>Feature sequence001 122 892 gene locus_tag LOCUS_00010 122 892 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868662.1 protein_id gnl|my_center|LOCUS_00010 1592 897 gene locus_tag LOCUS_00020 1592 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2930 1602 gene locus_tag LOCUS_00030 gene rimO 2930 1602 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_00030 5921 2934 gene locus_tag LOCUS_00040 5921 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7377 6055 gene locus_tag LOCUS_00050 7377 6055 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 protein_id gnl|my_center|LOCUS_00050 7497 8882 gene locus_tag LOCUS_00060 7497 8882 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_00060 8927 9919 gene locus_tag LOCUS_00070 8927 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11861 10113 gene locus_tag LOCUS_00080 11861 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12741 11875 gene locus_tag LOCUS_00090 gene hslO 12741 11875 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965667.1 protein_id gnl|my_center|LOCUS_00090 13878 12799 gene locus_tag LOCUS_00100 13878 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14009 14995 gene locus_tag LOCUS_00110 14009 14995 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357473.1 protein_id gnl|my_center|LOCUS_00110 15061 15939 gene locus_tag LOCUS_00120 gene dapA 15061 15939 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_00120 15949 16704 gene locus_tag LOCUS_00130 gene dapB 15949 16704 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_00130 17331 16861 gene locus_tag LOCUS_00140 17331 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18852 17374 gene locus_tag LOCUS_00150 18852 17374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20611 18884 gene locus_tag LOCUS_00160 20611 18884 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880188.1 protein_id gnl|my_center|LOCUS_00160 21043 20621 gene locus_tag LOCUS_00170 21043 20621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23266 21197 gene locus_tag LOCUS_00180 23266 21197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24855 23776 gene locus_tag LOCUS_00190 gene hflX 24855 23776 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_00190 26155 24950 gene locus_tag LOCUS_00200 26155 24950 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 protein_id gnl|my_center|LOCUS_00200 27623 26181 gene locus_tag LOCUS_00210 gene melB 27623 26181 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028111.1 protein_id gnl|my_center|LOCUS_00210 27925 28794 gene locus_tag LOCUS_00220 27925 28794 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_00220 28980 29053 gene locus_tag LOCUS_t00010 28980 29053 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29059 29135 gene locus_tag LOCUS_t00020 29059 29135 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29169 29244 gene locus_tag LOCUS_t00030 29169 29244 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 29251 29325 gene locus_tag LOCUS_t00040 29251 29325 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 29336 29411 gene locus_tag LOCUS_t00050 29336 29411 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29419 29502 gene locus_tag LOCUS_t00060 29419 29502 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29570 29645 gene locus_tag LOCUS_t00070 29570 29645 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29650 29725 gene locus_tag LOCUS_t00080 29650 29725 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 30516 29827 gene locus_tag LOCUS_00230 30516 29827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 32681 30528 gene locus_tag LOCUS_00240 32681 30528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 33531 32734 gene locus_tag LOCUS_00250 33531 32734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 65508 33556 gene locus_tag LOCUS_00260 65508 33556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 68717 68121 gene locus_tag LOCUS_00270 68717 68121 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965953.1 protein_id gnl|my_center|LOCUS_00270 71218 68738 gene locus_tag LOCUS_00280 71218 68738 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_00280 72518 71343 gene locus_tag LOCUS_00290 72518 71343 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948371.1 protein_id gnl|my_center|LOCUS_00290 72819 74294 gene locus_tag LOCUS_00300 gene guaB 72819 74294 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 protein_id gnl|my_center|LOCUS_00300 75731 74466 gene locus_tag LOCUS_00310 75731 74466 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_00310 77182 75857 gene locus_tag LOCUS_00320 gene der 77182 75857 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_00320 79718 77202 gene locus_tag LOCUS_00330 gene gyrA 79718 77202 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_00330 81706 79718 gene locus_tag LOCUS_00340 gene gyrB 81706 79718 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_00340 83562 81895 gene locus_tag LOCUS_00350 83562 81895 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201677.1 protein_id gnl|my_center|LOCUS_00350 86289 83665 gene locus_tag LOCUS_00360 86289 83665 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_00360 87096 86368 gene locus_tag LOCUS_00370 87096 86368 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111646.1 protein_id gnl|my_center|LOCUS_00370 88162 87179 gene locus_tag LOCUS_00380 88162 87179 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_00380 88745 88179 gene locus_tag LOCUS_00390 88745 88179 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868834.1 protein_id gnl|my_center|LOCUS_00390 90256 88745 gene locus_tag LOCUS_00400 90256 88745 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814147.1 protein_id gnl|my_center|LOCUS_00400 91304 90339 gene locus_tag LOCUS_00410 91304 90339 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_00410 92242 91328 gene locus_tag LOCUS_00420 92242 91328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 93352 92522 gene locus_tag LOCUS_00430 93352 92522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 94711 93458 gene locus_tag LOCUS_00440 94711 93458 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_00440 95769 94804 gene locus_tag LOCUS_00450 gene pfkA 95769 94804 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_00450 97042 95795 gene locus_tag LOCUS_00460 97042 95795 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_00460 97804 97073 gene locus_tag LOCUS_00470 97804 97073 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_00470 98562 97816 gene locus_tag LOCUS_00480 98562 97816 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357968.1 protein_id gnl|my_center|LOCUS_00480 98964 98614 gene locus_tag LOCUS_00490 gene rplT 98964 98614 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 protein_id gnl|my_center|LOCUS_00490 99177 98977 gene locus_tag LOCUS_00500 gene rpmI 99177 98977 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_00500 99661 99146 gene locus_tag LOCUS_00510 gene infC 99661 99146 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293357.1 protein_id gnl|my_center|LOCUS_00510 100463 99975 gene locus_tag LOCUS_00520 100463 99975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 102441 100510 gene locus_tag LOCUS_00530 gene thrS 102441 100510 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786083.1 protein_id gnl|my_center|LOCUS_00530 104423 102603 gene locus_tag LOCUS_00540 104423 102603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 105344 104424 gene locus_tag LOCUS_00550 105344 104424 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_00550 107482 105467 gene locus_tag LOCUS_00560 gene recG 107482 105467 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_00560 109174 107525 gene locus_tag LOCUS_00570 109174 107525 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_00570 109537 109187 gene locus_tag LOCUS_00580 109537 109187 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021722362.1 protein_id gnl|my_center|LOCUS_00580 109774 109962 gene locus_tag LOCUS_00590 gene rpmB 109774 109962 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392437.1 protein_id gnl|my_center|LOCUS_00590 110709 110056 gene locus_tag LOCUS_00600 gene rpe 110709 110056 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354925.1 protein_id gnl|my_center|LOCUS_00600 111719 110847 gene locus_tag LOCUS_00610 gene rsgA 111719 110847 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 protein_id gnl|my_center|LOCUS_00610 112797 111733 gene locus_tag LOCUS_00620 gene rlmN 112797 111733 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_00620 114169 112886 gene locus_tag LOCUS_00630 gene rsmB 114169 112886 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_00630 115110 114169 gene locus_tag LOCUS_00640 gene fmt 115110 114169 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_00640 115595 115140 gene locus_tag LOCUS_00650 gene def 115595 115140 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_00650 117806 115620 gene locus_tag LOCUS_00660 gene priA 117806 115620 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_00660 119093 117915 gene locus_tag LOCUS_00670 gene coaBC 119093 117915 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_00670 119321 119130 gene locus_tag LOCUS_00680 119321 119130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 119963 119352 gene locus_tag LOCUS_00690 gene gmk 119963 119352 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_00690 120872 119979 gene locus_tag LOCUS_00700 120872 119979 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_00700 121844 120885 gene locus_tag LOCUS_00710 121844 120885 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869874.1 protein_id gnl|my_center|LOCUS_00710 124064 122013 gene locus_tag LOCUS_00720 gene ligA 124064 122013 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048227.1 protein_id gnl|my_center|LOCUS_00720 126322 124094 gene locus_tag LOCUS_00730 gene pcrA 126322 124094 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836754.1 protein_id gnl|my_center|LOCUS_00730 127398 126406 gene locus_tag LOCUS_00740 127398 126406 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_00740 130265 127626 gene locus_tag LOCUS_00750 gene ppdK 130265 127626 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_00750 131320 130628 gene locus_tag LOCUS_00760 131320 130628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 132361 131468 gene locus_tag LOCUS_00770 gene era 132361 131468 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 protein_id gnl|my_center|LOCUS_00770 132857 132375 gene locus_tag LOCUS_00780 gene ybeY 132857 132375 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831142.1 protein_id gnl|my_center|LOCUS_00780 134474 132876 gene locus_tag LOCUS_00790 134474 132876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 136033 134528 gene locus_tag LOCUS_00800 gene dnaB 136033 134528 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343910.1 protein_id gnl|my_center|LOCUS_00800 137115 136279 gene locus_tag LOCUS_00810 137115 136279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 138863 137112 gene locus_tag LOCUS_00820 gene pepF 138863 137112 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453998.1 protein_id gnl|my_center|LOCUS_00820 140341 138920 gene locus_tag LOCUS_00830 140341 138920 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_00830 141278 140382 gene locus_tag LOCUS_00840 141278 140382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 142544 141288 gene locus_tag LOCUS_00850 142544 141288 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729265.1 protein_id gnl|my_center|LOCUS_00850 142977 144518 gene locus_tag LOCUS_00860 142977 144518 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016044.1 protein_id gnl|my_center|LOCUS_00860 144834 144643 gene locus_tag LOCUS_00870 144834 144643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 144826 147087 gene locus_tag LOCUS_00880 144826 147087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 147108 147467 gene locus_tag LOCUS_00890 147108 147467 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230627.1 protein_id gnl|my_center|LOCUS_00890 147467 148048 gene locus_tag LOCUS_00900 gene recR 147467 148048 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_00900 149326 148205 gene locus_tag LOCUS_00910 149326 148205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 151029 149359 gene locus_tag LOCUS_00920 151029 149359 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460381.1 protein_id gnl|my_center|LOCUS_00920 >Feature sequence002 659 1939 gene locus_tag LOCUS_00930 gene tig 659 1939 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_00930 2154 2771 gene locus_tag LOCUS_00940 gene clpP 2154 2771 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_00940 2793 4058 gene locus_tag LOCUS_00950 gene clpX 2793 4058 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_00950 4148 4735 gene locus_tag LOCUS_00960 gene yihA 4148 4735 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045119.1 protein_id gnl|my_center|LOCUS_00960 4732 5436 gene locus_tag LOCUS_00970 4732 5436 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_00970 5689 6126 gene locus_tag LOCUS_00980 gene mraZ 5689 6126 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_00980 6137 7066 gene locus_tag LOCUS_00990 gene rsmH 6137 7066 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_00990 7078 7671 gene locus_tag LOCUS_01000 7078 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 7694 8383 gene locus_tag LOCUS_01010 7694 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 8472 9647 gene locus_tag LOCUS_01020 8472 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 9658 10830 gene locus_tag LOCUS_01030 gene ftsZ 9658 10830 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_01030 10849 11310 gene locus_tag LOCUS_01040 gene nrdR 10849 11310 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_01040 11609 11782 gene locus_tag LOCUS_01050 11609 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 11850 13082 gene locus_tag LOCUS_01060 11850 13082 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_01060 13085 13624 gene locus_tag LOCUS_01070 13085 13624 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_01070 13661 14068 gene locus_tag LOCUS_01080 gene ruvX 13661 14068 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_01080 14117 14428 gene locus_tag LOCUS_01090 14117 14428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 14443 15918 gene locus_tag LOCUS_01100 14443 15918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 16089 17126 gene locus_tag LOCUS_01110 16089 17126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 17201 17872 gene locus_tag LOCUS_01120 gene tsf 17201 17872 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_01120 17921 18628 gene locus_tag LOCUS_01130 gene pyrH 17921 18628 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_01130 18744 19316 gene locus_tag LOCUS_01140 gene frr 18744 19316 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_01140 19316 19993 gene locus_tag LOCUS_01150 19316 19993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 20041 20934 gene locus_tag LOCUS_01160 20041 20934 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_01160 20936 22027 gene locus_tag LOCUS_01170 20936 22027 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241803.1 protein_id gnl|my_center|LOCUS_01170 22024 22392 gene locus_tag LOCUS_01180 22024 22392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 22619 23650 gene locus_tag LOCUS_01190 gene ispG 22619 23650 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880999.1 protein_id gnl|my_center|LOCUS_01190 23755 25314 gene locus_tag LOCUS_01200 23755 25314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 25304 28267 gene locus_tag LOCUS_01210 25304 28267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 28268 28933 gene locus_tag LOCUS_01220 28268 28933 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_01220 28954 29535 gene locus_tag LOCUS_01230 gene lspA 28954 29535 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 protein_id gnl|my_center|LOCUS_01230 29540 30445 gene locus_tag LOCUS_01240 29540 30445 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584158.1 protein_id gnl|my_center|LOCUS_01240 30696 31172 gene locus_tag LOCUS_01250 30696 31172 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_01250 31188 32273 gene locus_tag LOCUS_01260 gene nusA 31188 32273 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428238.1 protein_id gnl|my_center|LOCUS_01260 32279 32584 gene locus_tag LOCUS_01270 32279 32584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 32587 34932 gene locus_tag LOCUS_01280 32587 34932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 34940 35299 gene locus_tag LOCUS_01290 gene rbfA 34940 35299 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874334.1 protein_id gnl|my_center|LOCUS_01290 35292 36278 gene locus_tag LOCUS_01300 35292 36278 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881055.1 protein_id gnl|my_center|LOCUS_01300 36262 37128 gene locus_tag LOCUS_01310 gene truB 36262 37128 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_01310 37150 38040 gene locus_tag LOCUS_01320 37150 38040 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627564.1 protein_id gnl|my_center|LOCUS_01320 38317 39054 gene locus_tag LOCUS_01330 38317 39054 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930880.1 protein_id gnl|my_center|LOCUS_01330 39038 39838 gene locus_tag LOCUS_01340 39038 39838 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_01340 39869 40558 gene locus_tag LOCUS_01350 gene scpB 39869 40558 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402814.1 protein_id gnl|my_center|LOCUS_01350 40669 48771 gene locus_tag LOCUS_01360 40669 48771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 48768 49475 gene locus_tag LOCUS_01370 48768 49475 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159577.1 protein_id gnl|my_center|LOCUS_01370 49500 50264 gene locus_tag LOCUS_01380 gene surE 49500 50264 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140447.1 protein_id gnl|my_center|LOCUS_01380 50261 50917 gene locus_tag LOCUS_01390 50261 50917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01390 50943 51482 gene locus_tag LOCUS_01400 50943 51482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01400 51500 52162 gene locus_tag LOCUS_01410 gene cmk 51500 52162 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439454.1 protein_id gnl|my_center|LOCUS_01410 52165 54327 gene locus_tag LOCUS_01420 52165 54327 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_01420 54451 54376 gene locus_tag LOCUS_t00090 54451 54376 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 54528 55337 gene locus_tag LOCUS_01430 gene proC 54528 55337 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360701.1 protein_id gnl|my_center|LOCUS_01430 55350 55775 gene locus_tag LOCUS_01440 gene rnhA 55350 55775 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_01440 57156 55780 gene locus_tag LOCUS_01450 57156 55780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 57787 57158 gene locus_tag LOCUS_01460 gene lexA 57787 57158 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986377.1 protein_id gnl|my_center|LOCUS_01460 58987 57911 gene locus_tag LOCUS_01470 58987 57911 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_01470 60478 59273 gene locus_tag LOCUS_01480 60478 59273 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_01480 61391 60471 gene locus_tag LOCUS_01490 gene miaA 61391 60471 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289405.1 protein_id gnl|my_center|LOCUS_01490 63260 61398 gene locus_tag LOCUS_01500 gene mutL 63260 61398 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_01500 65898 63262 gene locus_tag LOCUS_01510 gene mutS 65898 63262 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435264.1 protein_id gnl|my_center|LOCUS_01510 67169 65895 gene locus_tag LOCUS_01520 gene miaB 67169 65895 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_01520 68394 67234 gene locus_tag LOCUS_01530 gene thiI 68394 67234 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200076.1 protein_id gnl|my_center|LOCUS_01530 69562 68396 gene locus_tag LOCUS_01540 69562 68396 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_01540 71954 69579 gene locus_tag LOCUS_01550 71954 69579 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_01550 74391 71980 gene locus_tag LOCUS_01560 gene pheT 74391 71980 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_01560 75421 74402 gene locus_tag LOCUS_01570 gene pheS 75421 74402 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382398.1 protein_id gnl|my_center|LOCUS_01570 77362 75635 gene locus_tag LOCUS_01580 gene recN 77362 75635 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_01580 77807 77364 gene locus_tag LOCUS_01590 77807 77364 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_01590 78698 77850 gene locus_tag LOCUS_01600 78698 77850 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948510.1 protein_id gnl|my_center|LOCUS_01600 79432 78758 gene locus_tag LOCUS_01610 79432 78758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986441.1 protein_id gnl|my_center|LOCUS_01610 80278 80075 gene locus_tag LOCUS_01620 80278 80075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 81427 80297 gene locus_tag LOCUS_01630 81427 80297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 81839 81420 gene locus_tag LOCUS_01640 gene nusB 81839 81420 CDS product N utilization substance protein NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830247.1 protein_id gnl|my_center|LOCUS_01640 82165 81836 gene locus_tag LOCUS_01650 82165 81836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 82733 82167 gene locus_tag LOCUS_01660 gene efp 82733 82167 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965394.1 protein_id gnl|my_center|LOCUS_01660 83775 82759 gene locus_tag LOCUS_01670 83775 82759 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831174.1 protein_id gnl|my_center|LOCUS_01670 83934 85241 gene locus_tag LOCUS_01680 83934 85241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 85385 85301 gene locus_tag LOCUS_t00100 85385 85301 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 85464 85389 gene locus_tag LOCUS_t00110 85464 85389 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 85551 85476 gene locus_tag LOCUS_t00120 85551 85476 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 85635 85559 gene locus_tag LOCUS_t00130 85635 85559 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 85737 85661 gene locus_tag LOCUS_t00140 85737 85661 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 85843 85767 gene locus_tag LOCUS_t00150 85843 85767 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 88164 85987 gene locus_tag LOCUS_01690 88164 85987 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_01690 90515 88230 gene locus_tag LOCUS_01700 gene recJ 90515 88230 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861665.1 protein_id gnl|my_center|LOCUS_01700 91636 90551 gene locus_tag LOCUS_01710 gene secF 91636 90551 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048082.1 protein_id gnl|my_center|LOCUS_01710 92969 91626 gene locus_tag LOCUS_01720 gene secD 92969 91626 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048083.1 protein_id gnl|my_center|LOCUS_01720 94495 93134 gene locus_tag LOCUS_01730 gene scfB 94495 93134 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_01730 94668 94495 gene locus_tag LOCUS_01740 94668 94495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 94966 94691 gene locus_tag LOCUS_01750 94966 94691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 96235 95096 gene locus_tag LOCUS_01760 gene tgt 96235 95096 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_01760 97262 96240 gene locus_tag LOCUS_01770 gene queA 97262 96240 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_01770 98306 97269 gene locus_tag LOCUS_01780 gene ruvB 98306 97269 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_01780 98910 98320 gene locus_tag LOCUS_01790 gene ruvA 98910 98320 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947019.1 protein_id gnl|my_center|LOCUS_01790 99395 98919 gene locus_tag LOCUS_01800 gene ruvC 99395 98919 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902123.1 protein_id gnl|my_center|LOCUS_01800 100487 99447 gene locus_tag LOCUS_01810 gene ugpC 100487 99447 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947455.1 protein_id gnl|my_center|LOCUS_01810 101884 100484 gene locus_tag LOCUS_01820 101884 100484 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_01820 102736 101930 gene locus_tag LOCUS_01830 102736 101930 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048205.1 protein_id gnl|my_center|LOCUS_01830 103271 102738 gene locus_tag LOCUS_01840 gene raiA 103271 102738 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_01840 >Feature sequence003 2649 121 gene locus_tag LOCUS_01850 2649 121 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391709.1 protein_id gnl|my_center|LOCUS_01850 2778 2860 gene locus_tag LOCUS_t00160 2778 2860 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4077 2887 gene locus_tag LOCUS_01860 4077 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 4609 4106 gene locus_tag LOCUS_01870 4609 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 7677 4672 gene locus_tag LOCUS_01880 7677 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 11209 7688 gene locus_tag LOCUS_01890 11209 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 13480 11393 gene locus_tag LOCUS_01900 gene pnp 13480 11393 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_01900 13812 13549 gene locus_tag LOCUS_01910 gene rpsO 13812 13549 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_01910 15327 13948 gene locus_tag LOCUS_01920 15327 13948 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048077.1 protein_id gnl|my_center|LOCUS_01920 15951 15331 gene locus_tag LOCUS_01930 15951 15331 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_01930 17152 15944 gene locus_tag LOCUS_01940 17152 15944 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_01940 17693 17190 gene locus_tag LOCUS_01950 17693 17190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 18535 17705 gene locus_tag LOCUS_01960 18535 17705 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_01960 18823 19707 gene locus_tag LOCUS_01970 18823 19707 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359214.1 protein_id gnl|my_center|LOCUS_01970 19731 20747 gene locus_tag LOCUS_01980 19731 20747 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966051.1 protein_id gnl|my_center|LOCUS_01980 20752 21153 gene locus_tag LOCUS_01990 20752 21153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 21566 21132 gene locus_tag LOCUS_02000 21566 21132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 22966 21716 gene locus_tag LOCUS_02010 22966 21716 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987090.1 protein_id gnl|my_center|LOCUS_02010 23550 22963 gene locus_tag LOCUS_02020 gene coaE 23550 22963 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583248.1 protein_id gnl|my_center|LOCUS_02020 26127 23590 gene locus_tag LOCUS_02030 gene polA 26127 23590 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_02030 27381 26149 gene locus_tag LOCUS_02040 27381 26149 CDS product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903941.1 protein_id gnl|my_center|LOCUS_02040 28531 27413 gene locus_tag LOCUS_02050 28531 27413 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431793.1 protein_id gnl|my_center|LOCUS_02050 31596 28531 gene locus_tag LOCUS_02060 gene lacZ 31596 28531 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_02060 32981 31785 gene locus_tag LOCUS_02070 32981 31785 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_02070 33735 32986 gene locus_tag LOCUS_02080 33735 32986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 34511 33732 gene locus_tag LOCUS_02090 34511 33732 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_02090 35582 34539 gene locus_tag LOCUS_02100 gene rpoD 35582 34539 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360364.1 protein_id gnl|my_center|LOCUS_02100 37380 35593 gene locus_tag LOCUS_02110 gene dnaG 37380 35593 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_02110 37714 37890 gene locus_tag LOCUS_02120 gene rpsU 37714 37890 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357777.1 protein_id gnl|my_center|LOCUS_02120 40892 37965 gene locus_tag LOCUS_02130 40892 37965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 41360 41016 gene locus_tag LOCUS_02140 41360 41016 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546430.1 protein_id gnl|my_center|LOCUS_02140 42670 41426 gene locus_tag LOCUS_02150 gene mtaB 42670 41426 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_02150 43597 42677 gene locus_tag LOCUS_02160 gene prmA 43597 42677 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964596.1 protein_id gnl|my_center|LOCUS_02160 44798 43611 gene locus_tag LOCUS_02170 gene dnaJ 44798 43611 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 protein_id gnl|my_center|LOCUS_02170 46660 44846 gene locus_tag LOCUS_02180 gene dnaK 46660 44846 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_02180 47249 46722 gene locus_tag LOCUS_02190 gene grpE 47249 46722 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454752.1 protein_id gnl|my_center|LOCUS_02190 48285 47272 gene locus_tag LOCUS_02200 gene hrcA 48285 47272 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454754.1 protein_id gnl|my_center|LOCUS_02200 49530 48415 gene locus_tag LOCUS_02210 gene hemW 49530 48415 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880921.1 protein_id gnl|my_center|LOCUS_02210 51336 49534 gene locus_tag LOCUS_02220 gene lepA 51336 49534 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726525.1 protein_id gnl|my_center|LOCUS_02220 51560 52321 gene locus_tag LOCUS_02230 51560 52321 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920018.1 protein_id gnl|my_center|LOCUS_02230 52749 52384 gene locus_tag LOCUS_02240 gene nifU 52749 52384 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_02240 53925 52762 gene locus_tag LOCUS_02250 gene nifS 53925 52762 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_02250 55190 53937 gene locus_tag LOCUS_02260 55190 53937 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294099.1 protein_id gnl|my_center|LOCUS_02260 55519 55205 gene locus_tag LOCUS_02270 gene trxA 55519 55205 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 protein_id gnl|my_center|LOCUS_02270 56010 55600 gene locus_tag LOCUS_02280 56010 55600 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583657.1 protein_id gnl|my_center|LOCUS_02280 57815 56019 gene locus_tag LOCUS_02290 gene aspS 57815 56019 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_02290 59083 57827 gene locus_tag LOCUS_02300 gene hisS 59083 57827 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_02300 60452 59142 gene locus_tag LOCUS_02310 gene hslU 60452 59142 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_02310 60994 60455 gene locus_tag LOCUS_02320 gene hslV 60994 60455 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636479.1 protein_id gnl|my_center|LOCUS_02320 62422 61106 gene locus_tag LOCUS_02330 gene trmFO 62422 61106 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583875.1 protein_id gnl|my_center|LOCUS_02330 64549 62450 gene locus_tag LOCUS_02340 gene topA 64549 62450 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_02340 66829 64577 gene locus_tag LOCUS_02350 66829 64577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 67246 66905 gene locus_tag LOCUS_02360 gene rplS 67246 66905 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_02360 68005 67418 gene locus_tag LOCUS_02370 68005 67418 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_02370 68867 68010 gene locus_tag LOCUS_02380 gene ylqF 68867 68010 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829495.1 protein_id gnl|my_center|LOCUS_02380 69555 68884 gene locus_tag LOCUS_02390 gene trmD 69555 68884 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_02390 70083 69583 gene locus_tag LOCUS_02400 gene rimM 70083 69583 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813199.1 protein_id gnl|my_center|LOCUS_02400 70291 70061 gene locus_tag LOCUS_02410 70291 70061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 70629 70303 gene locus_tag LOCUS_02420 gene rpsP 70629 70303 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268750.1 protein_id gnl|my_center|LOCUS_02420 71996 70680 gene locus_tag LOCUS_02430 gene ffh 71996 70680 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_02430 72373 72047 gene locus_tag LOCUS_02440 72373 72047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 73362 72466 gene locus_tag LOCUS_02450 gene ftsY 73362 72466 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081293.1 protein_id gnl|my_center|LOCUS_02450 77057 73392 gene locus_tag LOCUS_02460 gene smc 77057 73392 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_02460 77737 77063 gene locus_tag LOCUS_02470 gene rnc 77737 77063 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557292.1 protein_id gnl|my_center|LOCUS_02470 78783 77782 gene locus_tag LOCUS_02480 gene plsX 78783 77782 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644323.1 protein_id gnl|my_center|LOCUS_02480 79084 78893 gene locus_tag LOCUS_02490 gene rpmF 79084 78893 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 protein_id gnl|my_center|LOCUS_02490 80421 79207 gene locus_tag LOCUS_02500 80421 79207 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_02500 81450 80446 gene locus_tag LOCUS_02510 gene pta 81450 80446 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_02510 81650 82873 gene locus_tag LOCUS_02520 81650 82873 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388463.1 protein_id gnl|my_center|LOCUS_02520 83494 83036 gene locus_tag LOCUS_02530 83494 83036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 84513 83560 gene locus_tag LOCUS_02540 84513 83560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 85091 84561 gene locus_tag LOCUS_02550 85091 84561 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_02550 85510 85094 gene locus_tag LOCUS_02560 85510 85094 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545228.1 protein_id gnl|my_center|LOCUS_02560 86837 85536 gene locus_tag LOCUS_02570 86837 85536 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107332.1 protein_id gnl|my_center|LOCUS_02570 87415 86834 gene locus_tag LOCUS_02580 87415 86834 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_02580 89141 87417 gene locus_tag LOCUS_02590 gene iorA 89141 87417 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_02590 90484 89168 gene locus_tag LOCUS_02600 90484 89168 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_02600 92670 90481 gene locus_tag LOCUS_02610 92670 90481 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_02610 94485 92881 gene locus_tag LOCUS_02620 gene rny 94485 92881 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_02620 95647 94667 gene locus_tag LOCUS_02630 gene recA 95647 94667 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_02630 >Feature sequence004 162 1232 gene locus_tag LOCUS_02640 gene serC 162 1232 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442921.1 protein_id gnl|my_center|LOCUS_02640 1235 2392 gene locus_tag LOCUS_02650 1235 2392 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_02650 4001 2604 gene locus_tag LOCUS_02660 4001 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 5019 5987 gene locus_tag LOCUS_02670 5019 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 6050 9658 gene locus_tag LOCUS_02680 6050 9658 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_02680 10596 9796 gene locus_tag LOCUS_02690 10596 9796 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_02690 11526 10708 gene locus_tag LOCUS_02700 11526 10708 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_02700 13343 11535 gene locus_tag LOCUS_02710 gene uvrC 13343 11535 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_02710 13423 13497 gene locus_tag LOCUS_t00170 13423 13497 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 25786 13565 gene locus_tag LOCUS_02720 25786 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 27583 26198 gene locus_tag LOCUS_02730 27583 26198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 29420 27690 gene locus_tag LOCUS_02740 gene melB 29420 27690 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028114.1 protein_id gnl|my_center|LOCUS_02740 31085 29550 gene locus_tag LOCUS_02750 gene xylB 31085 29550 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_02750 35025 31219 gene locus_tag LOCUS_02760 35025 31219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 36822 35215 gene locus_tag LOCUS_02770 36822 35215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 38402 37035 gene locus_tag LOCUS_02780 38402 37035 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_02780 44369 38421 gene locus_tag LOCUS_02790 44369 38421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 47372 44940 gene locus_tag LOCUS_02800 47372 44940 CDS product DUF6067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202412.1 protein_id gnl|my_center|LOCUS_02800 50544 47446 gene locus_tag LOCUS_02810 50544 47446 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_02810 52487 50919 gene locus_tag LOCUS_02820 52487 50919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 55214 52545 gene locus_tag LOCUS_02830 55214 52545 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_02830 56932 55235 gene locus_tag LOCUS_02840 56932 55235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 57231 57037 gene locus_tag LOCUS_02850 57231 57037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 57328 57237 gene locus_tag LOCUS_t00180 57328 57237 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 57649 58230 gene locus_tag LOCUS_02860 57649 58230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 58465 59412 gene locus_tag LOCUS_02870 58465 59412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 60068 59484 gene locus_tag LOCUS_02880 gene yfbR 60068 59484 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158196.1 protein_id gnl|my_center|LOCUS_02880 60867 60253 gene locus_tag LOCUS_02890 60867 60253 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966375.1 protein_id gnl|my_center|LOCUS_02890 62221 61148 gene locus_tag LOCUS_02900 62221 61148 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226128.1 protein_id gnl|my_center|LOCUS_02900 63832 62405 gene locus_tag LOCUS_02910 63832 62405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 65436 63847 gene locus_tag LOCUS_02920 65436 63847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 66722 65739 gene locus_tag LOCUS_02930 66722 65739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 67729 67034 gene locus_tag LOCUS_02940 67729 67034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 68911 67730 gene locus_tag LOCUS_02950 68911 67730 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048436.1 protein_id gnl|my_center|LOCUS_02950 69830 68904 gene locus_tag LOCUS_02960 69830 68904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 70443 69952 gene locus_tag LOCUS_02970 70443 69952 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180154.1 protein_id gnl|my_center|LOCUS_02970 71350 70676 gene locus_tag LOCUS_02980 71350 70676 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_02980 71823 71407 gene locus_tag LOCUS_02990 71823 71407 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904077.1 protein_id gnl|my_center|LOCUS_02990 72492 71956 gene locus_tag LOCUS_03000 gene yfcE 72492 71956 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765084.1 protein_id gnl|my_center|LOCUS_03000 72848 72591 gene locus_tag LOCUS_03010 72848 72591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 72820 73656 gene locus_tag LOCUS_03020 72820 73656 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357629.1 protein_id gnl|my_center|LOCUS_03020 74408 73752 gene locus_tag LOCUS_03030 74408 73752 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_03030 75516 74500 gene locus_tag LOCUS_03040 75516 74500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 76998 75640 gene locus_tag LOCUS_03050 gene rlmD 76998 75640 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048300.1 protein_id gnl|my_center|LOCUS_03050 79653 77083 gene locus_tag LOCUS_03060 79653 77083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 81710 79824 gene locus_tag LOCUS_03070 81710 79824 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_03070 83535 81703 gene locus_tag LOCUS_03080 83535 81703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_03080 84642 83707 gene locus_tag LOCUS_03090 84642 83707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 >Feature sequence005 12222 967 gene locus_tag LOCUS_03100 12222 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 13227 12772 gene locus_tag LOCUS_03110 13227 12772 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_03110 13483 13770 gene locus_tag LOCUS_03120 13483 13770 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_03120 13788 15416 gene locus_tag LOCUS_03130 gene groL 13788 15416 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_03130 18403 15479 gene locus_tag LOCUS_03140 18403 15479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 19810 18554 gene locus_tag LOCUS_03150 19810 18554 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027623.1 protein_id gnl|my_center|LOCUS_03150 19981 21789 gene locus_tag LOCUS_03160 19981 21789 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_03160 22285 21851 gene locus_tag LOCUS_03170 22285 21851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 23363 22323 gene locus_tag LOCUS_03180 23363 22323 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_03180 24058 23417 gene locus_tag LOCUS_03190 gene upp 24058 23417 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_03190 25614 24085 gene locus_tag LOCUS_03200 25614 24085 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_03200 27198 25720 gene locus_tag LOCUS_03210 27198 25720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 28996 27257 gene locus_tag LOCUS_03220 28996 27257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 29467 29030 gene locus_tag LOCUS_03230 29467 29030 CDS product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266965.1 protein_id gnl|my_center|LOCUS_03230 30257 29673 gene locus_tag LOCUS_03240 30257 29673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 31117 30272 gene locus_tag LOCUS_03250 31117 30272 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_03250 31405 31127 gene locus_tag LOCUS_03260 gene rpmA 31405 31127 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_03260 31721 31407 gene locus_tag LOCUS_03270 31721 31407 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392095.1 protein_id gnl|my_center|LOCUS_03270 32028 31723 gene locus_tag LOCUS_03280 gene rplU 32028 31723 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881063.1 protein_id gnl|my_center|LOCUS_03280 32204 31956 gene locus_tag LOCUS_03290 32204 31956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 32941 32267 gene locus_tag LOCUS_03300 32941 32267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 34758 32935 gene locus_tag LOCUS_03310 34758 32935 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_03310 35681 34731 gene locus_tag LOCUS_03320 35681 34731 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644304.1 protein_id gnl|my_center|LOCUS_03320 36730 35786 gene locus_tag LOCUS_03330 gene manA 36730 35786 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_03330 37600 36962 gene locus_tag LOCUS_03340 37600 36962 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015799.1 protein_id gnl|my_center|LOCUS_03340 39026 37656 gene locus_tag LOCUS_03350 39026 37656 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986932.1 protein_id gnl|my_center|LOCUS_03350 40780 39035 gene locus_tag LOCUS_03360 40780 39035 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_03360 41132 40812 gene locus_tag LOCUS_03370 41132 40812 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_03370 42096 41125 gene locus_tag LOCUS_03380 42096 41125 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986935.1 protein_id gnl|my_center|LOCUS_03380 42682 42101 gene locus_tag LOCUS_03390 42682 42101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 43255 42773 gene locus_tag LOCUS_03400 43255 42773 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_03400 45445 43367 gene locus_tag LOCUS_03410 45445 43367 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_03410 45779 45465 gene locus_tag LOCUS_03420 45779 45465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 46326 45877 gene locus_tag LOCUS_03430 gene rpiB 46326 45877 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437841.1 protein_id gnl|my_center|LOCUS_03430 47407 46418 gene locus_tag LOCUS_03440 47407 46418 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_03440 49377 47467 gene locus_tag LOCUS_03450 49377 47467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 50248 49451 gene locus_tag LOCUS_03460 50248 49451 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_03460 50855 50256 gene locus_tag LOCUS_03470 gene rsxA 50855 50256 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_03470 51559 50852 gene locus_tag LOCUS_03480 51559 50852 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_03480 52190 51573 gene locus_tag LOCUS_03490 52190 51573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 53224 52196 gene locus_tag LOCUS_03500 53224 52196 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_03500 54597 53296 gene locus_tag LOCUS_03510 gene rsxC 54597 53296 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428488.1 protein_id gnl|my_center|LOCUS_03510 59634 54787 gene locus_tag LOCUS_03520 59634 54787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 59980 60579 gene locus_tag LOCUS_03530 59980 60579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 63562 60758 gene locus_tag LOCUS_03540 gene uvrA 63562 60758 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_03540 65596 63602 gene locus_tag LOCUS_03550 gene uvrB 65596 63602 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567072.1 protein_id gnl|my_center|LOCUS_03550 66060 65695 gene locus_tag LOCUS_03560 66060 65695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 66500 66087 gene locus_tag LOCUS_03570 66500 66087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 67812 66541 gene locus_tag LOCUS_03580 67812 66541 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986281.1 protein_id gnl|my_center|LOCUS_03580 68645 67875 gene locus_tag LOCUS_03590 68645 67875 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_03590 69443 68934 gene locus_tag LOCUS_03600 gene rplQ 69443 68934 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641268.1 protein_id gnl|my_center|LOCUS_03600 70406 69459 gene locus_tag LOCUS_03610 70406 69459 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_03610 71069 70428 gene locus_tag LOCUS_03620 gene rpsD 71069 70428 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_03620 71475 71083 gene locus_tag LOCUS_03630 gene rpsK 71475 71083 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_03630 71859 71488 gene locus_tag LOCUS_03640 gene rpsM 71859 71488 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_03640 72365 72144 gene locus_tag LOCUS_03650 gene infA 72365 72144 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668257.1 protein_id gnl|my_center|LOCUS_03650 72660 72394 gene locus_tag LOCUS_03660 72660 72394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 73415 72669 gene locus_tag LOCUS_03670 gene map 73415 72669 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_03670 74045 73416 gene locus_tag LOCUS_03680 74045 73416 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_03680 75376 74045 gene locus_tag LOCUS_03690 gene secY 75376 74045 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_03690 75819 75376 gene locus_tag LOCUS_03700 gene rplO 75819 75376 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_03700 76013 75831 gene locus_tag LOCUS_03710 gene rpmD 76013 75831 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222615.1 protein_id gnl|my_center|LOCUS_03710 76541 76026 gene locus_tag LOCUS_03720 gene rpsE 76541 76026 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_03720 76921 76553 gene locus_tag LOCUS_03730 gene rplR 76921 76553 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_03730 77476 76934 gene locus_tag LOCUS_03740 gene rplF 77476 76934 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933827.1 protein_id gnl|my_center|LOCUS_03740 77890 77486 gene locus_tag LOCUS_03750 gene rpsH 77890 77486 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_03750 78086 77901 gene locus_tag LOCUS_03760 78086 77901 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_03760 78667 78089 gene locus_tag LOCUS_03770 gene rplE 78667 78089 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080824.1 protein_id gnl|my_center|LOCUS_03770 79095 78679 gene locus_tag LOCUS_03780 gene rplX 79095 78679 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938609.1 protein_id gnl|my_center|LOCUS_03780 79473 79105 gene locus_tag LOCUS_03790 gene rplN 79473 79105 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258241.1 protein_id gnl|my_center|LOCUS_03790 >Feature sequence006 652 83 gene locus_tag LOCUS_03800 652 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 1173 652 gene locus_tag LOCUS_03810 gene rplP 1173 652 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_03810 1931 1173 gene locus_tag LOCUS_03820 gene rpsC 1931 1173 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879933.1 protein_id gnl|my_center|LOCUS_03820 2331 1933 gene locus_tag LOCUS_03830 gene rplV 2331 1933 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829734.1 protein_id gnl|my_center|LOCUS_03830 2620 2342 gene locus_tag LOCUS_03840 gene rpsS 2620 2342 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966408.1 protein_id gnl|my_center|LOCUS_03840 3459 2632 gene locus_tag LOCUS_03850 gene rplB 3459 2632 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_03850 3766 3476 gene locus_tag LOCUS_03860 gene rplW 3766 3476 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_03860 4389 3766 gene locus_tag LOCUS_03870 gene rplD 4389 3766 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_03870 5063 4401 gene locus_tag LOCUS_03880 gene rplC 5063 4401 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_03880 5383 5075 gene locus_tag LOCUS_03890 gene rpsJ 5383 5075 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567567.1 protein_id gnl|my_center|LOCUS_03890 6720 5809 gene locus_tag LOCUS_03900 6720 5809 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948021.1 protein_id gnl|my_center|LOCUS_03900 7539 6838 gene locus_tag LOCUS_03910 7539 6838 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357915.1 protein_id gnl|my_center|LOCUS_03910 7738 8466 gene locus_tag LOCUS_03920 7738 8466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 8558 9511 gene locus_tag LOCUS_03930 8558 9511 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963688.1 protein_id gnl|my_center|LOCUS_03930 9618 9821 gene locus_tag LOCUS_03940 9618 9821 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_03940 9952 10641 gene locus_tag LOCUS_03950 9952 10641 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_03950 10687 11439 gene locus_tag LOCUS_03960 10687 11439 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_03960 11436 12002 gene locus_tag LOCUS_03970 11436 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 13709 12036 gene locus_tag LOCUS_03980 13709 12036 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_03980 14589 13948 gene locus_tag LOCUS_03990 14589 13948 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_03990 15426 14599 gene locus_tag LOCUS_04000 gene rsmA 15426 14599 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_04000 16050 15442 gene locus_tag LOCUS_04010 16050 15442 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_04010 16835 16068 gene locus_tag LOCUS_04020 16835 16068 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815002.1 protein_id gnl|my_center|LOCUS_04020 18787 16853 gene locus_tag LOCUS_04030 gene metG 18787 16853 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_04030 19454 18834 gene locus_tag LOCUS_04040 19454 18834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 20113 19496 gene locus_tag LOCUS_04050 20113 19496 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_04050 21374 20139 gene locus_tag LOCUS_04060 gene tyrS 21374 20139 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_04060 24181 21608 gene locus_tag LOCUS_04070 24181 21608 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966825.1 protein_id gnl|my_center|LOCUS_04070 24928 24206 gene locus_tag LOCUS_04080 24928 24206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897077.1 protein_id gnl|my_center|LOCUS_04080 26506 24953 gene locus_tag LOCUS_04090 26506 24953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 26729 29131 gene locus_tag LOCUS_04100 gene leuS 26729 29131 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_04100 29272 30291 gene locus_tag LOCUS_04110 gene gap 29272 30291 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_04110 32078 30387 gene locus_tag LOCUS_04120 gene malL 32078 30387 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_04120 32937 32140 gene locus_tag LOCUS_04130 gene rsmI 32937 32140 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_04130 33817 32960 gene locus_tag LOCUS_04140 33817 32960 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_04140 34106 35035 gene locus_tag LOCUS_04150 gene fba 34106 35035 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_04150 36492 35110 gene locus_tag LOCUS_04160 36492 35110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 37172 36507 gene locus_tag LOCUS_04170 37172 36507 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_04170 38556 37396 gene locus_tag LOCUS_04180 38556 37396 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_04180 40681 38723 gene locus_tag LOCUS_04190 40681 38723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 protein_id gnl|my_center|LOCUS_04190 43658 40698 gene locus_tag LOCUS_04200 43658 40698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 45405 43834 gene locus_tag LOCUS_04210 gene gpmI 45405 43834 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_04210 46252 45503 gene locus_tag LOCUS_04220 gene tpiA 46252 45503 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964030.1 protein_id gnl|my_center|LOCUS_04220 47474 46287 gene locus_tag LOCUS_04230 47474 46287 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_04230 48552 47587 gene locus_tag LOCUS_04240 gene dusB 48552 47587 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_04240 49632 48598 gene locus_tag LOCUS_04250 49632 48598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 49798 51414 gene locus_tag LOCUS_04260 49798 51414 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_04260 52689 51439 gene locus_tag LOCUS_04270 52689 51439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 53856 52735 gene locus_tag LOCUS_04280 53856 52735 CDS product M29 family aminopeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729641.1 protein_id gnl|my_center|LOCUS_04280 54495 53878 gene locus_tag LOCUS_04290 54495 53878 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_04290 57511 54653 gene locus_tag LOCUS_04300 57511 54653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 68571 57649 gene locus_tag LOCUS_04310 68571 57649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 69122 70168 gene locus_tag LOCUS_04320 69122 70168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 70269 71435 gene locus_tag LOCUS_04330 70269 71435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 >Feature sequence007 228 758 gene locus_tag LOCUS_04340 228 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 837 1715 gene locus_tag LOCUS_04350 837 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 2045 4606 gene locus_tag LOCUS_04360 2045 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 4784 5018 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgctggttcttctactatttcttcttg 10670 7401 gene locus_tag LOCUS_04370 gene addA 10670 7401 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989936.1 protein_id gnl|my_center|LOCUS_04370 14156 10707 gene locus_tag LOCUS_04380 gene addB 14156 10707 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861078.1 protein_id gnl|my_center|LOCUS_04380 15850 14294 gene locus_tag LOCUS_04390 15850 14294 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_04390 15989 15825 gene locus_tag LOCUS_04400 15989 15825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 18351 16117 gene locus_tag LOCUS_04410 18351 16117 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_04410 19051 18410 gene locus_tag LOCUS_04420 gene lepB 19051 18410 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711853.1 protein_id gnl|my_center|LOCUS_04420 20828 19143 gene locus_tag LOCUS_04430 20828 19143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 23677 20915 gene locus_tag LOCUS_04440 23677 20915 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 protein_id gnl|my_center|LOCUS_04440 25306 23825 gene locus_tag LOCUS_04450 25306 23825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 26540 25737 gene locus_tag LOCUS_04460 26540 25737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 33516 26545 gene locus_tag LOCUS_04470 33516 26545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 35872 34094 gene locus_tag LOCUS_04480 35872 34094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 36722 36318 gene locus_tag LOCUS_04490 36722 36318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 38209 36824 gene locus_tag LOCUS_04500 gene atpD 38209 36824 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_04500 39161 38325 gene locus_tag LOCUS_04510 gene atpG 39161 38325 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_04510 40739 39222 gene locus_tag LOCUS_04520 gene atpA 40739 39222 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_04520 41018 40791 gene locus_tag LOCUS_04530 41018 40791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 41574 41059 gene locus_tag LOCUS_04540 41574 41059 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_04540 41841 41584 gene locus_tag LOCUS_04550 41841 41584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 42782 42015 gene locus_tag LOCUS_04560 42782 42015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 44440 42890 gene locus_tag LOCUS_04570 44440 42890 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048283.1 protein_id gnl|my_center|LOCUS_04570 45064 44735 gene locus_tag LOCUS_04580 45064 44735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 45221 45661 gene locus_tag LOCUS_04590 45221 45661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 47023 45770 gene locus_tag LOCUS_04600 47023 45770 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_04600 47500 49023 gene locus_tag LOCUS_04610 gene hemL 47500 49023 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 protein_id gnl|my_center|LOCUS_04610 49350 50036 gene locus_tag LOCUS_04620 49350 50036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 50268 50834 gene locus_tag LOCUS_04630 50268 50834 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_04630 52345 51038 gene locus_tag LOCUS_04640 52345 51038 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence008 486 1505 gene locus_tag LOCUS_04650 gene aroF 486 1505 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_04650 1596 2447 gene locus_tag LOCUS_04660 1596 2447 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_04660 2450 3466 gene locus_tag LOCUS_04670 gene aroB 2450 3466 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_04670 3827 5107 gene locus_tag LOCUS_04680 gene aroA 3827 5107 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_04680 5116 6186 gene locus_tag LOCUS_04690 gene aroC 5116 6186 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_04690 6230 7369 gene locus_tag LOCUS_04700 gene pheA 6230 7369 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_04700 7370 8644 gene locus_tag LOCUS_04710 7370 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 8806 9867 gene locus_tag LOCUS_04720 8806 9867 CDS product phosphonoacetaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202931.1 protein_id gnl|my_center|LOCUS_04720 10014 11495 gene locus_tag LOCUS_04730 10014 11495 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_04730 11705 12076 gene locus_tag LOCUS_04740 11705 12076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 12203 13855 gene locus_tag LOCUS_04750 12203 13855 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_04750 14320 15531 gene locus_tag LOCUS_04760 14320 15531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 15584 16519 gene locus_tag LOCUS_04770 15584 16519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 16534 16896 gene locus_tag LOCUS_04780 16534 16896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 16982 18139 gene locus_tag LOCUS_04790 16982 18139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 18167 18430 gene locus_tag LOCUS_04800 18167 18430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 18458 19312 gene locus_tag LOCUS_04810 18458 19312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 19354 19713 gene locus_tag LOCUS_04820 19354 19713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 19728 20693 gene locus_tag LOCUS_04830 19728 20693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 20886 20758 gene locus_tag LOCUS_04840 20886 20758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 21000 21227 gene locus_tag LOCUS_04850 gene acpP 21000 21227 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873663.1 protein_id gnl|my_center|LOCUS_04850 21372 21521 gene locus_tag LOCUS_04860 gene rpmG 21372 21521 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_04860 21552 21926 gene locus_tag LOCUS_04870 21552 21926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 21961 22572 gene locus_tag LOCUS_04880 gene nusG 21961 22572 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_04880 22829 23254 gene locus_tag LOCUS_04890 gene rplK 22829 23254 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085807.1 protein_id gnl|my_center|LOCUS_04890 23265 23954 gene locus_tag LOCUS_04900 gene rplA 23265 23954 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_04900 24145 24639 gene locus_tag LOCUS_04910 gene rplJ 24145 24639 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 protein_id gnl|my_center|LOCUS_04910 24710 25087 gene locus_tag LOCUS_04920 gene rplL 24710 25087 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966422.1 protein_id gnl|my_center|LOCUS_04920 25598 25158 gene locus_tag LOCUS_04930 gene rplI 25598 25158 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903027.1 protein_id gnl|my_center|LOCUS_04930 25735 26241 gene locus_tag LOCUS_04940 gene ispF 25735 26241 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_04940 26311 27936 gene locus_tag LOCUS_04950 26311 27936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 28009 28365 gene locus_tag LOCUS_04960 28009 28365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 28587 30221 gene locus_tag LOCUS_04970 28587 30221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 30330 30686 gene locus_tag LOCUS_04980 30330 30686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 31365 35321 gene locus_tag LOCUS_04990 gene rpoB 31365 35321 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_04990 35337 38963 gene locus_tag LOCUS_05000 gene rpoC 35337 38963 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_05000 39134 40303 gene locus_tag LOCUS_05010 gene metK 39134 40303 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_05010 40443 42770 gene locus_tag LOCUS_05020 40443 42770 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263357.1 protein_id gnl|my_center|LOCUS_05020 42798 43850 gene locus_tag LOCUS_05030 gene tsaD 42798 43850 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_05030 44033 44284 gene locus_tag LOCUS_05040 44033 44284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 44344 44715 gene locus_tag LOCUS_05050 gene rpsL 44344 44715 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403790.1 protein_id gnl|my_center|LOCUS_05050 44746 45216 gene locus_tag LOCUS_05060 gene rpsG 44746 45216 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_05060 45326 47395 gene locus_tag LOCUS_05070 gene fusA 45326 47395 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_05070 47741 48940 gene locus_tag LOCUS_05080 gene tuf 47741 48940 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_05080 51142 49469 gene locus_tag LOCUS_05090 51142 49469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 51516 53057 gene locus_tag LOCUS_05100 51516 53057 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456609.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence009 238 549 gene locus_tag LOCUS_05110 238 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 3271 923 gene locus_tag LOCUS_05120 3271 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 6925 3443 gene locus_tag LOCUS_05130 gene mfd 6925 3443 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_05130 9277 7082 gene locus_tag LOCUS_05140 9277 7082 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688713.1 protein_id gnl|my_center|LOCUS_05140 10617 9694 gene locus_tag LOCUS_05150 10617 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 11048 14119 gene locus_tag LOCUS_05160 11048 14119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 14163 15266 gene locus_tag LOCUS_05170 gene prfB 14163 15266 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018379.1 protein_id gnl|my_center|LOCUS_05170 15351 16628 gene locus_tag LOCUS_05180 gene serS 15351 16628 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963346.1 protein_id gnl|my_center|LOCUS_05180 16896 17966 gene locus_tag LOCUS_05190 16896 17966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 18055 18954 gene locus_tag LOCUS_05200 18055 18954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 20141 19146 gene locus_tag LOCUS_05210 gene galE 20141 19146 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_05210 20755 20228 gene locus_tag LOCUS_05220 20755 20228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 22139 20970 gene locus_tag LOCUS_05230 22139 20970 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_05230 22527 23369 gene locus_tag LOCUS_05240 gene galU 22527 23369 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_05240 34025 23463 gene locus_tag LOCUS_05250 34025 23463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 43652 34254 gene locus_tag LOCUS_05260 43652 34254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 44662 43934 gene locus_tag LOCUS_05270 44662 43934 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_05270 48486 44983 gene locus_tag LOCUS_05280 gene nifJ 48486 44983 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391612.1 protein_id gnl|my_center|LOCUS_05280 48788 49759 gene locus_tag LOCUS_05290 48788 49759 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 protein_id gnl|my_center|LOCUS_05290 50837 49968 gene locus_tag LOCUS_05300 50837 49968 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_05300 51241 51053 gene locus_tag LOCUS_05310 51241 51053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 >Feature sequence010 1171 86 gene locus_tag LOCUS_05320 gene ychF 1171 86 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965433.1 protein_id gnl|my_center|LOCUS_05320 1879 1190 gene locus_tag LOCUS_05330 1879 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 2603 1893 gene locus_tag LOCUS_05340 gene rlmB 2603 1893 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_05340 3190 2756 gene locus_tag LOCUS_05350 3190 2756 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966433.1 protein_id gnl|my_center|LOCUS_05350 3838 3461 gene locus_tag LOCUS_05360 3838 3461 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_05360 4077 3835 gene locus_tag LOCUS_05370 4077 3835 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115145.1 protein_id gnl|my_center|LOCUS_05370 4291 4566 gene locus_tag LOCUS_05380 4291 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 4790 7744 gene locus_tag LOCUS_05390 4790 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 7796 8095 gene locus_tag LOCUS_05400 7796 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 9411 8182 gene locus_tag LOCUS_05410 9411 8182 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_05410 10524 9559 gene locus_tag LOCUS_05420 10524 9559 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_05420 10847 10521 gene locus_tag LOCUS_05430 10847 10521 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_05430 11049 10837 gene locus_tag LOCUS_05440 11049 10837 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_05440 12522 11206 gene locus_tag LOCUS_05450 12522 11206 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_05450 13120 12926 gene locus_tag LOCUS_05460 13120 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 13269 13730 gene locus_tag LOCUS_05470 13269 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 13970 16645 gene locus_tag LOCUS_05480 13970 16645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 16855 19596 gene locus_tag LOCUS_05490 16855 19596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 20187 20855 gene locus_tag LOCUS_05500 gene lexA 20187 20855 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812299.1 protein_id gnl|my_center|LOCUS_05500 20956 21303 gene locus_tag LOCUS_05510 20956 21303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 21407 21580 gene locus_tag LOCUS_05520 21407 21580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 22212 22802 gene locus_tag LOCUS_05530 22212 22802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 23127 25094 gene locus_tag LOCUS_05540 23127 25094 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_05540 25548 26054 gene locus_tag LOCUS_05550 25548 26054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 26413 31380 gene locus_tag LOCUS_05560 26413 31380 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072770864.1 protein_id gnl|my_center|LOCUS_05560 31441 31770 gene locus_tag LOCUS_05570 31441 31770 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143661.1 protein_id gnl|my_center|LOCUS_05570 31798 32835 gene locus_tag LOCUS_05580 31798 32835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 33720 32824 gene locus_tag LOCUS_05590 33720 32824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 34532 37246 gene locus_tag LOCUS_05600 34532 37246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 37514 37945 gene locus_tag LOCUS_05610 37514 37945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 37926 38417 gene locus_tag LOCUS_05620 37926 38417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 38500 39450 gene locus_tag LOCUS_05630 38500 39450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence011 6484 7266 gene locus_tag LOCUS_05640 6484 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 7286 8542 gene locus_tag LOCUS_05650 7286 8542 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_05650 8791 10116 gene locus_tag LOCUS_05660 8791 10116 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921883.1 protein_id gnl|my_center|LOCUS_05660 11227 10181 gene locus_tag LOCUS_05670 11227 10181 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_05670 11485 12972 gene locus_tag LOCUS_05680 11485 12972 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_05680 13073 14347 gene locus_tag LOCUS_05690 gene tilS 13073 14347 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966480.1 protein_id gnl|my_center|LOCUS_05690 14372 14938 gene locus_tag LOCUS_05700 gene hpt 14372 14938 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905038.1 protein_id gnl|my_center|LOCUS_05700 14991 16328 gene locus_tag LOCUS_05710 14991 16328 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_05710 16455 17420 gene locus_tag LOCUS_05720 16455 17420 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 protein_id gnl|my_center|LOCUS_05720 17428 18048 gene locus_tag LOCUS_05730 17428 18048 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_05730 18383 18045 gene locus_tag LOCUS_05740 18383 18045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05740 18752 18402 gene locus_tag LOCUS_05750 18752 18402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 20431 18809 gene locus_tag LOCUS_05760 20431 18809 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681283.1 protein_id gnl|my_center|LOCUS_05760 22949 20511 gene locus_tag LOCUS_05770 22949 20511 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_05770 24025 23150 gene locus_tag LOCUS_05780 24025 23150 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030736.1 protein_id gnl|my_center|LOCUS_05780 24348 25682 gene locus_tag LOCUS_05790 24348 25682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 25815 27062 gene locus_tag LOCUS_05800 25815 27062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 27321 28247 gene locus_tag LOCUS_05810 27321 28247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 30199 28406 gene locus_tag LOCUS_05820 30199 28406 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027553.1 protein_id gnl|my_center|LOCUS_05820 30448 31677 gene locus_tag LOCUS_05830 30448 31677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 31718 32392 gene locus_tag LOCUS_05840 31718 32392 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_05840 32516 33124 gene locus_tag LOCUS_05850 32516 33124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 33212 33745 gene locus_tag LOCUS_05860 33212 33745 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250651.1 protein_id gnl|my_center|LOCUS_05860 33975 35183 gene locus_tag LOCUS_05870 33975 35183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 35323 36021 gene locus_tag LOCUS_05880 35323 36021 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_05880 36113 37567 gene locus_tag LOCUS_05890 36113 37567 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948715.1 protein_id gnl|my_center|LOCUS_05890 38557 37922 gene locus_tag LOCUS_05900 38557 37922 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_05900 <39285 38574 gene locus_tag LOCUS_05910 <39285 38574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454770.1:tRNA threonylcarbamoyladenosine dehydratase >Feature sequence012 363 1196 gene locus_tag LOCUS_05920 363 1196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_05920 2367 1255 gene locus_tag LOCUS_05930 gene glf 2367 1255 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_05930 3896 2427 gene locus_tag LOCUS_05940 3896 2427 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107690.1 protein_id gnl|my_center|LOCUS_05940 4823 3969 gene locus_tag LOCUS_05950 4823 3969 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762999.1 protein_id gnl|my_center|LOCUS_05950 5683 4844 gene locus_tag LOCUS_05960 5683 4844 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778456.1 protein_id gnl|my_center|LOCUS_05960 7606 5867 gene locus_tag LOCUS_05970 gene potA 7606 5867 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762997.1 protein_id gnl|my_center|LOCUS_05970 8512 7979 gene locus_tag LOCUS_05980 8512 7979 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_05980 22508 9354 gene locus_tag LOCUS_05990 22508 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 23603 22911 gene locus_tag LOCUS_06000 gene pfs 23603 22911 CDS product aminodeoxyfutalosine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859787.1 protein_id gnl|my_center|LOCUS_06000 26711 23982 gene locus_tag LOCUS_06010 26711 23982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 27924 26980 gene locus_tag LOCUS_06020 27924 26980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 30886 28229 gene locus_tag LOCUS_06030 30886 28229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 33905 31212 gene locus_tag LOCUS_06040 33905 31212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 35582 33978 gene locus_tag LOCUS_06050 35582 33978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 36579 35800 gene locus_tag LOCUS_06060 36579 35800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570194.1 protein_id gnl|my_center|LOCUS_06060 <37618 36710 gene locus_tag LOCUS_06070 <37618 36710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_102964529.1:IS481 family transposase >Feature sequence013 18 440 gene locus_tag LOCUS_06080 18 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 569 2341 gene locus_tag LOCUS_06090 569 2341 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204819.1 protein_id gnl|my_center|LOCUS_06090 2897 2475 gene locus_tag LOCUS_06100 2897 2475 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_06100 3693 2980 gene locus_tag LOCUS_06110 3693 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 3880 4650 gene locus_tag LOCUS_06120 3880 4650 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436256.1 protein_id gnl|my_center|LOCUS_06120 6840 4732 gene locus_tag LOCUS_06130 6840 4732 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_06130 8328 6916 gene locus_tag LOCUS_06140 gene gatB 8328 6916 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965957.1 protein_id gnl|my_center|LOCUS_06140 9762 8341 gene locus_tag LOCUS_06150 gene gatA 9762 8341 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947462.1 protein_id gnl|my_center|LOCUS_06150 10040 9765 gene locus_tag LOCUS_06160 10040 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 11809 10064 gene locus_tag LOCUS_06170 gene aspS 11809 10064 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599762.1 protein_id gnl|my_center|LOCUS_06170 12415 11915 gene locus_tag LOCUS_06180 12415 11915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 12736 13566 gene locus_tag LOCUS_06190 gene ispE 12736 13566 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124916.1 protein_id gnl|my_center|LOCUS_06190 13746 15629 gene locus_tag LOCUS_06200 gene glgB 13746 15629 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_06200 15752 16933 gene locus_tag LOCUS_06210 15752 16933 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_06210 16942 18060 gene locus_tag LOCUS_06220 gene glgD 16942 18060 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_06220 18205 19638 gene locus_tag LOCUS_06230 gene glgA 18205 19638 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_06230 20092 22512 gene locus_tag LOCUS_06240 20092 22512 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_06240 22682 24472 gene locus_tag LOCUS_06250 22682 24472 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437164.1 protein_id gnl|my_center|LOCUS_06250 24755 25303 gene locus_tag LOCUS_06260 gene ilvN 24755 25303 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_06260 25281 26285 gene locus_tag LOCUS_06270 gene ilvC 25281 26285 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_06270 26416 27963 gene locus_tag LOCUS_06280 26416 27963 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_06280 27998 29584 gene locus_tag LOCUS_06290 gene cimA 27998 29584 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966451.1 protein_id gnl|my_center|LOCUS_06290 29629 30888 gene locus_tag LOCUS_06300 gene leuC 29629 30888 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_06300 30936 31427 gene locus_tag LOCUS_06310 gene leuD 30936 31427 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_06310 31454 32521 gene locus_tag LOCUS_06320 gene leuB 31454 32521 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_06320 32569 33450 gene locus_tag LOCUS_06330 gene ilvE 32569 33450 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_06330 33517 35172 gene locus_tag LOCUS_06340 gene ilvD 33517 35172 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966447.1 protein_id gnl|my_center|LOCUS_06340 35191 36864 gene locus_tag LOCUS_06350 gene ilvB 35191 36864 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence014 689 84 gene locus_tag LOCUS_06360 689 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 989 2692 gene locus_tag LOCUS_06370 989 2692 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_06370 2900 4396 gene locus_tag LOCUS_06380 2900 4396 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957028.1 protein_id gnl|my_center|LOCUS_06380 4657 4424 gene locus_tag LOCUS_06390 4657 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 4773 5858 gene locus_tag LOCUS_06400 4773 5858 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_06400 5917 6663 gene locus_tag LOCUS_06410 5917 6663 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_06410 9267 6724 gene locus_tag LOCUS_06420 9267 6724 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_06420 10346 9327 gene locus_tag LOCUS_06430 10346 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 11517 10570 gene locus_tag LOCUS_06440 11517 10570 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_06440 12700 11519 gene locus_tag LOCUS_06450 12700 11519 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266763.1 protein_id gnl|my_center|LOCUS_06450 14528 12693 gene locus_tag LOCUS_06460 14528 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 15997 14702 gene locus_tag LOCUS_06470 15997 14702 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064307.1 protein_id gnl|my_center|LOCUS_06470 16676 16104 gene locus_tag LOCUS_06480 16676 16104 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728269.1 protein_id gnl|my_center|LOCUS_06480 17486 16818 gene locus_tag LOCUS_06490 17486 16818 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_06490 19713 17605 gene locus_tag LOCUS_06500 19713 17605 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_06500 21311 20154 gene locus_tag LOCUS_06510 21311 20154 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_06510 22241 21330 gene locus_tag LOCUS_06520 22241 21330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 23449 22310 gene locus_tag LOCUS_06530 23449 22310 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_06530 24476 23457 gene locus_tag LOCUS_06540 24476 23457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06540 25142 24546 gene locus_tag LOCUS_06550 gene eda 25142 24546 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065248.1 protein_id gnl|my_center|LOCUS_06550 26094 25264 gene locus_tag LOCUS_06560 26094 25264 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047578.1 protein_id gnl|my_center|LOCUS_06560 27244 26201 gene locus_tag LOCUS_06570 gene uxuA 27244 26201 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964641.1 protein_id gnl|my_center|LOCUS_06570 28650 27241 gene locus_tag LOCUS_06580 gene uxaC 28650 27241 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_06580 28899 29759 gene locus_tag LOCUS_06590 28899 29759 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861630.1 protein_id gnl|my_center|LOCUS_06590 30994 29891 gene locus_tag LOCUS_06600 30994 29891 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_06600 31211 32950 gene locus_tag LOCUS_06610 31211 32950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 33922 33077 gene locus_tag LOCUS_06620 33922 33077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 34245 35282 gene locus_tag LOCUS_06630 34245 35282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 <35925 35351 gene locus_tag LOCUS_06640 <35925 35351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454892.1:thiamine diphosphokinase >Feature sequence015 627 1289 gene locus_tag LOCUS_06650 627 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 1448 5194 gene locus_tag LOCUS_06660 1448 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 5841 15911 gene locus_tag LOCUS_06670 5841 15911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 16090 22059 gene locus_tag LOCUS_06680 16090 22059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 22459 23499 gene locus_tag LOCUS_06690 22459 23499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 23456 31771 gene locus_tag LOCUS_06700 23456 31771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence016 <1 1447 gene locus_tag LOCUS_06710 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860391.1:leucine-rich repeat protein 1667 4255 gene locus_tag LOCUS_06720 1667 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 4499 4951 gene locus_tag LOCUS_06730 4499 4951 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861978.1 protein_id gnl|my_center|LOCUS_06730 4948 5412 gene locus_tag LOCUS_06740 4948 5412 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460271.1 protein_id gnl|my_center|LOCUS_06740 5409 7928 gene locus_tag LOCUS_06750 5409 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 7889 8059 gene locus_tag LOCUS_06760 7889 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 8380 11556 gene locus_tag LOCUS_06770 8380 11556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 11825 12748 gene locus_tag LOCUS_06780 11825 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582477.1 protein_id gnl|my_center|LOCUS_06780 12909 14234 gene locus_tag LOCUS_06790 12909 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 14435 15244 gene locus_tag LOCUS_06800 14435 15244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence017 465 1319 gene locus_tag LOCUS_06810 gene argB 465 1319 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_06810 1405 2562 gene locus_tag LOCUS_06820 1405 2562 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_06820 2692 3609 gene locus_tag LOCUS_06830 gene argF 2692 3609 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_06830 3736 4773 gene locus_tag LOCUS_06840 3736 4773 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837306.1 protein_id gnl|my_center|LOCUS_06840 4781 5635 gene locus_tag LOCUS_06850 4781 5635 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788527.1 protein_id gnl|my_center|LOCUS_06850 5864 7642 gene locus_tag LOCUS_06860 5864 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 7886 9745 gene locus_tag LOCUS_06870 7886 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 10010 11521 gene locus_tag LOCUS_06880 10010 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 11856 13343 gene locus_tag LOCUS_06890 11856 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 13677 14756 gene locus_tag LOCUS_06900 gene gcvT 13677 14756 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683018.1 protein_id gnl|my_center|LOCUS_06900 14840 15190 gene locus_tag LOCUS_06910 14840 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 15288 16046 gene locus_tag LOCUS_06920 15288 16046 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389893.1 protein_id gnl|my_center|LOCUS_06920 16234 17541 gene locus_tag LOCUS_06930 gene gcvPA 16234 17541 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678346.1 protein_id gnl|my_center|LOCUS_06930 17555 18985 gene locus_tag LOCUS_06940 gene gcvPB 17555 18985 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679310.1 protein_id gnl|my_center|LOCUS_06940 19161 21170 gene locus_tag LOCUS_06950 19161 21170 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507576.1 protein_id gnl|my_center|LOCUS_06950 21181 21987 gene locus_tag LOCUS_06960 21181 21987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 22229 24064 gene locus_tag LOCUS_06970 22229 24064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 26482 24206 gene locus_tag LOCUS_06980 26482 24206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 26795 27187 gene locus_tag LOCUS_06990 26795 27187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 27279 28748 gene locus_tag LOCUS_07000 27279 28748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence018 <1 5192 gene locus_tag LOCUS_07010 <1 5192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990688.1:leucine-rich repeat protein 5430 6137 gene locus_tag LOCUS_07020 5430 6137 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_07020 7071 6247 gene locus_tag LOCUS_07030 7071 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 8613 7306 gene locus_tag LOCUS_07040 8613 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 10780 8948 gene locus_tag LOCUS_07050 gene dhaK 10780 8948 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720758.1 protein_id gnl|my_center|LOCUS_07050 12073 10943 gene locus_tag LOCUS_07060 12073 10943 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948659.1 protein_id gnl|my_center|LOCUS_07060 12285 12602 gene locus_tag LOCUS_07070 12285 12602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 12958 14229 gene locus_tag LOCUS_07080 12958 14229 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_07080 14683 14360 gene locus_tag LOCUS_tm00010 14683 14360 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 14980 14786 gene locus_tag LOCUS_07090 14980 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 15248 14997 gene locus_tag LOCUS_07100 15248 14997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 15426 15130 gene locus_tag LOCUS_07110 15426 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 16350 15535 gene locus_tag LOCUS_07120 16350 15535 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_07120 18299 16542 gene locus_tag LOCUS_07130 gene argS 18299 16542 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_07130 19607 18513 gene locus_tag LOCUS_07140 gene recF 19607 18513 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_07140 20560 19646 gene locus_tag LOCUS_07150 gene metA 20560 19646 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_07150 21917 20646 gene locus_tag LOCUS_07160 21917 20646 CDS product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504787.1 protein_id gnl|my_center|LOCUS_07160 22775 22320 gene locus_tag LOCUS_07170 gene smpB 22775 22320 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_07170 23156 22881 gene locus_tag LOCUS_07180 23156 22881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 26834 23334 gene locus_tag LOCUS_07190 26834 23334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 27865 27047 gene locus_tag LOCUS_07200 27865 27047 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence019 76 1134 gene locus_tag LOCUS_07210 76 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 1309 1383 gene locus_tag LOCUS_t00190 1309 1383 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1393 1469 gene locus_tag LOCUS_t00200 1393 1469 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1483 1557 gene locus_tag LOCUS_t00210 1483 1557 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1571 1646 gene locus_tag LOCUS_t00220 1571 1646 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2120 7159 gene locus_tag LOCUS_07220 2120 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 7446 8798 gene locus_tag LOCUS_07230 7446 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 9218 10636 gene locus_tag LOCUS_07240 9218 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 10698 12062 gene locus_tag LOCUS_07250 10698 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 12298 12720 gene locus_tag LOCUS_07260 12298 12720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 14141 12861 gene locus_tag LOCUS_07270 14141 12861 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_07270 17055 14467 gene locus_tag LOCUS_07280 gene gyrA 17055 14467 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361457.1 protein_id gnl|my_center|LOCUS_07280 19017 17065 gene locus_tag LOCUS_07290 gene gyrB 19017 17065 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_07290 20886 19528 gene locus_tag LOCUS_07300 20886 19528 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_07300 24165 21340 gene locus_tag LOCUS_07310 24165 21340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 24909 24241 gene locus_tag LOCUS_07320 24909 24241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence020 2748 4055 gene locus_tag LOCUS_07330 gene arsB 2748 4055 CDS product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059107106.1 protein_id gnl|my_center|LOCUS_07330 5821 4211 gene locus_tag LOCUS_07340 5821 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 10456 6023 gene locus_tag LOCUS_07350 10456 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 15435 10468 gene locus_tag LOCUS_07360 15435 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 16070 16789 gene locus_tag LOCUS_07370 16070 16789 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_07370 16902 18974 gene locus_tag LOCUS_07380 16902 18974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 20590 19154 gene locus_tag LOCUS_07390 gene lpdA 20590 19154 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766155.1 protein_id gnl|my_center|LOCUS_07390 21454 20645 gene locus_tag LOCUS_07400 21454 20645 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706576.1 protein_id gnl|my_center|LOCUS_07400 22952 21711 gene locus_tag LOCUS_07410 22952 21711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence021 1304 312 gene locus_tag LOCUS_07420 1304 312 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_07420 1604 1933 gene locus_tag LOCUS_07430 1604 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1938 2558 gene locus_tag LOCUS_07440 1938 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3229 2576 gene locus_tag LOCUS_07450 3229 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 3435 5183 gene locus_tag LOCUS_07460 gene cdr 3435 5183 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087552.1 protein_id gnl|my_center|LOCUS_07460 6547 5345 gene locus_tag LOCUS_07470 6547 5345 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_07470 8128 6692 gene locus_tag LOCUS_07480 gene melB 8128 6692 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032709637.1 protein_id gnl|my_center|LOCUS_07480 8402 8602 gene locus_tag LOCUS_07490 8402 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 8743 8934 gene locus_tag LOCUS_07500 8743 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 10455 9202 gene locus_tag LOCUS_07510 10455 9202 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_07510 11475 10846 gene locus_tag LOCUS_07520 11475 10846 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986474.1 protein_id gnl|my_center|LOCUS_07520 11804 11541 gene locus_tag LOCUS_07530 11804 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 14047 12062 gene locus_tag LOCUS_07540 gene aor 14047 12062 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_07540 14542 16356 gene locus_tag LOCUS_07550 14542 16356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 16453 18288 gene locus_tag LOCUS_07560 16453 18288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 18405 21254 gene locus_tag LOCUS_07570 18405 21254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 21378 22346 gene locus_tag LOCUS_07580 21378 22346 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence022 756 487 gene locus_tag LOCUS_07590 756 487 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_07590 2055 937 gene locus_tag LOCUS_07600 2055 937 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_07600 2342 3721 gene locus_tag LOCUS_07610 gene dnaA 2342 3721 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582428.1 protein_id gnl|my_center|LOCUS_07610 4059 5174 gene locus_tag LOCUS_07620 gene dnaN 4059 5174 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_07620 7652 6339 gene locus_tag LOCUS_07630 gene pepV 7652 6339 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459801.1 protein_id gnl|my_center|LOCUS_07630 7968 8888 gene locus_tag LOCUS_07640 7968 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 8962 9369 gene locus_tag LOCUS_07650 8962 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 9388 9702 gene locus_tag LOCUS_07660 9388 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 9779 10084 gene locus_tag LOCUS_07670 9779 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 11919 10099 gene locus_tag LOCUS_07680 gene typA 11919 10099 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_07680 12161 12451 gene locus_tag LOCUS_07690 12161 12451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 14082 13540 gene locus_tag LOCUS_07700 14082 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 14864 14079 gene locus_tag LOCUS_07710 14864 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 16069 14867 gene locus_tag LOCUS_07720 16069 14867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 16423 16689 gene locus_tag LOCUS_07730 16423 16689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 16673 16930 gene locus_tag LOCUS_07740 16673 16930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 17084 17746 gene locus_tag LOCUS_07750 17084 17746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 17850 18104 gene locus_tag LOCUS_07760 17850 18104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 18120 18196 gene locus_tag LOCUS_t00230 18120 18196 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18305 20374 gene locus_tag LOCUS_07770 gene fusA 18305 20374 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence023 7 798 gene locus_tag LOCUS_07780 7 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2219 873 gene locus_tag LOCUS_07790 2219 873 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582613.1 protein_id gnl|my_center|LOCUS_07790 4060 2372 gene locus_tag LOCUS_07800 4060 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5103 4267 gene locus_tag LOCUS_07810 5103 4267 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963591.1 protein_id gnl|my_center|LOCUS_07810 7193 5448 gene locus_tag LOCUS_07820 7193 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 9134 7275 gene locus_tag LOCUS_07830 9134 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 10505 9363 gene locus_tag LOCUS_07840 10505 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 12034 10850 gene locus_tag LOCUS_07850 12034 10850 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_07850 13623 12214 gene locus_tag LOCUS_07860 13623 12214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 13778 13638 gene locus_tag LOCUS_07870 13778 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 14728 14048 gene locus_tag LOCUS_07880 14728 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 15682 14741 gene locus_tag LOCUS_07890 15682 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 16960 15992 gene locus_tag LOCUS_07900 16960 15992 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 protein_id gnl|my_center|LOCUS_07900 17577 17035 gene locus_tag LOCUS_07910 17577 17035 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_07910 17873 19105 gene locus_tag LOCUS_07920 17873 19105 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816160.1 protein_id gnl|my_center|LOCUS_07920 19550 19263 gene locus_tag LOCUS_07930 19550 19263 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_07930 21395 19815 gene locus_tag LOCUS_07940 21395 19815 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence024 3423 4835 gene locus_tag LOCUS_07950 3423 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07950 4874 6223 gene locus_tag LOCUS_07960 4874 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 6297 8573 gene locus_tag LOCUS_07970 6297 8573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 10507 8675 gene locus_tag LOCUS_07980 10507 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 13973 10794 gene locus_tag LOCUS_07990 13973 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 14116 14265 gene locus_tag LOCUS_08000 14116 14265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 14515 18282 gene locus_tag LOCUS_08010 14515 18282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 18358 19323 gene locus_tag LOCUS_08020 18358 19323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence025 <1 3669 gene locus_tag LOCUS_08030 <1 3669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860677.1:phosphoribosylformylglycinamidine synthase 3793 4755 gene locus_tag LOCUS_08040 3793 4755 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920615.1 protein_id gnl|my_center|LOCUS_08040 4890 6770 gene locus_tag LOCUS_08050 4890 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 7122 8012 gene locus_tag LOCUS_08060 gene pyrB 7122 8012 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018849.1 protein_id gnl|my_center|LOCUS_08060 8179 9387 gene locus_tag LOCUS_08070 8179 9387 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485025.1 protein_id gnl|my_center|LOCUS_08070 9576 10700 gene locus_tag LOCUS_08080 9576 10700 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190913.1 protein_id gnl|my_center|LOCUS_08080 10746 13919 gene locus_tag LOCUS_08090 gene carB 10746 13919 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 protein_id gnl|my_center|LOCUS_08090 13935 14666 gene locus_tag LOCUS_08100 13935 14666 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_08100 14738 15658 gene locus_tag LOCUS_08110 gene pyrD 14738 15658 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081057.1 protein_id gnl|my_center|LOCUS_08110 15686 16381 gene locus_tag LOCUS_08120 gene pyrF 15686 16381 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_08120 16445 17089 gene locus_tag LOCUS_08130 gene pyrE 16445 17089 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357418.1 protein_id gnl|my_center|LOCUS_08130 17249 17719 gene locus_tag LOCUS_08140 17249 17719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 17762 18457 gene locus_tag LOCUS_08150 17762 18457 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_08150 18504 19973 gene locus_tag LOCUS_08160 18504 19973 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_08160 21240 20056 gene locus_tag LOCUS_08170 21240 20056 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence026 262 624 gene locus_tag LOCUS_08180 262 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 664 2211 gene locus_tag LOCUS_08190 664 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 3960 2917 gene locus_tag LOCUS_08200 3960 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 4345 4530 gene locus_tag LOCUS_08210 4345 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 4658 4978 gene locus_tag LOCUS_08220 4658 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 5525 5124 gene locus_tag LOCUS_08230 5525 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 5856 6380 gene locus_tag LOCUS_08240 5856 6380 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897366.1 protein_id gnl|my_center|LOCUS_08240 6431 6946 gene locus_tag LOCUS_08250 6431 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 7532 6933 gene locus_tag LOCUS_08260 7532 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 8290 7538 gene locus_tag LOCUS_08270 gene mobB 8290 7538 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867211.1 protein_id gnl|my_center|LOCUS_08270 9082 8330 gene locus_tag LOCUS_08280 9082 8330 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186532.1 protein_id gnl|my_center|LOCUS_08280 9731 9066 gene locus_tag LOCUS_08290 gene ecfA1 9731 9066 CDS product energy-coupling factor ABC transporter ATP-binding protein EcfA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082181.1 protein_id gnl|my_center|LOCUS_08290 10386 9721 gene locus_tag LOCUS_08300 10386 9721 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_08300 11051 10476 gene locus_tag LOCUS_08310 11051 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 12683 11190 gene locus_tag LOCUS_08320 12683 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 13522 12749 gene locus_tag LOCUS_08330 13522 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 14627 13635 gene locus_tag LOCUS_08340 14627 13635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 15944 14691 gene locus_tag LOCUS_08350 15944 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 16243 16476 gene locus_tag LOCUS_08360 16243 16476 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003013836.1 protein_id gnl|my_center|LOCUS_08360 17350 16847 gene locus_tag LOCUS_08370 17350 16847 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877613.1 protein_id gnl|my_center|LOCUS_08370 18392 17340 gene locus_tag LOCUS_08380 18392 17340 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256572.1 protein_id gnl|my_center|LOCUS_08380 18625 20355 gene locus_tag LOCUS_08390 18625 20355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 protein_id gnl|my_center|LOCUS_08390 20778 21260 gene locus_tag LOCUS_08400 20778 21260 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665857.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence027 257 181 gene locus_tag LOCUS_t00240 257 181 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1149 475 gene locus_tag LOCUS_08410 1149 475 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432519.1 protein_id gnl|my_center|LOCUS_08410 1925 1347 gene locus_tag LOCUS_08420 1925 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2963 1959 gene locus_tag LOCUS_08430 gene trpS 2963 1959 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518857.1 protein_id gnl|my_center|LOCUS_08430 3752 3291 gene locus_tag LOCUS_08440 3752 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3918 3742 gene locus_tag LOCUS_08450 3918 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 5213 3921 gene locus_tag LOCUS_08460 5213 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 7035 5560 gene locus_tag LOCUS_08470 gene thrC 7035 5560 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434031.1 protein_id gnl|my_center|LOCUS_08470 7461 7036 gene locus_tag LOCUS_08480 7461 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_08480 8080 7565 gene locus_tag LOCUS_08490 gene thpR 8080 7565 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_08490 9759 8356 gene locus_tag LOCUS_08500 9759 8356 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_08500 10909 9842 gene locus_tag LOCUS_08510 gene prfA 10909 9842 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_08510 12888 11086 gene locus_tag LOCUS_08520 12888 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 13445 13233 gene locus_tag LOCUS_08530 gene rpmE 13445 13233 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457203.1 protein_id gnl|my_center|LOCUS_08530 15219 13648 gene locus_tag LOCUS_08540 15219 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 16360 15371 gene locus_tag LOCUS_08550 16360 15371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 16862 16581 gene locus_tag LOCUS_08560 gene spoVG 16862 16581 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_08560 18611 17016 gene locus_tag LOCUS_08570 18611 17016 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_08570 19661 18750 gene locus_tag LOCUS_08580 gene trxB 19661 18750 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence028 3708 934 gene locus_tag LOCUS_08590 3708 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 5555 4074 gene locus_tag LOCUS_08600 5555 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 6938 5730 gene locus_tag LOCUS_08610 6938 5730 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681108.1 protein_id gnl|my_center|LOCUS_08610 7469 7741 gene locus_tag LOCUS_08620 7469 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 7808 8080 gene locus_tag LOCUS_08630 7808 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 8086 8502 gene locus_tag LOCUS_08640 8086 8502 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_08640 8517 9554 gene locus_tag LOCUS_08650 8517 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 9747 11153 gene locus_tag LOCUS_08660 9747 11153 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681540.1 protein_id gnl|my_center|LOCUS_08660 11237 11527 gene locus_tag LOCUS_08670 gene yhbY 11237 11527 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358089.1 protein_id gnl|my_center|LOCUS_08670 11637 12218 gene locus_tag LOCUS_08680 11637 12218 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037239.1 protein_id gnl|my_center|LOCUS_08680 12320 12661 gene locus_tag LOCUS_08690 12320 12661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 12729 13634 gene locus_tag LOCUS_08700 12729 13634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 16443 13897 gene locus_tag LOCUS_08710 16443 13897 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956923.1 protein_id gnl|my_center|LOCUS_08710 16757 16440 gene locus_tag LOCUS_08720 16757 16440 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434762.1 protein_id gnl|my_center|LOCUS_08720 18110 16953 gene locus_tag LOCUS_08730 18110 16953 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_08730 <19187 18457 gene locus_tag LOCUS_08740 <19187 18457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048277.1:cation diffusion facilitator family transporter >Feature sequence029 322 1455 gene locus_tag LOCUS_08750 322 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1826 4411 gene locus_tag LOCUS_08760 1826 4411 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166393.1 protein_id gnl|my_center|LOCUS_08760 4630 5550 gene locus_tag LOCUS_08770 4630 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 5741 6304 gene locus_tag LOCUS_08780 5741 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 7659 6442 gene locus_tag LOCUS_08790 7659 6442 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209169.1 protein_id gnl|my_center|LOCUS_08790 8039 8500 gene locus_tag LOCUS_08800 8039 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 8525 9478 gene locus_tag LOCUS_08810 8525 9478 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_08810 10560 9622 gene locus_tag LOCUS_08820 10560 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 11311 10562 gene locus_tag LOCUS_08830 11311 10562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963648.1 protein_id gnl|my_center|LOCUS_08830 12498 11812 gene locus_tag LOCUS_08840 12498 11812 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 protein_id gnl|my_center|LOCUS_08840 14282 12837 gene locus_tag LOCUS_08850 14282 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 14414 14563 gene locus_tag LOCUS_08860 14414 14563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 14579 15583 gene locus_tag LOCUS_08870 14579 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 16097 15795 gene locus_tag LOCUS_08880 gene rpsR 16097 15795 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_08880 16547 16143 gene locus_tag LOCUS_08890 gene ssb 16547 16143 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_08890 16860 16579 gene locus_tag LOCUS_08900 gene rpsF 16860 16579 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence030 568 110 gene locus_tag LOCUS_08910 568 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2323 1067 gene locus_tag LOCUS_08920 2323 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 2561 3154 gene locus_tag LOCUS_08930 2561 3154 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_08930 3927 3238 gene locus_tag LOCUS_08940 3927 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 5370 3985 gene locus_tag LOCUS_08950 gene cysS 5370 3985 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_08950 6134 5382 gene locus_tag LOCUS_08960 gene cysE 6134 5382 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_08960 7720 6275 gene locus_tag LOCUS_08970 7720 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 8381 7956 gene locus_tag LOCUS_08980 8381 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 8960 8559 gene locus_tag LOCUS_08990 8960 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 11345 9441 gene locus_tag LOCUS_09000 11345 9441 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_09000 13021 11738 gene locus_tag LOCUS_09010 13021 11738 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_09010 13085 13261 gene locus_tag LOCUS_09020 13085 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 13358 14578 gene locus_tag LOCUS_09030 13358 14578 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_09030 14980 14834 gene locus_tag LOCUS_09040 14980 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 15757 14981 gene locus_tag LOCUS_09050 15757 14981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 15992 16474 gene locus_tag LOCUS_09060 15992 16474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 16477 16914 gene locus_tag LOCUS_09070 16477 16914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 17450 17103 gene locus_tag LOCUS_09080 17450 17103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence031 5742 4063 gene locus_tag LOCUS_09090 5742 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 8840 5871 gene locus_tag LOCUS_09100 8840 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 9538 8918 gene locus_tag LOCUS_09110 9538 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 11487 9574 gene locus_tag LOCUS_09120 11487 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 12232 11489 gene locus_tag LOCUS_09130 12232 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 12144 12332 gene locus_tag LOCUS_09140 12144 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 13637 12486 gene locus_tag LOCUS_09150 13637 12486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 14586 13852 gene locus_tag LOCUS_09160 14586 13852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 17448 14641 gene locus_tag LOCUS_09170 17448 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 17664 17527 gene locus_tag LOCUS_09180 17664 17527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence032 544 131 gene locus_tag LOCUS_09190 gene rpsI 544 131 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_09190 992 558 gene locus_tag LOCUS_09200 gene rplM 992 558 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_09200 2331 4394 gene locus_tag LOCUS_09210 2331 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5548 4745 gene locus_tag LOCUS_09220 5548 4745 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681556.1 protein_id gnl|my_center|LOCUS_09220 7533 5635 gene locus_tag LOCUS_09230 7533 5635 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502257.1 protein_id gnl|my_center|LOCUS_09230 8908 7523 gene locus_tag LOCUS_09240 8908 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 9645 8926 gene locus_tag LOCUS_09250 gene truA 9645 8926 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_09250 10534 9695 gene locus_tag LOCUS_09260 10534 9695 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_09260 11460 10609 gene locus_tag LOCUS_09270 11460 10609 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_09270 12529 11657 gene locus_tag LOCUS_09280 12529 11657 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_09280 13315 12728 gene locus_tag LOCUS_09290 13315 12728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 13843 13319 gene locus_tag LOCUS_09300 13843 13319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 14468 15619 gene locus_tag LOCUS_09310 gene aroC 14468 15619 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_09310 15791 15864 gene locus_tag LOCUS_t00250 15791 15864 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15943 16179 gene locus_tag LOCUS_09320 15943 16179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 16187 16726 gene locus_tag LOCUS_09330 16187 16726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence033 1564 1067 gene locus_tag LOCUS_09340 1564 1067 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939955.1 protein_id gnl|my_center|LOCUS_09340 2990 1686 gene locus_tag LOCUS_09350 2990 1686 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_09350 3590 4885 gene locus_tag LOCUS_09360 3590 4885 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896573.1 protein_id gnl|my_center|LOCUS_09360 6849 4942 gene locus_tag LOCUS_09370 gene mnmG 6849 4942 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898858.1 protein_id gnl|my_center|LOCUS_09370 8288 6960 gene locus_tag LOCUS_09380 gene mnmE 8288 6960 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_09380 9308 8364 gene locus_tag LOCUS_09390 9308 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 10528 9458 gene locus_tag LOCUS_09400 10528 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 11213 10866 gene locus_tag LOCUS_09410 gene rnpA 11213 10866 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853349.1 protein_id gnl|my_center|LOCUS_09410 11355 11221 gene locus_tag LOCUS_09420 11355 11221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 12954 11662 gene locus_tag LOCUS_09430 12954 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 14905 13502 gene locus_tag LOCUS_09440 14905 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 <17081 15133 gene locus_tag LOCUS_09450 <17081 15133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013246158.1:MBG domain-containing protein >Feature sequence034 267 530 gene locus_tag LOCUS_09460 267 530 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986552.1 protein_id gnl|my_center|LOCUS_09460 646 2337 gene locus_tag LOCUS_09470 gene malL 646 2337 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_09470 2572 2910 gene locus_tag LOCUS_09480 2572 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 4595 2994 gene locus_tag LOCUS_09490 4595 2994 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456609.1 protein_id gnl|my_center|LOCUS_09490 6595 4949 gene locus_tag LOCUS_09500 6595 4949 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_09500 7783 6854 gene locus_tag LOCUS_09510 7783 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 8849 7821 gene locus_tag LOCUS_09520 gene iolG 8849 7821 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_09520 9753 8875 gene locus_tag LOCUS_09530 gene iolE 9753 8875 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 protein_id gnl|my_center|LOCUS_09530 12052 10151 gene locus_tag LOCUS_09540 gene iolD 12052 10151 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195356.1 protein_id gnl|my_center|LOCUS_09540 12954 12184 gene locus_tag LOCUS_09550 12954 12184 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_09550 14658 13021 gene locus_tag LOCUS_09560 14658 13021 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211645.1 protein_id gnl|my_center|LOCUS_09560 16664 14925 gene locus_tag LOCUS_09570 16664 14925 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674328.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence035 1136 255 gene locus_tag LOCUS_09580 1136 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2031 1216 gene locus_tag LOCUS_09590 2031 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3137 2343 gene locus_tag LOCUS_09600 3137 2343 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_09600 4863 3337 gene locus_tag LOCUS_09610 4863 3337 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_09610 5076 5726 gene locus_tag LOCUS_09620 5076 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 5938 7158 gene locus_tag LOCUS_09630 5938 7158 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_09630 8832 7261 gene locus_tag LOCUS_09640 8832 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 9162 10499 gene locus_tag LOCUS_09650 9162 10499 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_09650 12373 10580 gene locus_tag LOCUS_09660 gene fucI 12373 10580 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_09660 12644 14746 gene locus_tag LOCUS_09670 12644 14746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence036 83 970 gene locus_tag LOCUS_09680 83 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1329 2276 gene locus_tag LOCUS_09690 1329 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2558 2854 gene locus_tag LOCUS_09700 2558 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2882 3922 gene locus_tag LOCUS_09710 2882 3922 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_09710 4940 4305 gene locus_tag LOCUS_09720 4940 4305 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775976.1 protein_id gnl|my_center|LOCUS_09720 5333 5743 gene locus_tag LOCUS_09730 5333 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 5807 6505 gene locus_tag LOCUS_09740 5807 6505 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638485.1 protein_id gnl|my_center|LOCUS_09740 9237 6676 gene locus_tag LOCUS_09750 9237 6676 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_09750 11973 9421 gene locus_tag LOCUS_09760 11973 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 12680 12294 gene locus_tag LOCUS_09770 12680 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 13924 12689 gene locus_tag LOCUS_09780 13924 12689 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_09780 15029 14082 gene locus_tag LOCUS_09790 15029 14082 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence037 977 1870 gene locus_tag LOCUS_09800 977 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2038 2904 gene locus_tag LOCUS_09810 2038 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3034 3834 gene locus_tag LOCUS_09820 3034 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 3966 5522 gene locus_tag LOCUS_09830 3966 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 5640 7691 gene locus_tag LOCUS_09840 5640 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 7707 8507 gene locus_tag LOCUS_09850 7707 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 9845 8667 gene locus_tag LOCUS_09860 9845 8667 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965365.1 protein_id gnl|my_center|LOCUS_09860 10646 9936 gene locus_tag LOCUS_09870 gene deoD 10646 9936 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183561.1 protein_id gnl|my_center|LOCUS_09870 11392 10733 gene locus_tag LOCUS_09880 gene deoC 11392 10733 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_09880 14195 11523 gene locus_tag LOCUS_09890 14195 11523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence038 246 719 gene locus_tag LOCUS_09900 gene greA 246 719 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_09900 1367 759 gene locus_tag LOCUS_09910 1367 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1549 2766 gene locus_tag LOCUS_09920 1549 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2935 4428 gene locus_tag LOCUS_09930 gene lysS 2935 4428 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_09930 4488 5798 gene locus_tag LOCUS_09940 4488 5798 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947924.1 protein_id gnl|my_center|LOCUS_09940 5866 6546 gene locus_tag LOCUS_09950 5866 6546 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426355.1 protein_id gnl|my_center|LOCUS_09950 6784 8040 gene locus_tag LOCUS_09960 6784 8040 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_09960 8209 9918 gene locus_tag LOCUS_09970 8209 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 10067 10693 gene locus_tag LOCUS_09980 gene tmk 10067 10693 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583153.1 protein_id gnl|my_center|LOCUS_09980 10725 11723 gene locus_tag LOCUS_09990 gene holB 10725 11723 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384059.1 protein_id gnl|my_center|LOCUS_09990 11816 12802 gene locus_tag LOCUS_10000 11816 12802 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_10000 12878 13051 gene locus_tag LOCUS_10010 12878 13051 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence039 1690 338 gene locus_tag LOCUS_10020 1690 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3197 1839 gene locus_tag LOCUS_10030 gene gltA 3197 1839 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_10030 4098 3247 gene locus_tag LOCUS_10040 4098 3247 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_10040 4351 4542 gene locus_tag LOCUS_10050 4351 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 8879 4728 gene locus_tag LOCUS_10060 8879 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 9365 10066 gene locus_tag LOCUS_10070 gene rsmG 9365 10066 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 protein_id gnl|my_center|LOCUS_10070 10468 11382 gene locus_tag LOCUS_10080 10468 11382 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_10080 11592 13022 gene locus_tag LOCUS_10090 gene gltX 11592 13022 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence040 1380 1517 gene locus_tag LOCUS_10100 1380 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1709 2167 gene locus_tag LOCUS_10110 1709 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2333 3040 gene locus_tag LOCUS_10120 2333 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10120 4404 3232 gene locus_tag LOCUS_10130 4404 3232 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_10130 5542 4433 gene locus_tag LOCUS_10140 5542 4433 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_10140 6804 5665 gene locus_tag LOCUS_10150 6804 5665 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965263.1 protein_id gnl|my_center|LOCUS_10150 8087 6834 gene locus_tag LOCUS_10160 8087 6834 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682315.1 protein_id gnl|my_center|LOCUS_10160 9169 8135 gene locus_tag LOCUS_10170 9169 8135 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583968.1 protein_id gnl|my_center|LOCUS_10170 10809 9460 gene locus_tag LOCUS_10180 10809 9460 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_10180 11602 12201 gene locus_tag LOCUS_10190 11602 12201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence041 4440 331 gene locus_tag LOCUS_10200 4440 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 7795 4955 gene locus_tag LOCUS_10210 7795 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 9031 7844 gene locus_tag LOCUS_10220 9031 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 9348 9109 gene locus_tag LOCUS_10230 9348 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 9934 10512 gene locus_tag LOCUS_10240 9934 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 <11610 10849 gene locus_tag LOCUS_10250 <11610 10849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962350.1:leucine-rich repeat domain-containing protein >Feature sequence042 669 9782 gene locus_tag LOCUS_10260 669 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 10310 9870 gene locus_tag LOCUS_10270 10310 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 11196 10303 gene locus_tag LOCUS_10280 11196 10303 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369769.1 protein_id gnl|my_center|LOCUS_10280 11506 11597 gene locus_tag LOCUS_t00260 11506 11597 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence043 653 267 gene locus_tag LOCUS_10290 653 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2037 850 gene locus_tag LOCUS_10300 2037 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 3145 2120 gene locus_tag LOCUS_10310 3145 2120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989559.1 protein_id gnl|my_center|LOCUS_10310 6711 3340 gene locus_tag LOCUS_10320 6711 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 7186 8697 gene locus_tag LOCUS_10330 7186 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 9064 9960 gene locus_tag LOCUS_10340 9064 9960 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_10340 10676 10242 gene locus_tag LOCUS_10350 10676 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 11245 10784 gene locus_tag LOCUS_10360 11245 10784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence044 4046 1779 gene locus_tag LOCUS_10370 4046 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 5649 4039 gene locus_tag LOCUS_10380 5649 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 6470 5748 gene locus_tag LOCUS_10390 6470 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 7341 6472 gene locus_tag LOCUS_10400 7341 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 9210 7405 gene locus_tag LOCUS_10410 9210 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 10132 9224 gene locus_tag LOCUS_10420 10132 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence045 222 307 gene locus_tag LOCUS_t00270 222 307 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 462 1679 gene locus_tag LOCUS_10430 462 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 2464 1745 gene locus_tag LOCUS_10440 2464 1745 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_10440 2563 2487 gene locus_tag LOCUS_t00280 2563 2487 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4698 2614 gene locus_tag LOCUS_10450 4698 2614 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964362.1 protein_id gnl|my_center|LOCUS_10450 5954 4722 gene locus_tag LOCUS_10460 5954 4722 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_10460 7051 6023 gene locus_tag LOCUS_10470 7051 6023 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023275.1 protein_id gnl|my_center|LOCUS_10470 10201 7064 gene locus_tag LOCUS_10480 gene ileS 10201 7064 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454939.1 protein_id gnl|my_center|LOCUS_10480 10407 10482 gene locus_tag LOCUS_t00290 10407 10482 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence046 42 1217 gene locus_tag LOCUS_10490 42 1217 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_10490 1473 3272 gene locus_tag LOCUS_10500 1473 3272 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_10500 3301 4002 gene locus_tag LOCUS_10510 3301 4002 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626384.1 protein_id gnl|my_center|LOCUS_10510 4078 4557 gene locus_tag LOCUS_10520 4078 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4658 4840 gene locus_tag LOCUS_10530 4658 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5967 4918 gene locus_tag LOCUS_10540 5967 4918 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_10540 6467 6108 gene locus_tag LOCUS_10550 6467 6108 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813896.1 protein_id gnl|my_center|LOCUS_10550 7563 6739 gene locus_tag LOCUS_10560 7563 6739 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925959.1 protein_id gnl|my_center|LOCUS_10560 8435 7566 gene locus_tag LOCUS_10570 8435 7566 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461117.1 protein_id gnl|my_center|LOCUS_10570 9267 8413 gene locus_tag LOCUS_10580 9267 8413 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272561.1 protein_id gnl|my_center|LOCUS_10580 9635 9267 gene locus_tag LOCUS_10590 9635 9267 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943770.1 protein_id gnl|my_center|LOCUS_10590 10072 9707 gene locus_tag LOCUS_10600 10072 9707 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461119.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence047 540 800 gene locus_tag LOCUS_10610 540 800 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_10610 908 1984 gene locus_tag LOCUS_10620 gene hydE 908 1984 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433972.1 protein_id gnl|my_center|LOCUS_10620 2129 3577 gene locus_tag LOCUS_10630 gene hydG 2129 3577 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108015.1 protein_id gnl|my_center|LOCUS_10630 3722 4987 gene locus_tag LOCUS_10640 gene hydF 3722 4987 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_10640 6307 5075 gene locus_tag LOCUS_10650 6307 5075 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_10650 7240 6332 gene locus_tag LOCUS_10660 gene cysK 7240 6332 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_10660 8238 7240 gene locus_tag LOCUS_10670 8238 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 8997 8251 gene locus_tag LOCUS_10680 8997 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 10050 9166 gene locus_tag LOCUS_10690 10050 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence048 586 3459 gene locus_tag LOCUS_10700 gene mgtA 586 3459 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861942.1 protein_id gnl|my_center|LOCUS_10700 3950 6052 gene locus_tag LOCUS_10710 3950 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence049 387 875 gene locus_tag LOCUS_10720 gene mog 387 875 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986482.1 protein_id gnl|my_center|LOCUS_10720 921 1292 gene locus_tag LOCUS_10730 921 1292 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_10730 1445 2647 gene locus_tag LOCUS_10740 1445 2647 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_10740 2954 3322 gene locus_tag LOCUS_10750 2954 3322 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_10750 3399 4250 gene locus_tag LOCUS_10760 3399 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 4323 5714 gene locus_tag LOCUS_10770 4323 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 5968 6234 gene locus_tag LOCUS_10780 5968 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6285 6518 gene locus_tag LOCUS_10790 6285 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10790 6515 8806 gene locus_tag LOCUS_10800 gene feoB 6515 8806 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287799.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence050 971 1837 gene locus_tag LOCUS_10810 971 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1891 2550 gene locus_tag LOCUS_10820 1891 2550 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262170.1 protein_id gnl|my_center|LOCUS_10820 2560 3567 gene locus_tag LOCUS_10830 2560 3567 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 protein_id gnl|my_center|LOCUS_10830 3750 4010 gene locus_tag LOCUS_10840 3750 4010 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583423.1 protein_id gnl|my_center|LOCUS_10840 4110 4616 gene locus_tag LOCUS_10850 4110 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4663 6192 gene locus_tag LOCUS_10860 gene malQ 4663 6192 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403431.1 protein_id gnl|my_center|LOCUS_10860 6334 8235 gene locus_tag LOCUS_10870 6334 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence051 36 110 gene locus_tag LOCUS_t00300 36 110 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 703 3726 gene locus_tag LOCUS_10880 703 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence052 1031 477 gene locus_tag LOCUS_10890 1031 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1807 1046 gene locus_tag LOCUS_10900 1807 1046 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015667.1 protein_id gnl|my_center|LOCUS_10900 2415 3836 gene locus_tag LOCUS_10910 2415 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 3829 4950 gene locus_tag LOCUS_10920 3829 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 6246 4972 gene locus_tag LOCUS_10930 6246 4972 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_10930 6717 6642 gene locus_tag LOCUS_t00310 6717 6642 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 <7307 6768 gene locus_tag LOCUS_10940 <7307 6768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965854.1:GGGtGRT protein >Feature sequence053 291 2180 gene locus_tag LOCUS_10950 291 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2270 2941 gene locus_tag LOCUS_10960 2270 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2968 3873 gene locus_tag LOCUS_10970 2968 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 4496 3945 gene locus_tag LOCUS_10980 4496 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 6453 4522 gene locus_tag LOCUS_10990 6453 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 6786 6711 gene locus_tag LOCUS_t00320 6786 6711 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6906 6796 gene locus_tag LOCUS_r00010 6906 6796 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence054 <1 2382 gene locus_tag LOCUS_11000 <1 2382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942796.1:InlB B-repeat-containing protein 2666 3475 gene locus_tag LOCUS_11010 2666 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3689 3531 gene locus_tag LOCUS_11020 3689 3531 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_11020 4386 3808 gene locus_tag LOCUS_11030 gene pth 4386 3808 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_11030 4760 4581 gene locus_tag LOCUS_11040 4760 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 5199 4729 gene locus_tag LOCUS_11050 gene tadA 5199 4729 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129664.1 protein_id gnl|my_center|LOCUS_11050 5667 5218 gene locus_tag LOCUS_11060 gene rlmH 5667 5218 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence055 <1 1351 gene locus_tag LOCUS_11070 <1 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461475.1:amidophosphoribosyltransferase 1418 2443 gene locus_tag LOCUS_11080 gene purM 1418 2443 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262439.1 protein_id gnl|my_center|LOCUS_11080 2527 3105 gene locus_tag LOCUS_11090 gene purN 2527 3105 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_11090 3247 4773 gene locus_tag LOCUS_11100 gene purH 3247 4773 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548356.1 protein_id gnl|my_center|LOCUS_11100 4832 6085 gene locus_tag LOCUS_11110 gene purD 4832 6085 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence056 986 165 gene locus_tag LOCUS_11120 986 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1362 2183 gene locus_tag LOCUS_11130 1362 2183 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 protein_id gnl|my_center|LOCUS_11130 2183 3121 gene locus_tag LOCUS_11140 2183 3121 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_11140 3560 3180 gene locus_tag LOCUS_11150 3560 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 3955 3608 gene locus_tag LOCUS_11160 3955 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 4433 4095 gene locus_tag LOCUS_11170 4433 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5612 4545 gene locus_tag LOCUS_11180 gene mnmA 5612 4545 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723698.1 protein_id gnl|my_center|LOCUS_11180 5902 5826 gene locus_tag LOCUS_t00330 5902 5826 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence057 >Feature sequence058 110 1591 gene locus_tag LOCUS_11190 110 1591 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_11190 2203 1679 gene locus_tag LOCUS_11200 2203 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 3587 2280 gene locus_tag LOCUS_11210 3587 2280 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_11210 4827 3598 gene locus_tag LOCUS_11220 4827 3598 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_11220 5734 4928 gene locus_tag LOCUS_11230 gene cdaA 5734 4928 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence059 569 883 gene locus_tag LOCUS_11240 569 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1130 2584 gene locus_tag LOCUS_11250 1130 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2748 3455 gene locus_tag LOCUS_11260 2748 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3753 5315 gene locus_tag LOCUS_11270 3753 5315 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063660.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence060 1488 511 gene locus_tag LOCUS_11280 1488 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2836 1979 gene locus_tag LOCUS_11290 2836 1979 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_11290 4147 2909 gene locus_tag LOCUS_11300 4147 2909 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899014.1 protein_id gnl|my_center|LOCUS_11300 5518 4328 gene locus_tag LOCUS_11310 5518 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence061 2293 773 gene locus_tag LOCUS_11320 2293 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3182 2388 gene locus_tag LOCUS_11330 3182 2388 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_11330 4084 3284 gene locus_tag LOCUS_11340 4084 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence062 2641 62 gene locus_tag LOCUS_11350 2641 62 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068835.1 protein_id gnl|my_center|LOCUS_11350 3799 2861 gene locus_tag LOCUS_11360 3799 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 4547 3807 gene locus_tag LOCUS_11370 4547 3807 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_11370 4987 4694 gene locus_tag LOCUS_11380 4987 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence063 1325 405 gene locus_tag LOCUS_11390 1325 405 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461029.1 protein_id gnl|my_center|LOCUS_11390 1463 3511 gene locus_tag LOCUS_11400 1463 3511 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045361.1 protein_id gnl|my_center|LOCUS_11400 3619 4623 gene locus_tag LOCUS_11410 3619 4623 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011578509.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence064 2346 1489 gene locus_tag LOCUS_11420 gene metF 2346 1489 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_11420 2935 2492 gene locus_tag LOCUS_11430 gene aroQ 2935 2492 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_11430 <4244 3009 gene locus_tag LOCUS_11440 <4244 3009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242688.1:MFS transporter >Feature sequence065 323 2116 gene locus_tag LOCUS_11450 323 2116 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_11450 2880 3209 gene locus_tag LOCUS_11460 2880 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence066 130 627 gene locus_tag LOCUS_11470 gene nuoE 130 627 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986413.1 protein_id gnl|my_center|LOCUS_11470 654 1016 gene locus_tag LOCUS_11480 654 1016 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_11480 1030 2544 gene locus_tag LOCUS_11490 gene nuoF 1030 2544 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11490 >Feature sequence067 <1 1173 gene locus_tag LOCUS_11500 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048021.1:GTPase ObgE 1191 2306 gene locus_tag LOCUS_11510 1191 2306 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183272.1 protein_id gnl|my_center|LOCUS_11510 2334 2657 gene locus_tag LOCUS_11520 gene rsfS 2334 2657 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880811.1 protein_id gnl|my_center|LOCUS_11520 2627 3067 gene locus_tag LOCUS_11530 gene tsaE 2627 3067 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722335.1 protein_id gnl|my_center|LOCUS_11530 3070 3633 gene locus_tag LOCUS_11540 3070 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence068 606 679 gene locus_tag LOCUS_t00340 606 679 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 683 769 gene locus_tag LOCUS_t00350 683 769 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1254 820 gene locus_tag LOCUS_11550 1254 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2183 1290 gene locus_tag LOCUS_11560 2183 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 3028 2180 gene locus_tag LOCUS_11570 3028 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence069 2357 948 gene locus_tag LOCUS_11580 2357 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 3266 2484 gene locus_tag LOCUS_11590 3266 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence070 <1 990 gene locus_tag LOCUS_11600 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867978.1:Ldh family oxidoreductase 1004 2176 gene locus_tag LOCUS_11610 1004 2176 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_11610 <3942 2266 gene locus_tag LOCUS_11620 <3942 2266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201627021.1:elongation factor G >Feature sequence071 74 2779 gene locus_tag LOCUS_11630 74 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence072 1326 427 gene locus_tag LOCUS_11640 1326 427 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206791.1 protein_id gnl|my_center|LOCUS_11640 2683 1403 gene locus_tag LOCUS_11650 2683 1403 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966819.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence073 1579 2235 gene locus_tag LOCUS_11660 1579 2235 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence074 3312 190 gene locus_tag LOCUS_11670 3312 190 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068838.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence075 546 1886 gene locus_tag LOCUS_11680 546 1886 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_11680 1921 3144 gene locus_tag LOCUS_11690 1921 3144 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence076 <1 1049 gene locus_tag LOCUS_11700 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459729.1:L-fucose/L-arabinose isomerase family protein 1078 3066 gene locus_tag LOCUS_11710 1078 3066 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972911.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence077 71 1420 gene locus_tag LOCUS_11720 71 1420 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_11720 1788 2981 gene locus_tag LOCUS_11730 1788 2981 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence078 <1 924 gene locus_tag LOCUS_11740 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932263.1:SDR family NAD(P)-dependent oxidoreductase 1294 2325 gene locus_tag LOCUS_11750 gene argC 1294 2325 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861435.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence079 <1 693 gene locus_tag LOCUS_11760 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016933.1:formate/nitrite transporter family protein 701 1456 gene locus_tag LOCUS_11770 701 1456 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence080 2219 942 gene locus_tag LOCUS_11780 gene hisD 2219 942 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_11780 2843 2220 gene locus_tag LOCUS_11790 gene hisG 2843 2220 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436683.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence081 414 1493 gene locus_tag LOCUS_11800 414 1493 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_11800 1890 1561 gene locus_tag LOCUS_11810 1890 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2084 1965 gene locus_tag LOCUS_11820 2084 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence082 <1 1155 gene locus_tag LOCUS_11830 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108151.1:metallophosphoesterase family protein 1494 2585 gene locus_tag LOCUS_11840 1494 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence083 1323 241 gene locus_tag LOCUS_11850 1323 241 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678891.1 protein_id gnl|my_center|LOCUS_11850 <2695 1782 gene locus_tag LOCUS_11860 <2695 1782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169800512.1:5'-nucleotidase C-terminal domain-containing protein >Feature sequence084 725 1558 gene locus_tag LOCUS_11870 725 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1720 1848 gene locus_tag LOCUS_11880 1720 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2012 2395 gene locus_tag LOCUS_11890 2012 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence085 1196 750 gene locus_tag LOCUS_11900 1196 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 2071 1199 gene locus_tag LOCUS_11910 2071 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2385 2310 gene locus_tag LOCUS_t00360 2385 2310 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2505 2395 gene locus_tag LOCUS_r00020 2505 2395 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence086 <1 531 gene locus_tag LOCUS_11920 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002389909.1:alpha-mannosidase 1514 612 gene locus_tag LOCUS_11930 1514 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 <2515 1526 gene locus_tag LOCUS_11940 <2515 1526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903779.1:transketolase family protein >Feature sequence087 1034 321 gene locus_tag LOCUS_11950 1034 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1979 1170 gene locus_tag LOCUS_11960 1979 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence088 515 1405 gene locus_tag LOCUS_11970 gene ttdA 515 1405 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 protein_id gnl|my_center|LOCUS_11970 1475 2086 gene locus_tag LOCUS_11980 gene ttdB 1475 2086 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077020.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence089 1283 372 gene locus_tag LOCUS_11990 1283 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 <2352 1292 gene locus_tag LOCUS_12000 <2352 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949155.1:homocysteine S-methyltransferase family protein >Feature sequence090 1004 48 gene locus_tag LOCUS_12010 1004 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2092 1136 gene locus_tag LOCUS_12020 2092 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence091 588 1331 gene locus_tag LOCUS_12030 gene nagB 588 1331 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024210.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence092 <1 1320 gene locus_tag LOCUS_12040 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393767.1:argininosuccinate lyase 1584 1411 gene locus_tag LOCUS_12050 1584 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence093 162 1826 gene locus_tag LOCUS_12060 162 1826 CDS product IS1634-like element ISMac12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023422.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence094 >Feature sequence095 177 1886 gene locus_tag LOCUS_12070 177 1886 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971525.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence096 <1 939 gene locus_tag LOCUS_12080 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583968.1:SIS domain-containing protein >Feature sequence097 >Feature sequence098 89 2 gene locus_tag LOCUS_t00370 89 2 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 879 217 gene locus_tag LOCUS_12090 879 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1962 904 gene locus_tag LOCUS_12100 1962 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence099 >Feature sequence100 22 98 gene locus_tag LOCUS_t00380 22 98 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 615 1277 gene locus_tag LOCUS_12110 615 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence101 >Feature sequence102 >Feature sequence103 232 1419 gene locus_tag LOCUS_12120 232 1419 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_12120 1614 1689 gene locus_tag LOCUS_t00390 1614 1689 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence104 1293 598 gene locus_tag LOCUS_12130 1293 598 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence105 134 1585 gene locus_tag LOCUS_12140 134 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence106 >Feature sequence107 >Feature sequence108 >Feature sequence109