22467 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081440.1 protein_id gnl|my_center|LOCUS_18260 24533 23469 gene locus_tag LOCUS_18270 24533 23469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081437.1 protein_id gnl|my_center|LOCUS_18270 26697 24661 gene locus_tag LOCUS_18280 26697 24661 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081506.1 protein_id gnl|my_center|LOCUS_18280 27772 26786 gene locus_tag LOCUS_18290 27772 26786 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_18290 28758 27772 gene locus_tag LOCUS_18300 28758 27772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_18300 29835 28921 gene locus_tag LOCUS_18310 gene rsgA 29835 28921 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_18310 32093 29832 gene locus_tag LOCUS_18320 32093 29832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 32751 32086 gene locus_tag LOCUS_18330 32751 32086 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_18330 32845 33417 gene locus_tag LOCUS_18340 gene xpt 32845 33417 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888255.1 protein_id gnl|my_center|LOCUS_18340 33543 34013 gene locus_tag LOCUS_18350 33543 34013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 34110 36635 gene locus_tag LOCUS_18360 gene gyrA 34110 36635 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_18360 36898 36683 gene locus_tag LOCUS_18370 36898 36683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 37723 36914 gene locus_tag LOCUS_18380 37723 36914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 39472 37733 gene locus_tag LOCUS_18390 gene polX 39472 37733 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_18390 39776 39525 gene locus_tag LOCUS_18400 39776 39525 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197795.1 protein_id gnl|my_center|LOCUS_18400 42287 39873 gene locus_tag LOCUS_18410 42287 39873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 42842 42384 gene locus_tag LOCUS_18420 42842 42384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 44064 42835 gene locus_tag LOCUS_18430 44064 42835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 45164 44061 gene locus_tag LOCUS_18440 45164 44061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 47719 45161 gene locus_tag LOCUS_18450 47719 45161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 49048 47732 gene locus_tag LOCUS_18460 49048 47732 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_18460 50337 49072 gene locus_tag LOCUS_18470 50337 49072 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909096.1 protein_id gnl|my_center|LOCUS_18470 50937 50467 gene locus_tag LOCUS_18480 50937 50467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence27 676 20 gene locus_tag LOCUS_18490 676 20 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_18490 2127 673 gene locus_tag LOCUS_18500 2127 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2531 4195 gene locus_tag LOCUS_18510 2531 4195 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670447.1 protein_id gnl|my_center|LOCUS_18510 4192 5010 gene locus_tag LOCUS_18520 4192 5010 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098166.1 protein_id gnl|my_center|LOCUS_18520 5709 5017 gene locus_tag LOCUS_18530 5709 5017 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815911.1 protein_id gnl|my_center|LOCUS_18530 5858 6793 gene locus_tag LOCUS_18540 5858 6793 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_18540 7816 6845 gene locus_tag LOCUS_18550 7816 6845 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_18550 9080 7944 gene locus_tag LOCUS_18560 9080 7944 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_18560 9823 9116 gene locus_tag LOCUS_18570 gene deoC 9823 9116 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356166.1 protein_id gnl|my_center|LOCUS_18570 11155 10022 gene locus_tag LOCUS_18580 11155 10022 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_18580 12598 11237 gene locus_tag LOCUS_18590 12598 11237 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_18590 13218 12652 gene locus_tag LOCUS_18600 13218 12652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 13860 13402 gene locus_tag LOCUS_18610 13860 13402 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860814.1 protein_id gnl|my_center|LOCUS_18610 14861 13953 gene locus_tag LOCUS_18620 14861 13953 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_18620 15231 14863 gene locus_tag LOCUS_18630 15231 14863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 15740 17407 gene locus_tag LOCUS_18640 gene ilvD 15740 17407 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255814.1 protein_id gnl|my_center|LOCUS_18640 17436 19160 gene locus_tag LOCUS_18650 17436 19160 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_18650 19168 19704 gene locus_tag LOCUS_18660 gene ilvN 19168 19704 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_18660 19737 20801 gene locus_tag LOCUS_18670 gene ilvC 19737 20801 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_18670 20807 22438 gene locus_tag LOCUS_18680 20807 22438 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256076.1 protein_id gnl|my_center|LOCUS_18680 22463 22756 gene locus_tag LOCUS_18690 22463 22756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 22759 24180 gene locus_tag LOCUS_18700 gene leuC 22759 24180 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_18700 24196 24789 gene locus_tag LOCUS_18710 gene leuD 24196 24789 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_18710 24801 26372 gene locus_tag LOCUS_18720 gene cimA 24801 26372 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_18720 26376 27434 gene locus_tag LOCUS_18730 gene leuB 26376 27434 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_18730 27463 28383 gene locus_tag LOCUS_18740 27463 28383 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_18740 28645 29547 gene locus_tag LOCUS_18750 28645 29547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 29776 30300 gene locus_tag LOCUS_18760 29776 30300 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188962.1 protein_id gnl|my_center|LOCUS_18760 30313 30633 gene locus_tag LOCUS_18770 30313 30633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 30967 32109 gene locus_tag LOCUS_18780 30967 32109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 32239 33132 gene locus_tag LOCUS_18790 32239 33132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 33257 33847 gene locus_tag LOCUS_18800 33257 33847 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18800 34365 33964 gene locus_tag LOCUS_18810 gene rbsD 34365 33964 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254480.1 protein_id gnl|my_center|LOCUS_18810 35534 34461 gene locus_tag LOCUS_18820 35534 34461 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_18820 36391 35570 gene locus_tag LOCUS_18830 36391 35570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 37214 36393 gene locus_tag LOCUS_18840 37214 36393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 38273 37221 gene locus_tag LOCUS_18850 38273 37221 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_18850 39365 38358 gene locus_tag LOCUS_18860 39365 38358 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_18860 39596 40435 gene locus_tag LOCUS_18870 gene yesN 39596 40435 CDS product two-component system response regulator YesN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244566.1 protein_id gnl|my_center|LOCUS_18870 40410 42194 gene locus_tag LOCUS_18880 40410 42194 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_18880 42234 43226 gene locus_tag LOCUS_18890 gene rbsB 42234 43226 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759000.1 protein_id gnl|my_center|LOCUS_18890 43399 44928 gene locus_tag LOCUS_18900 gene gguA 43399 44928 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992366.1 protein_id gnl|my_center|LOCUS_18900 44979 45986 gene locus_tag LOCUS_18910 44979 45986 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311044.1 protein_id gnl|my_center|LOCUS_18910 46096 47091 gene locus_tag LOCUS_18920 46096 47091 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311043.1 protein_id gnl|my_center|LOCUS_18920 47359 48501 gene locus_tag LOCUS_18930 47359 48501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 48660 49676 gene locus_tag LOCUS_18940 48660 49676 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256287.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence28 167 1678 gene locus_tag LOCUS_18950 167 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3669 1702 gene locus_tag LOCUS_18960 3669 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 6210 3880 gene locus_tag LOCUS_18970 6210 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 6536 7696 gene locus_tag LOCUS_18980 6536 7696 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_18980 7693 8730 gene locus_tag LOCUS_18990 7693 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 9096 8707 gene locus_tag LOCUS_19000 9096 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 9668 9108 gene locus_tag LOCUS_19010 9668 9108 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521511.1 protein_id gnl|my_center|LOCUS_19010 10422 9670 gene locus_tag LOCUS_19020 10422 9670 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_19020 10561 12801 gene locus_tag LOCUS_19030 10561 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 13514 12858 gene locus_tag LOCUS_19040 13514 12858 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949128.1 protein_id gnl|my_center|LOCUS_19040 14487 13768 gene locus_tag LOCUS_19050 14487 13768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 14673 15530 gene locus_tag LOCUS_19060 14673 15530 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_19060 15926 16135 gene locus_tag LOCUS_19070 15926 16135 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_19070 16981 17961 gene locus_tag LOCUS_19080 16981 17961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 18371 18012 gene locus_tag LOCUS_19090 18371 18012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 18555 20378 gene locus_tag LOCUS_19100 18555 20378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211330736.1 protein_id gnl|my_center|LOCUS_19100 20832 20386 gene locus_tag LOCUS_19110 gene aroQ 20832 20386 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_19110 22414 20801 gene locus_tag LOCUS_19120 22414 20801 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052140.1 protein_id gnl|my_center|LOCUS_19120 23583 22411 gene locus_tag LOCUS_19130 gene aroC 23583 22411 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933099.1 protein_id gnl|my_center|LOCUS_19130 24446 23580 gene locus_tag LOCUS_19140 24446 23580 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405001.1 protein_id gnl|my_center|LOCUS_19140 25810 24446 gene locus_tag LOCUS_19150 gene aroA 25810 24446 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_19150 26685 25807 gene locus_tag LOCUS_19160 26685 25807 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_19160 27697 26687 gene locus_tag LOCUS_19170 gene aroF 27697 26687 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_19170 28129 27728 gene locus_tag LOCUS_19180 gene aroH 28129 27728 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_19180 29178 28333 gene locus_tag LOCUS_19190 gene pheA 29178 28333 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933330.1 protein_id gnl|my_center|LOCUS_19190 29425 29195 gene locus_tag LOCUS_19200 29425 29195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350508.1 protein_id gnl|my_center|LOCUS_19200 30089 29520 gene locus_tag LOCUS_19210 30089 29520 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236362.1 protein_id gnl|my_center|LOCUS_19210 30283 31215 gene locus_tag LOCUS_19220 30283 31215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 31379 31984 gene locus_tag LOCUS_19230 31379 31984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 32049 32402 gene locus_tag LOCUS_19240 32049 32402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 34748 32421 gene locus_tag LOCUS_19250 34748 32421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 34927 35619 gene locus_tag LOCUS_19260 34927 35619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 35869 36246 gene locus_tag LOCUS_19270 35869 36246 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660364.1 protein_id gnl|my_center|LOCUS_19270 36308 36544 gene locus_tag LOCUS_19280 36308 36544 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255927.1 protein_id gnl|my_center|LOCUS_19280 36630 37676 gene locus_tag LOCUS_19290 36630 37676 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660365.1 protein_id gnl|my_center|LOCUS_19290 37684 38439 gene locus_tag LOCUS_19300 37684 38439 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545035.1 protein_id gnl|my_center|LOCUS_19300 38459 39061 gene locus_tag LOCUS_19310 38459 39061 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545946.1 protein_id gnl|my_center|LOCUS_19310 39241 39465 gene locus_tag LOCUS_19320 39241 39465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 39501 40106 gene locus_tag LOCUS_19330 39501 40106 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927076.1 protein_id gnl|my_center|LOCUS_19330 40227 41468 gene locus_tag LOCUS_19340 40227 41468 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870223.1 protein_id gnl|my_center|LOCUS_19340 41519 41686 gene locus_tag LOCUS_19350 41519 41686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 41679 42551 gene locus_tag LOCUS_19360 41679 42551 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941155.1 protein_id gnl|my_center|LOCUS_19360 42761 44242 gene locus_tag LOCUS_19370 42761 44242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 44278 44658 gene locus_tag LOCUS_19380 44278 44658 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_19380 44961 45299 gene locus_tag LOCUS_19390 44961 45299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 45426 46331 gene locus_tag LOCUS_19400 45426 46331 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868648.1 protein_id gnl|my_center|LOCUS_19400 46691 46494 gene locus_tag LOCUS_19410 46691 46494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 48087 47032 gene locus_tag LOCUS_19420 gene arsB 48087 47032 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943585.1 protein_id gnl|my_center|LOCUS_19420 49452 49015 gene locus_tag LOCUS_19430 49452 49015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence29 80 1477 gene locus_tag LOCUS_19440 gene lpdA 80 1477 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085912.1 protein_id gnl|my_center|LOCUS_19440 1481 5518 gene locus_tag LOCUS_19450 1481 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 5692 6918 gene locus_tag LOCUS_19460 gene rpsA 5692 6918 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_19460 6975 8069 gene locus_tag LOCUS_19470 6975 8069 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_19470 8066 8623 gene locus_tag LOCUS_19480 8066 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 8927 9379 gene locus_tag LOCUS_19490 gene nuoE 8927 9379 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_19490 9372 11237 gene locus_tag LOCUS_19500 gene nuoF 9372 11237 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_19500 11234 13303 gene locus_tag LOCUS_19510 11234 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 13300 14130 gene locus_tag LOCUS_19520 13300 14130 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_19520 14139 15563 gene locus_tag LOCUS_19530 gene gltA 14139 15563 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_19530 15705 16997 gene locus_tag LOCUS_19540 15705 16997 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_19540 16994 18283 gene locus_tag LOCUS_19550 16994 18283 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_19550 18287 18673 gene locus_tag LOCUS_19560 gene acpS 18287 18673 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174182.1 protein_id gnl|my_center|LOCUS_19560 18670 19326 gene locus_tag LOCUS_19570 18670 19326 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_19570 19323 20243 gene locus_tag LOCUS_19580 19323 20243 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_19580 20500 20255 gene locus_tag LOCUS_19590 20500 20255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 20650 21207 gene locus_tag LOCUS_19600 gene frr 20650 21207 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259405.1 protein_id gnl|my_center|LOCUS_19600 21220 21951 gene locus_tag LOCUS_19610 21220 21951 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_19610 21948 22772 gene locus_tag LOCUS_19620 21948 22772 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141396.1 protein_id gnl|my_center|LOCUS_19620 23620 22829 gene locus_tag LOCUS_19630 23620 22829 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256951.1 protein_id gnl|my_center|LOCUS_19630 24772 23687 gene locus_tag LOCUS_19640 24772 23687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 25212 24772 gene locus_tag LOCUS_19650 25212 24772 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080225.1 protein_id gnl|my_center|LOCUS_19650 25856 25233 gene locus_tag LOCUS_19660 25856 25233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 26664 25864 gene locus_tag LOCUS_19670 26664 25864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 26965 27897 gene locus_tag LOCUS_19680 gene cysK 26965 27897 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_19680 27910 28647 gene locus_tag LOCUS_19690 gene cysE 27910 28647 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_19690 29721 28648 gene locus_tag LOCUS_19700 29721 28648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 29859 30431 gene locus_tag LOCUS_19710 29859 30431 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256302.1 protein_id gnl|my_center|LOCUS_19710 30928 30512 gene locus_tag LOCUS_19720 30928 30512 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_19720 31768 30998 gene locus_tag LOCUS_19730 gene surE 31768 30998 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258539.1 protein_id gnl|my_center|LOCUS_19730 32416 31841 gene locus_tag LOCUS_19740 32416 31841 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_19740 32642 33505 gene locus_tag LOCUS_19750 gene rpsB 32642 33505 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_19750 33541 34149 gene locus_tag LOCUS_19760 gene tsf 33541 34149 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_19760 34205 34921 gene locus_tag LOCUS_19770 gene pyrH 34205 34921 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_19770 35111 35359 gene locus_tag LOCUS_19780 35111 35359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 35545 35706 gene locus_tag LOCUS_19790 35545 35706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 36048 36374 gene locus_tag LOCUS_19800 36048 36374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 36824 37867 gene locus_tag LOCUS_19810 gene pheS 36824 37867 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_19810 37864 40404 gene locus_tag LOCUS_19820 gene pheT 37864 40404 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_19820 42059 40455 gene locus_tag LOCUS_19830 42059 40455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 42444 42085 gene locus_tag LOCUS_19840 42444 42085 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_19840 43284 42523 gene locus_tag LOCUS_19850 43284 42523 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_19850 43414 44610 gene locus_tag LOCUS_19860 43414 44610 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772618.1 protein_id gnl|my_center|LOCUS_19860 45702 44743 gene locus_tag LOCUS_19870 45702 44743 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_19870 47060 45720 gene locus_tag LOCUS_19880 47060 45720 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479718.1 protein_id gnl|my_center|LOCUS_19880 47257 47883 gene locus_tag LOCUS_19890 47257 47883 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_19890 47876 48907 gene locus_tag LOCUS_19900 47876 48907 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence30 1423 365 gene locus_tag LOCUS_19910 1423 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1576 2187 gene locus_tag LOCUS_19920 1576 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2208 2654 gene locus_tag LOCUS_19930 2208 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 3272 2667 gene locus_tag LOCUS_19940 3272 2667 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_19940 3465 3292 gene locus_tag LOCUS_19950 3465 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 3733 3515 gene locus_tag LOCUS_19960 3733 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 4444 3809 gene locus_tag LOCUS_19970 4444 3809 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257105.1 protein_id gnl|my_center|LOCUS_19970 4588 5100 gene locus_tag LOCUS_19980 4588 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 5184 5729 gene locus_tag LOCUS_19990 5184 5729 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065297.1 protein_id gnl|my_center|LOCUS_19990 6017 6562 gene locus_tag LOCUS_20000 6017 6562 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065297.1 protein_id gnl|my_center|LOCUS_20000 7509 6637 gene locus_tag LOCUS_20010 7509 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 7709 8503 gene locus_tag LOCUS_20020 7709 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 8535 9554 gene locus_tag LOCUS_20030 gene add 8535 9554 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256408.1 protein_id gnl|my_center|LOCUS_20030 10857 9583 gene locus_tag LOCUS_20040 10857 9583 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970205.1 protein_id gnl|my_center|LOCUS_20040 12074 10854 gene locus_tag LOCUS_20050 12074 10854 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204046.1 protein_id gnl|my_center|LOCUS_20050 12338 12802 gene locus_tag LOCUS_20060 12338 12802 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_20060 15296 12828 gene locus_tag LOCUS_20070 15296 12828 CDS product DUF4084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065525186.1 protein_id gnl|my_center|LOCUS_20070 16616 15438 gene locus_tag LOCUS_20080 16616 15438 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582733.1 protein_id gnl|my_center|LOCUS_20080 17421 16717 gene locus_tag LOCUS_20090 17421 16717 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259517.1 protein_id gnl|my_center|LOCUS_20090 18217 17426 gene locus_tag LOCUS_20100 gene cbiQ 18217 17426 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259516.1 protein_id gnl|my_center|LOCUS_20100 19189 18233 gene locus_tag LOCUS_20110 19189 18233 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259515.1 protein_id gnl|my_center|LOCUS_20110 19295 19678 gene locus_tag LOCUS_20120 19295 19678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 21151 19727 gene locus_tag LOCUS_20130 21151 19727 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860163.1 protein_id gnl|my_center|LOCUS_20130 21949 21233 gene locus_tag LOCUS_20140 21949 21233 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_20140 22087 22713 gene locus_tag LOCUS_20150 22087 22713 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393334.1 protein_id gnl|my_center|LOCUS_20150 22734 23096 gene locus_tag LOCUS_20160 22734 23096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 24069 23104 gene locus_tag LOCUS_20170 24069 23104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 24391 24579 gene locus_tag LOCUS_20180 24391 24579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 24788 25669 gene locus_tag LOCUS_20190 24788 25669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 25748 26404 gene locus_tag LOCUS_20200 25748 26404 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404017.1 protein_id gnl|my_center|LOCUS_20200 26503 27093 gene locus_tag LOCUS_20210 26503 27093 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_20210 27074 27613 gene locus_tag LOCUS_20220 27074 27613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 27606 28766 gene locus_tag LOCUS_20230 27606 28766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 28793 29674 gene locus_tag LOCUS_20240 28793 29674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 30876 29755 gene locus_tag LOCUS_20250 30876 29755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 30952 32091 gene locus_tag LOCUS_20260 30952 32091 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728149.1 protein_id gnl|my_center|LOCUS_20260 33292 32102 gene locus_tag LOCUS_20270 33292 32102 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258460.1 protein_id gnl|my_center|LOCUS_20270 33912 33298 gene locus_tag LOCUS_20280 33912 33298 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398676.1 protein_id gnl|my_center|LOCUS_20280 35114 33900 gene locus_tag LOCUS_20290 gene obgE 35114 33900 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497128.1 protein_id gnl|my_center|LOCUS_20290 36484 35162 gene locus_tag LOCUS_20300 36484 35162 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_20300 38166 36517 gene locus_tag LOCUS_20310 gene argS 38166 36517 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964359.1 protein_id gnl|my_center|LOCUS_20310 38747 38481 gene locus_tag LOCUS_20320 gene rpsT 38747 38481 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258282.1 protein_id gnl|my_center|LOCUS_20320 39324 38878 gene locus_tag LOCUS_20330 39324 38878 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888078.1 protein_id gnl|my_center|LOCUS_20330 39589 40086 gene locus_tag LOCUS_20340 39589 40086 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_20340 40395 40162 gene locus_tag LOCUS_20350 40395 40162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 41026 40637 gene locus_tag LOCUS_20360 41026 40637 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080625.1 protein_id gnl|my_center|LOCUS_20360 41266 41664 gene locus_tag LOCUS_20370 41266 41664 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022881.1 protein_id gnl|my_center|LOCUS_20370 41725 42066 gene locus_tag LOCUS_20380 41725 42066 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545235.1 protein_id gnl|my_center|LOCUS_20380 42644 42946 gene locus_tag LOCUS_20390 42644 42946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 42950 43135 gene locus_tag LOCUS_20400 42950 43135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 43340 44236 gene locus_tag LOCUS_20410 43340 44236 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_20410 44252 44554 gene locus_tag LOCUS_20420 44252 44554 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870640.1 protein_id gnl|my_center|LOCUS_20420 44629 45075 gene locus_tag LOCUS_20430 44629 45075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 45381 45214 gene locus_tag LOCUS_20440 45381 45214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 45841 46128 gene locus_tag LOCUS_20450 45841 46128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 46180 46920 gene locus_tag LOCUS_20460 46180 46920 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392941.1 protein_id gnl|my_center|LOCUS_20460 46917 47360 gene locus_tag LOCUS_20470 gene tsaA 46917 47360 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence31 1872 1702 gene locus_tag LOCUS_20480 1872 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1941 3824 gene locus_tag LOCUS_20490 1941 3824 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257185.1 protein_id gnl|my_center|LOCUS_20490 3874 4095 gene locus_tag LOCUS_20500 3874 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 4181 5674 gene locus_tag LOCUS_20510 4181 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 6068 5751 gene locus_tag LOCUS_20520 6068 5751 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403775.1 protein_id gnl|my_center|LOCUS_20520 6706 6065 gene locus_tag LOCUS_20530 6706 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 6826 7362 gene locus_tag LOCUS_20540 6826 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 7365 8621 gene locus_tag LOCUS_20550 7365 8621 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870487.1 protein_id gnl|my_center|LOCUS_20550 8614 9309 gene locus_tag LOCUS_20560 8614 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 10074 9310 gene locus_tag LOCUS_20570 10074 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 10111 11730 gene locus_tag LOCUS_20580 10111 11730 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_20580 12560 11736 gene locus_tag LOCUS_20590 12560 11736 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_20590 12692 13618 gene locus_tag LOCUS_20600 12692 13618 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_20600 13622 14200 gene locus_tag LOCUS_20610 13622 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 15527 14202 gene locus_tag LOCUS_20620 15527 14202 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_20620 15642 16340 gene locus_tag LOCUS_20630 15642 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 16370 18637 gene locus_tag LOCUS_20640 16370 18637 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177619.1 protein_id gnl|my_center|LOCUS_20640 18649 19554 gene locus_tag LOCUS_20650 18649 19554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 19654 19998 gene locus_tag LOCUS_20660 19654 19998 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768657.1 protein_id gnl|my_center|LOCUS_20660 20132 20509 gene locus_tag LOCUS_20670 20132 20509 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888350.1 protein_id gnl|my_center|LOCUS_20670 20595 22250 gene locus_tag LOCUS_20680 gene hutU 20595 22250 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256864.1 protein_id gnl|my_center|LOCUS_20680 22258 22626 gene locus_tag LOCUS_20690 22258 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 22623 23525 gene locus_tag LOCUS_20700 22623 23525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 26408 23529 gene locus_tag LOCUS_20710 26408 23529 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_20710 27010 26480 gene locus_tag LOCUS_20720 27010 26480 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_20720 27755 27024 gene locus_tag LOCUS_20730 27755 27024 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_20730 28827 27766 gene locus_tag LOCUS_20740 28827 27766 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_20740 29055 28828 gene locus_tag LOCUS_20750 29055 28828 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_20750 30130 29501 gene locus_tag LOCUS_20760 30130 29501 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257557.1 protein_id gnl|my_center|LOCUS_20760 30607 30356 gene locus_tag LOCUS_20770 30607 30356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 30558 32087 gene locus_tag LOCUS_20780 30558 32087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 33422 32112 gene locus_tag LOCUS_20790 33422 32112 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258332.1 protein_id gnl|my_center|LOCUS_20790 33780 33406 gene locus_tag LOCUS_20800 gene crcB 33780 33406 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946260.1 protein_id gnl|my_center|LOCUS_20800 35162 33876 gene locus_tag LOCUS_20810 gene eno 35162 33876 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317534.1 protein_id gnl|my_center|LOCUS_20810 36006 35380 gene locus_tag LOCUS_20820 36006 35380 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256303.1 protein_id gnl|my_center|LOCUS_20820 36869 36360 gene locus_tag LOCUS_20830 36869 36360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 36944 37930 gene locus_tag LOCUS_20840 36944 37930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 37960 39189 gene locus_tag LOCUS_20850 37960 39189 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_20850 39345 39578 gene locus_tag LOCUS_20860 39345 39578 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_20860 39588 40700 gene locus_tag LOCUS_20870 39588 40700 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_20870 40715 41500 gene locus_tag LOCUS_20880 40715 41500 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_20880 41513 42061 gene locus_tag LOCUS_20890 41513 42061 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940603.1 protein_id gnl|my_center|LOCUS_20890 43597 42434 gene locus_tag LOCUS_20900 43597 42434 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_20900 46365 43696 gene locus_tag LOCUS_20910 46365 43696 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461688.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence32 <1 516 gene locus_tag LOCUS_20920 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258942.1:response regulator 547 768 gene locus_tag LOCUS_20930 547 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 761 1981 gene locus_tag LOCUS_20940 761 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 4263 2032 gene locus_tag LOCUS_20950 gene pnp 4263 2032 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_20950 4680 4411 gene locus_tag LOCUS_20960 gene rpsO 4680 4411 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_20960 5604 4780 gene locus_tag LOCUS_20970 5604 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 7040 5607 gene locus_tag LOCUS_20980 gene proS 7040 5607 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257194.1 protein_id gnl|my_center|LOCUS_20980 7598 7056 gene locus_tag LOCUS_20990 7598 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 7927 7595 gene locus_tag LOCUS_21000 7927 7595 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259720.1 protein_id gnl|my_center|LOCUS_21000 9092 7992 gene locus_tag LOCUS_21010 9092 7992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 10550 9096 gene locus_tag LOCUS_21020 10550 9096 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_21020 12112 10547 gene locus_tag LOCUS_21030 12112 10547 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 protein_id gnl|my_center|LOCUS_21030 12961 12221 gene locus_tag LOCUS_21040 12961 12221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 13225 12989 gene locus_tag LOCUS_21050 13225 12989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 14251 13265 gene locus_tag LOCUS_21060 gene atpB 14251 13265 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258899.1 protein_id gnl|my_center|LOCUS_21060 14531 14235 gene locus_tag LOCUS_21070 14531 14235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 16027 14567 gene locus_tag LOCUS_21080 16027 14567 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_21080 17500 16028 gene locus_tag LOCUS_21090 17500 16028 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_21090 19016 17511 gene locus_tag LOCUS_21100 19016 17511 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 protein_id gnl|my_center|LOCUS_21100 21201 19021 gene locus_tag LOCUS_21110 gene nuoL 21201 19021 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_21110 21523 21215 gene locus_tag LOCUS_21120 gene nuoK 21523 21215 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_21120 22044 21529 gene locus_tag LOCUS_21130 22044 21529 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_21130 23252 22041 gene locus_tag LOCUS_21140 gene nuoH 23252 22041 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257851.1 protein_id gnl|my_center|LOCUS_21140 23646 23290 gene locus_tag LOCUS_21150 gene ndhC 23646 23290 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_21150 25708 23723 gene locus_tag LOCUS_21160 25708 23723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 25935 26573 gene locus_tag LOCUS_21170 25935 26573 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921152.1 protein_id gnl|my_center|LOCUS_21170 27741 26620 gene locus_tag LOCUS_21180 27741 26620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 28236 27841 gene locus_tag LOCUS_21190 gene rpsI 28236 27841 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254378.1 protein_id gnl|my_center|LOCUS_21190 28677 28252 gene locus_tag LOCUS_21200 gene rplM 28677 28252 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544931.1 protein_id gnl|my_center|LOCUS_21200 29484 28747 gene locus_tag LOCUS_21210 gene truA 29484 28747 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288727.1 protein_id gnl|my_center|LOCUS_21210 29886 29509 gene locus_tag LOCUS_21220 29886 29509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 30858 29893 gene locus_tag LOCUS_21230 30858 29893 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_21230 31556 30909 gene locus_tag LOCUS_21240 gene rpsD 31556 30909 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_21240 31984 31580 gene locus_tag LOCUS_21250 gene rpsK 31984 31580 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040166.1 protein_id gnl|my_center|LOCUS_21250 32484 32095 gene locus_tag LOCUS_21260 gene rpsM 32484 32095 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_21260 33464 32652 gene locus_tag LOCUS_21270 gene map 33464 32652 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_21270 34123 33470 gene locus_tag LOCUS_21280 34123 33470 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_21280 35485 34133 gene locus_tag LOCUS_21290 gene secY 35485 34133 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_21290 35968 35516 gene locus_tag LOCUS_21300 gene rplO 35968 35516 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288687.1 protein_id gnl|my_center|LOCUS_21300 36174 35965 gene locus_tag LOCUS_21310 gene rpmD 36174 35965 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771513.1 protein_id gnl|my_center|LOCUS_21310 36694 36167 gene locus_tag LOCUS_21320 gene rpsE 36694 36167 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_21320 37088 36723 gene locus_tag LOCUS_21330 gene rplR 37088 36723 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_21330 37654 37100 gene locus_tag LOCUS_21340 gene rplF 37654 37100 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583360.1 protein_id gnl|my_center|LOCUS_21340 38099 37683 gene locus_tag LOCUS_21350 gene rpsH 38099 37683 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459105.1 protein_id gnl|my_center|LOCUS_21350 38303 38121 gene locus_tag LOCUS_21360 38303 38121 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143902.1 protein_id gnl|my_center|LOCUS_21360 38847 38305 gene locus_tag LOCUS_21370 gene rplE 38847 38305 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_21370 39199 38864 gene locus_tag LOCUS_21380 gene rplX 39199 38864 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_21380 39587 39216 gene locus_tag LOCUS_21390 gene rplN 39587 39216 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_21390 39864 39592 gene locus_tag LOCUS_21400 gene rpsQ 39864 39592 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879936.1 protein_id gnl|my_center|LOCUS_21400 40073 39861 gene locus_tag LOCUS_21410 gene rpmC 40073 39861 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258239.1 protein_id gnl|my_center|LOCUS_21410 40498 40070 gene locus_tag LOCUS_21420 gene rplP 40498 40070 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081822.1 protein_id gnl|my_center|LOCUS_21420 41221 40544 gene locus_tag LOCUS_21430 gene rpsC 41221 40544 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_21430 41618 41274 gene locus_tag LOCUS_21440 gene rplV 41618 41274 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638065.1 protein_id gnl|my_center|LOCUS_21440 41906 41622 gene locus_tag LOCUS_21450 gene rpsS 41906 41622 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909214.1 protein_id gnl|my_center|LOCUS_21450 42775 41939 gene locus_tag LOCUS_21460 gene rplB 42775 41939 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258234.1 protein_id gnl|my_center|LOCUS_21460 43077 42775 gene locus_tag LOCUS_21470 gene rplW 43077 42775 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_21470 43720 43091 gene locus_tag LOCUS_21480 gene rplD 43720 43091 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258232.1 protein_id gnl|my_center|LOCUS_21480 44392 43763 gene locus_tag LOCUS_21490 gene rplC 44392 43763 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_21490 45032 44721 gene locus_tag LOCUS_21500 gene rpsJ 45032 44721 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258230.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence33 1325 3886 gene locus_tag LOCUS_21510 1325 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 5889 4039 gene locus_tag LOCUS_21520 gene dnaK 5889 4039 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_21520 6093 7406 gene locus_tag LOCUS_21530 6093 7406 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_21530 7936 7403 gene locus_tag LOCUS_21540 7936 7403 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938435.1 protein_id gnl|my_center|LOCUS_21540 10122 7933 gene locus_tag LOCUS_21550 gene glgP 10122 7933 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_21550 10944 10330 gene locus_tag LOCUS_21560 10944 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 11131 10961 gene locus_tag LOCUS_21570 11131 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 12892 11282 gene locus_tag LOCUS_21580 12892 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 14148 13003 gene locus_tag LOCUS_21590 14148 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 15389 14145 gene locus_tag LOCUS_21600 15389 14145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 15495 15959 gene locus_tag LOCUS_21610 15495 15959 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681082.1 protein_id gnl|my_center|LOCUS_21610 16128 15964 gene locus_tag LOCUS_21620 16128 15964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 16837 16130 gene locus_tag LOCUS_21630 gene ccsA 16837 16130 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886993.1 protein_id gnl|my_center|LOCUS_21630 17517 16834 gene locus_tag LOCUS_21640 17517 16834 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938347.1 protein_id gnl|my_center|LOCUS_21640 18248 17514 gene locus_tag LOCUS_21650 18248 17514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_21650 20127 18238 gene locus_tag LOCUS_21660 20127 18238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 20658 20137 gene locus_tag LOCUS_21670 20658 20137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 21173 20667 gene locus_tag LOCUS_21680 21173 20667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 21723 21238 gene locus_tag LOCUS_21690 21723 21238 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384854.1 protein_id gnl|my_center|LOCUS_21690 23783 21720 gene locus_tag LOCUS_21700 23783 21720 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_21700 24300 23785 gene locus_tag LOCUS_21710 24300 23785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 24531 24953 gene locus_tag LOCUS_21720 24531 24953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 24963 25610 gene locus_tag LOCUS_21730 24963 25610 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_21730 25663 26526 gene locus_tag LOCUS_21740 25663 26526 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_21740 26523 27050 gene locus_tag LOCUS_21750 26523 27050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 27060 28787 gene locus_tag LOCUS_21760 gene recN 27060 28787 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_21760 28792 32223 gene locus_tag LOCUS_21770 28792 32223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 34826 32436 gene locus_tag LOCUS_21780 34826 32436 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_21780 34913 35503 gene locus_tag LOCUS_21790 34913 35503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 35658 36905 gene locus_tag LOCUS_21800 35658 36905 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_21800 36999 37358 gene locus_tag LOCUS_21810 36999 37358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 37376 37903 gene locus_tag LOCUS_21820 gene yjjX 37376 37903 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226224.1 protein_id gnl|my_center|LOCUS_21820 38609 38136 gene locus_tag LOCUS_21830 38609 38136 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256064.1 protein_id gnl|my_center|LOCUS_21830 38658 39173 gene locus_tag LOCUS_21840 38658 39173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 39177 39548 gene locus_tag LOCUS_21850 39177 39548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 39589 41247 gene locus_tag LOCUS_21860 gene dnaX 39589 41247 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660459.1 protein_id gnl|my_center|LOCUS_21860 41258 41596 gene locus_tag LOCUS_21870 41258 41596 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_21870 41600 42205 gene locus_tag LOCUS_21880 gene recR 41600 42205 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256424.1 protein_id gnl|my_center|LOCUS_21880 44827 42302 gene locus_tag LOCUS_21890 44827 42302 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence34 2289 1285 gene locus_tag LOCUS_21900 2289 1285 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582579.1 protein_id gnl|my_center|LOCUS_21900 2687 3775 gene locus_tag LOCUS_21910 2687 3775 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_21910 3840 4832 gene locus_tag LOCUS_21920 gene glpX 3840 4832 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084313.1 protein_id gnl|my_center|LOCUS_21920 5533 4844 gene locus_tag LOCUS_21930 5533 4844 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_21930 8233 5540 gene locus_tag LOCUS_21940 8233 5540 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_21940 8820 8245 gene locus_tag LOCUS_21950 gene kdpC 8820 8245 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_21950 9074 8823 gene locus_tag LOCUS_21960 9074 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 11183 9093 gene locus_tag LOCUS_21970 gene kdpB 11183 9093 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 protein_id gnl|my_center|LOCUS_21970 12917 11199 gene locus_tag LOCUS_21980 gene kdpA 12917 11199 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089518.1 protein_id gnl|my_center|LOCUS_21980 14798 13317 gene locus_tag LOCUS_21990 gene xylB 14798 13317 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_21990 15857 14820 gene locus_tag LOCUS_22000 15857 14820 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_22000 16946 15900 gene locus_tag LOCUS_22010 gene rbsC 16946 15900 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419501.1 protein_id gnl|my_center|LOCUS_22010 18478 16943 gene locus_tag LOCUS_22020 18478 16943 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584014.1 protein_id gnl|my_center|LOCUS_22020 19007 18513 gene locus_tag LOCUS_22030 19007 18513 CDS product YjbQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576695.1 protein_id gnl|my_center|LOCUS_22030 19753 19004 gene locus_tag LOCUS_22040 19753 19004 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674983.1 protein_id gnl|my_center|LOCUS_22040 21122 19746 gene locus_tag LOCUS_22050 21122 19746 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 protein_id gnl|my_center|LOCUS_22050 21963 21160 gene locus_tag LOCUS_22060 21963 21160 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031700.1 protein_id gnl|my_center|LOCUS_22060 22421 21996 gene locus_tag LOCUS_22070 22421 21996 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_22070 23058 24086 gene locus_tag LOCUS_22080 23058 24086 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976195.1 protein_id gnl|my_center|LOCUS_22080 24179 24778 gene locus_tag LOCUS_22090 24179 24778 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162810208.1 protein_id gnl|my_center|LOCUS_22090 24861 25958 gene locus_tag LOCUS_22100 24861 25958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 26163 28670 gene locus_tag LOCUS_22110 26163 28670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 28856 29437 gene locus_tag LOCUS_22120 28856 29437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 30208 29663 gene locus_tag LOCUS_22130 30208 29663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 33128 30465 gene locus_tag LOCUS_22140 33128 30465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 33546 35666 gene locus_tag LOCUS_22150 33546 35666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 35775 36842 gene locus_tag LOCUS_22160 35775 36842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 38518 36854 gene locus_tag LOCUS_22170 38518 36854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 39804 38539 gene locus_tag LOCUS_22180 39804 38539 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_22180 40313 42046 gene locus_tag LOCUS_22190 gene ptsP 40313 42046 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722867.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence35 <1 1023 gene locus_tag LOCUS_22200 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942515.1:sensor domain-containing diguanylate cyclase 1659 1027 gene locus_tag LOCUS_22210 1659 1027 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967457.1 protein_id gnl|my_center|LOCUS_22210 1792 2832 gene locus_tag LOCUS_22220 1792 2832 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972097.1 protein_id gnl|my_center|LOCUS_22220 4215 2833 gene locus_tag LOCUS_22230 4215 2833 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256764.1 protein_id gnl|my_center|LOCUS_22230 4889 4212 gene locus_tag LOCUS_22240 4889 4212 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_22240 5105 5629 gene locus_tag LOCUS_22250 5105 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 6358 5693 gene locus_tag LOCUS_22260 6358 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 8914 6503 gene locus_tag LOCUS_22270 8914 6503 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177619.1 protein_id gnl|my_center|LOCUS_22270 12212 9123 gene locus_tag LOCUS_22280 12212 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 13000 12314 gene locus_tag LOCUS_22290 13000 12314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 13105 13557 gene locus_tag LOCUS_22300 13105 13557 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_22300 14459 13560 gene locus_tag LOCUS_22310 gene menA 14459 13560 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_22310 15388 14501 gene locus_tag LOCUS_22320 gene menA 15388 14501 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_22320 15990 15784 gene locus_tag LOCUS_22330 15990 15784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 16194 18176 gene locus_tag LOCUS_22340 16194 18176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_22340 18399 18689 gene locus_tag LOCUS_22350 18399 18689 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529995.1 protein_id gnl|my_center|LOCUS_22350 18686 19105 gene locus_tag LOCUS_22360 18686 19105 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_22360 19697 19185 gene locus_tag LOCUS_22370 19697 19185 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_22370 20052 19735 gene locus_tag LOCUS_22380 20052 19735 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459853.1 protein_id gnl|my_center|LOCUS_22380 20659 20057 gene locus_tag LOCUS_22390 20659 20057 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 protein_id gnl|my_center|LOCUS_22390 20790 21542 gene locus_tag LOCUS_22400 20790 21542 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_22400 21621 22316 gene locus_tag LOCUS_22410 gene walR 21621 22316 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244363.1 protein_id gnl|my_center|LOCUS_22410 22313 23773 gene locus_tag LOCUS_22420 22313 23773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 23831 24646 gene locus_tag LOCUS_22430 23831 24646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 27005 24957 gene locus_tag LOCUS_22440 27005 24957 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108532.1 protein_id gnl|my_center|LOCUS_22440 29549 27033 gene locus_tag LOCUS_22450 29549 27033 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937681.1 protein_id gnl|my_center|LOCUS_22450 30840 29692 gene locus_tag LOCUS_22460 30840 29692 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870473.1 protein_id gnl|my_center|LOCUS_22460 31655 30963 gene locus_tag LOCUS_22470 31655 30963 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272569.1 protein_id gnl|my_center|LOCUS_22470 32320 31781 gene locus_tag LOCUS_22480 gene msrA 32320 31781 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_22480 32958 32449 gene locus_tag LOCUS_22490 32958 32449 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408018.1 protein_id gnl|my_center|LOCUS_22490 33327 32998 gene locus_tag LOCUS_22500 33327 32998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 36141 33976 gene locus_tag LOCUS_22510 gene feoB 36141 33976 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_22510 36412 36188 gene locus_tag LOCUS_22520 36412 36188 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_22520 36643 36431 gene locus_tag LOCUS_22530 36643 36431 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_22530 36774 37430 gene locus_tag LOCUS_22540 36774 37430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 37489 38808 gene locus_tag LOCUS_22550 37489 38808 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256145.1 protein_id gnl|my_center|LOCUS_22550 38957 40054 gene locus_tag LOCUS_22560 38957 40054 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256144.1 protein_id gnl|my_center|LOCUS_22560 40064 41224 gene locus_tag LOCUS_22570 40064 41224 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_22570 41398 41805 gene locus_tag LOCUS_22580 41398 41805 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249134.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence36 1495 500 gene locus_tag LOCUS_22590 1495 500 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707231.1 protein_id gnl|my_center|LOCUS_22590 3016 1499 gene locus_tag LOCUS_22600 3016 1499 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972980.1 protein_id gnl|my_center|LOCUS_22600 3940 4719 gene locus_tag LOCUS_22610 gene rhaR 3940 4719 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_22610 4897 5649 gene locus_tag LOCUS_22620 4897 5649 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532941.1 protein_id gnl|my_center|LOCUS_22620 5649 6167 gene locus_tag LOCUS_22630 5649 6167 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903443.1 protein_id gnl|my_center|LOCUS_22630 6198 7169 gene locus_tag LOCUS_22640 6198 7169 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404751.1 protein_id gnl|my_center|LOCUS_22640 7288 7581 gene locus_tag LOCUS_22650 7288 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 9352 8090 gene locus_tag LOCUS_22660 9352 8090 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755814.1 protein_id gnl|my_center|LOCUS_22660 9664 9425 gene locus_tag LOCUS_22670 9664 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 10504 9701 gene locus_tag LOCUS_22680 10504 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 12326 10566 gene locus_tag LOCUS_22690 12326 10566 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_22690 12755 12408 gene locus_tag LOCUS_22700 12755 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 13900 12905 gene locus_tag LOCUS_22710 13900 12905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 16062 14104 gene locus_tag LOCUS_22720 16062 14104 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545932.1 protein_id gnl|my_center|LOCUS_22720 17304 16069 gene locus_tag LOCUS_22730 17304 16069 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062420975.1 protein_id gnl|my_center|LOCUS_22730 17637 18821 gene locus_tag LOCUS_22740 17637 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 18808 19458 gene locus_tag LOCUS_22750 18808 19458 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722886.1 protein_id gnl|my_center|LOCUS_22750 19470 19892 gene locus_tag LOCUS_22760 19470 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 20039 20521 gene locus_tag LOCUS_22770 20039 20521 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869225.1 protein_id gnl|my_center|LOCUS_22770 20518 22323 gene locus_tag LOCUS_22780 20518 22323 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869226.1 protein_id gnl|my_center|LOCUS_22780 22405 22680 gene locus_tag LOCUS_22790 22405 22680 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021717.1 protein_id gnl|my_center|LOCUS_22790 22738 24576 gene locus_tag LOCUS_22800 22738 24576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 24590 25765 gene locus_tag LOCUS_22810 24590 25765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 25769 26239 gene locus_tag LOCUS_22820 25769 26239 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867844.1 protein_id gnl|my_center|LOCUS_22820 26232 27143 gene locus_tag LOCUS_22830 26232 27143 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389175.1 protein_id gnl|my_center|LOCUS_22830 27348 27677 gene locus_tag LOCUS_22840 27348 27677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 27692 28126 gene locus_tag LOCUS_22850 27692 28126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 28128 29207 gene locus_tag LOCUS_22860 28128 29207 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389179.1 protein_id gnl|my_center|LOCUS_22860 29367 30509 gene locus_tag LOCUS_22870 gene moeB 29367 30509 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_22870 31608 30514 gene locus_tag LOCUS_22880 31608 30514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 31810 32787 gene locus_tag LOCUS_22890 31810 32787 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_22890 32794 33486 gene locus_tag LOCUS_22900 32794 33486 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_22900 33488 34585 gene locus_tag LOCUS_22910 33488 34585 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391617.1 protein_id gnl|my_center|LOCUS_22910 34712 34972 gene locus_tag LOCUS_22920 gene moaD 34712 34972 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257741.1 protein_id gnl|my_center|LOCUS_22920 34990 35976 gene locus_tag LOCUS_22930 gene moaA 34990 35976 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_22930 35994 36482 gene locus_tag LOCUS_22940 gene moaC 35994 36482 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975566.1 protein_id gnl|my_center|LOCUS_22940 36486 36950 gene locus_tag LOCUS_22950 36486 36950 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257742.1 protein_id gnl|my_center|LOCUS_22950 37667 37056 gene locus_tag LOCUS_22960 37667 37056 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439458.1 protein_id gnl|my_center|LOCUS_22960 38286 39743 gene locus_tag LOCUS_22970 38286 39743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 40301 39768 gene locus_tag LOCUS_22980 40301 39768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence37 1013 159 gene locus_tag LOCUS_22990 gene yidA 1013 159 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704455.1 protein_id gnl|my_center|LOCUS_22990 1292 1014 gene locus_tag LOCUS_23000 1292 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2726 1314 gene locus_tag LOCUS_23010 2726 1314 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206473.1 protein_id gnl|my_center|LOCUS_23010 4578 2737 gene locus_tag LOCUS_23020 4578 2737 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989931.1 protein_id gnl|my_center|LOCUS_23020 5988 4720 gene locus_tag LOCUS_23030 gene celB 5988 4720 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_23030 6317 5991 gene locus_tag LOCUS_23040 6317 5991 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992103.1 protein_id gnl|my_center|LOCUS_23040 6624 6310 gene locus_tag LOCUS_23050 6624 6310 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836401.1 protein_id gnl|my_center|LOCUS_23050 6803 8725 gene locus_tag LOCUS_23060 6803 8725 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 protein_id gnl|my_center|LOCUS_23060 8715 9329 gene locus_tag LOCUS_23070 8715 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 10224 9331 gene locus_tag LOCUS_23080 10224 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 11138 10401 gene locus_tag LOCUS_23090 11138 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 11832 11131 gene locus_tag LOCUS_23100 11832 11131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403437.1 protein_id gnl|my_center|LOCUS_23100 12185 11829 gene locus_tag LOCUS_23110 12185 11829 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963588.1 protein_id gnl|my_center|LOCUS_23110 12402 13523 gene locus_tag LOCUS_23120 12402 13523 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583303.1 protein_id gnl|my_center|LOCUS_23120 13564 14442 gene locus_tag LOCUS_23130 13564 14442 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151652833.1 protein_id gnl|my_center|LOCUS_23130 14800 14405 gene locus_tag LOCUS_23140 14800 14405 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889078.1 protein_id gnl|my_center|LOCUS_23140 15056 15466 gene locus_tag LOCUS_23150 15056 15466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 15497 16012 gene locus_tag LOCUS_23160 15497 16012 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969840.1 protein_id gnl|my_center|LOCUS_23160 16106 16792 gene locus_tag LOCUS_23170 16106 16792 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860219.1 protein_id gnl|my_center|LOCUS_23170 16818 17603 gene locus_tag LOCUS_23180 16818 17603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 19207 17609 gene locus_tag LOCUS_23190 19207 17609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365927.1 protein_id gnl|my_center|LOCUS_23190 19301 19966 gene locus_tag LOCUS_23200 19301 19966 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_23200 19963 20976 gene locus_tag LOCUS_23210 19963 20976 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227738.1 protein_id gnl|my_center|LOCUS_23210 22647 20977 gene locus_tag LOCUS_23220 22647 20977 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_23220 23049 23855 gene locus_tag LOCUS_23230 23049 23855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 protein_id gnl|my_center|LOCUS_23230 23859 26243 gene locus_tag LOCUS_23240 23859 26243 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 protein_id gnl|my_center|LOCUS_23240 26570 30115 gene locus_tag LOCUS_23250 26570 30115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 30523 31290 gene locus_tag LOCUS_23260 30523 31290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 32853 31375 gene locus_tag LOCUS_23270 gene guaB 32853 31375 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_23270 34364 32865 gene locus_tag LOCUS_23280 gene purH 34364 32865 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679591.1 protein_id gnl|my_center|LOCUS_23280 34962 34333 gene locus_tag LOCUS_23290 gene purN 34962 34333 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679594.1 protein_id gnl|my_center|LOCUS_23290 37235 34959 gene locus_tag LOCUS_23300 37235 34959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 38678 37260 gene locus_tag LOCUS_23310 gene purF 38678 37260 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257473.1 protein_id gnl|my_center|LOCUS_23310 39216 38728 gene locus_tag LOCUS_23320 39216 38728 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681904.1 protein_id gnl|my_center|LOCUS_23320 40190 39213 gene locus_tag LOCUS_23330 40190 39213 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681898.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence38 61 936 gene locus_tag LOCUS_23340 gene prmC 61 936 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_23340 938 1852 gene locus_tag LOCUS_23350 938 1852 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_23350 1827 2450 gene locus_tag LOCUS_23360 1827 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2510 3940 gene locus_tag LOCUS_23370 2510 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 4625 3966 gene locus_tag LOCUS_23380 4625 3966 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926557.1 protein_id gnl|my_center|LOCUS_23380 4870 4943 gene locus_tag LOCUS_t00260 4870 4943 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4982 5055 gene locus_tag LOCUS_t00270 4982 5055 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5326 7782 gene locus_tag LOCUS_23390 gene leuS 5326 7782 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479923.1 protein_id gnl|my_center|LOCUS_23390 7977 8567 gene locus_tag LOCUS_23400 7977 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 8657 10402 gene locus_tag LOCUS_23410 gene cydD 8657 10402 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933481.1 protein_id gnl|my_center|LOCUS_23410 10399 12135 gene locus_tag LOCUS_23420 gene cydC 10399 12135 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974886.1 protein_id gnl|my_center|LOCUS_23420 12206 14377 gene locus_tag LOCUS_23430 12206 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 16713 14395 gene locus_tag LOCUS_23440 16713 14395 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259434.1 protein_id gnl|my_center|LOCUS_23440 16756 17772 gene locus_tag LOCUS_23450 16756 17772 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860134.1 protein_id gnl|my_center|LOCUS_23450 17789 18004 gene locus_tag LOCUS_23460 17789 18004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 20031 18019 gene locus_tag LOCUS_23470 20031 18019 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257484.1 protein_id gnl|my_center|LOCUS_23470 21509 20028 gene locus_tag LOCUS_23480 21509 20028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 22294 21518 gene locus_tag LOCUS_23490 22294 21518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 23114 22320 gene locus_tag LOCUS_23500 23114 22320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 23344 24960 gene locus_tag LOCUS_23510 23344 24960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 26295 24973 gene locus_tag LOCUS_23520 26295 24973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 27698 26295 gene locus_tag LOCUS_23530 27698 26295 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257378.1 protein_id gnl|my_center|LOCUS_23530 28557 27736 gene locus_tag LOCUS_23540 28557 27736 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_23540 29635 28550 gene locus_tag LOCUS_23550 29635 28550 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_23550 29824 29678 gene locus_tag LOCUS_23560 29824 29678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 30499 29852 gene locus_tag LOCUS_23570 30499 29852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23570 31235 30483 gene locus_tag LOCUS_23580 31235 30483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 32186 31251 gene locus_tag LOCUS_23590 32186 31251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 34288 32762 gene locus_tag LOCUS_23600 34288 32762 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_23600 35232 34357 gene locus_tag LOCUS_23610 gene rfbA 35232 34357 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476438.1 protein_id gnl|my_center|LOCUS_23610 36317 35229 gene locus_tag LOCUS_23620 gene rfbB 36317 35229 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186461.1 protein_id gnl|my_center|LOCUS_23620 36788 37426 gene locus_tag LOCUS_23630 36788 37426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 37454 38986 gene locus_tag LOCUS_23640 gene rny 37454 38986 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258580.1 protein_id gnl|my_center|LOCUS_23640 39666 39031 gene locus_tag LOCUS_23650 39666 39031 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence39 36 1091 gene locus_tag LOCUS_23660 36 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 1093 3192 gene locus_tag LOCUS_23670 1093 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 3195 3782 gene locus_tag LOCUS_23680 3195 3782 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937663.1 protein_id gnl|my_center|LOCUS_23680 3779 4111 gene locus_tag LOCUS_23690 3779 4111 CDS product O-6-alkylguanine-DNA--cysteine-protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174014.1 protein_id gnl|my_center|LOCUS_23690 4115 5047 gene locus_tag LOCUS_23700 4115 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 5110 7374 gene locus_tag LOCUS_23710 5110 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 7397 7891 gene locus_tag LOCUS_23720 7397 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 8785 7916 gene locus_tag LOCUS_23730 8785 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 10319 8868 gene locus_tag LOCUS_23740 gene gatB 10319 8868 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_23740 11522 10344 gene locus_tag LOCUS_23750 11522 10344 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257780.1 protein_id gnl|my_center|LOCUS_23750 12738 11725 gene locus_tag LOCUS_23760 12738 11725 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257630.1 protein_id gnl|my_center|LOCUS_23760 12891 13391 gene locus_tag LOCUS_23770 12891 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 15257 13785 gene locus_tag LOCUS_23780 gene gatA 15257 13785 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257583.1 protein_id gnl|my_center|LOCUS_23780 15550 15254 gene locus_tag LOCUS_23790 gene gatC 15550 15254 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_23790 15871 16935 gene locus_tag LOCUS_23800 15871 16935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 17104 18141 gene locus_tag LOCUS_23810 17104 18141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 18269 19225 gene locus_tag LOCUS_23820 18269 19225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 19635 20522 gene locus_tag LOCUS_23830 19635 20522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 20692 21594 gene locus_tag LOCUS_23840 20692 21594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 21712 22833 gene locus_tag LOCUS_23850 21712 22833 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_23850 23816 22830 gene locus_tag LOCUS_23860 23816 22830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 23868 23941 gene locus_tag LOCUS_t00280 23868 23941 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23953 24282 gene locus_tag LOCUS_23870 23953 24282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 24306 25052 gene locus_tag LOCUS_23880 24306 25052 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_23880 25033 25689 gene locus_tag LOCUS_23890 25033 25689 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583881.1 protein_id gnl|my_center|LOCUS_23890 28605 25777 gene locus_tag LOCUS_23900 28605 25777 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 protein_id gnl|my_center|LOCUS_23900 30043 28775 gene locus_tag LOCUS_23910 30043 28775 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_23910 30094 30288 gene locus_tag LOCUS_23920 30094 30288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 30469 33252 gene locus_tag LOCUS_23930 30469 33252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 33257 34870 gene locus_tag LOCUS_23940 33257 34870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 34963 36978 gene locus_tag LOCUS_23950 34963 36978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 37029 37709 gene locus_tag LOCUS_23960 37029 37709 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_23960 37709 39070 gene locus_tag LOCUS_23970 37709 39070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence40 1045 515 gene locus_tag LOCUS_23980 1045 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 1258 2352 gene locus_tag LOCUS_23990 1258 2352 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_23990 2443 3588 gene locus_tag LOCUS_24000 2443 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 3600 3947 gene locus_tag LOCUS_24010 3600 3947 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_24010 3951 5465 gene locus_tag LOCUS_24020 3951 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 5810 5568 gene locus_tag LOCUS_24030 5810 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 5917 7218 gene locus_tag LOCUS_24040 5917 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 7225 8709 gene locus_tag LOCUS_24050 7225 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 9151 8741 gene locus_tag LOCUS_24060 9151 8741 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_24060 10206 9178 gene locus_tag LOCUS_24070 gene tsaD 10206 9178 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244138.1 protein_id gnl|my_center|LOCUS_24070 11459 10224 gene locus_tag LOCUS_24080 11459 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 12858 11443 gene locus_tag LOCUS_24090 gene selA 12858 11443 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_24090 13219 12815 gene locus_tag LOCUS_24100 13219 12815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 13295 13368 gene locus_tag LOCUS_t00290 13295 13368 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 13725 13420 gene locus_tag LOCUS_24110 13725 13420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 14892 13966 gene locus_tag LOCUS_24120 14892 13966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 15317 17410 gene locus_tag LOCUS_24130 15317 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 17617 18156 gene locus_tag LOCUS_24140 17617 18156 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062063.1 protein_id gnl|my_center|LOCUS_24140 18218 18874 gene locus_tag LOCUS_24150 18218 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 18958 21537 gene locus_tag LOCUS_24160 18958 21537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 21621 22523 gene locus_tag LOCUS_24170 gene dusB 21621 22523 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619224.1 protein_id gnl|my_center|LOCUS_24170 23324 22509 gene locus_tag LOCUS_24180 23324 22509 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765640.1 protein_id gnl|my_center|LOCUS_24180 23512 24069 gene locus_tag LOCUS_24190 gene efp 23512 24069 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_24190 24126 24458 gene locus_tag LOCUS_24200 24126 24458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 24461 25654 gene locus_tag LOCUS_24210 24461 25654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 25818 27818 gene locus_tag LOCUS_24220 25818 27818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 27939 31454 gene locus_tag LOCUS_24230 gene metH 27939 31454 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259744.1 protein_id gnl|my_center|LOCUS_24230 31463 33352 gene locus_tag LOCUS_24240 31463 33352 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_24240 33362 33817 gene locus_tag LOCUS_24250 33362 33817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 33814 35211 gene locus_tag LOCUS_24260 33814 35211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 35239 36012 gene locus_tag LOCUS_24270 35239 36012 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence41 1750 1016 gene locus_tag LOCUS_24280 1750 1016 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_24280 1891 3084 gene locus_tag LOCUS_24290 1891 3084 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256990.1 protein_id gnl|my_center|LOCUS_24290 3117 4502 gene locus_tag LOCUS_24300 3117 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 4499 5233 gene locus_tag LOCUS_24310 4499 5233 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_24310 5408 6694 gene locus_tag LOCUS_24320 5408 6694 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066871940.1 protein_id gnl|my_center|LOCUS_24320 6786 7712 gene locus_tag LOCUS_24330 6786 7712 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533462.1 protein_id gnl|my_center|LOCUS_24330 7725 8588 gene locus_tag LOCUS_24340 7725 8588 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528572.1 protein_id gnl|my_center|LOCUS_24340 8643 9650 gene locus_tag LOCUS_24350 8643 9650 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_24350 9647 10648 gene locus_tag LOCUS_24360 9647 10648 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_24360 10650 11825 gene locus_tag LOCUS_24370 gene nagA 10650 11825 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987105.1 protein_id gnl|my_center|LOCUS_24370 11967 12572 gene locus_tag LOCUS_24380 11967 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 13750 12590 gene locus_tag LOCUS_24390 13750 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 14131 14853 gene locus_tag LOCUS_24400 gene alaXM 14131 14853 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 protein_id gnl|my_center|LOCUS_24400 16209 15316 gene locus_tag LOCUS_24410 16209 15316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 16826 16206 gene locus_tag LOCUS_24420 16826 16206 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095816.1 protein_id gnl|my_center|LOCUS_24420 19022 16980 gene locus_tag LOCUS_24430 19022 16980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 19137 19727 gene locus_tag LOCUS_24440 19137 19727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 19818 21860 gene locus_tag LOCUS_24450 gene uvrB 19818 21860 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_24450 22206 21862 gene locus_tag LOCUS_24460 22206 21862 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392730.1 protein_id gnl|my_center|LOCUS_24460 23236 22160 gene locus_tag LOCUS_24470 23236 22160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 24339 23251 gene locus_tag LOCUS_24480 24339 23251 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259411.1 protein_id gnl|my_center|LOCUS_24480 25429 24434 gene locus_tag LOCUS_24490 gene mvaD 25429 24434 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_24490 28419 26494 gene locus_tag LOCUS_24500 gene gyrB 28419 26494 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 protein_id gnl|my_center|LOCUS_24500 29437 28448 gene locus_tag LOCUS_24510 29437 28448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 29555 30373 gene locus_tag LOCUS_24520 29555 30373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 30524 31225 gene locus_tag LOCUS_24530 gene plsY 30524 31225 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228511.1 protein_id gnl|my_center|LOCUS_24530 32117 31236 gene locus_tag LOCUS_24540 32117 31236 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030050.1 protein_id gnl|my_center|LOCUS_24540 32991 32263 gene locus_tag LOCUS_24550 32991 32263 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_24550 33821 32994 gene locus_tag LOCUS_24560 33821 32994 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944016.1 protein_id gnl|my_center|LOCUS_24560 34033 34935 gene locus_tag LOCUS_24570 34033 34935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence42 1428 115 gene locus_tag LOCUS_24580 1428 115 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_24580 2064 1651 gene locus_tag LOCUS_24590 2064 1651 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937348.1 protein_id gnl|my_center|LOCUS_24590 2185 2367 gene locus_tag LOCUS_24600 2185 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2448 3206 gene locus_tag LOCUS_24610 2448 3206 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393691.1 protein_id gnl|my_center|LOCUS_24610 3830 3234 gene locus_tag LOCUS_24620 3830 3234 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_24620 3932 4417 gene locus_tag LOCUS_24630 3932 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 4449 5624 gene locus_tag LOCUS_24640 gene rpoD 4449 5624 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258920.1 protein_id gnl|my_center|LOCUS_24640 6186 5677 gene locus_tag LOCUS_24650 6186 5677 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_24650 6639 6187 gene locus_tag LOCUS_24660 6639 6187 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615364.1 protein_id gnl|my_center|LOCUS_24660 7054 8334 gene locus_tag LOCUS_24670 gene rho 7054 8334 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_24670 8331 9452 gene locus_tag LOCUS_24680 8331 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 11973 9502 gene locus_tag LOCUS_24690 gene priA 11973 9502 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259672.1 protein_id gnl|my_center|LOCUS_24690 12863 12018 gene locus_tag LOCUS_24700 gene amrB 12863 12018 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942474.1 protein_id gnl|my_center|LOCUS_24700 14165 12942 gene locus_tag LOCUS_24710 14165 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 14977 14252 gene locus_tag LOCUS_24720 14977 14252 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942832.1 protein_id gnl|my_center|LOCUS_24720 16435 14993 gene locus_tag LOCUS_24730 16435 14993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 17700 16456 gene locus_tag LOCUS_24740 17700 16456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 17855 19156 gene locus_tag LOCUS_24750 gene miaB 17855 19156 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258276.1 protein_id gnl|my_center|LOCUS_24750 19153 19851 gene locus_tag LOCUS_24760 19153 19851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 20158 20484 gene locus_tag LOCUS_24770 20158 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24770 22330 20654 gene locus_tag LOCUS_24780 gene ettA 22330 20654 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_24780 23239 22475 gene locus_tag LOCUS_24790 23239 22475 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459737.1 protein_id gnl|my_center|LOCUS_24790 23448 24440 gene locus_tag LOCUS_24800 gene trxB 23448 24440 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880288.1 protein_id gnl|my_center|LOCUS_24800 25508 24534 gene locus_tag LOCUS_24810 25508 24534 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454499.1 protein_id gnl|my_center|LOCUS_24810 26569 25538 gene locus_tag LOCUS_24820 26569 25538 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_24820 26655 26849 gene locus_tag LOCUS_24830 26655 26849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 27310 26885 gene locus_tag LOCUS_24840 27310 26885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 27433 28029 gene locus_tag LOCUS_24850 27433 28029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 28261 28797 gene locus_tag LOCUS_24860 28261 28797 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_24860 28959 32531 gene locus_tag LOCUS_24870 gene nifJ 28959 32531 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_24870 32623 33630 gene locus_tag LOCUS_24880 32623 33630 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_24880 33966 33706 gene locus_tag LOCUS_24890 gene infA 33966 33706 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284370.1 protein_id gnl|my_center|LOCUS_24890 34194 33994 gene locus_tag LOCUS_24900 34194 33994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 34620 34511 gene locus_tag LOCUS_r00010 34620 34511 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence43 287 1228 gene locus_tag LOCUS_24910 287 1228 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964780.1 protein_id gnl|my_center|LOCUS_24910 2864 1233 gene locus_tag LOCUS_24920 gene nadB 2864 1233 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939096.1 protein_id gnl|my_center|LOCUS_24920 3888 2857 gene locus_tag LOCUS_24930 gene nadA 3888 2857 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404647.1 protein_id gnl|my_center|LOCUS_24930 4743 3892 gene locus_tag LOCUS_24940 gene nadC 4743 3892 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_24940 7050 5137 gene locus_tag LOCUS_24950 7050 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 8040 7264 gene locus_tag LOCUS_24960 8040 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 8918 8037 gene locus_tag LOCUS_24970 8918 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 9411 8926 gene locus_tag LOCUS_24980 gene folK 9411 8926 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_24980 10106 9408 gene locus_tag LOCUS_24990 10106 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 11134 10103 gene locus_tag LOCUS_25000 11134 10103 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_25000 11897 11163 gene locus_tag LOCUS_25010 11897 11163 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_25010 12430 11903 gene locus_tag LOCUS_25020 12430 11903 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_25020 13322 12507 gene locus_tag LOCUS_25030 gene murI 13322 12507 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_25030 14050 13325 gene locus_tag LOCUS_25040 14050 13325 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_25040 14480 14133 gene locus_tag LOCUS_25050 gene rplS 14480 14133 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257535.1 protein_id gnl|my_center|LOCUS_25050 17181 14710 gene locus_tag LOCUS_25060 17181 14710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 17810 17178 gene locus_tag LOCUS_25070 17810 17178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 19787 17928 gene locus_tag LOCUS_25080 gene uvrC 19787 17928 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257899.1 protein_id gnl|my_center|LOCUS_25080 20832 19861 gene locus_tag LOCUS_25090 gene selD 20832 19861 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301201.1 protein_id gnl|my_center|LOCUS_25090 20944 21723 gene locus_tag LOCUS_25100 20944 21723 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258204.1 protein_id gnl|my_center|LOCUS_25100 21986 22741 gene locus_tag LOCUS_25110 21986 22741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 22738 23358 gene locus_tag LOCUS_25120 22738 23358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256163.1 protein_id gnl|my_center|LOCUS_25120 23366 25354 gene locus_tag LOCUS_25130 23366 25354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 25344 26018 gene locus_tag LOCUS_25140 25344 26018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256161.1 protein_id gnl|my_center|LOCUS_25140 26022 27749 gene locus_tag LOCUS_25150 26022 27749 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_25150 27746 28798 gene locus_tag LOCUS_25160 27746 28798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 28832 29467 gene locus_tag LOCUS_25170 28832 29467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 30986 29526 gene locus_tag LOCUS_25180 30986 29526 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_25180 32117 31014 gene locus_tag LOCUS_25190 32117 31014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 32701 32231 gene locus_tag LOCUS_25200 32701 32231 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_25200 32768 33793 gene locus_tag LOCUS_25210 32768 33793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 34407 33790 gene locus_tag LOCUS_25220 34407 33790 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 protein_id gnl|my_center|LOCUS_25220 34475 34550 gene locus_tag LOCUS_t00300 34475 34550 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence44 1598 516 gene locus_tag LOCUS_25230 1598 516 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_25230 3094 1688 gene locus_tag LOCUS_25240 gene gndA 3094 1688 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_25240 4377 3115 gene locus_tag LOCUS_25250 4377 3115 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_25250 5253 4417 gene locus_tag LOCUS_25260 5253 4417 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582612.1 protein_id gnl|my_center|LOCUS_25260 6674 5289 gene locus_tag LOCUS_25270 gene uxaC 6674 5289 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039186.1 protein_id gnl|my_center|LOCUS_25270 6820 7821 gene locus_tag LOCUS_25280 6820 7821 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_25280 8228 9418 gene locus_tag LOCUS_25290 8228 9418 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243026.1 protein_id gnl|my_center|LOCUS_25290 9579 11099 gene locus_tag LOCUS_25300 9579 11099 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243027.1 protein_id gnl|my_center|LOCUS_25300 11096 12079 gene locus_tag LOCUS_25310 11096 12079 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082910121.1 protein_id gnl|my_center|LOCUS_25310 12110 13036 gene locus_tag LOCUS_25320 12110 13036 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717730.1 protein_id gnl|my_center|LOCUS_25320 13086 13916 gene locus_tag LOCUS_25330 13086 13916 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392942.1 protein_id gnl|my_center|LOCUS_25330 14462 13986 gene locus_tag LOCUS_25340 14462 13986 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582732.1 protein_id gnl|my_center|LOCUS_25340 15354 14533 gene locus_tag LOCUS_25350 15354 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 15427 16035 gene locus_tag LOCUS_25360 15427 16035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 17098 16520 gene locus_tag LOCUS_25370 17098 16520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 17373 18284 gene locus_tag LOCUS_25380 17373 18284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25380 18295 18936 gene locus_tag LOCUS_25390 18295 18936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 19031 19573 gene locus_tag LOCUS_25400 19031 19573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 19809 20708 gene locus_tag LOCUS_25410 19809 20708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 21064 20828 gene locus_tag LOCUS_25420 21064 20828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 21283 22479 gene locus_tag LOCUS_25430 21283 22479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 24036 22525 gene locus_tag LOCUS_25440 24036 22525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 24538 24044 gene locus_tag LOCUS_25450 24538 24044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 24748 27291 gene locus_tag LOCUS_25460 24748 27291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 28702 27359 gene locus_tag LOCUS_25470 28702 27359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 29676 28699 gene locus_tag LOCUS_25480 29676 28699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 31354 29741 gene locus_tag LOCUS_25490 31354 29741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 31917 31441 gene locus_tag LOCUS_25500 31917 31441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 32819 31929 gene locus_tag LOCUS_25510 32819 31929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 33354 33058 gene locus_tag LOCUS_25520 33354 33058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 33519 34292 gene locus_tag LOCUS_25530 33519 34292 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891631.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence45 1876 740 gene locus_tag LOCUS_25540 1876 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 3242 1881 gene locus_tag LOCUS_25550 3242 1881 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896889.1 protein_id gnl|my_center|LOCUS_25550 4213 3239 gene locus_tag LOCUS_25560 4213 3239 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_25560 5529 4213 gene locus_tag LOCUS_25570 5529 4213 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_25570 6181 5543 gene locus_tag LOCUS_25580 6181 5543 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_25580 6728 6171 gene locus_tag LOCUS_25590 gene rimI 6728 6171 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 protein_id gnl|my_center|LOCUS_25590 7393 6725 gene locus_tag LOCUS_25600 gene tsaB 7393 6725 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_25600 7889 7395 gene locus_tag LOCUS_25610 gene tsaE 7889 7395 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257860.1 protein_id gnl|my_center|LOCUS_25610 9046 7901 gene locus_tag LOCUS_25620 9046 7901 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_25620 9236 9027 gene locus_tag LOCUS_25630 9236 9027 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909342.1 protein_id gnl|my_center|LOCUS_25630 9284 9925 gene locus_tag LOCUS_25640 9284 9925 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583822.1 protein_id gnl|my_center|LOCUS_25640 9930 10895 gene locus_tag LOCUS_25650 9930 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 10904 11191 gene locus_tag LOCUS_25660 10904 11191 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404971.1 protein_id gnl|my_center|LOCUS_25660 11795 11241 gene locus_tag LOCUS_25670 11795 11241 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 protein_id gnl|my_center|LOCUS_25670 12071 12988 gene locus_tag LOCUS_25680 gene era 12071 12988 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_25680 13110 13586 gene locus_tag LOCUS_25690 gene rpiB 13110 13586 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_25690 13588 14271 gene locus_tag LOCUS_25700 13588 14271 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528133.1 protein_id gnl|my_center|LOCUS_25700 14277 15215 gene locus_tag LOCUS_25710 14277 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 16706 15252 gene locus_tag LOCUS_25720 16706 15252 CDS product cytochrome c biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071250.1 protein_id gnl|my_center|LOCUS_25720 18162 16828 gene locus_tag LOCUS_25730 18162 16828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 19044 18226 gene locus_tag LOCUS_25740 19044 18226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 19581 19048 gene locus_tag LOCUS_25750 19581 19048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 19681 20310 gene locus_tag LOCUS_25760 19681 20310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 20547 21188 gene locus_tag LOCUS_25770 20547 21188 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_25770 21217 22365 gene locus_tag LOCUS_25780 21217 22365 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228931.1 protein_id gnl|my_center|LOCUS_25780 22362 24098 gene locus_tag LOCUS_25790 22362 24098 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_25790 24131 25207 gene locus_tag LOCUS_25800 24131 25207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 25222 25659 gene locus_tag LOCUS_25810 25222 25659 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027944.1 protein_id gnl|my_center|LOCUS_25810 25945 25718 gene locus_tag LOCUS_25820 25945 25718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 26290 25964 gene locus_tag LOCUS_25830 26290 25964 CDS product DUF4190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036963.1 protein_id gnl|my_center|LOCUS_25830 26894 26325 gene locus_tag LOCUS_25840 26894 26325 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258302.1 protein_id gnl|my_center|LOCUS_25840 27743 26934 gene locus_tag LOCUS_25850 27743 26934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 29061 27967 gene locus_tag LOCUS_25860 29061 27967 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_25860 29189 30571 gene locus_tag LOCUS_25870 29189 30571 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_25870 32589 30568 gene locus_tag LOCUS_25880 32589 30568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 32672 32881 gene locus_tag LOCUS_25890 32672 32881 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816072.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence46 2084 792 gene locus_tag LOCUS_25900 gene mtaB 2084 792 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_25900 2777 2115 gene locus_tag LOCUS_25910 2777 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 4198 2780 gene locus_tag LOCUS_25920 4198 2780 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880520.1 protein_id gnl|my_center|LOCUS_25920 5015 4203 gene locus_tag LOCUS_25930 5015 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 5116 5328 gene locus_tag LOCUS_25940 5116 5328 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_25940 6023 5394 gene locus_tag LOCUS_25950 6023 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 7171 6020 gene locus_tag LOCUS_25960 7171 6020 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257518.1 protein_id gnl|my_center|LOCUS_25960 7279 8172 gene locus_tag LOCUS_25970 7279 8172 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529577.1 protein_id gnl|my_center|LOCUS_25970 8225 9067 gene locus_tag LOCUS_25980 8225 9067 CDS product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_25980 9180 10421 gene locus_tag LOCUS_25990 9180 10421 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143789.1 protein_id gnl|my_center|LOCUS_25990 10455 13244 gene locus_tag LOCUS_26000 10455 13244 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_26000 13419 13973 gene locus_tag LOCUS_26010 gene crtO 13419 13973 CDS product glycosyl-4,4'-diaponeurosporenoate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805835.1 protein_id gnl|my_center|LOCUS_26010 13936 15084 gene locus_tag LOCUS_26020 13936 15084 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_26020 15095 15679 gene locus_tag LOCUS_26030 15095 15679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 15864 16301 gene locus_tag LOCUS_26040 15864 16301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 16458 19688 gene locus_tag LOCUS_26050 16458 19688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 19947 20075 gene locus_tag LOCUS_26060 19947 20075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 20181 20762 gene locus_tag LOCUS_26070 20181 20762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 20759 21076 gene locus_tag LOCUS_26080 20759 21076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 21099 21926 gene locus_tag LOCUS_26090 21099 21926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 23574 22021 gene locus_tag LOCUS_26100 23574 22021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 24148 23564 gene locus_tag LOCUS_26110 24148 23564 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966541.1 protein_id gnl|my_center|LOCUS_26110 24440 26626 gene locus_tag LOCUS_26120 24440 26626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 26750 28768 gene locus_tag LOCUS_26130 26750 28768 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259283.1 protein_id gnl|my_center|LOCUS_26130 28847 29290 gene locus_tag LOCUS_26140 28847 29290 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909108.1 protein_id gnl|my_center|LOCUS_26140 29333 30304 gene locus_tag LOCUS_26150 gene aztC 29333 30304 CDS product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532309.1 protein_id gnl|my_center|LOCUS_26150 30486 31373 gene locus_tag LOCUS_26160 30486 31373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence47 <1 609 gene locus_tag LOCUS_26170 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941622.1:transposase 1576 803 gene locus_tag LOCUS_26180 1576 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 4276 1625 gene locus_tag LOCUS_26190 4276 1625 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257621.1 protein_id gnl|my_center|LOCUS_26190 4733 4281 gene locus_tag LOCUS_26200 gene nrdR 4733 4281 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259262.1 protein_id gnl|my_center|LOCUS_26200 6119 4956 gene locus_tag LOCUS_26210 gene ftsZ 6119 4956 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_26210 7445 6210 gene locus_tag LOCUS_26220 gene ftsA 7445 6210 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392368.1 protein_id gnl|my_center|LOCUS_26220 9128 7449 gene locus_tag LOCUS_26230 9128 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 10235 9267 gene locus_tag LOCUS_26240 gene murB 10235 9267 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256646.1 protein_id gnl|my_center|LOCUS_26240 11659 10235 gene locus_tag LOCUS_26250 gene murC 11659 10235 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939773.1 protein_id gnl|my_center|LOCUS_26250 12195 11656 gene locus_tag LOCUS_26260 12195 11656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 13292 12192 gene locus_tag LOCUS_26270 13292 12192 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_26270 14469 13213 gene locus_tag LOCUS_26280 gene ftsW 14469 13213 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256650.1 protein_id gnl|my_center|LOCUS_26280 15818 14436 gene locus_tag LOCUS_26290 gene murD 15818 14436 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460698.1 protein_id gnl|my_center|LOCUS_26290 16813 15821 gene locus_tag LOCUS_26300 gene mraY 16813 15821 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_26300 16986 16810 gene locus_tag LOCUS_26310 16986 16810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 18772 16994 gene locus_tag LOCUS_26320 18772 16994 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_26320 19251 18769 gene locus_tag LOCUS_26330 19251 18769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 20245 19304 gene locus_tag LOCUS_26340 gene rsmH 20245 19304 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_26340 20684 20247 gene locus_tag LOCUS_26350 gene mraZ 20684 20247 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256658.1 protein_id gnl|my_center|LOCUS_26350 20863 21288 gene locus_tag LOCUS_26360 20863 21288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 21293 21808 gene locus_tag LOCUS_26370 21293 21808 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_26370 22502 21786 gene locus_tag LOCUS_26380 22502 21786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 23358 22495 gene locus_tag LOCUS_26390 23358 22495 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358679.1 protein_id gnl|my_center|LOCUS_26390 23535 23804 gene locus_tag LOCUS_26400 23535 23804 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660478.1 protein_id gnl|my_center|LOCUS_26400 23827 24033 gene locus_tag LOCUS_26410 gene copP 23827 24033 CDS product copper-binding metallochaperone CopP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648265.1 protein_id gnl|my_center|LOCUS_26410 24045 26471 gene locus_tag LOCUS_26420 24045 26471 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_26420 26627 28627 gene locus_tag LOCUS_26430 gene tkt 26627 28627 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_26430 28631 29083 gene locus_tag LOCUS_26440 28631 29083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 29080 31860 gene locus_tag LOCUS_26450 29080 31860 CDS product bifunctional transaldolase/phosoglucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089497.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence48 893 264 gene locus_tag LOCUS_26460 893 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1622 1038 gene locus_tag LOCUS_26470 1622 1038 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_26470 3060 1912 gene locus_tag LOCUS_26480 3060 1912 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_26480 3299 3129 gene locus_tag LOCUS_26490 3299 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 3850 3296 gene locus_tag LOCUS_26500 3850 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 4533 4072 gene locus_tag LOCUS_26510 4533 4072 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_26510 5299 4829 gene locus_tag LOCUS_26520 5299 4829 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966926.1 protein_id gnl|my_center|LOCUS_26520 9691 5438 gene locus_tag LOCUS_26530 9691 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 10593 10087 gene locus_tag LOCUS_26540 10593 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 11632 10652 gene locus_tag LOCUS_26550 11632 10652 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200923.1 protein_id gnl|my_center|LOCUS_26550 11693 12517 gene locus_tag LOCUS_26560 11693 12517 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066517.1 protein_id gnl|my_center|LOCUS_26560 13715 12762 gene locus_tag LOCUS_26570 13715 12762 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228220.1 protein_id gnl|my_center|LOCUS_26570 14680 13712 gene locus_tag LOCUS_26580 14680 13712 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966870.1 protein_id gnl|my_center|LOCUS_26580 16719 14782 gene locus_tag LOCUS_26590 16719 14782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 18268 17600 gene locus_tag LOCUS_26600 18268 17600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 18557 18261 gene locus_tag LOCUS_26610 18557 18261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 19534 18779 gene locus_tag LOCUS_26620 19534 18779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 21093 20266 gene locus_tag LOCUS_26630 21093 20266 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268112.1 protein_id gnl|my_center|LOCUS_26630 21985 21686 gene locus_tag LOCUS_26640 21985 21686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 23474 22422 gene locus_tag LOCUS_26650 23474 22422 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_26650 26019 23866 gene locus_tag LOCUS_26660 26019 23866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 26796 26029 gene locus_tag LOCUS_26670 26796 26029 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287292.1 protein_id gnl|my_center|LOCUS_26670 27817 26897 gene locus_tag LOCUS_26680 27817 26897 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_26680 29255 27891 gene locus_tag LOCUS_26690 29255 27891 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321046.1 protein_id gnl|my_center|LOCUS_26690 30351 29323 gene locus_tag LOCUS_26700 30351 29323 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_26700 >Feature sequence49 15 635 gene locus_tag LOCUS_26710 15 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 1543 767 gene locus_tag LOCUS_26720 gene yycF 1543 767 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262930.1 protein_id gnl|my_center|LOCUS_26720 2188 1733 gene locus_tag LOCUS_26730 2188 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2459 2163 gene locus_tag LOCUS_26740 2459 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 3959 2634 gene locus_tag LOCUS_26750 3959 2634 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222248.1 protein_id gnl|my_center|LOCUS_26750 4283 3981 gene locus_tag LOCUS_26760 4283 3981 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723637.1 protein_id gnl|my_center|LOCUS_26760 5041 4448 gene locus_tag LOCUS_26770 5041 4448 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256187.1 protein_id gnl|my_center|LOCUS_26770 5686 5093 gene locus_tag LOCUS_26780 5686 5093 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256187.1 protein_id gnl|my_center|LOCUS_26780 6201 5743 gene locus_tag LOCUS_26790 6201 5743 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986654.1 protein_id gnl|my_center|LOCUS_26790 7533 6223 gene locus_tag LOCUS_26800 7533 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 7725 8387 gene locus_tag LOCUS_26810 7725 8387 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 protein_id gnl|my_center|LOCUS_26810 11923 8393 gene locus_tag LOCUS_26820 11923 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 13781 12102 gene locus_tag LOCUS_26830 13781 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 14117 13872 gene locus_tag LOCUS_26840 14117 13872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 16251 14155 gene locus_tag LOCUS_26850 16251 14155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 17145 16357 gene locus_tag LOCUS_26860 17145 16357 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066690.1 protein_id gnl|my_center|LOCUS_26860 18196 17168 gene locus_tag LOCUS_26870 18196 17168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 18494 18676 gene locus_tag LOCUS_26880 18494 18676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 19153 23724 gene locus_tag LOCUS_26890 19153 23724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 24852 23845 gene locus_tag LOCUS_26900 24852 23845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932826.1 protein_id gnl|my_center|LOCUS_26900 25067 26902 gene locus_tag LOCUS_26910 25067 26902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 26903 27823 gene locus_tag LOCUS_26920 26903 27823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 29241 28057 gene locus_tag LOCUS_26930 gene gguB 29241 28057 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257795.1 protein_id gnl|my_center|LOCUS_26930 30773 29253 gene locus_tag LOCUS_26940 gene gguA 30773 29253 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257794.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence50 68 769 gene locus_tag LOCUS_26950 68 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 1543 860 gene locus_tag LOCUS_26960 1543 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 2475 1561 gene locus_tag LOCUS_26970 2475 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 3281 2568 gene locus_tag LOCUS_26980 3281 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 3425 3925 gene locus_tag LOCUS_26990 3425 3925 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066818.1 protein_id gnl|my_center|LOCUS_26990 5133 4018 gene locus_tag LOCUS_27000 5133 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 5820 5215 gene locus_tag LOCUS_27010 5820 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 6391 5813 gene locus_tag LOCUS_27020 gene rpoE 6391 5813 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_27020 7159 8175 gene locus_tag LOCUS_27030 7159 8175 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_27030 8172 8909 gene locus_tag LOCUS_27040 8172 8909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387006.1 protein_id gnl|my_center|LOCUS_27040 10465 9176 gene locus_tag LOCUS_27050 10465 9176 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259552.1 protein_id gnl|my_center|LOCUS_27050 12201 10471 gene locus_tag LOCUS_27060 12201 10471 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259553.1 protein_id gnl|my_center|LOCUS_27060 12611 14065 gene locus_tag LOCUS_27070 12611 14065 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 protein_id gnl|my_center|LOCUS_27070 14084 15193 gene locus_tag LOCUS_27080 14084 15193 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 protein_id gnl|my_center|LOCUS_27080 15729 15241 gene locus_tag LOCUS_27090 15729 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 16653 15793 gene locus_tag LOCUS_27100 16653 15793 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993979.1 protein_id gnl|my_center|LOCUS_27100 17501 16761 gene locus_tag LOCUS_27110 17501 16761 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_27110 17637 17915 gene locus_tag LOCUS_27120 17637 17915 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_27120 17908 18177 gene locus_tag LOCUS_27130 17908 18177 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015205689.1 protein_id gnl|my_center|LOCUS_27130 18294 19520 gene locus_tag LOCUS_27140 18294 19520 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_27140 19864 20166 gene locus_tag LOCUS_27150 19864 20166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 21025 20438 gene locus_tag LOCUS_27160 21025 20438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 21952 21374 gene locus_tag LOCUS_27170 21952 21374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 22556 22131 gene locus_tag LOCUS_27180 22556 22131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 23093 22605 gene locus_tag LOCUS_27190 23093 22605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 24498 23110 gene locus_tag LOCUS_27200 24498 23110 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_27200 26428 24506 gene locus_tag LOCUS_27210 26428 24506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 27582 27007 gene locus_tag LOCUS_27220 27582 27007 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230676.1 protein_id gnl|my_center|LOCUS_27220 28502 27855 gene locus_tag LOCUS_27230 28502 27855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 30133 28598 gene locus_tag LOCUS_27240 30133 28598 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764195.1 protein_id gnl|my_center|LOCUS_27240 30638 30330 gene locus_tag LOCUS_27250 30638 30330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence51 85 567 gene locus_tag LOCUS_27260 85 567 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396765.1 protein_id gnl|my_center|LOCUS_27260 1181 573 gene locus_tag LOCUS_27270 1181 573 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_27270 1716 1171 gene locus_tag LOCUS_27280 1716 1171 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227754.1 protein_id gnl|my_center|LOCUS_27280 1785 3080 gene locus_tag LOCUS_27290 1785 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 3861 3085 gene locus_tag LOCUS_27300 3861 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 4429 5355 gene locus_tag LOCUS_27310 4429 5355 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942950.1 protein_id gnl|my_center|LOCUS_27310 5352 8792 gene locus_tag LOCUS_27320 5352 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 9180 11033 gene locus_tag LOCUS_27330 9180 11033 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943274.1 protein_id gnl|my_center|LOCUS_27330 11052 13742 gene locus_tag LOCUS_27340 11052 13742 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258507.1 protein_id gnl|my_center|LOCUS_27340 15416 13899 gene locus_tag LOCUS_27350 15416 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 15603 15905 gene locus_tag LOCUS_27360 15603 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 16535 15909 gene locus_tag LOCUS_27370 16535 15909 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_27370 16877 17362 gene locus_tag LOCUS_27380 16877 17362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 17364 17675 gene locus_tag LOCUS_27390 17364 17675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 17681 19429 gene locus_tag LOCUS_27400 gene nuoL 17681 19429 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568473.1 protein_id gnl|my_center|LOCUS_27400 19433 20938 gene locus_tag LOCUS_27410 19433 20938 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 protein_id gnl|my_center|LOCUS_27410 20942 21253 gene locus_tag LOCUS_27420 20942 21253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 21311 21793 gene locus_tag LOCUS_27430 21311 21793 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_27430 21796 22299 gene locus_tag LOCUS_27440 21796 22299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27440 22302 23486 gene locus_tag LOCUS_27450 22302 23486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27450 23483 24409 gene locus_tag LOCUS_27460 23483 24409 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939562.1 protein_id gnl|my_center|LOCUS_27460 24406 24828 gene locus_tag LOCUS_27470 24406 24828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 24773 25279 gene locus_tag LOCUS_27480 gene hycI 24773 25279 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485809.1 protein_id gnl|my_center|LOCUS_27480 25942 25334 gene locus_tag LOCUS_27490 25942 25334 CDS product GntR family transcriptional regulator, LSA1692 subfamily inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675001.1 protein_id gnl|my_center|LOCUS_27490 26434 27429 gene locus_tag LOCUS_27500 26434 27429 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_27500 27518 28654 gene locus_tag LOCUS_27510 27518 28654 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence52 70 152 gene locus_tag LOCUS_t00310 70 152 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 189 1658 gene locus_tag LOCUS_27520 gene tig 189 1658 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830810.1 protein_id gnl|my_center|LOCUS_27520 1693 2298 gene locus_tag LOCUS_27530 gene clpP 1693 2298 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631995.1 protein_id gnl|my_center|LOCUS_27530 2367 3155 gene locus_tag LOCUS_27540 2367 3155 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_27540 3159 4205 gene locus_tag LOCUS_27550 gene rlmN 3159 4205 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_27550 4248 5159 gene locus_tag LOCUS_27560 gene ftsY 4248 5159 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081293.1 protein_id gnl|my_center|LOCUS_27560 5215 6276 gene locus_tag LOCUS_27570 gene prfB 5215 6276 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_27570 7325 6357 gene locus_tag LOCUS_27580 gene pfkA 7325 6357 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_27580 7557 7360 gene locus_tag LOCUS_27590 7557 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 8112 7576 gene locus_tag LOCUS_27600 8112 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 8463 8134 gene locus_tag LOCUS_27610 8463 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 9269 8490 gene locus_tag LOCUS_27620 9269 8490 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_27620 10134 9289 gene locus_tag LOCUS_27630 10134 9289 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_27630 10357 11001 gene locus_tag LOCUS_27640 10357 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 11011 11820 gene locus_tag LOCUS_27650 11011 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 11817 12512 gene locus_tag LOCUS_27660 11817 12512 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968194.1 protein_id gnl|my_center|LOCUS_27660 12617 13228 gene locus_tag LOCUS_27670 12617 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 14035 15141 gene locus_tag LOCUS_27680 14035 15141 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_27680 15277 15948 gene locus_tag LOCUS_27690 15277 15948 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 protein_id gnl|my_center|LOCUS_27690 15958 17334 gene locus_tag LOCUS_27700 15958 17334 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_27700 17433 19631 gene locus_tag LOCUS_27710 17433 19631 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_27710 19722 20189 gene locus_tag LOCUS_27720 19722 20189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 20182 20421 gene locus_tag LOCUS_27730 20182 20421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 20550 21797 gene locus_tag LOCUS_27740 20550 21797 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584137.1 protein_id gnl|my_center|LOCUS_27740 21860 22600 gene locus_tag LOCUS_27750 21860 22600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 22748 22675 gene locus_tag LOCUS_t00320 22748 22675 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 24283 22796 gene locus_tag LOCUS_27760 gene gltX 24283 22796 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257408.1 protein_id gnl|my_center|LOCUS_27760 25407 24307 gene locus_tag LOCUS_27770 gene rodA 25407 24307 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_27770 25690 25421 gene locus_tag LOCUS_27780 gene minE 25690 25421 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816777.1 protein_id gnl|my_center|LOCUS_27780 26495 25707 gene locus_tag LOCUS_27790 gene minD 26495 25707 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255922.1 protein_id gnl|my_center|LOCUS_27790 27221 26505 gene locus_tag LOCUS_27800 gene minC 27221 26505 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255923.1 protein_id gnl|my_center|LOCUS_27800 >Feature sequence53 <1 614 gene locus_tag LOCUS_27810 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257453.1:ATP-binding protein 1861 611 gene locus_tag LOCUS_27820 gene tetA(P) 1861 611 CDS product tetracycline efflux MFS transporter TetA(P) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964756.1 protein_id gnl|my_center|LOCUS_27820 3213 1879 gene locus_tag LOCUS_27830 3213 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 4109 3210 gene locus_tag LOCUS_27840 4109 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 5314 4106 gene locus_tag LOCUS_27850 5314 4106 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256834.1 protein_id gnl|my_center|LOCUS_27850 6068 5319 gene locus_tag LOCUS_27860 6068 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 6529 6065 gene locus_tag LOCUS_27870 6529 6065 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909388.1 protein_id gnl|my_center|LOCUS_27870 7237 6539 gene locus_tag LOCUS_27880 7237 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 7841 7242 gene locus_tag LOCUS_27890 7841 7242 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_27890 8794 7859 gene locus_tag LOCUS_27900 8794 7859 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_27900 9007 9504 gene locus_tag LOCUS_27910 9007 9504 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943250.1 protein_id gnl|my_center|LOCUS_27910 9578 11221 gene locus_tag LOCUS_27920 9578 11221 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 protein_id gnl|my_center|LOCUS_27920 11484 12290 gene locus_tag LOCUS_27930 11484 12290 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012644897.1 protein_id gnl|my_center|LOCUS_27930 12345 13199 gene locus_tag LOCUS_27940 12345 13199 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392729.1 protein_id gnl|my_center|LOCUS_27940 13597 13196 gene locus_tag LOCUS_27950 13597 13196 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816710.1 protein_id gnl|my_center|LOCUS_27950 14582 13728 gene locus_tag LOCUS_27960 gene focA 14582 13728 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816739.1 protein_id gnl|my_center|LOCUS_27960 16973 14613 gene locus_tag LOCUS_27970 16973 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 17448 16966 gene locus_tag LOCUS_27980 17448 16966 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_27980 18326 17445 gene locus_tag LOCUS_27990 18326 17445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 19909 18347 gene locus_tag LOCUS_28000 19909 18347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_28000 20989 19994 gene locus_tag LOCUS_28010 20989 19994 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029926.1 protein_id gnl|my_center|LOCUS_28010 21956 21024 gene locus_tag LOCUS_28020 21956 21024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938368.1 protein_id gnl|my_center|LOCUS_28020 23086 21953 gene locus_tag LOCUS_28030 23086 21953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969639.1 protein_id gnl|my_center|LOCUS_28030 23918 23163 gene locus_tag LOCUS_28040 23918 23163 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114176.1 protein_id gnl|my_center|LOCUS_28040 24858 24118 gene locus_tag LOCUS_28050 24858 24118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 26038 24944 gene locus_tag LOCUS_28060 26038 24944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence54 1659 889 gene locus_tag LOCUS_28070 1659 889 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005679031.1 protein_id gnl|my_center|LOCUS_28070 4915 1712 gene locus_tag LOCUS_28080 4915 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 7173 5119 gene locus_tag LOCUS_28090 7173 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 7895 7380 gene locus_tag LOCUS_28100 7895 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 8926 7892 gene locus_tag LOCUS_28110 8926 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 9543 8923 gene locus_tag LOCUS_28120 9543 8923 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_28120 9714 10205 gene locus_tag LOCUS_28130 9714 10205 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_28130 10292 10615 gene locus_tag LOCUS_28140 gene trxA 10292 10615 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_28140 10751 12511 gene locus_tag LOCUS_28150 10751 12511 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172451083.1 protein_id gnl|my_center|LOCUS_28150 12629 13423 gene locus_tag LOCUS_28160 12629 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 14598 13534 gene locus_tag LOCUS_28170 14598 13534 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888750.1 protein_id gnl|my_center|LOCUS_28170 14833 14633 gene locus_tag LOCUS_28180 14833 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 15751 14855 gene locus_tag LOCUS_28190 15751 14855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 15996 16793 gene locus_tag LOCUS_28200 15996 16793 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_28200 17052 17693 gene locus_tag LOCUS_28210 17052 17693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 17706 18644 gene locus_tag LOCUS_28220 17706 18644 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941155.1 protein_id gnl|my_center|LOCUS_28220 18712 20115 gene locus_tag LOCUS_28230 18712 20115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 20121 20549 gene locus_tag LOCUS_28240 gene rnhA 20121 20549 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770770.1 protein_id gnl|my_center|LOCUS_28240 20506 20703 gene locus_tag LOCUS_28250 20506 20703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 20716 21072 gene locus_tag LOCUS_28260 20716 21072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28260 21212 21141 gene locus_tag LOCUS_t00330 21212 21141 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 22388 21282 gene locus_tag LOCUS_28270 22388 21282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 23332 22385 gene locus_tag LOCUS_28280 23332 22385 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256056.1 protein_id gnl|my_center|LOCUS_28280 >Feature sequence55 687 277 gene locus_tag LOCUS_28290 687 277 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_28290 803 1057 gene locus_tag LOCUS_28300 803 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 1202 1744 gene locus_tag LOCUS_28310 1202 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2189 1884 gene locus_tag LOCUS_28320 2189 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 2073 2603 gene locus_tag LOCUS_28330 2073 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 2685 3188 gene locus_tag LOCUS_28340 2685 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 3451 4323 gene locus_tag LOCUS_28350 3451 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 4320 4994 gene locus_tag LOCUS_28360 4320 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 4963 5952 gene locus_tag LOCUS_28370 4963 5952 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_28370 5942 7222 gene locus_tag LOCUS_28380 5942 7222 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250796.1 protein_id gnl|my_center|LOCUS_28380 7231 7746 gene locus_tag LOCUS_28390 7231 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 7781 8212 gene locus_tag LOCUS_28400 7781 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 9523 8519 gene locus_tag LOCUS_28410 gene holB 9523 8519 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_28410 9582 11819 gene locus_tag LOCUS_28420 9582 11819 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257189.1 protein_id gnl|my_center|LOCUS_28420 12702 11881 gene locus_tag LOCUS_28430 12702 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 12820 13287 gene locus_tag LOCUS_28440 12820 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 13301 14107 gene locus_tag LOCUS_28450 13301 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 14357 14965 gene locus_tag LOCUS_28460 14357 14965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 15063 15764 gene locus_tag LOCUS_28470 15063 15764 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931455.1 protein_id gnl|my_center|LOCUS_28470 15740 16075 gene locus_tag LOCUS_28480 15740 16075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 17203 16223 gene locus_tag LOCUS_28490 17203 16223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 17477 18538 gene locus_tag LOCUS_28500 17477 18538 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868871.1 protein_id gnl|my_center|LOCUS_28500 18579 19571 gene locus_tag LOCUS_28510 gene pyrB 18579 19571 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_28510 19594 21030 gene locus_tag LOCUS_28520 19594 21030 CDS product bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_28520 21034 22062 gene locus_tag LOCUS_28530 21034 22062 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406732.1 protein_id gnl|my_center|LOCUS_28530 >Feature sequence56 1274 381 gene locus_tag LOCUS_28540 1274 381 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392729.1 protein_id gnl|my_center|LOCUS_28540 3006 1282 gene locus_tag LOCUS_28550 gene recJ 3006 1282 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_28550 4121 3006 gene locus_tag LOCUS_28560 4121 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 4207 5352 gene locus_tag LOCUS_28570 gene tgt 4207 5352 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_28570 5355 6176 gene locus_tag LOCUS_28580 gene uppP 5355 6176 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_28580 6199 6924 gene locus_tag LOCUS_28590 6199 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 7071 8171 gene locus_tag LOCUS_28600 gene recA 7071 8171 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388318.1 protein_id gnl|my_center|LOCUS_28600 8149 8706 gene locus_tag LOCUS_28610 8149 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 8731 9600 gene locus_tag LOCUS_28620 8731 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 10863 9604 gene locus_tag LOCUS_28630 gene ahcY 10863 9604 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258873.1 protein_id gnl|my_center|LOCUS_28630 11845 10883 gene locus_tag LOCUS_28640 11845 10883 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_28640 12162 14582 gene locus_tag LOCUS_28650 12162 14582 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256869.1 protein_id gnl|my_center|LOCUS_28650 14741 15553 gene locus_tag LOCUS_28660 14741 15553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 16833 15556 gene locus_tag LOCUS_28670 16833 15556 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_28670 17810 16833 gene locus_tag LOCUS_28680 17810 16833 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_28680 18778 17807 gene locus_tag LOCUS_28690 gene pdhA 18778 17807 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_28690 19244 21034 gene locus_tag LOCUS_28700 gene thrS 19244 21034 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665762.1 protein_id gnl|my_center|LOCUS_28700 >Feature sequence57 150 1490 gene locus_tag LOCUS_28710 gene hisD 150 1490 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888771.1 protein_id gnl|my_center|LOCUS_28710 1555 2562 gene locus_tag LOCUS_28720 1555 2562 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173753.1 protein_id gnl|my_center|LOCUS_28720 2570 3406 gene locus_tag LOCUS_28730 2570 3406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530487.1 protein_id gnl|my_center|LOCUS_28730 3410 4219 gene locus_tag LOCUS_28740 3410 4219 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531158.1 protein_id gnl|my_center|LOCUS_28740 4405 5439 gene locus_tag LOCUS_28750 gene hrcA 4405 5439 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_28750 5461 6027 gene locus_tag LOCUS_28760 gene grpE 5461 6027 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257941.1 protein_id gnl|my_center|LOCUS_28760 6037 7962 gene locus_tag LOCUS_28770 gene dnaK 6037 7962 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_28770 7970 9091 gene locus_tag LOCUS_28780 gene dnaJ 7970 9091 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_28780 9084 9998 gene locus_tag LOCUS_28790 9084 9998 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_28790 10157 10387 gene locus_tag LOCUS_28800 10157 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 11309 10395 gene locus_tag LOCUS_28810 gene thrB 11309 10395 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_28810 12367 11306 gene locus_tag LOCUS_28820 gene thrC 12367 11306 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865143.1 protein_id gnl|my_center|LOCUS_28820 12845 12420 gene locus_tag LOCUS_28830 12845 12420 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349708.1 protein_id gnl|my_center|LOCUS_28830 12934 13521 gene locus_tag LOCUS_28840 gene sigZ 12934 13521 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120749.1 protein_id gnl|my_center|LOCUS_28840 13583 14728 gene locus_tag LOCUS_28850 13583 14728 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791323.1 protein_id gnl|my_center|LOCUS_28850 14815 15549 gene locus_tag LOCUS_28860 gene lexA 14815 15549 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256381.1 protein_id gnl|my_center|LOCUS_28860 15997 15617 gene locus_tag LOCUS_28870 gene rplL 15997 15617 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536194.1 protein_id gnl|my_center|LOCUS_28870 16568 16038 gene locus_tag LOCUS_28880 gene rplJ 16568 16038 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_28880 17487 16768 gene locus_tag LOCUS_28890 gene rplA 17487 16768 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258051.1 protein_id gnl|my_center|LOCUS_28890 17966 17541 gene locus_tag LOCUS_28900 gene rplK 17966 17541 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_28900 18718 18044 gene locus_tag LOCUS_28910 gene nusG 18718 18044 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_28910 18967 18755 gene locus_tag LOCUS_28920 18967 18755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 19109 19035 gene locus_tag LOCUS_t00340 19109 19035 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 19333 19163 gene locus_tag LOCUS_28930 gene rpmG 19333 19163 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114322.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence58 1546 698 gene locus_tag LOCUS_28940 1546 698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080070.1 protein_id gnl|my_center|LOCUS_28940 2535 1543 gene locus_tag LOCUS_28950 2535 1543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080068.1 protein_id gnl|my_center|LOCUS_28950 4358 2625 gene locus_tag LOCUS_28960 4358 2625 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080066.1 protein_id gnl|my_center|LOCUS_28960 5571 4594 gene locus_tag LOCUS_28970 5571 4594 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584146.1 protein_id gnl|my_center|LOCUS_28970 6670 5651 gene locus_tag LOCUS_28980 6670 5651 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257043.1 protein_id gnl|my_center|LOCUS_28980 6981 7778 gene locus_tag LOCUS_28990 6981 7778 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258853.1 protein_id gnl|my_center|LOCUS_28990 7876 9018 gene locus_tag LOCUS_29000 7876 9018 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_29000 9015 10412 gene locus_tag LOCUS_29010 9015 10412 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_29010 10438 10528 gene locus_tag LOCUS_t00350 10438 10528 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11406 10684 gene locus_tag LOCUS_29020 11406 10684 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_29020 12335 11442 gene locus_tag LOCUS_29030 12335 11442 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036544.1 protein_id gnl|my_center|LOCUS_29030 12740 12378 gene locus_tag LOCUS_29040 12740 12378 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944172.1 protein_id gnl|my_center|LOCUS_29040 13334 13092 gene locus_tag LOCUS_29050 13334 13092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256705.1 protein_id gnl|my_center|LOCUS_29050 13781 14755 gene locus_tag LOCUS_29060 13781 14755 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480277.1 protein_id gnl|my_center|LOCUS_29060 14757 15779 gene locus_tag LOCUS_29070 14757 15779 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350864.1 protein_id gnl|my_center|LOCUS_29070 15782 16579 gene locus_tag LOCUS_29080 15782 16579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 17095 16649 gene locus_tag LOCUS_29090 17095 16649 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084078882.1 protein_id gnl|my_center|LOCUS_29090 17329 17805 gene locus_tag LOCUS_29100 17329 17805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 18278 17880 gene locus_tag LOCUS_29110 18278 17880 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence59 188 418 gene locus_tag LOCUS_29120 188 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 415 1101 gene locus_tag LOCUS_29130 415 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 1071 1760 gene locus_tag LOCUS_29140 1071 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 1745 2248 gene locus_tag LOCUS_29150 1745 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 2248 2754 gene locus_tag LOCUS_29160 2248 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 2759 3529 gene locus_tag LOCUS_29170 2759 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 3538 3933 gene locus_tag LOCUS_29180 3538 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 3930 4121 gene locus_tag LOCUS_29190 3930 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 7294 4253 gene locus_tag LOCUS_29200 7294 4253 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966800.1 protein_id gnl|my_center|LOCUS_29200 8975 7452 gene locus_tag LOCUS_29210 8975 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 9667 9389 gene locus_tag LOCUS_29220 9667 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 9899 9693 gene locus_tag LOCUS_29230 9899 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 10274 9918 gene locus_tag LOCUS_29240 10274 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 12249 10315 gene locus_tag LOCUS_29250 12249 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 12455 13414 gene locus_tag LOCUS_29260 12455 13414 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256215.1 protein_id gnl|my_center|LOCUS_29260 13440 14606 gene locus_tag LOCUS_29270 13440 14606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 14667 15767 gene locus_tag LOCUS_29280 14667 15767 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546631.1 protein_id gnl|my_center|LOCUS_29280 16344 15835 gene locus_tag LOCUS_29290 16344 15835 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989581.1 protein_id gnl|my_center|LOCUS_29290 17395 16388 gene locus_tag LOCUS_29300 17395 16388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 17735 17382 gene locus_tag LOCUS_29310 17735 17382 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265882.1 protein_id gnl|my_center|LOCUS_29310 17861 18205 gene locus_tag LOCUS_29320 17861 18205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 >Feature sequence60 1350 835 gene locus_tag LOCUS_29330 1350 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 1582 2706 gene locus_tag LOCUS_29340 1582 2706 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_29340 2908 3507 gene locus_tag LOCUS_29350 2908 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 4001 5629 gene locus_tag LOCUS_29360 4001 5629 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_29360 7082 5700 gene locus_tag LOCUS_29370 7082 5700 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705197.1 protein_id gnl|my_center|LOCUS_29370 7401 8168 gene locus_tag LOCUS_29380 gene surE 7401 8168 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258539.1 protein_id gnl|my_center|LOCUS_29380 9878 8253 gene locus_tag LOCUS_29390 9878 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 10498 10031 gene locus_tag LOCUS_29400 gene bfr 10498 10031 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_29400 10934 10647 gene locus_tag LOCUS_29410 10934 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 12363 11188 gene locus_tag LOCUS_29420 gene xylA 12363 11188 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_29420 13592 12378 gene locus_tag LOCUS_29430 13592 12378 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 protein_id gnl|my_center|LOCUS_29430 14831 13632 gene locus_tag LOCUS_29440 gene gguB 14831 13632 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974840.1 protein_id gnl|my_center|LOCUS_29440 16398 14872 gene locus_tag LOCUS_29450 16398 14872 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 protein_id gnl|my_center|LOCUS_29450 >Feature sequence61 577 2847 gene locus_tag LOCUS_29460 577 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 4015 2831 gene locus_tag LOCUS_29470 4015 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 4379 4089 gene locus_tag LOCUS_29480 4379 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 4991 4416 gene locus_tag LOCUS_29490 4991 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 5673 4993 gene locus_tag LOCUS_29500 5673 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 6286 5774 gene locus_tag LOCUS_29510 6286 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 7900 6344 gene locus_tag LOCUS_29520 7900 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 9119 7962 gene locus_tag LOCUS_29530 9119 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 10237 9203 gene locus_tag LOCUS_29540 10237 9203 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226230.1 protein_id gnl|my_center|LOCUS_29540 10833 12338 gene locus_tag LOCUS_29550 gene araA 10833 12338 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705775.1 protein_id gnl|my_center|LOCUS_29550 12412 13503 gene locus_tag LOCUS_29560 gene chvE 12412 13503 CDS product sugar ABC transporter substrate-binding protein ChvE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311697.1 protein_id gnl|my_center|LOCUS_29560 13646 15187 gene locus_tag LOCUS_29570 gene gguA 13646 15187 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 protein_id gnl|my_center|LOCUS_29570 15184 16347 gene locus_tag LOCUS_29580 gene gguB 15184 16347 CDS product sugar ABC transporter permease GguB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 protein_id gnl|my_center|LOCUS_29580 16671 16459 gene locus_tag LOCUS_29590 16671 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence62 1 399 gene locus_tag LOCUS_29600 1 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 507 2000 gene locus_tag LOCUS_29610 507 2000 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687230.1 protein_id gnl|my_center|LOCUS_29610 2002 2994 gene locus_tag LOCUS_29620 2002 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978822.1 protein_id gnl|my_center|LOCUS_29620 3009 3815 gene locus_tag LOCUS_29630 3009 3815 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811367.1 protein_id gnl|my_center|LOCUS_29630 3854 4483 gene locus_tag LOCUS_29640 gene hxlA 3854 4483 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246452.1 protein_id gnl|my_center|LOCUS_29640 4528 5094 gene locus_tag LOCUS_29650 gene hxlB 4528 5094 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 protein_id gnl|my_center|LOCUS_29650 5129 6097 gene locus_tag LOCUS_29660 5129 6097 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 protein_id gnl|my_center|LOCUS_29660 6239 7201 gene locus_tag LOCUS_29670 6239 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 8049 7198 gene locus_tag LOCUS_29680 8049 7198 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704983.1 protein_id gnl|my_center|LOCUS_29680 8519 8445 gene locus_tag LOCUS_t00360 8519 8445 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9534 8623 gene locus_tag LOCUS_29690 9534 8623 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 protein_id gnl|my_center|LOCUS_29690 9627 10514 gene locus_tag LOCUS_29700 9627 10514 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_29700 11162 10548 gene locus_tag LOCUS_29710 11162 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 11959 11195 gene locus_tag LOCUS_29720 11959 11195 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_29720 12172 12780 gene locus_tag LOCUS_29730 12172 12780 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_29730 12866 14233 gene locus_tag LOCUS_29740 gene dnaB 12866 14233 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_29740 14235 14951 gene locus_tag LOCUS_29750 14235 14951 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257454.1 protein_id gnl|my_center|LOCUS_29750 >Feature sequence63 2111 1059 gene locus_tag LOCUS_29760 gene gap 2111 1059 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_29760 3495 2176 gene locus_tag LOCUS_29770 3495 2176 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920957.1 protein_id gnl|my_center|LOCUS_29770 3667 5190 gene locus_tag LOCUS_29780 3667 5190 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257930.1 protein_id gnl|my_center|LOCUS_29780 5240 6592 gene locus_tag LOCUS_29790 5240 6592 CDS product CpXC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257830.1 protein_id gnl|my_center|LOCUS_29790 7895 6726 gene locus_tag LOCUS_29800 7895 6726 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258067.1 protein_id gnl|my_center|LOCUS_29800 8839 8159 gene locus_tag LOCUS_29810 8839 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 8979 9965 gene locus_tag LOCUS_29820 8979 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 12774 9967 gene locus_tag LOCUS_29830 12774 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 14142 12793 gene locus_tag LOCUS_29840 14142 12793 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_29840 14293 14985 gene locus_tag LOCUS_29850 14293 14985 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence64 1067 1720 gene locus_tag LOCUS_29860 1067 1720 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_29860 2388 1756 gene locus_tag LOCUS_29870 2388 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 3413 2418 gene locus_tag LOCUS_29880 3413 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 3450 3749 gene locus_tag LOCUS_29890 3450 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 4262 3630 gene locus_tag LOCUS_29900 4262 3630 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256303.1 protein_id gnl|my_center|LOCUS_29900 4652 4275 gene locus_tag LOCUS_29910 4652 4275 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_29910 5956 4802 gene locus_tag LOCUS_29920 5956 4802 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 protein_id gnl|my_center|LOCUS_29920 7719 5953 gene locus_tag LOCUS_29930 7719 5953 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_29930 8544 7891 gene locus_tag LOCUS_29940 8544 7891 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990695.1 protein_id gnl|my_center|LOCUS_29940 8771 11302 gene locus_tag LOCUS_29950 gene mgtA 8771 11302 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_29950 11472 12053 gene locus_tag LOCUS_29960 11472 12053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 12473 12967 gene locus_tag LOCUS_29970 12473 12967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 12968 13195 gene locus_tag LOCUS_29980 12968 13195 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_29980 13221 13352 gene locus_tag LOCUS_29990 13221 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 13354 14379 gene locus_tag LOCUS_30000 13354 14379 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_30000 >Feature sequence65 364 1032 gene locus_tag LOCUS_30010 364 1032 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_30010 1357 1145 gene locus_tag LOCUS_30020 1357 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 1471 2097 gene locus_tag LOCUS_30030 1471 2097 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_30030 2163 2236 gene locus_tag LOCUS_t00370 2163 2236 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2374 2691 gene locus_tag LOCUS_30040 gene rplU 2374 2691 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_30040 2697 2969 gene locus_tag LOCUS_30050 gene rpmA 2697 2969 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_30050 3052 3525 gene locus_tag LOCUS_30060 3052 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 3639 4211 gene locus_tag LOCUS_30070 3639 4211 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405033.1 protein_id gnl|my_center|LOCUS_30070 4246 4800 gene locus_tag LOCUS_30080 gene hpt 4246 4800 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_30080 4820 6334 gene locus_tag LOCUS_30090 4820 6334 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881416.1 protein_id gnl|my_center|LOCUS_30090 6324 7085 gene locus_tag LOCUS_30100 6324 7085 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_30100 8640 7093 gene locus_tag LOCUS_30110 8640 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 9506 8637 gene locus_tag LOCUS_30120 9506 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 9699 10931 gene locus_tag LOCUS_30130 9699 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 11580 11302 gene locus_tag LOCUS_30140 11580 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 >Feature sequence66 622 1524 gene locus_tag LOCUS_30150 622 1524 CDS product CRISPR-associated ring nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258133.1 protein_id gnl|my_center|LOCUS_30150 1608 4082 gene locus_tag LOCUS_30160 gene cas10 1608 4082 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229152.1 protein_id gnl|my_center|LOCUS_30160 4085 4477 gene locus_tag LOCUS_30170 4085 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 4498 5298 gene locus_tag LOCUS_30180 gene csm3 4498 5298 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256463.1 protein_id gnl|my_center|LOCUS_30180 5295 6320 gene locus_tag LOCUS_30190 gene csm4 5295 6320 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256462.1 protein_id gnl|my_center|LOCUS_30190 6317 7447 gene locus_tag LOCUS_30200 6317 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 7444 8661 gene locus_tag LOCUS_30210 7444 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 8666 9643 gene locus_tag LOCUS_30220 8666 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 9669 10058 gene locus_tag LOCUS_30230 gene csx15 9669 10058 CDS product CRISPR-associated protein Csx15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257334.1 protein_id gnl|my_center|LOCUS_30230 10073 10912 gene locus_tag LOCUS_30240 gene cas6 10073 10912 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256458.1 protein_id gnl|my_center|LOCUS_30240 10937 11947 gene locus_tag LOCUS_30250 gene cas1 10937 11947 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_30250 11960 12244 gene locus_tag LOCUS_30260 11960 12244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 12346 >13909 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttaaaaacaacaaatgcccgtcagggcattgagac >Feature sequence67 1854 112 gene locus_tag LOCUS_30270 1854 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860733.1 protein_id gnl|my_center|LOCUS_30270 2784 1858 gene locus_tag LOCUS_30280 2784 1858 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_30280 4479 3430 gene locus_tag LOCUS_30290 4479 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 4918 4484 gene locus_tag LOCUS_30300 4918 4484 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546638.1 protein_id gnl|my_center|LOCUS_30300 6679 5291 gene locus_tag LOCUS_30310 6679 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 7809 6895 gene locus_tag LOCUS_30320 7809 6895 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243262.1 protein_id gnl|my_center|LOCUS_30320 7926 8207 gene locus_tag LOCUS_30330 7926 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 8487 9134 gene locus_tag LOCUS_30340 8487 9134 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_30340 9124 10107 gene locus_tag LOCUS_30350 9124 10107 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_30350 10129 10551 gene locus_tag LOCUS_30360 10129 10551 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966052.1 protein_id gnl|my_center|LOCUS_30360 13248 10723 gene locus_tag LOCUS_30370 13248 10723 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272299.1 protein_id gnl|my_center|LOCUS_30370 13612 13313 gene locus_tag LOCUS_30380 13612 13313 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668756.1 protein_id gnl|my_center|LOCUS_30380 >Feature sequence68 2272 1292 gene locus_tag LOCUS_30390 2272 1292 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721880.1 protein_id gnl|my_center|LOCUS_30390 2392 3369 gene locus_tag LOCUS_30400 2392 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 3558 5648 gene locus_tag LOCUS_30410 3558 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 5815 6768 gene locus_tag LOCUS_30420 5815 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 6794 7675 gene locus_tag LOCUS_30430 6794 7675 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 protein_id gnl|my_center|LOCUS_30430 7917 8456 gene locus_tag LOCUS_30440 7917 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 8489 9103 gene locus_tag LOCUS_30450 gene tsf 8489 9103 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_30450 10007 9294 gene locus_tag LOCUS_30460 10007 9294 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027265332.1 protein_id gnl|my_center|LOCUS_30460 11256 10027 gene locus_tag LOCUS_30470 11256 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 12682 11513 gene locus_tag LOCUS_30480 12682 11513 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence69 106 1344 gene locus_tag LOCUS_30490 106 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 1341 2189 gene locus_tag LOCUS_30500 gene rsmA 1341 2189 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256787.1 protein_id gnl|my_center|LOCUS_30500 2253 2873 gene locus_tag LOCUS_30510 2253 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 3042 3338 gene locus_tag LOCUS_30520 3042 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 5321 3339 gene locus_tag LOCUS_30530 5321 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 5513 6619 gene locus_tag LOCUS_30540 5513 6619 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_30540 6626 8026 gene locus_tag LOCUS_30550 gene cysS 6626 8026 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257711.1 protein_id gnl|my_center|LOCUS_30550 8030 8758 gene locus_tag LOCUS_30560 gene rlmB 8030 8758 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257938.1 protein_id gnl|my_center|LOCUS_30560 8862 9344 gene locus_tag LOCUS_30570 8862 9344 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870310.1 protein_id gnl|my_center|LOCUS_30570 9927 9412 gene locus_tag LOCUS_30580 9927 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 11207 9939 gene locus_tag LOCUS_30590 gene serS 11207 9939 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_30590 >Feature sequence70 62 1564 gene locus_tag LOCUS_30600 62 1564 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_30600 1630 2415 gene locus_tag LOCUS_30610 1630 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 3637 2474 gene locus_tag LOCUS_30620 3637 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3731 3913 gene locus_tag LOCUS_30630 3731 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 3936 4148 gene locus_tag LOCUS_30640 3936 4148 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869140.1 protein_id gnl|my_center|LOCUS_30640 4739 4194 gene locus_tag LOCUS_30650 4739 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 4899 5120 gene locus_tag LOCUS_30660 4899 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 6277 5117 gene locus_tag LOCUS_30670 6277 5117 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257518.1 protein_id gnl|my_center|LOCUS_30670 6376 7290 gene locus_tag LOCUS_30680 6376 7290 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529577.1 protein_id gnl|my_center|LOCUS_30680 7318 8157 gene locus_tag LOCUS_30690 gene proC 7318 8157 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_30690 9217 8201 gene locus_tag LOCUS_30700 gene cydB 9217 8201 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933479.1 protein_id gnl|my_center|LOCUS_30700 10612 9227 gene locus_tag LOCUS_30710 10612 9227 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461542.1 protein_id gnl|my_center|LOCUS_30710 11068 10646 gene locus_tag LOCUS_30720 11068 10646 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933365.1 protein_id gnl|my_center|LOCUS_30720 11176 12240 gene locus_tag LOCUS_30730 gene prfA 11176 12240 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583170.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence71 <1 1060 gene locus_tag LOCUS_30740 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383451.1:DSD1 family PLP-dependent enzyme 1098 1916 gene locus_tag LOCUS_30750 1098 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 1918 3069 gene locus_tag LOCUS_30760 1918 3069 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816110.1 protein_id gnl|my_center|LOCUS_30760 3474 3184 gene locus_tag LOCUS_30770 3474 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 4273 5505 gene locus_tag LOCUS_30780 4273 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 5741 5968 gene locus_tag LOCUS_30790 5741 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 5995 6306 gene locus_tag LOCUS_30800 5995 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 7068 6460 gene locus_tag LOCUS_30810 gene sigZ 7068 6460 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398507.1 protein_id gnl|my_center|LOCUS_30810 7424 7068 gene locus_tag LOCUS_30820 7424 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 7893 8045 gene locus_tag LOCUS_30830 7893 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 9894 10163 gene locus_tag LOCUS_30840 9894 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 10730 10308 gene locus_tag LOCUS_30850 10730 10308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 >Feature sequence72 1483 839 gene locus_tag LOCUS_30860 1483 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 2063 1581 gene locus_tag LOCUS_30870 2063 1581 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486744.1 protein_id gnl|my_center|LOCUS_30870 2199 2687 gene locus_tag LOCUS_30880 gene sylA 2199 2687 CDS product transcriptional regulator SylA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359121.1 protein_id gnl|my_center|LOCUS_30880 2773 4533 gene locus_tag LOCUS_30890 2773 4533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_30890 4526 6466 gene locus_tag LOCUS_30900 4526 6466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_30900 8018 6534 gene locus_tag LOCUS_30910 8018 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 8220 8645 gene locus_tag LOCUS_30920 8220 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 8739 9500 gene locus_tag LOCUS_30930 8739 9500 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_30930 9504 11132 gene locus_tag LOCUS_30940 9504 11132 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_30940 >Feature sequence73 2453 1725 gene locus_tag LOCUS_30950 2453 1725 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963790.1 protein_id gnl|my_center|LOCUS_30950 3974 2460 gene locus_tag LOCUS_30960 3974 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257117.1 protein_id gnl|my_center|LOCUS_30960 4875 4003 gene locus_tag LOCUS_30970 gene rfbD 4875 4003 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582730.1 protein_id gnl|my_center|LOCUS_30970 5276 4989 gene locus_tag LOCUS_30980 5276 4989 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_30980 5532 5269 gene locus_tag LOCUS_30990 5532 5269 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_30990 7585 5633 gene locus_tag LOCUS_31000 7585 5633 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_31000 8705 7596 gene locus_tag LOCUS_31010 8705 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 9826 8705 gene locus_tag LOCUS_31020 9826 8705 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258587.1 protein_id gnl|my_center|LOCUS_31020 >Feature sequence74 576 1664 gene locus_tag LOCUS_31030 576 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 1858 2661 gene locus_tag LOCUS_31040 1858 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 2983 4269 gene locus_tag LOCUS_31050 gene gluD 2983 4269 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420866.1 protein_id gnl|my_center|LOCUS_31050 5117 4314 gene locus_tag LOCUS_31060 5117 4314 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_31060 6020 5211 gene locus_tag LOCUS_31070 6020 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 6123 6677 gene locus_tag LOCUS_31080 6123 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 7925 6678 gene locus_tag LOCUS_31090 7925 6678 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259400.1 protein_id gnl|my_center|LOCUS_31090 8769 7936 gene locus_tag LOCUS_31100 8769 7936 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_31100 <9533 8775 gene locus_tag LOCUS_31110 <9533 8775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941312.1:carbon-nitrogen hydrolase >Feature sequence75 935 252 gene locus_tag LOCUS_31120 935 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 1818 949 gene locus_tag LOCUS_31130 1818 949 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259119.1 protein_id gnl|my_center|LOCUS_31130 3144 1834 gene locus_tag LOCUS_31140 3144 1834 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_31140 3213 3689 gene locus_tag LOCUS_31150 3213 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 4248 5303 gene locus_tag LOCUS_31160 4248 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 5420 5821 gene locus_tag LOCUS_31170 5420 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 5826 6266 gene locus_tag LOCUS_31180 5826 6266 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108259.1 protein_id gnl|my_center|LOCUS_31180 >Feature sequence76 553 1851 gene locus_tag LOCUS_31190 553 1851 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288817.1 protein_id gnl|my_center|LOCUS_31190 1927 2250 gene locus_tag LOCUS_31200 1927 2250 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901606.1 protein_id gnl|my_center|LOCUS_31200 2284 3309 gene locus_tag LOCUS_31210 2284 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 3387 4040 gene locus_tag LOCUS_31220 3387 4040 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869658.1 protein_id gnl|my_center|LOCUS_31220 4058 4324 gene locus_tag LOCUS_31230 4058 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 4349 4684 gene locus_tag LOCUS_31240 4349 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 4681 5400 gene locus_tag LOCUS_31250 4681 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 5418 6128 gene locus_tag LOCUS_31260 5418 6128 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_31260 6377 7150 gene locus_tag LOCUS_31270 6377 7150 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987106.1 protein_id gnl|my_center|LOCUS_31270 7274 8440 gene locus_tag LOCUS_31280 gene alr 7274 8440 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_31280 8499 8571 gene locus_tag LOCUS_t00380 8499 8571 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8845 8763 gene locus_tag LOCUS_t00390 8845 8763 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence77 1302 373 gene locus_tag LOCUS_31290 1302 373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_31290 2249 1299 gene locus_tag LOCUS_31300 2249 1299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_31300 3373 2252 gene locus_tag LOCUS_31310 3373 2252 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_31310 3996 3370 gene locus_tag LOCUS_31320 3996 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 4216 4869 gene locus_tag LOCUS_31330 4216 4869 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_31330 5494 4892 gene locus_tag LOCUS_31340 5494 4892 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943862.1 protein_id gnl|my_center|LOCUS_31340 5695 6618 gene locus_tag LOCUS_31350 5695 6618 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224041.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence78 1342 635 gene locus_tag LOCUS_31360 1342 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 1505 2422 gene locus_tag LOCUS_31370 1505 2422 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259143.1 protein_id gnl|my_center|LOCUS_31370 2890 2817 gene locus_tag LOCUS_t00400 2890 2817 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3035 3670 gene locus_tag LOCUS_31380 3035 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3731 4393 gene locus_tag LOCUS_31390 3731 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 5365 4415 gene locus_tag LOCUS_31400 5365 4415 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889308.1 protein_id gnl|my_center|LOCUS_31400 6264 5362 gene locus_tag LOCUS_31410 6264 5362 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_31410 >Feature sequence79 <1 912 gene locus_tag LOCUS_31420 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583849.1:CBS domain-containing protein 931 1470 gene locus_tag LOCUS_31430 931 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 2035 1451 gene locus_tag LOCUS_31440 2035 1451 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259156.1 protein_id gnl|my_center|LOCUS_31440 2208 4280 gene locus_tag LOCUS_31450 gene fusA 2208 4280 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_31450 >Feature sequence80 703 455 gene locus_tag LOCUS_31460 703 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 1933 713 gene locus_tag LOCUS_31470 gene xseA 1933 713 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259569.1 protein_id gnl|my_center|LOCUS_31470 2030 2479 gene locus_tag LOCUS_31480 2030 2479 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583739.1 protein_id gnl|my_center|LOCUS_31480 2513 3034 gene locus_tag LOCUS_31490 2513 3034 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837076.1 protein_id gnl|my_center|LOCUS_31490 3800 3084 gene locus_tag LOCUS_31500 3800 3084 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990768.1 protein_id gnl|my_center|LOCUS_31500 4796 3813 gene locus_tag LOCUS_31510 4796 3813 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_31510 >Feature sequence81 137 2434 gene locus_tag LOCUS_31520 137 2434 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257190.1 protein_id gnl|my_center|LOCUS_31520 2535 2846 gene locus_tag LOCUS_31530 gene lsrG 2535 2846 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098845.1 protein_id gnl|my_center|LOCUS_31530 2843 4000 gene locus_tag LOCUS_31540 2843 4000 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486144.1 protein_id gnl|my_center|LOCUS_31540 4907 4062 gene locus_tag LOCUS_31550 4907 4062 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence82 2445 1945 gene locus_tag LOCUS_31560 2445 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 3297 2452 gene locus_tag LOCUS_31570 gene mreC 3297 2452 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964556.1 protein_id gnl|my_center|LOCUS_31570 4408 3344 gene locus_tag LOCUS_31580 4408 3344 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_31580 >Feature sequence83 1402 1052 gene locus_tag LOCUS_31590 1402 1052 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141202.1 protein_id gnl|my_center|LOCUS_31590 1578 2213 gene locus_tag LOCUS_31600 1578 2213 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223578.1 protein_id gnl|my_center|LOCUS_31600 2210 3037 gene locus_tag LOCUS_31610 2210 3037 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021186.1 protein_id gnl|my_center|LOCUS_31610 >Feature sequence84 <1 1360 gene locus_tag LOCUS_31620 <1 1360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583619.1:TrpB-like pyridoxal phosphate-dependent enzyme 1844 1500 gene locus_tag LOCUS_31630 1844 1500 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_31630 2122 1841 gene locus_tag LOCUS_31640 2122 1841 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022117.1 protein_id gnl|my_center|LOCUS_31640 3335 2109 gene locus_tag LOCUS_31650 3335 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 4159 3332 gene locus_tag LOCUS_31660 4159 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence85 2100 1069 gene locus_tag LOCUS_31670 2100 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 3285 2290 gene locus_tag LOCUS_31680 3285 2290 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986275.1 protein_id gnl|my_center|LOCUS_31680 >Feature sequence86 2110 3366 gene locus_tag LOCUS_31690 2110 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 3379 3525 gene locus_tag LOCUS_31700 3379 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 >Feature sequence87 <1 1227 gene locus_tag LOCUS_31710 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943352.1:4Fe-4S binding protein 2528 1224 gene locus_tag LOCUS_31720 2528 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 2617 3366 gene locus_tag LOCUS_31730 2617 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 3473 3545 gene locus_tag LOCUS_t00410 3473 3545 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence88 <1 1119 gene locus_tag LOCUS_31740 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233927.1:DUF3048 domain-containing protein 1139 1678 gene locus_tag LOCUS_31750 1139 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 >Feature sequence89 >Feature sequence90 1023 85 gene locus_tag LOCUS_31760 1023 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 1121 1711 gene locus_tag LOCUS_31770 1121 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 <2238 1679 gene locus_tag LOCUS_31780 <2238 1679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257055.1:ABC transporter permease >Feature sequence91 936 127 gene locus_tag LOCUS_31790 936 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1161 1586 gene locus_tag LOCUS_31800 1161 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 >Feature sequence92 1171 254 gene locus_tag LOCUS_31810 gene rfbB 1171 254 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978112.1 protein_id gnl|my_center|LOCUS_31810 >Feature sequence93 1360 137 gene locus_tag LOCUS_31820 1360 137 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140087.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence94 230 63 gene locus_tag LOCUS_31830 230 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 <1664 1103 gene locus_tag LOCUS_31840 <1664 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056920.1:A/G-specific adenine glycosylase >Feature sequence95