>Feature sequence01 1896 973 gene locus_tag LOCUS_00010 1896 973 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_00010 2495 1944 gene locus_tag LOCUS_00020 gene pyrR 2495 1944 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583925.1 protein_id gnl|my_center|LOCUS_00020 5878 2753 gene locus_tag LOCUS_00030 gene ileS 5878 2753 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454939.1 protein_id gnl|my_center|LOCUS_00030 6345 6261 gene locus_tag LOCUS_t00010 6345 6261 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6653 6480 gene locus_tag LOCUS_00040 6653 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7634 6735 gene locus_tag LOCUS_00050 7634 6735 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232221.1 protein_id gnl|my_center|LOCUS_00050 7777 8820 gene locus_tag LOCUS_00060 7777 8820 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_00060 8958 9845 gene locus_tag LOCUS_00070 8958 9845 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761129.1 protein_id gnl|my_center|LOCUS_00070 10899 9961 gene locus_tag LOCUS_00080 gene arcC 10899 9961 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_00080 12147 10927 gene locus_tag LOCUS_00090 12147 10927 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376558.1 protein_id gnl|my_center|LOCUS_00090 12197 12649 gene locus_tag LOCUS_00100 12197 12649 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971034.1 protein_id gnl|my_center|LOCUS_00100 12794 12708 gene locus_tag LOCUS_t00020 12794 12708 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13320 13862 gene locus_tag LOCUS_00110 13320 13862 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869204.1 protein_id gnl|my_center|LOCUS_00110 17284 13916 gene locus_tag LOCUS_00120 17284 13916 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541505.1 protein_id gnl|my_center|LOCUS_00120 18330 17281 gene locus_tag LOCUS_00130 gene ispG 18330 17281 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629734.1 protein_id gnl|my_center|LOCUS_00130 19454 18423 gene locus_tag LOCUS_00140 gene rseP 19454 18423 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_00140 20601 19459 gene locus_tag LOCUS_00150 gene dxr 20601 19459 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986796.1 protein_id gnl|my_center|LOCUS_00150 21653 20616 gene locus_tag LOCUS_00160 gene ytvI 21653 20616 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392554.1 protein_id gnl|my_center|LOCUS_00160 22453 21671 gene locus_tag LOCUS_00170 22453 21671 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266974.1 protein_id gnl|my_center|LOCUS_00170 23227 22460 gene locus_tag LOCUS_00180 23227 22460 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389465.1 protein_id gnl|my_center|LOCUS_00180 23784 23224 gene locus_tag LOCUS_00190 gene frr 23784 23224 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_00190 24526 23747 gene locus_tag LOCUS_00200 gene pyrH 24526 23747 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_00200 25132 24533 gene locus_tag LOCUS_00210 gene tsf 25132 24533 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_00210 25851 25138 gene locus_tag LOCUS_00220 gene rpsB 25851 25138 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_00220 26284 25967 gene locus_tag LOCUS_00230 26284 25967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27611 26271 gene locus_tag LOCUS_00240 27611 26271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 28420 27635 gene locus_tag LOCUS_00250 gene whiG 28420 27635 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_00250 28781 28398 gene locus_tag LOCUS_00260 28781 28398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30819 28774 gene locus_tag LOCUS_00270 gene flhA 30819 28774 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460749.1 protein_id gnl|my_center|LOCUS_00270 31919 30819 gene locus_tag LOCUS_00280 gene flhB 31919 30819 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193133.1 protein_id gnl|my_center|LOCUS_00280 32683 31916 gene locus_tag LOCUS_00290 gene fliR 32683 31916 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_00290 32968 32702 gene locus_tag LOCUS_00300 gene fliQ 32968 32702 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_00300 34027 33017 gene locus_tag LOCUS_00310 34027 33017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34755 34240 gene locus_tag LOCUS_00320 34755 34240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 35750 34752 gene locus_tag LOCUS_00330 gene fliM 35750 34752 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666990.1 protein_id gnl|my_center|LOCUS_00330 36202 35780 gene locus_tag LOCUS_00340 36202 35780 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793169.1 protein_id gnl|my_center|LOCUS_00340 36974 36228 gene locus_tag LOCUS_00350 36974 36228 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_00350 37764 36949 gene locus_tag LOCUS_00360 37764 36949 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_00360 39015 37783 gene locus_tag LOCUS_00370 gene flgE 39015 37783 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657723.1 protein_id gnl|my_center|LOCUS_00370 39488 39114 gene locus_tag LOCUS_00380 39488 39114 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_00380 39921 39475 gene locus_tag LOCUS_00390 39921 39475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41244 39940 gene locus_tag LOCUS_00400 41244 39940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 41701 41249 gene locus_tag LOCUS_00410 41701 41249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 43068 41749 gene locus_tag LOCUS_00420 gene fliI 43068 41749 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_00420 43790 43065 gene locus_tag LOCUS_00430 43790 43065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44799 43783 gene locus_tag LOCUS_00440 gene fliG 44799 43783 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870078.1 protein_id gnl|my_center|LOCUS_00440 46331 44799 gene locus_tag LOCUS_00450 gene fliF 46331 44799 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870079.1 protein_id gnl|my_center|LOCUS_00450 46655 46362 gene locus_tag LOCUS_00460 gene fliE 46655 46362 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392291.1 protein_id gnl|my_center|LOCUS_00460 47187 46729 gene locus_tag LOCUS_00470 gene flgC 47187 46729 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986962.1 protein_id gnl|my_center|LOCUS_00470 47568 47191 gene locus_tag LOCUS_00480 gene flgB 47568 47191 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_00480 48613 47837 gene locus_tag LOCUS_00490 gene codY 48613 47837 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810676.1 protein_id gnl|my_center|LOCUS_00490 50041 48638 gene locus_tag LOCUS_00500 gene hslU 50041 48638 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392544.1 protein_id gnl|my_center|LOCUS_00500 50633 50076 gene locus_tag LOCUS_00510 gene hslV 50633 50076 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_00510 51642 50623 gene locus_tag LOCUS_00520 gene xerC 51642 50623 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_00520 53804 51726 gene locus_tag LOCUS_00530 gene topA 53804 51726 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_00530 54733 53801 gene locus_tag LOCUS_00540 gene dprA 54733 53801 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_00540 55034 56698 gene locus_tag LOCUS_00550 55034 56698 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_00550 56698 57954 gene locus_tag LOCUS_00560 56698 57954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 57990 59216 gene locus_tag LOCUS_00570 57990 59216 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890704.1 protein_id gnl|my_center|LOCUS_00570 59306 59989 gene locus_tag LOCUS_00580 59306 59989 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836976.1 protein_id gnl|my_center|LOCUS_00580 59994 60764 gene locus_tag LOCUS_00590 59994 60764 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_00590 60895 62127 gene locus_tag LOCUS_00600 60895 62127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 62521 62135 gene locus_tag LOCUS_00610 62521 62135 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_00610 64038 62518 gene locus_tag LOCUS_00620 64038 62518 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_00620 65172 64162 gene locus_tag LOCUS_00630 gene trpS 65172 64162 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245134.1 protein_id gnl|my_center|LOCUS_00630 66346 65660 gene locus_tag LOCUS_00640 66346 65660 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_00640 67408 66398 gene locus_tag LOCUS_00650 67408 66398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 67954 67424 gene locus_tag LOCUS_00660 67954 67424 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_00660 68750 68049 gene locus_tag LOCUS_00670 gene sigK 68750 68049 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_00670 70239 68845 gene locus_tag LOCUS_00680 70239 68845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 71986 70304 gene locus_tag LOCUS_00690 71986 70304 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_00690 72994 72116 gene locus_tag LOCUS_00700 gene galU 72994 72116 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_00700 73122 74270 gene locus_tag LOCUS_00710 73122 74270 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_00710 75746 74271 gene locus_tag LOCUS_00720 gene glgA 75746 74271 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_00720 76805 75753 gene locus_tag LOCUS_00730 gene galT 76805 75753 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_00730 77948 76878 gene locus_tag LOCUS_00740 77948 76878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 78150 77968 gene locus_tag LOCUS_00750 78150 77968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 79609 78224 gene locus_tag LOCUS_00760 gene ypeB 79609 78224 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391745.1 protein_id gnl|my_center|LOCUS_00760 80112 79630 gene locus_tag LOCUS_00770 80112 79630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 81198 80194 gene locus_tag LOCUS_00780 gene mltG 81198 80194 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_00780 82065 81238 gene locus_tag LOCUS_00790 82065 81238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 83031 82081 gene locus_tag LOCUS_00800 83031 82081 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393143.1 protein_id gnl|my_center|LOCUS_00800 84186 83089 gene locus_tag LOCUS_00810 gene fbp 84186 83089 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393749.1 protein_id gnl|my_center|LOCUS_00810 84985 84299 gene locus_tag LOCUS_00820 84985 84299 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_00820 85469 85209 gene locus_tag LOCUS_00830 85469 85209 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_00830 88223 85539 gene locus_tag LOCUS_00840 gene alaS 88223 85539 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_00840 89980 88238 gene locus_tag LOCUS_00850 89980 88238 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_00850 90979 90164 gene locus_tag LOCUS_00860 90979 90164 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 protein_id gnl|my_center|LOCUS_00860 91716 91036 gene locus_tag LOCUS_00870 91716 91036 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887998.1 protein_id gnl|my_center|LOCUS_00870 92438 91710 gene locus_tag LOCUS_00880 92438 91710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 93716 92760 gene locus_tag LOCUS_00890 93716 92760 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106004889.1 protein_id gnl|my_center|LOCUS_00890 93802 94986 gene locus_tag LOCUS_00900 gene dinB 93802 94986 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_00900 96274 95096 gene locus_tag LOCUS_00910 96274 95096 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460999.1 protein_id gnl|my_center|LOCUS_00910 97063 96290 gene locus_tag LOCUS_00920 97063 96290 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_00920 98142 97129 gene locus_tag LOCUS_00930 gene gctA 98142 97129 CDS product glutaconate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902658.1 protein_id gnl|my_center|LOCUS_00930 99746 98319 gene locus_tag LOCUS_00940 gene gnfM 99746 98319 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_00940 101458 99764 gene locus_tag LOCUS_00950 101458 99764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 101598 102179 gene locus_tag LOCUS_00960 101598 102179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 102734 102198 gene locus_tag LOCUS_00970 102734 102198 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065298.1 protein_id gnl|my_center|LOCUS_00970 102979 105321 gene locus_tag LOCUS_00980 102979 105321 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272342.1 protein_id gnl|my_center|LOCUS_00980 106672 105356 gene locus_tag LOCUS_00990 106672 105356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 107139 106732 gene locus_tag LOCUS_01000 107139 106732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 108109 107282 gene locus_tag LOCUS_01010 108109 107282 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_01010 109748 108150 gene locus_tag LOCUS_01020 109748 108150 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925110.1 protein_id gnl|my_center|LOCUS_01020 111146 109875 gene locus_tag LOCUS_01030 111146 109875 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_01030 112934 111174 gene locus_tag LOCUS_01040 112934 111174 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_01040 113413 114393 gene locus_tag LOCUS_01050 113413 114393 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986740.1 protein_id gnl|my_center|LOCUS_01050 114421 115722 gene locus_tag LOCUS_01060 114421 115722 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392338.1 protein_id gnl|my_center|LOCUS_01060 118389 115762 gene locus_tag LOCUS_01070 118389 115762 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232087.1 protein_id gnl|my_center|LOCUS_01070 120787 118955 gene locus_tag LOCUS_01080 120787 118955 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086363.1 protein_id gnl|my_center|LOCUS_01080 121315 121004 gene locus_tag LOCUS_01090 121315 121004 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393689.1 protein_id gnl|my_center|LOCUS_01090 121487 123646 gene locus_tag LOCUS_01100 121487 123646 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_01100 124914 123724 gene locus_tag LOCUS_01110 124914 123724 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225108.1 protein_id gnl|my_center|LOCUS_01110 125162 127384 gene locus_tag LOCUS_01120 gene tlpB 125162 127384 CDS product methyl-accepting chemotaxis protein TlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243983.1 protein_id gnl|my_center|LOCUS_01120 129361 127448 gene locus_tag LOCUS_01130 129361 127448 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_01130 130352 129549 gene locus_tag LOCUS_01140 130352 129549 CDS product DUF2935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554487.1 protein_id gnl|my_center|LOCUS_01140 130680 131078 gene locus_tag LOCUS_01150 130680 131078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 >Feature sequence02 286 1029 gene locus_tag LOCUS_01160 286 1029 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868662.1 protein_id gnl|my_center|LOCUS_01160 1032 2402 gene locus_tag LOCUS_01170 gene celF 1032 2402 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145749.1 protein_id gnl|my_center|LOCUS_01170 2512 3522 gene locus_tag LOCUS_01180 2512 3522 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584023.1 protein_id gnl|my_center|LOCUS_01180 4272 3568 gene locus_tag LOCUS_01190 gene grpE 4272 3568 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_01190 6206 4278 gene locus_tag LOCUS_01200 gene dnaK 6206 4278 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_01200 6643 6272 gene locus_tag LOCUS_01210 6643 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 8085 7129 gene locus_tag LOCUS_01220 gene meaB 8085 7129 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_01220 8555 8151 gene locus_tag LOCUS_01230 8555 8151 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_01230 9776 8640 gene locus_tag LOCUS_01240 9776 8640 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_01240 10214 9813 gene locus_tag LOCUS_01250 10214 9813 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869046.1 protein_id gnl|my_center|LOCUS_01250 10631 10260 gene locus_tag LOCUS_01260 10631 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 12235 10670 gene locus_tag LOCUS_01270 12235 10670 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_01270 13098 12469 gene locus_tag LOCUS_01280 13098 12469 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173693.1 protein_id gnl|my_center|LOCUS_01280 13707 13189 gene locus_tag LOCUS_01290 13707 13189 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289378.1 protein_id gnl|my_center|LOCUS_01290 14999 13704 gene locus_tag LOCUS_01300 14999 13704 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162927915.1 protein_id gnl|my_center|LOCUS_01300 16545 14935 gene locus_tag LOCUS_01310 16545 14935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 17406 16654 gene locus_tag LOCUS_01320 gene lgt 17406 16654 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_01320 17504 17911 gene locus_tag LOCUS_01330 17504 17911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 18673 17939 gene locus_tag LOCUS_01340 18673 17939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812523.1 protein_id gnl|my_center|LOCUS_01340 21480 18754 gene locus_tag LOCUS_01350 21480 18754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 22153 21473 gene locus_tag LOCUS_01360 22153 21473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 23857 22304 gene locus_tag LOCUS_01370 23857 22304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 24922 23885 gene locus_tag LOCUS_01380 24922 23885 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_01380 25131 25415 gene locus_tag LOCUS_01390 25131 25415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 25428 25643 gene locus_tag LOCUS_01400 25428 25643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 25744 26094 gene locus_tag LOCUS_01410 25744 26094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 26033 27091 gene locus_tag LOCUS_01420 26033 27091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 27189 27980 gene locus_tag LOCUS_01430 27189 27980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 28773 27991 gene locus_tag LOCUS_01440 28773 27991 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_01440 30723 29461 gene locus_tag LOCUS_01450 30723 29461 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_01450 31058 31600 gene locus_tag LOCUS_01460 31058 31600 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048323.1 protein_id gnl|my_center|LOCUS_01460 32188 31946 gene locus_tag LOCUS_01470 32188 31946 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_01470 32425 32622 gene locus_tag LOCUS_01480 32425 32622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 32626 33090 gene locus_tag LOCUS_01490 32626 33090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 33195 33683 gene locus_tag LOCUS_01500 33195 33683 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899658.1 protein_id gnl|my_center|LOCUS_01500 34617 33772 gene locus_tag LOCUS_01510 34617 33772 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 protein_id gnl|my_center|LOCUS_01510 35769 34723 gene locus_tag LOCUS_01520 35769 34723 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393149.1 protein_id gnl|my_center|LOCUS_01520 35941 35738 gene locus_tag LOCUS_01530 35941 35738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 36255 36025 gene locus_tag LOCUS_01540 36255 36025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 37922 36438 gene locus_tag LOCUS_01550 37922 36438 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_01550 38956 37919 gene locus_tag LOCUS_01560 gene ltaE 38956 37919 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_01560 39399 39028 gene locus_tag LOCUS_01570 39399 39028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 40067 39453 gene locus_tag LOCUS_01580 gene coaE 40067 39453 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_01580 42795 40093 gene locus_tag LOCUS_01590 gene polA 42795 40093 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_01590 44241 42982 gene locus_tag LOCUS_01600 44241 42982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 44855 44238 gene locus_tag LOCUS_01610 44855 44238 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_01610 46786 44921 gene locus_tag LOCUS_01620 gene aspS 46786 44921 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_01620 48053 46773 gene locus_tag LOCUS_01630 gene hisS 48053 46773 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_01630 48757 48101 gene locus_tag LOCUS_01640 48757 48101 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_01640 49251 48802 gene locus_tag LOCUS_01650 gene dtd 49251 48802 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_01650 51420 49255 gene locus_tag LOCUS_01660 51420 49255 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_01660 52121 51579 gene locus_tag LOCUS_01670 52121 51579 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_01670 54711 52135 gene locus_tag LOCUS_01680 gene recJ 54711 52135 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246110.1 protein_id gnl|my_center|LOCUS_01680 55157 54792 gene locus_tag LOCUS_01690 55157 54792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 55883 55209 gene locus_tag LOCUS_01700 55883 55209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 57996 55864 gene locus_tag LOCUS_01710 57996 55864 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 protein_id gnl|my_center|LOCUS_01710 59596 58031 gene locus_tag LOCUS_01720 gene murJ 59596 58031 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391760.1 protein_id gnl|my_center|LOCUS_01720 59816 60991 gene locus_tag LOCUS_01730 59816 60991 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269378.1 protein_id gnl|my_center|LOCUS_01730 61012 61290 gene locus_tag LOCUS_01740 61012 61290 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_01740 61308 63332 gene locus_tag LOCUS_01750 61308 63332 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956923.1 protein_id gnl|my_center|LOCUS_01750 63674 65464 gene locus_tag LOCUS_01760 63674 65464 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967136.1 protein_id gnl|my_center|LOCUS_01760 65541 67328 gene locus_tag LOCUS_01770 65541 67328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 protein_id gnl|my_center|LOCUS_01770 68473 67364 gene locus_tag LOCUS_01780 68473 67364 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_01780 69975 68494 gene locus_tag LOCUS_01790 69975 68494 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015158974.1 protein_id gnl|my_center|LOCUS_01790 70484 69972 gene locus_tag LOCUS_01800 70484 69972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 71359 70685 gene locus_tag LOCUS_01810 71359 70685 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810750.1 protein_id gnl|my_center|LOCUS_01810 71892 71356 gene locus_tag LOCUS_01820 71892 71356 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250688.1 protein_id gnl|my_center|LOCUS_01820 74798 71976 gene locus_tag LOCUS_01830 74798 71976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 75675 74881 gene locus_tag LOCUS_01840 75675 74881 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_01840 76296 75736 gene locus_tag LOCUS_01850 76296 75736 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_01850 77617 76397 gene locus_tag LOCUS_01860 77617 76397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 78622 77696 gene locus_tag LOCUS_01870 78622 77696 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_01870 79734 78775 gene locus_tag LOCUS_01880 79734 78775 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_01880 80514 79744 gene locus_tag LOCUS_01890 80514 79744 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812980.1 protein_id gnl|my_center|LOCUS_01890 80722 81858 gene locus_tag LOCUS_01900 80722 81858 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_01900 82560 82012 gene locus_tag LOCUS_01910 82560 82012 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986929.1 protein_id gnl|my_center|LOCUS_01910 83263 82802 gene locus_tag LOCUS_01920 83263 82802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 84081 83563 gene locus_tag LOCUS_01930 84081 83563 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294232.1 protein_id gnl|my_center|LOCUS_01930 86251 84440 gene locus_tag LOCUS_01940 86251 84440 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_01940 87895 86264 gene locus_tag LOCUS_01950 87895 86264 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088555170.1 protein_id gnl|my_center|LOCUS_01950 >Feature sequence03 84 10 gene locus_tag LOCUS_t00030 84 10 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 167 92 gene locus_tag LOCUS_t00040 167 92 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 274 197 gene locus_tag LOCUS_t00050 274 197 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 359 285 gene locus_tag LOCUS_t00060 359 285 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 550 1071 gene locus_tag LOCUS_01960 550 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 1195 2973 gene locus_tag LOCUS_01970 1195 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 3189 2938 gene locus_tag LOCUS_01980 3189 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 3443 3820 gene locus_tag LOCUS_01990 3443 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 4921 4121 gene locus_tag LOCUS_02000 4921 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 6761 5169 gene locus_tag LOCUS_02010 6761 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 6916 7722 gene locus_tag LOCUS_02020 6916 7722 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458913.1 protein_id gnl|my_center|LOCUS_02020 7921 7697 gene locus_tag LOCUS_02030 7921 7697 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_02030 9672 7975 gene locus_tag LOCUS_02040 9672 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 9851 9684 gene locus_tag LOCUS_02050 9851 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 10075 9848 gene locus_tag LOCUS_02060 10075 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 10515 10075 gene locus_tag LOCUS_02070 10515 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 11357 10512 gene locus_tag LOCUS_02080 11357 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 12447 11422 gene locus_tag LOCUS_02090 12447 11422 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_02090 12655 13212 gene locus_tag LOCUS_02100 gene rsmD 12655 13212 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460510.1 protein_id gnl|my_center|LOCUS_02100 16421 13287 gene locus_tag LOCUS_02110 16421 13287 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_02110 16664 16425 gene locus_tag LOCUS_02120 16664 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 18093 16735 gene locus_tag LOCUS_02130 18093 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 19349 18090 gene locus_tag LOCUS_02140 19349 18090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 20090 19446 gene locus_tag LOCUS_02150 20090 19446 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_02150 21868 20255 gene locus_tag LOCUS_02160 21868 20255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 22640 21861 gene locus_tag LOCUS_02170 22640 21861 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_02170 23730 22618 gene locus_tag LOCUS_02180 23730 22618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 23893 24705 gene locus_tag LOCUS_02190 23893 24705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 24738 25400 gene locus_tag LOCUS_02200 24738 25400 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_02200 25562 26617 gene locus_tag LOCUS_02210 25562 26617 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393376.1 protein_id gnl|my_center|LOCUS_02210 27327 26701 gene locus_tag LOCUS_02220 27327 26701 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108450.1 protein_id gnl|my_center|LOCUS_02220 28285 27395 gene locus_tag LOCUS_02230 gene ftcD 28285 27395 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_02230 29934 28414 gene locus_tag LOCUS_02240 gene hutH 29934 28414 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922740.1 protein_id gnl|my_center|LOCUS_02240 31622 29970 gene locus_tag LOCUS_02250 gene hutU 31622 29970 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 protein_id gnl|my_center|LOCUS_02250 32995 31958 gene locus_tag LOCUS_02260 32995 31958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 33257 34408 gene locus_tag LOCUS_02270 33257 34408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 34500 36773 gene locus_tag LOCUS_02280 34500 36773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 37082 38308 gene locus_tag LOCUS_02290 37082 38308 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_02290 39682 38489 gene locus_tag LOCUS_02300 gene megL 39682 38489 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_02300 40771 39827 gene locus_tag LOCUS_02310 gene rihA 40771 39827 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207423.1 protein_id gnl|my_center|LOCUS_02310 41687 40764 gene locus_tag LOCUS_02320 41687 40764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537587.1 protein_id gnl|my_center|LOCUS_02320 42729 41671 gene locus_tag LOCUS_02330 42729 41671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383862.1 protein_id gnl|my_center|LOCUS_02330 44318 42726 gene locus_tag LOCUS_02340 44318 42726 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383861.1 protein_id gnl|my_center|LOCUS_02340 45509 44388 gene locus_tag LOCUS_02350 45509 44388 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_02350 46456 45536 gene locus_tag LOCUS_02360 46456 45536 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_02360 47527 46610 gene locus_tag LOCUS_02370 47527 46610 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231023.1 protein_id gnl|my_center|LOCUS_02370 47694 48164 gene locus_tag LOCUS_02380 47694 48164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 49313 48681 gene locus_tag LOCUS_02390 49313 48681 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810935.1 protein_id gnl|my_center|LOCUS_02390 50204 49350 gene locus_tag LOCUS_02400 50204 49350 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460266.1 protein_id gnl|my_center|LOCUS_02400 50920 50483 gene locus_tag LOCUS_02410 50920 50483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 51235 51026 gene locus_tag LOCUS_02420 51235 51026 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545791.1 protein_id gnl|my_center|LOCUS_02420 51568 51290 gene locus_tag LOCUS_02430 51568 51290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 51695 52240 gene locus_tag LOCUS_02440 51695 52240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 53387 52215 gene locus_tag LOCUS_02450 53387 52215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 53884 53459 gene locus_tag LOCUS_02460 53884 53459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 56408 53919 gene locus_tag LOCUS_02470 56408 53919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 56618 57907 gene locus_tag LOCUS_02480 56618 57907 CDS product TIGR00529 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867137.1 protein_id gnl|my_center|LOCUS_02480 58731 57943 gene locus_tag LOCUS_02490 58731 57943 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_02490 59335 58826 gene locus_tag LOCUS_02500 gene ndk 59335 58826 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_02500 59893 59522 gene locus_tag LOCUS_02510 gene speD 59893 59522 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392796.1 protein_id gnl|my_center|LOCUS_02510 60140 61591 gene locus_tag LOCUS_02520 60140 61591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 61584 62294 gene locus_tag LOCUS_02530 61584 62294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_02530 62278 63468 gene locus_tag LOCUS_02540 62278 63468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 63484 65298 gene locus_tag LOCUS_02550 63484 65298 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_02550 65300 66676 gene locus_tag LOCUS_02560 65300 66676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 67502 66687 gene locus_tag LOCUS_02570 67502 66687 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462308.1 protein_id gnl|my_center|LOCUS_02570 68681 67650 gene locus_tag LOCUS_02580 gene ychF 68681 67650 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393954.1 protein_id gnl|my_center|LOCUS_02580 70684 68894 gene locus_tag LOCUS_02590 70684 68894 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_02590 72516 70666 gene locus_tag LOCUS_02600 72516 70666 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_02600 73863 72778 gene locus_tag LOCUS_02610 73863 72778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 75170 73860 gene locus_tag LOCUS_02620 75170 73860 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_02620 75982 75362 gene locus_tag LOCUS_02630 75982 75362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256161.1 protein_id gnl|my_center|LOCUS_02630 76850 76026 gene locus_tag LOCUS_02640 76850 76026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 77507 76872 gene locus_tag LOCUS_02650 77507 76872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 78346 77573 gene locus_tag LOCUS_02660 78346 77573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256164.1 protein_id gnl|my_center|LOCUS_02660 79003 80688 gene locus_tag LOCUS_02670 79003 80688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 80675 81916 gene locus_tag LOCUS_02680 80675 81916 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_02680 83667 82078 gene locus_tag LOCUS_02690 83667 82078 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_02690 84132 83704 gene locus_tag LOCUS_02700 84132 83704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 >Feature sequence04 3 1295 gene locus_tag LOCUS_02710 3 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 1285 3177 gene locus_tag LOCUS_02720 gene uvrC 1285 3177 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_02720 3207 3665 gene locus_tag LOCUS_02730 3207 3665 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956716.1 protein_id gnl|my_center|LOCUS_02730 3734 4789 gene locus_tag LOCUS_02740 3734 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 4804 5187 gene locus_tag LOCUS_02750 4804 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 6097 5222 gene locus_tag LOCUS_02760 gene whiA 6097 5222 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438915.1 protein_id gnl|my_center|LOCUS_02760 7097 6120 gene locus_tag LOCUS_02770 7097 6120 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583492.1 protein_id gnl|my_center|LOCUS_02770 7984 7094 gene locus_tag LOCUS_02780 gene rapZ 7984 7094 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_02780 8822 8022 gene locus_tag LOCUS_02790 8822 8022 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392045.1 protein_id gnl|my_center|LOCUS_02790 9449 8841 gene locus_tag LOCUS_02800 9449 8841 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393991.1 protein_id gnl|my_center|LOCUS_02800 9678 10490 gene locus_tag LOCUS_02810 gene cdaA 9678 10490 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_02810 10487 11701 gene locus_tag LOCUS_02820 10487 11701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 11781 13142 gene locus_tag LOCUS_02830 gene glmM 11781 13142 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048332.1 protein_id gnl|my_center|LOCUS_02830 14581 13139 gene locus_tag LOCUS_02840 14581 13139 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_02840 14727 15164 gene locus_tag LOCUS_02850 14727 15164 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_02850 15243 16913 gene locus_tag LOCUS_02860 15243 16913 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105241.1 protein_id gnl|my_center|LOCUS_02860 16964 17287 gene locus_tag LOCUS_02870 16964 17287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 17288 17638 gene locus_tag LOCUS_02880 17288 17638 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_02880 17684 18391 gene locus_tag LOCUS_02890 17684 18391 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461522.1 protein_id gnl|my_center|LOCUS_02890 18564 19514 gene locus_tag LOCUS_02900 18564 19514 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_02900 19602 20264 gene locus_tag LOCUS_02910 19602 20264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 20361 22256 gene locus_tag LOCUS_02920 20361 22256 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_02920 22225 23583 gene locus_tag LOCUS_02930 22225 23583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 23710 24105 gene locus_tag LOCUS_02940 23710 24105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 24201 26057 gene locus_tag LOCUS_02950 24201 26057 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_02950 26075 27196 gene locus_tag LOCUS_02960 26075 27196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 27402 28346 gene locus_tag LOCUS_02970 27402 28346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 28336 29034 gene locus_tag LOCUS_02980 28336 29034 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393648.1 protein_id gnl|my_center|LOCUS_02980 29049 29573 gene locus_tag LOCUS_02990 29049 29573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 29536 30339 gene locus_tag LOCUS_03000 29536 30339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 30332 30832 gene locus_tag LOCUS_03010 gene rimI 30332 30832 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_03010 31844 30930 gene locus_tag LOCUS_03020 gene pyrF 31844 30930 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_03020 32042 33073 gene locus_tag LOCUS_03030 gene tsaD 32042 33073 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016472.1 protein_id gnl|my_center|LOCUS_03030 33073 34410 gene locus_tag LOCUS_03040 33073 34410 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392749.1 protein_id gnl|my_center|LOCUS_03040 34481 35542 gene locus_tag LOCUS_03050 34481 35542 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_03050 35533 36552 gene locus_tag LOCUS_03060 35533 36552 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_03060 36549 37544 gene locus_tag LOCUS_03070 36549 37544 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_03070 39839 37689 gene locus_tag LOCUS_03080 39839 37689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 40017 40205 gene locus_tag LOCUS_03090 40017 40205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 40621 40172 gene locus_tag LOCUS_03100 gene nifU 40621 40172 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_03100 41832 40642 gene locus_tag LOCUS_03110 gene nifS 41832 40642 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_03110 42232 41825 gene locus_tag LOCUS_03120 42232 41825 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_03120 42469 43926 gene locus_tag LOCUS_03130 42469 43926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 43902 44762 gene locus_tag LOCUS_03140 43902 44762 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392700.1 protein_id gnl|my_center|LOCUS_03140 44821 46200 gene locus_tag LOCUS_03150 gene rpoN 44821 46200 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391805.1 protein_id gnl|my_center|LOCUS_03150 46386 47732 gene locus_tag LOCUS_03160 gene rsxC 46386 47732 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_03160 47761 48735 gene locus_tag LOCUS_03170 47761 48735 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_03170 48742 49374 gene locus_tag LOCUS_03180 48742 49374 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_03180 49417 50004 gene locus_tag LOCUS_03190 gene rsxA 49417 50004 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_03190 50018 50842 gene locus_tag LOCUS_03200 50018 50842 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_03200 50912 51955 gene locus_tag LOCUS_03210 50912 51955 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_03210 52016 52261 gene locus_tag LOCUS_03220 52016 52261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 52267 52857 gene locus_tag LOCUS_03230 52267 52857 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_03230 53001 53654 gene locus_tag LOCUS_03240 gene radC 53001 53654 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392073.1 protein_id gnl|my_center|LOCUS_03240 53693 54718 gene locus_tag LOCUS_03250 53693 54718 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_03250 54739 55551 gene locus_tag LOCUS_03260 gene mreC 54739 55551 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_03260 55644 56096 gene locus_tag LOCUS_03270 55644 56096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 56122 57936 gene locus_tag LOCUS_03280 gene mrdA 56122 57936 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_03280 57972 58694 gene locus_tag LOCUS_03290 gene minC 57972 58694 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816782.1 protein_id gnl|my_center|LOCUS_03290 58691 59488 gene locus_tag LOCUS_03300 gene minD 58691 59488 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_03300 59501 59761 gene locus_tag LOCUS_03310 gene minE 59501 59761 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816777.1 protein_id gnl|my_center|LOCUS_03310 59916 60896 gene locus_tag LOCUS_03320 gene rodA 59916 60896 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_03320 60917 61339 gene locus_tag LOCUS_03330 60917 61339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 62914 61328 gene locus_tag LOCUS_03340 62914 61328 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393417.1 protein_id gnl|my_center|LOCUS_03340 64617 62911 gene locus_tag LOCUS_03350 64617 62911 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_03350 64794 66755 gene locus_tag LOCUS_03360 gene pcrA 64794 66755 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_03360 66776 68827 gene locus_tag LOCUS_03370 gene ligA 66776 68827 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_03370 68817 69101 gene locus_tag LOCUS_03380 gene gatC 68817 69101 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719430.1 protein_id gnl|my_center|LOCUS_03380 69121 70632 gene locus_tag LOCUS_03390 gene gatA 69121 70632 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_03390 70625 72067 gene locus_tag LOCUS_03400 gene gatB 70625 72067 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_03400 72105 73070 gene locus_tag LOCUS_03410 gene murB 72105 73070 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_03410 74939 73224 gene locus_tag LOCUS_03420 74939 73224 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_03420 >Feature sequence05 50 1171 gene locus_tag LOCUS_03430 50 1171 CDS product NAD/NADP octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891455.1 protein_id gnl|my_center|LOCUS_03430 1168 2931 gene locus_tag LOCUS_03440 1168 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3978 3124 gene locus_tag LOCUS_03450 3978 3124 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_03450 5165 4617 gene locus_tag LOCUS_03460 5165 4617 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_03460 5464 6843 gene locus_tag LOCUS_03470 5464 6843 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668604.1 protein_id gnl|my_center|LOCUS_03470 6845 8140 gene locus_tag LOCUS_03480 6845 8140 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678796.1 protein_id gnl|my_center|LOCUS_03480 8334 9116 gene locus_tag LOCUS_03490 gene dapB 8334 9116 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_03490 10522 9242 gene locus_tag LOCUS_03500 10522 9242 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140609.1 protein_id gnl|my_center|LOCUS_03500 11904 10522 gene locus_tag LOCUS_03510 11904 10522 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141444.1 protein_id gnl|my_center|LOCUS_03510 12088 14487 gene locus_tag LOCUS_03520 12088 14487 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_03520 14628 15386 gene locus_tag LOCUS_03530 14628 15386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 16472 15486 gene locus_tag LOCUS_03540 16472 15486 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_03540 19703 16554 gene locus_tag LOCUS_03550 19703 16554 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393289.1 protein_id gnl|my_center|LOCUS_03550 20845 19700 gene locus_tag LOCUS_03560 20845 19700 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221317.1 protein_id gnl|my_center|LOCUS_03560 21091 22878 gene locus_tag LOCUS_03570 gene pepF 21091 22878 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655834.1 protein_id gnl|my_center|LOCUS_03570 22959 24719 gene locus_tag LOCUS_03580 22959 24719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 24977 24783 gene locus_tag LOCUS_03590 24977 24783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 26026 25361 gene locus_tag LOCUS_03600 26026 25361 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390012.1 protein_id gnl|my_center|LOCUS_03600 26771 26100 gene locus_tag LOCUS_03610 26771 26100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 27728 26886 gene locus_tag LOCUS_03620 gene thiM 27728 26886 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_03620 28605 27793 gene locus_tag LOCUS_03630 gene thiD 28605 27793 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948480.1 protein_id gnl|my_center|LOCUS_03630 29762 30004 gene locus_tag LOCUS_03640 29762 30004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 30182 30505 gene locus_tag LOCUS_03650 30182 30505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 32028 30739 gene locus_tag LOCUS_03660 32028 30739 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 protein_id gnl|my_center|LOCUS_03660 33449 32025 gene locus_tag LOCUS_03670 33449 32025 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929201.1 protein_id gnl|my_center|LOCUS_03670 34145 37537 gene locus_tag LOCUS_03680 34145 37537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 39198 37729 gene locus_tag LOCUS_03690 39198 37729 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_03690 40726 39281 gene locus_tag LOCUS_03700 40726 39281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 42322 40940 gene locus_tag LOCUS_03710 42322 40940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 42664 42401 gene locus_tag LOCUS_03720 42664 42401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 43500 42709 gene locus_tag LOCUS_03730 43500 42709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_03730 44960 44244 gene locus_tag LOCUS_03740 44960 44244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944002.1 protein_id gnl|my_center|LOCUS_03740 45720 44947 gene locus_tag LOCUS_03750 45720 44947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_03750 46759 45707 gene locus_tag LOCUS_03760 46759 45707 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583299.1 protein_id gnl|my_center|LOCUS_03760 47629 46760 gene locus_tag LOCUS_03770 47629 46760 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_03770 49049 47832 gene locus_tag LOCUS_03780 49049 47832 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_03780 50543 49842 gene locus_tag LOCUS_03790 50543 49842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 51369 50626 gene locus_tag LOCUS_03800 51369 50626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 52108 51539 gene locus_tag LOCUS_03810 52108 51539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 52794 52201 gene locus_tag LOCUS_03820 52794 52201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 54315 52882 gene locus_tag LOCUS_03830 54315 52882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 55307 54366 gene locus_tag LOCUS_03840 55307 54366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 55426 55253 gene locus_tag LOCUS_03850 55426 55253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 55893 56144 gene locus_tag LOCUS_03860 55893 56144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 56302 56051 gene locus_tag LOCUS_03870 56302 56051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 57104 56640 gene locus_tag LOCUS_03880 57104 56640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 58358 57183 gene locus_tag LOCUS_03890 58358 57183 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296167.1 protein_id gnl|my_center|LOCUS_03890 59508 58345 gene locus_tag LOCUS_03900 59508 58345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681919.1 protein_id gnl|my_center|LOCUS_03900 60455 59523 gene locus_tag LOCUS_03910 60455 59523 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389792.1 protein_id gnl|my_center|LOCUS_03910 61338 60559 gene locus_tag LOCUS_03920 61338 60559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 62951 61878 gene locus_tag LOCUS_03930 62951 61878 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229495.1 protein_id gnl|my_center|LOCUS_03930 64157 63168 gene locus_tag LOCUS_03940 gene dcyD 64157 63168 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128192.1 protein_id gnl|my_center|LOCUS_03940 65660 64755 gene locus_tag LOCUS_03950 65660 64755 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393059.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence06 460 597 gene locus_tag LOCUS_03960 460 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 853 1887 gene locus_tag LOCUS_03970 gene pheS 853 1887 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_03970 1918 4368 gene locus_tag LOCUS_03980 gene pheT 1918 4368 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_03980 4372 6111 gene locus_tag LOCUS_03990 gene polX 4372 6111 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_03990 6238 7191 gene locus_tag LOCUS_04000 6238 7191 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768278.1 protein_id gnl|my_center|LOCUS_04000 7203 8330 gene locus_tag LOCUS_04010 7203 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 8362 8979 gene locus_tag LOCUS_04020 8362 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 9005 9589 gene locus_tag LOCUS_04030 9005 9589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 9570 11933 gene locus_tag LOCUS_04040 9570 11933 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_04040 14130 11944 gene locus_tag LOCUS_04050 14130 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 14340 15572 gene locus_tag LOCUS_04060 gene tyrS 14340 15572 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_04060 15638 16312 gene locus_tag LOCUS_04070 gene yunB 15638 16312 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021806.1 protein_id gnl|my_center|LOCUS_04070 16355 17137 gene locus_tag LOCUS_04080 gene nadE 16355 17137 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869673.1 protein_id gnl|my_center|LOCUS_04080 17141 17887 gene locus_tag LOCUS_04090 17141 17887 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_04090 17957 18496 gene locus_tag LOCUS_04100 17957 18496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 18529 19065 gene locus_tag LOCUS_04110 gene ruvC 18529 19065 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_04110 19049 19636 gene locus_tag LOCUS_04120 gene ruvA 19049 19636 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707372.1 protein_id gnl|my_center|LOCUS_04120 19623 20657 gene locus_tag LOCUS_04130 gene ruvB 19623 20657 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_04130 20732 21184 gene locus_tag LOCUS_04140 20732 21184 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_04140 21168 21392 gene locus_tag LOCUS_04150 21168 21392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 21371 22768 gene locus_tag LOCUS_04160 21371 22768 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393198.1 protein_id gnl|my_center|LOCUS_04160 22770 23783 gene locus_tag LOCUS_04170 gene queA 22770 23783 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_04170 23805 24911 gene locus_tag LOCUS_04180 gene tgt 23805 24911 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944694.1 protein_id gnl|my_center|LOCUS_04180 25003 25296 gene locus_tag LOCUS_04190 gene yajC 25003 25296 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393195.1 protein_id gnl|my_center|LOCUS_04190 25505 26530 gene locus_tag LOCUS_04200 25505 26530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 26496 26705 gene locus_tag LOCUS_04210 26496 26705 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869714.1 protein_id gnl|my_center|LOCUS_04210 26698 27846 gene locus_tag LOCUS_04220 26698 27846 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 protein_id gnl|my_center|LOCUS_04220 27848 28672 gene locus_tag LOCUS_04230 gene korB 27848 28672 CDS product 2-oxoglutarate synthase subunit KorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876665.1 protein_id gnl|my_center|LOCUS_04230 28672 29214 gene locus_tag LOCUS_04240 28672 29214 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_04240 29266 30921 gene locus_tag LOCUS_04250 29266 30921 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_04250 30956 31369 gene locus_tag LOCUS_04260 gene mce 30956 31369 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879707.1 protein_id gnl|my_center|LOCUS_04260 31674 31880 gene locus_tag LOCUS_04270 31674 31880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 32054 32491 gene locus_tag LOCUS_04280 gene mraZ 32054 32491 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_04280 32491 33423 gene locus_tag LOCUS_04290 gene rsmH 32491 33423 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881225.1 protein_id gnl|my_center|LOCUS_04290 33420 33854 gene locus_tag LOCUS_04300 33420 33854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 33880 35979 gene locus_tag LOCUS_04310 33880 35979 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_04310 36062 37510 gene locus_tag LOCUS_04320 36062 37510 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_04320 37479 38933 gene locus_tag LOCUS_04330 37479 38933 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256654.1 protein_id gnl|my_center|LOCUS_04330 38927 39913 gene locus_tag LOCUS_04340 gene mraY 38927 39913 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460699.1 protein_id gnl|my_center|LOCUS_04340 39931 41052 gene locus_tag LOCUS_04350 gene ftsW 39931 41052 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_04350 41065 42183 gene locus_tag LOCUS_04360 gene murG 41065 42183 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_04360 42253 43611 gene locus_tag LOCUS_04370 gene murC 42253 43611 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_04370 43691 44956 gene locus_tag LOCUS_04380 gene murA 43691 44956 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460694.1 protein_id gnl|my_center|LOCUS_04380 44974 45732 gene locus_tag LOCUS_04390 44974 45732 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965424.1 protein_id gnl|my_center|LOCUS_04390 45745 46470 gene locus_tag LOCUS_04400 45745 46470 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393732.1 protein_id gnl|my_center|LOCUS_04400 46470 46841 gene locus_tag LOCUS_04410 46470 46841 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392367.1 protein_id gnl|my_center|LOCUS_04410 46887 47951 gene locus_tag LOCUS_04420 gene ftsZ 46887 47951 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_04420 48072 48968 gene locus_tag LOCUS_04430 gene spoIIGA 48072 48968 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_04430 48965 49696 gene locus_tag LOCUS_04440 gene sigE 48965 49696 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774280.1 protein_id gnl|my_center|LOCUS_04440 49808 50581 gene locus_tag LOCUS_04450 gene sigG 49808 50581 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944988.1 protein_id gnl|my_center|LOCUS_04450 50598 51323 gene locus_tag LOCUS_04460 50598 51323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 51389 51649 gene locus_tag LOCUS_04470 51389 51649 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181832.1 protein_id gnl|my_center|LOCUS_04470 51705 52973 gene locus_tag LOCUS_04480 51705 52973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 52970 53698 gene locus_tag LOCUS_04490 52970 53698 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061297.1 protein_id gnl|my_center|LOCUS_04490 53731 54264 gene locus_tag LOCUS_04500 gene divIVA 53731 54264 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131611.1 protein_id gnl|my_center|LOCUS_04500 54269 54949 gene locus_tag LOCUS_04510 54269 54949 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_04510 54962 56566 gene locus_tag LOCUS_04520 54962 56566 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016558.1 protein_id gnl|my_center|LOCUS_04520 57298 56513 gene locus_tag LOCUS_04530 57298 56513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 57490 58647 gene locus_tag LOCUS_04540 57490 58647 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392810.1 protein_id gnl|my_center|LOCUS_04540 58753 59082 gene locus_tag LOCUS_04550 58753 59082 CDS product DUF5665 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392384.1 protein_id gnl|my_center|LOCUS_04550 59112 59642 gene locus_tag LOCUS_04560 59112 59642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 59827 60297 gene locus_tag LOCUS_04570 gene lspA 59827 60297 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460664.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence07 293 829 gene locus_tag LOCUS_04580 293 829 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_04580 1474 950 gene locus_tag LOCUS_04590 1474 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 1895 1455 gene locus_tag LOCUS_04600 1895 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2138 1917 gene locus_tag LOCUS_04610 2138 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2845 2228 gene locus_tag LOCUS_04620 2845 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 3603 2842 gene locus_tag LOCUS_04630 3603 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 4892 3600 gene locus_tag LOCUS_04640 4892 3600 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_04640 5971 4886 gene locus_tag LOCUS_04650 5971 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6615 5968 gene locus_tag LOCUS_04660 6615 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 7138 8538 gene locus_tag LOCUS_04670 7138 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 9472 8627 gene locus_tag LOCUS_04680 9472 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 10444 9611 gene locus_tag LOCUS_04690 gene ylqF 10444 9611 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392488.1 protein_id gnl|my_center|LOCUS_04690 10917 10411 gene locus_tag LOCUS_04700 gene lepB 10917 10411 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_04700 11267 10914 gene locus_tag LOCUS_04710 gene rplS 11267 10914 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_04710 12015 11236 gene locus_tag LOCUS_04720 gene trmD 12015 11236 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_04720 12365 12132 gene locus_tag LOCUS_04730 12365 12132 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392483.1 protein_id gnl|my_center|LOCUS_04730 12676 12383 gene locus_tag LOCUS_04740 gene rpsP 12676 12383 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392482.1 protein_id gnl|my_center|LOCUS_04740 14039 12717 gene locus_tag LOCUS_04750 gene ffh 14039 12717 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_04750 14400 14029 gene locus_tag LOCUS_04760 14400 14029 CDS product YlxM family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460448.1 protein_id gnl|my_center|LOCUS_04760 15404 14484 gene locus_tag LOCUS_04770 gene ftsY 15404 14484 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392477.1 protein_id gnl|my_center|LOCUS_04770 18950 15432 gene locus_tag LOCUS_04780 gene smc 18950 15432 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460497.1 protein_id gnl|my_center|LOCUS_04780 19074 19346 gene locus_tag LOCUS_04790 19074 19346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 20059 19313 gene locus_tag LOCUS_04800 gene rncS 20059 19313 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_04800 21237 20029 gene locus_tag LOCUS_04810 gene fabF 21237 20029 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_04810 21584 21342 gene locus_tag LOCUS_04820 gene acpP 21584 21342 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_04820 22366 21611 gene locus_tag LOCUS_04830 gene fabG 22366 21611 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_04830 23307 22363 gene locus_tag LOCUS_04840 gene fabD 23307 22363 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_04840 24192 23323 gene locus_tag LOCUS_04850 24192 23323 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_04850 25255 24233 gene locus_tag LOCUS_04860 gene plsX 25255 24233 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_04860 25821 25252 gene locus_tag LOCUS_04870 gene fapR 25821 25252 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419115.1 protein_id gnl|my_center|LOCUS_04870 26687 26124 gene locus_tag LOCUS_04880 26687 26124 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419111.1 protein_id gnl|my_center|LOCUS_04880 27469 26741 gene locus_tag LOCUS_04890 27469 26741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 27532 28818 gene locus_tag LOCUS_04900 gene ylbJ 27532 28818 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392455.1 protein_id gnl|my_center|LOCUS_04900 29402 28815 gene locus_tag LOCUS_04910 29402 28815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 29921 29436 gene locus_tag LOCUS_04920 gene coaD 29921 29436 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_04920 30561 30121 gene locus_tag LOCUS_04930 30561 30121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 30661 31596 gene locus_tag LOCUS_04940 gene gpr 30661 31596 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_04940 31905 31651 gene locus_tag LOCUS_04950 31905 31651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 34098 32104 gene locus_tag LOCUS_04960 gene recG 34098 32104 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_04960 35837 34167 gene locus_tag LOCUS_04970 35837 34167 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272451.1 protein_id gnl|my_center|LOCUS_04970 36205 35834 gene locus_tag LOCUS_04980 36205 35834 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_04980 36436 36627 gene locus_tag LOCUS_04990 gene rpmB 36436 36627 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392437.1 protein_id gnl|my_center|LOCUS_04990 36979 36815 gene locus_tag LOCUS_05000 36979 36815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 37708 37031 gene locus_tag LOCUS_05010 gene rpe 37708 37031 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869007.1 protein_id gnl|my_center|LOCUS_05010 38570 37701 gene locus_tag LOCUS_05020 gene rsgA 38570 37701 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392430.1 protein_id gnl|my_center|LOCUS_05020 40445 38598 gene locus_tag LOCUS_05030 gene pknB 40445 38598 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_05030 41193 40453 gene locus_tag LOCUS_05040 41193 40453 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_05040 42685 41348 gene locus_tag LOCUS_05050 gene rsmB 42685 41348 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_05050 43362 42688 gene locus_tag LOCUS_05060 43362 42688 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870390.1 protein_id gnl|my_center|LOCUS_05060 44824 43391 gene locus_tag LOCUS_05070 44824 43391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 46854 44908 gene locus_tag LOCUS_05080 46854 44908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 48040 46847 gene locus_tag LOCUS_05090 gene coaBC 48040 46847 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_05090 48310 48107 gene locus_tag LOCUS_05100 48310 48107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 48912 48292 gene locus_tag LOCUS_05110 gene gmk 48912 48292 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_05110 49263 48955 gene locus_tag LOCUS_05120 gene mihF 49263 48955 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_05120 51419 49335 gene locus_tag LOCUS_05130 51419 49335 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_05130 51505 52392 gene locus_tag LOCUS_05140 51505 52392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 52385 53992 gene locus_tag LOCUS_05150 52385 53992 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393415.1 protein_id gnl|my_center|LOCUS_05150 54040 54780 gene locus_tag LOCUS_05160 54040 54780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 55093 56397 gene locus_tag LOCUS_05170 55093 56397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 57761 56577 gene locus_tag LOCUS_05180 57761 56577 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_05180 57936 58439 gene locus_tag LOCUS_05190 57936 58439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 <59028 58515 gene locus_tag LOCUS_05200 <59028 58515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479941.1:tryptophanase >Feature sequence08 332 973 gene locus_tag LOCUS_05210 332 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 970 1689 gene locus_tag LOCUS_05220 970 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1693 2640 gene locus_tag LOCUS_05230 1693 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 2831 5116 gene locus_tag LOCUS_05240 2831 5116 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393243.1 protein_id gnl|my_center|LOCUS_05240 5113 6183 gene locus_tag LOCUS_05250 5113 6183 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393244.1 protein_id gnl|my_center|LOCUS_05250 6341 7495 gene locus_tag LOCUS_05260 6341 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 7497 10346 gene locus_tag LOCUS_05270 7497 10346 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 protein_id gnl|my_center|LOCUS_05270 10995 10336 gene locus_tag LOCUS_05280 10995 10336 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636477.1 protein_id gnl|my_center|LOCUS_05280 11139 11522 gene locus_tag LOCUS_05290 11139 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 11588 12001 gene locus_tag LOCUS_05300 11588 12001 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_05300 12100 12570 gene locus_tag LOCUS_05310 gene nrdR 12100 12570 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459010.1 protein_id gnl|my_center|LOCUS_05310 12625 15231 gene locus_tag LOCUS_05320 12625 15231 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_05320 15225 15404 gene locus_tag LOCUS_05330 15225 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 15535 16413 gene locus_tag LOCUS_05340 15535 16413 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_05340 16545 17720 gene locus_tag LOCUS_05350 16545 17720 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155556.1 protein_id gnl|my_center|LOCUS_05350 19821 17740 gene locus_tag LOCUS_05360 19821 17740 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679730.1 protein_id gnl|my_center|LOCUS_05360 21580 20090 gene locus_tag LOCUS_05370 21580 20090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 22363 21596 gene locus_tag LOCUS_05380 gene sigI 22363 21596 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498572.1 protein_id gnl|my_center|LOCUS_05380 23071 23709 gene locus_tag LOCUS_05390 23071 23709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 23896 25686 gene locus_tag LOCUS_05400 23896 25686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_05400 25686 27575 gene locus_tag LOCUS_05410 25686 27575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360293.1 protein_id gnl|my_center|LOCUS_05410 27864 27637 gene locus_tag LOCUS_05420 27864 27637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 28341 29753 gene locus_tag LOCUS_05430 gene murD 28341 29753 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_05430 29839 30627 gene locus_tag LOCUS_05440 29839 30627 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_05440 30939 34283 gene locus_tag LOCUS_05450 30939 34283 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_05450 34390 34608 gene locus_tag LOCUS_05460 34390 34608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 34610 35566 gene locus_tag LOCUS_05470 gene pfkA 34610 35566 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393368.1 protein_id gnl|my_center|LOCUS_05470 35753 37636 gene locus_tag LOCUS_05480 gene pyk 35753 37636 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232673.1 protein_id gnl|my_center|LOCUS_05480 37795 37917 gene locus_tag LOCUS_05490 37795 37917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 37974 39077 gene locus_tag LOCUS_05500 37974 39077 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263229.1 protein_id gnl|my_center|LOCUS_05500 39207 39329 gene locus_tag LOCUS_05510 39207 39329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 39456 39842 gene locus_tag LOCUS_05520 39456 39842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 41598 39865 gene locus_tag LOCUS_05530 41598 39865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 42347 43369 gene locus_tag LOCUS_05540 42347 43369 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090649235.1 protein_id gnl|my_center|LOCUS_05540 45148 46050 gene locus_tag LOCUS_05550 45148 46050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 46093 49470 gene locus_tag LOCUS_05560 46093 49470 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861850.1 protein_id gnl|my_center|LOCUS_05560 49472 51277 gene locus_tag LOCUS_05570 49472 51277 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 protein_id gnl|my_center|LOCUS_05570 51349 51774 gene locus_tag LOCUS_05580 51349 51774 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138156903.1 protein_id gnl|my_center|LOCUS_05580 53176 52037 gene locus_tag LOCUS_05590 53176 52037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 53662 53970 gene locus_tag LOCUS_05600 53662 53970 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 protein_id gnl|my_center|LOCUS_05600 54588 54049 gene locus_tag LOCUS_05610 54588 54049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 >Feature sequence09 1130 711 gene locus_tag LOCUS_05620 1130 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2143 1157 gene locus_tag LOCUS_05630 gene prfB 2143 1157 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018379.1 protein_id gnl|my_center|LOCUS_05630 5040 2305 gene locus_tag LOCUS_05640 gene secA 5040 2305 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_05640 5664 5092 gene locus_tag LOCUS_05650 5664 5092 CDS product DUF5317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459113.1 protein_id gnl|my_center|LOCUS_05650 6919 5669 gene locus_tag LOCUS_05660 6919 5669 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459114.1 protein_id gnl|my_center|LOCUS_05660 7848 7207 gene locus_tag LOCUS_05670 7848 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272208.1 protein_id gnl|my_center|LOCUS_05670 9031 7916 gene locus_tag LOCUS_05680 9031 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 9571 9053 gene locus_tag LOCUS_05690 gene raiA 9571 9053 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_05690 9920 10123 gene locus_tag LOCUS_05700 9920 10123 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391770.1 protein_id gnl|my_center|LOCUS_05700 10512 10171 gene locus_tag LOCUS_05710 10512 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 10897 10505 gene locus_tag LOCUS_05720 10897 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 12287 10929 gene locus_tag LOCUS_05730 gene fliD 12287 10929 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704960.1 protein_id gnl|my_center|LOCUS_05730 12646 12359 gene locus_tag LOCUS_05740 gene csrA 12646 12359 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865081.1 protein_id gnl|my_center|LOCUS_05740 13100 12648 gene locus_tag LOCUS_05750 gene fliW 13100 12648 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156273801.1 protein_id gnl|my_center|LOCUS_05750 13956 13141 gene locus_tag LOCUS_05760 13956 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 15427 13985 gene locus_tag LOCUS_05770 gene flgK 15427 13985 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_05770 15861 15445 gene locus_tag LOCUS_05780 15861 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 16221 15925 gene locus_tag LOCUS_05790 16221 15925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 16761 16309 gene locus_tag LOCUS_05800 16761 16309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 17501 16767 gene locus_tag LOCUS_05810 17501 16767 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541081.1 protein_id gnl|my_center|LOCUS_05810 17881 17537 gene locus_tag LOCUS_05820 17881 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 19118 17931 gene locus_tag LOCUS_05830 gene metK 19118 17931 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392413.1 protein_id gnl|my_center|LOCUS_05830 19669 19211 gene locus_tag LOCUS_05840 gene fabZ 19669 19211 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257317.1 protein_id gnl|my_center|LOCUS_05840 19958 19641 gene locus_tag LOCUS_05850 19958 19641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 20740 19979 gene locus_tag LOCUS_05860 gene flgG 20740 19979 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869894.1 protein_id gnl|my_center|LOCUS_05860 21550 20813 gene locus_tag LOCUS_05870 gene flgF 21550 20813 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392318.1 protein_id gnl|my_center|LOCUS_05870 22649 21633 gene locus_tag LOCUS_05880 22649 21633 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_05880 23004 22753 gene locus_tag LOCUS_05890 gene spoIIID 23004 22753 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356559.1 protein_id gnl|my_center|LOCUS_05890 23904 23086 gene locus_tag LOCUS_05900 23904 23086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 24960 23977 gene locus_tag LOCUS_05910 gene spoIID 24960 23977 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_05910 26313 25033 gene locus_tag LOCUS_05920 gene murA 26313 25033 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723459.1 protein_id gnl|my_center|LOCUS_05920 27067 26408 gene locus_tag LOCUS_05930 27067 26408 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_05930 28467 27082 gene locus_tag LOCUS_05940 28467 27082 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869607.1 protein_id gnl|my_center|LOCUS_05940 30272 28503 gene locus_tag LOCUS_05950 30272 28503 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925146.1 protein_id gnl|my_center|LOCUS_05950 30602 30279 gene locus_tag LOCUS_05960 30602 30279 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_05960 31659 30595 gene locus_tag LOCUS_05970 31659 30595 CDS product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304547.1 protein_id gnl|my_center|LOCUS_05970 32273 31656 gene locus_tag LOCUS_05980 32273 31656 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422659.1 protein_id gnl|my_center|LOCUS_05980 32851 32285 gene locus_tag LOCUS_05990 32851 32285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 34895 32910 gene locus_tag LOCUS_06000 34895 32910 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925145.1 protein_id gnl|my_center|LOCUS_06000 35256 34939 gene locus_tag LOCUS_06010 35256 34939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 36495 35293 gene locus_tag LOCUS_06020 gene wecB 36495 35293 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_06020 37595 36531 gene locus_tag LOCUS_06030 37595 36531 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_06030 38160 37681 gene locus_tag LOCUS_06040 38160 37681 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_06040 38820 38230 gene locus_tag LOCUS_06050 38820 38230 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227667.1 protein_id gnl|my_center|LOCUS_06050 39333 38875 gene locus_tag LOCUS_06060 gene rpiB 39333 38875 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_06060 40527 39376 gene locus_tag LOCUS_06070 40527 39376 CDS product DUF917 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391754.1 protein_id gnl|my_center|LOCUS_06070 42325 40559 gene locus_tag LOCUS_06080 42325 40559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence10 349 62 gene locus_tag LOCUS_06090 349 62 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 protein_id gnl|my_center|LOCUS_06090 924 346 gene locus_tag LOCUS_06100 924 346 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_06100 1272 1198 gene locus_tag LOCUS_t00070 1272 1198 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1359 1285 gene locus_tag LOCUS_t00080 1359 1285 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1574 1795 gene locus_tag LOCUS_06110 1574 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2408 1941 gene locus_tag LOCUS_06120 2408 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 3469 2405 gene locus_tag LOCUS_06130 gene mtnA 3469 2405 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_06130 4293 3484 gene locus_tag LOCUS_06140 4293 3484 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_06140 5790 4351 gene locus_tag LOCUS_06150 5790 4351 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_06150 6258 5833 gene locus_tag LOCUS_06160 6258 5833 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228886.1 protein_id gnl|my_center|LOCUS_06160 8690 6261 gene locus_tag LOCUS_06170 gene gyrA 8690 6261 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391557.1 protein_id gnl|my_center|LOCUS_06170 10627 8708 gene locus_tag LOCUS_06180 gene gyrB 10627 8708 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_06180 11616 10702 gene locus_tag LOCUS_06190 11616 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 12744 11626 gene locus_tag LOCUS_06200 gene recF 12744 11626 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391554.1 protein_id gnl|my_center|LOCUS_06200 13890 12748 gene locus_tag LOCUS_06210 gene dnaN 13890 12748 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058182.1 protein_id gnl|my_center|LOCUS_06210 15547 14168 gene locus_tag LOCUS_06220 gene dnaA 15547 14168 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_06220 16214 16540 gene locus_tag LOCUS_06230 gene rnpA 16214 16540 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_06230 16782 17441 gene locus_tag LOCUS_06240 16782 17441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 17438 18097 gene locus_tag LOCUS_06250 17438 18097 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393997.1 protein_id gnl|my_center|LOCUS_06250 18230 19618 gene locus_tag LOCUS_06260 gene mnmE 18230 19618 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 protein_id gnl|my_center|LOCUS_06260 19662 21485 gene locus_tag LOCUS_06270 gene mnmG 19662 21485 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462329.1 protein_id gnl|my_center|LOCUS_06270 21506 22252 gene locus_tag LOCUS_06280 21506 22252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 22314 23111 gene locus_tag LOCUS_06290 22314 23111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 23096 23872 gene locus_tag LOCUS_06300 gene soj 23096 23872 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_06300 23850 24698 gene locus_tag LOCUS_06310 23850 24698 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_06310 24748 25875 gene locus_tag LOCUS_06320 gene alr 24748 25875 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_06320 26150 27061 gene locus_tag LOCUS_06330 26150 27061 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582467.1 protein_id gnl|my_center|LOCUS_06330 27081 27485 gene locus_tag LOCUS_06340 27081 27485 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582466.1 protein_id gnl|my_center|LOCUS_06340 27485 28114 gene locus_tag LOCUS_06350 27485 28114 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_06350 28184 28843 gene locus_tag LOCUS_06360 28184 28843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 29027 28773 gene locus_tag LOCUS_06370 29027 28773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 29168 29662 gene locus_tag LOCUS_06380 29168 29662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 29673 30839 gene locus_tag LOCUS_06390 29673 30839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 30851 31183 gene locus_tag LOCUS_06400 30851 31183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 31207 31920 gene locus_tag LOCUS_06410 31207 31920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 31942 32148 gene locus_tag LOCUS_06420 31942 32148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 32286 32717 gene locus_tag LOCUS_06430 32286 32717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 32766 33161 gene locus_tag LOCUS_06440 gene ssb 32766 33161 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391677.1 protein_id gnl|my_center|LOCUS_06440 33199 33426 gene locus_tag LOCUS_06450 gene rpsR 33199 33426 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391678.1 protein_id gnl|my_center|LOCUS_06450 33498 34457 gene locus_tag LOCUS_06460 33498 34457 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869405.1 protein_id gnl|my_center|LOCUS_06460 34547 34999 gene locus_tag LOCUS_06470 gene rplI 34547 34999 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048442.1 protein_id gnl|my_center|LOCUS_06470 35001 36917 gene locus_tag LOCUS_06480 gene lonC 35001 36917 CDS product Lon family ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391681.1 protein_id gnl|my_center|LOCUS_06480 36936 38270 gene locus_tag LOCUS_06490 gene dnaB 36936 38270 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_06490 38339 39718 gene locus_tag LOCUS_06500 38339 39718 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_06500 39896 39985 gene locus_tag LOCUS_t00090 39896 39985 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 40057 40147 gene locus_tag LOCUS_t00100 40057 40147 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 40160 40236 gene locus_tag LOCUS_t00110 40160 40236 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 40274 40352 gene locus_tag LOCUS_t00120 40274 40352 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 40383 40895 gene locus_tag LOCUS_06510 gene tadA 40383 40895 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_06510 40949 41038 gene locus_tag LOCUS_t00130 40949 41038 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 41062 41152 gene locus_tag LOCUS_t00140 41062 41152 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence11 3007 2093 gene locus_tag LOCUS_06520 3007 2093 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816555.1 protein_id gnl|my_center|LOCUS_06520 3801 3091 gene locus_tag LOCUS_06530 3801 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3943 4410 gene locus_tag LOCUS_06540 3943 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 4415 5041 gene locus_tag LOCUS_06550 4415 5041 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032657.1 protein_id gnl|my_center|LOCUS_06550 5704 5099 gene locus_tag LOCUS_06560 5704 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 6602 5757 gene locus_tag LOCUS_06570 6602 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 7343 6684 gene locus_tag LOCUS_06580 7343 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 8205 7378 gene locus_tag LOCUS_06590 8205 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256164.1 protein_id gnl|my_center|LOCUS_06590 8629 9012 gene locus_tag LOCUS_06600 8629 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 9522 9025 gene locus_tag LOCUS_06610 9522 9025 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583841.1 protein_id gnl|my_center|LOCUS_06610 10850 9564 gene locus_tag LOCUS_06620 gene purD 10850 9564 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817230.1 protein_id gnl|my_center|LOCUS_06620 12461 10869 gene locus_tag LOCUS_06630 gene purH 12461 10869 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817232.1 protein_id gnl|my_center|LOCUS_06630 13148 12465 gene locus_tag LOCUS_06640 gene purN 13148 12465 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_06640 14151 13129 gene locus_tag LOCUS_06650 gene purM 14151 13129 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_06650 15592 14153 gene locus_tag LOCUS_06660 gene purF 15592 14153 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879029.1 protein_id gnl|my_center|LOCUS_06660 16095 15580 gene locus_tag LOCUS_06670 gene purE 16095 15580 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_06670 17452 16163 gene locus_tag LOCUS_06680 17452 16163 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047961.1 protein_id gnl|my_center|LOCUS_06680 17924 17499 gene locus_tag LOCUS_06690 gene hpt 17924 17499 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_06690 18204 18398 gene locus_tag LOCUS_06700 18204 18398 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583030.1 protein_id gnl|my_center|LOCUS_06700 18744 18466 gene locus_tag LOCUS_06710 18744 18466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 20134 18734 gene locus_tag LOCUS_06720 20134 18734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 21934 20138 gene locus_tag LOCUS_06730 21934 20138 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_06730 22207 23673 gene locus_tag LOCUS_06740 gene guaB 22207 23673 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541542.1 protein_id gnl|my_center|LOCUS_06740 24968 23691 gene locus_tag LOCUS_06750 24968 23691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 25519 25046 gene locus_tag LOCUS_06760 25519 25046 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082082.1 protein_id gnl|my_center|LOCUS_06760 26400 25588 gene locus_tag LOCUS_06770 26400 25588 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359187.1 protein_id gnl|my_center|LOCUS_06770 27502 26423 gene locus_tag LOCUS_06780 27502 26423 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249584.1 protein_id gnl|my_center|LOCUS_06780 27858 27499 gene locus_tag LOCUS_06790 27858 27499 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965516.1 protein_id gnl|my_center|LOCUS_06790 28361 27876 gene locus_tag LOCUS_06800 28361 27876 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878538.1 protein_id gnl|my_center|LOCUS_06800 30463 28406 gene locus_tag LOCUS_06810 30463 28406 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392263.1 protein_id gnl|my_center|LOCUS_06810 31014 30493 gene locus_tag LOCUS_06820 31014 30493 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_06820 32659 31193 gene locus_tag LOCUS_06830 32659 31193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 32945 32751 gene locus_tag LOCUS_06840 32945 32751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 34274 33270 gene locus_tag LOCUS_06850 34274 33270 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_06850 34628 34440 gene locus_tag LOCUS_06860 34628 34440 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_06860 35419 34718 gene locus_tag LOCUS_06870 35419 34718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 36720 36100 gene locus_tag LOCUS_06880 36720 36100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 36786 36869 gene locus_tag LOCUS_t00150 36786 36869 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 36875 36799 gene locus_tag LOCUS_t00160 36875 36799 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37201 36929 gene locus_tag LOCUS_06890 37201 36929 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140124.1 protein_id gnl|my_center|LOCUS_06890 39306 37321 gene locus_tag LOCUS_06900 39306 37321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 <40565 39484 gene locus_tag LOCUS_06910 <40565 39484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048147002.1:cyclic 2,3-diphosphoglycerate synthase >Feature sequence12 276 791 gene locus_tag LOCUS_06920 276 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 968 3673 gene locus_tag LOCUS_06930 968 3673 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_06930 3726 4031 gene locus_tag LOCUS_06940 3726 4031 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358680.1 protein_id gnl|my_center|LOCUS_06940 4760 4104 gene locus_tag LOCUS_06950 4760 4104 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582682.1 protein_id gnl|my_center|LOCUS_06950 5448 4900 gene locus_tag LOCUS_06960 5448 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 6378 6303 gene locus_tag LOCUS_t00170 6378 6303 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6468 6392 gene locus_tag LOCUS_t00180 6468 6392 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6855 9197 gene locus_tag LOCUS_06970 6855 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 9245 10696 gene locus_tag LOCUS_06980 gene tilS 9245 10696 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_06980 10767 12701 gene locus_tag LOCUS_06990 gene ftsH 10767 12701 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_06990 12762 13655 gene locus_tag LOCUS_07000 12762 13655 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 protein_id gnl|my_center|LOCUS_07000 13787 15124 gene locus_tag LOCUS_07010 13787 15124 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886510.1 protein_id gnl|my_center|LOCUS_07010 15117 16427 gene locus_tag LOCUS_07020 15117 16427 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_07020 16458 17759 gene locus_tag LOCUS_07030 gene hutI 16458 17759 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887529.1 protein_id gnl|my_center|LOCUS_07030 17825 18070 gene locus_tag LOCUS_07040 17825 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 18143 19843 gene locus_tag LOCUS_07050 18143 19843 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_07050 19944 20960 gene locus_tag LOCUS_07060 19944 20960 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_07060 21118 21810 gene locus_tag LOCUS_07070 21118 21810 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583582.1 protein_id gnl|my_center|LOCUS_07070 21857 22630 gene locus_tag LOCUS_07080 21857 22630 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_07080 23098 24477 gene locus_tag LOCUS_07090 23098 24477 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869220.1 protein_id gnl|my_center|LOCUS_07090 24489 24905 gene locus_tag LOCUS_07100 24489 24905 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392625.1 protein_id gnl|my_center|LOCUS_07100 24926 25927 gene locus_tag LOCUS_07110 gene dusB 24926 25927 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_07110 26054 26590 gene locus_tag LOCUS_07120 26054 26590 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391695.1 protein_id gnl|my_center|LOCUS_07120 26603 27526 gene locus_tag LOCUS_07130 26603 27526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391696.1 protein_id gnl|my_center|LOCUS_07130 27584 28663 gene locus_tag LOCUS_07140 27584 28663 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391697.1 protein_id gnl|my_center|LOCUS_07140 28870 29349 gene locus_tag LOCUS_07150 gene greA 28870 29349 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_07150 29430 30923 gene locus_tag LOCUS_07160 gene lysS 29430 30923 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence13 640 1908 gene locus_tag LOCUS_07170 640 1908 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123093.1 protein_id gnl|my_center|LOCUS_07170 2879 2016 gene locus_tag LOCUS_07180 2879 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 3263 2976 gene locus_tag LOCUS_07190 3263 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 3447 4058 gene locus_tag LOCUS_07200 gene lexA 3447 4058 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_07200 5428 4109 gene locus_tag LOCUS_07210 5428 4109 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_07210 6722 5436 gene locus_tag LOCUS_07220 gene hflX 6722 5436 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081386.1 protein_id gnl|my_center|LOCUS_07220 8000 6993 gene locus_tag LOCUS_07230 8000 6993 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811577.1 protein_id gnl|my_center|LOCUS_07230 8331 8116 gene locus_tag LOCUS_07240 8331 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 8715 8443 gene locus_tag LOCUS_07250 gene hfq 8715 8443 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_07250 9682 8750 gene locus_tag LOCUS_07260 gene miaA 9682 8750 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_07260 11478 9757 gene locus_tag LOCUS_07270 gene mutL 11478 9757 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583440.1 protein_id gnl|my_center|LOCUS_07270 14171 11478 gene locus_tag LOCUS_07280 gene mutS 14171 11478 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_07280 15572 14196 gene locus_tag LOCUS_07290 gene miaB 15572 14196 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_07290 16871 15684 gene locus_tag LOCUS_07300 gene thiI 16871 15684 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_07300 18097 16916 gene locus_tag LOCUS_07310 18097 16916 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_07310 18278 19012 gene locus_tag LOCUS_07320 18278 19012 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_07320 19589 19002 gene locus_tag LOCUS_07330 19589 19002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 19782 21887 gene locus_tag LOCUS_07340 19782 21887 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_07340 22929 22156 gene locus_tag LOCUS_07350 22929 22156 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_07350 23403 23101 gene locus_tag LOCUS_07360 23403 23101 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362540.1 protein_id gnl|my_center|LOCUS_07360 24359 23577 gene locus_tag LOCUS_07370 24359 23577 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_07370 24920 24369 gene locus_tag LOCUS_07380 24920 24369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 26506 24977 gene locus_tag LOCUS_07390 gene rny 26506 24977 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_07390 27203 26751 gene locus_tag LOCUS_07400 27203 26751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 28257 27211 gene locus_tag LOCUS_07410 gene recA 28257 27211 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_07410 28947 28348 gene locus_tag LOCUS_07420 gene thpR 28947 28348 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_07420 <30026 28953 gene locus_tag LOCUS_07430 <30026 28953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582488.1:competence/damage-inducible protein A >Feature sequence14 1479 493 gene locus_tag LOCUS_07440 1479 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2392 1514 gene locus_tag LOCUS_07450 2392 1514 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886496.1 protein_id gnl|my_center|LOCUS_07450 2941 2477 gene locus_tag LOCUS_07460 gene ytfJ 2941 2477 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392871.1 protein_id gnl|my_center|LOCUS_07460 3554 2997 gene locus_tag LOCUS_07470 3554 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4210 3680 gene locus_tag LOCUS_07480 gene scpB 4210 3680 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_07480 4919 4245 gene locus_tag LOCUS_07490 4919 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5581 4934 gene locus_tag LOCUS_07500 5581 4934 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_07500 6201 5851 gene locus_tag LOCUS_07510 gene spoVAE 6201 5851 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 protein_id gnl|my_center|LOCUS_07510 7232 6222 gene locus_tag LOCUS_07520 gene spoVAD 7232 6222 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_07520 7707 7258 gene locus_tag LOCUS_07530 gene spoVAC 7707 7258 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_07530 7910 7704 gene locus_tag LOCUS_07540 7910 7704 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393002.1 protein_id gnl|my_center|LOCUS_07540 8708 7992 gene locus_tag LOCUS_07550 gene sigF 8708 7992 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_07550 9112 8705 gene locus_tag LOCUS_07560 gene spoIIAB 9112 8705 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393006.1 protein_id gnl|my_center|LOCUS_07560 9485 9105 gene locus_tag LOCUS_07570 9485 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 10794 9562 gene locus_tag LOCUS_07580 gene dacF 10794 9562 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_07580 11757 10870 gene locus_tag LOCUS_07590 gene xerD 11757 10870 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_07590 12506 11910 gene locus_tag LOCUS_07600 12506 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 13363 12584 gene locus_tag LOCUS_07610 13363 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 13938 13393 gene locus_tag LOCUS_07620 13938 13393 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_07620 14683 13940 gene locus_tag LOCUS_07630 14683 13940 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_07630 15794 14658 gene locus_tag LOCUS_07640 15794 14658 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_07640 16027 15815 gene locus_tag LOCUS_07650 16027 15815 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_07650 17217 16150 gene locus_tag LOCUS_07660 gene bcd 17217 16150 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 protein_id gnl|my_center|LOCUS_07660 19246 17501 gene locus_tag LOCUS_07670 19246 17501 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398669.1 protein_id gnl|my_center|LOCUS_07670 20059 19298 gene locus_tag LOCUS_07680 gene spo0A 20059 19298 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_07680 21514 20186 gene locus_tag LOCUS_07690 gene spoIVB 21514 20186 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 protein_id gnl|my_center|LOCUS_07690 23328 21595 gene locus_tag LOCUS_07700 gene recN 23328 21595 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583410.1 protein_id gnl|my_center|LOCUS_07700 23790 23335 gene locus_tag LOCUS_07710 gene argR 23790 23335 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_07710 24713 23814 gene locus_tag LOCUS_07720 24713 23814 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_07720 26592 24715 gene locus_tag LOCUS_07730 gene dxs 26592 24715 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_07730 27165 26605 gene locus_tag LOCUS_07740 27165 26605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393021.1 protein_id gnl|my_center|LOCUS_07740 27447 27253 gene locus_tag LOCUS_07750 27447 27253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence15 1743 325 gene locus_tag LOCUS_07760 1743 325 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393286.1 protein_id gnl|my_center|LOCUS_07760 3887 2532 gene locus_tag LOCUS_07770 3887 2532 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_07770 4167 3943 gene locus_tag LOCUS_07780 4167 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07780 4377 4177 gene locus_tag LOCUS_07790 4377 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 7248 4813 gene locus_tag LOCUS_07800 7248 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 7636 7562 gene locus_tag LOCUS_t00190 7636 7562 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7951 8265 gene locus_tag LOCUS_07810 7951 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 9560 8199 gene locus_tag LOCUS_07820 9560 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 11046 9640 gene locus_tag LOCUS_07830 gene hydG 11046 9640 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393235.1 protein_id gnl|my_center|LOCUS_07830 12350 11070 gene locus_tag LOCUS_07840 gene hydE 12350 11070 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_07840 12703 12404 gene locus_tag LOCUS_07850 12703 12404 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393237.1 protein_id gnl|my_center|LOCUS_07850 13562 13122 gene locus_tag LOCUS_07860 13562 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 14527 13676 gene locus_tag LOCUS_07870 14527 13676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 14781 15614 gene locus_tag LOCUS_07880 gene ppaX 14781 15614 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 protein_id gnl|my_center|LOCUS_07880 15714 17843 gene locus_tag LOCUS_07890 15714 17843 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_07890 18591 17974 gene locus_tag LOCUS_07900 18591 17974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 21221 18816 gene locus_tag LOCUS_07910 gene lon 21221 18816 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_07910 23110 21566 gene locus_tag LOCUS_07920 gene lonB 23110 21566 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816883.1 protein_id gnl|my_center|LOCUS_07920 24656 23394 gene locus_tag LOCUS_07930 gene clpX 24656 23394 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_07930 25270 24671 gene locus_tag LOCUS_07940 gene clpP 25270 24671 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_07940 26957 25473 gene locus_tag LOCUS_07950 gene tig 26957 25473 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence16 340 612 gene locus_tag LOCUS_07960 340 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 815 1075 gene locus_tag LOCUS_07970 815 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1707 1177 gene locus_tag LOCUS_07980 1707 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2389 3843 gene locus_tag LOCUS_07990 2389 3843 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811628.1 protein_id gnl|my_center|LOCUS_07990 3903 5156 gene locus_tag LOCUS_08000 3903 5156 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_08000 5378 6571 gene locus_tag LOCUS_08010 5378 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 9190 6731 gene locus_tag LOCUS_08020 9190 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 9407 10243 gene locus_tag LOCUS_08030 gene speE 9407 10243 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227543.1 protein_id gnl|my_center|LOCUS_08030 10270 11148 gene locus_tag LOCUS_08040 gene speB 10270 11148 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808139.1 protein_id gnl|my_center|LOCUS_08040 11186 12883 gene locus_tag LOCUS_08050 gene argS 11186 12883 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_08050 14898 13501 gene locus_tag LOCUS_08060 gene rocR 14898 13501 CDS product arginine utilization transcriptional regulator RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110073.1 protein_id gnl|my_center|LOCUS_08060 15286 16356 gene locus_tag LOCUS_08070 gene kdd 15286 16356 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_08070 16459 17796 gene locus_tag LOCUS_08080 gene ablA 16459 17796 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_08080 17815 18906 gene locus_tag LOCUS_08090 17815 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_08090 19074 20774 gene locus_tag LOCUS_08100 19074 20774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 20814 22400 gene locus_tag LOCUS_08110 20814 22400 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_08110 22471 23292 gene locus_tag LOCUS_08120 22471 23292 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_08120 23314 23766 gene locus_tag LOCUS_08130 23314 23766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 24084 25712 gene locus_tag LOCUS_08140 24084 25712 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence17 928 1692 gene locus_tag LOCUS_08150 928 1692 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425887.1 protein_id gnl|my_center|LOCUS_08150 1725 2300 gene locus_tag LOCUS_08160 1725 2300 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880618.1 protein_id gnl|my_center|LOCUS_08160 3804 2368 gene locus_tag LOCUS_08170 3804 2368 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_08170 3982 6600 gene locus_tag LOCUS_08180 3982 6600 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_08180 6672 7871 gene locus_tag LOCUS_08190 6672 7871 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817351.1 protein_id gnl|my_center|LOCUS_08190 8266 8505 gene locus_tag LOCUS_08200 8266 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 8760 9326 gene locus_tag LOCUS_08210 gene yycF 8760 9326 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831816.1 protein_id gnl|my_center|LOCUS_08210 9319 10752 gene locus_tag LOCUS_08220 9319 10752 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_08220 10997 11881 gene locus_tag LOCUS_08230 10997 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 13204 11972 gene locus_tag LOCUS_08240 13204 11972 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080841.1 protein_id gnl|my_center|LOCUS_08240 14190 13498 gene locus_tag LOCUS_08250 14190 13498 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_08250 14502 14993 gene locus_tag LOCUS_08260 14502 14993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 15173 16465 gene locus_tag LOCUS_08270 15173 16465 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837602.1 protein_id gnl|my_center|LOCUS_08270 16570 17289 gene locus_tag LOCUS_08280 gene ytaF 16570 17289 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393339.1 protein_id gnl|my_center|LOCUS_08280 17818 19176 gene locus_tag LOCUS_08290 gene mgtE 17818 19176 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_08290 19425 19730 gene locus_tag LOCUS_08300 19425 19730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 19767 21827 gene locus_tag LOCUS_08310 19767 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 21956 23371 gene locus_tag LOCUS_08320 21956 23371 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861828.1 protein_id gnl|my_center|LOCUS_08320 23949 23416 gene locus_tag LOCUS_08330 23949 23416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 24315 23971 gene locus_tag LOCUS_08340 24315 23971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence18 287 616 gene locus_tag LOCUS_08350 287 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 597 1409 gene locus_tag LOCUS_08360 597 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1601 2611 gene locus_tag LOCUS_08370 1601 2611 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768275.1 protein_id gnl|my_center|LOCUS_08370 2572 3477 gene locus_tag LOCUS_08380 gene rsmA 2572 3477 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966268.1 protein_id gnl|my_center|LOCUS_08380 3638 4105 gene locus_tag LOCUS_08390 3638 4105 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773636.1 protein_id gnl|my_center|LOCUS_08390 4125 4388 gene locus_tag LOCUS_08400 4125 4388 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356889.1 protein_id gnl|my_center|LOCUS_08400 5796 4417 gene locus_tag LOCUS_08410 5796 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 7015 5780 gene locus_tag LOCUS_08420 7015 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 7968 7012 gene locus_tag LOCUS_08430 7968 7012 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_08430 8159 9160 gene locus_tag LOCUS_08440 8159 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391744.1 protein_id gnl|my_center|LOCUS_08440 9198 10166 gene locus_tag LOCUS_08450 gene ispE 9198 10166 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140106.1 protein_id gnl|my_center|LOCUS_08450 10163 12346 gene locus_tag LOCUS_08460 10163 12346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 12359 13306 gene locus_tag LOCUS_08470 12359 13306 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_08470 13342 13983 gene locus_tag LOCUS_08480 13342 13983 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_08480 14013 14615 gene locus_tag LOCUS_08490 gene pth 14013 14615 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880175.1 protein_id gnl|my_center|LOCUS_08490 14615 17989 gene locus_tag LOCUS_08500 gene mfd 14615 17989 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_08500 18061 18621 gene locus_tag LOCUS_08510 gene spoVT 18061 18621 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_08510 18756 20327 gene locus_tag LOCUS_08520 18756 20327 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_08520 20356 21183 gene locus_tag LOCUS_08530 20356 21183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 21273 21554 gene locus_tag LOCUS_08540 21273 21554 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547195.1 protein_id gnl|my_center|LOCUS_08540 21610 21876 gene locus_tag LOCUS_08550 21610 21876 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234988.1 protein_id gnl|my_center|LOCUS_08550 22187 21891 gene locus_tag LOCUS_08560 22187 21891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 22420 22184 gene locus_tag LOCUS_08570 22420 22184 CDS product sigma-70 region 4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391638.1 protein_id gnl|my_center|LOCUS_08570 23129 22692 gene locus_tag LOCUS_08580 23129 22692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 23425 23132 gene locus_tag LOCUS_08590 gene yabP 23425 23132 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226714.1 protein_id gnl|my_center|LOCUS_08590 23737 24126 gene locus_tag LOCUS_08600 23737 24126 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809726.1 protein_id gnl|my_center|LOCUS_08600 24137 24224 gene locus_tag LOCUS_t00200 24137 24224 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence19 1536 652 gene locus_tag LOCUS_08610 1536 652 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461865.1 protein_id gnl|my_center|LOCUS_08610 3463 1934 gene locus_tag LOCUS_08620 3463 1934 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_08620 4960 3623 gene locus_tag LOCUS_08630 4960 3623 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_08630 5142 5789 gene locus_tag LOCUS_08640 5142 5789 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392812.1 protein_id gnl|my_center|LOCUS_08640 7520 5946 gene locus_tag LOCUS_08650 7520 5946 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_08650 7754 8431 gene locus_tag LOCUS_08660 7754 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 8544 10139 gene locus_tag LOCUS_08670 8544 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 10136 11845 gene locus_tag LOCUS_08680 10136 11845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 11954 13516 gene locus_tag LOCUS_08690 11954 13516 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965635.1 protein_id gnl|my_center|LOCUS_08690 13513 14571 gene locus_tag LOCUS_08700 13513 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 14609 15301 gene locus_tag LOCUS_08710 14609 15301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392507.1 protein_id gnl|my_center|LOCUS_08710 17650 15344 gene locus_tag LOCUS_08720 17650 15344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 18465 17983 gene locus_tag LOCUS_08730 18465 17983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 18796 18578 gene locus_tag LOCUS_08740 18796 18578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 19766 20212 gene locus_tag LOCUS_08750 19766 20212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 21022 20243 gene locus_tag LOCUS_08760 21022 20243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 22330 21767 gene locus_tag LOCUS_08770 22330 21767 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_08770 23381 22434 gene locus_tag LOCUS_08780 23381 22434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence20 700 1557 gene locus_tag LOCUS_08790 700 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1787 3868 gene locus_tag LOCUS_08800 gene fusA 1787 3868 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_08800 4963 4010 gene locus_tag LOCUS_08810 4963 4010 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391635.1 protein_id gnl|my_center|LOCUS_08810 5095 6015 gene locus_tag LOCUS_08820 gene trxB 5095 6015 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_08820 6171 6635 gene locus_tag LOCUS_08830 6171 6635 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551762.1 protein_id gnl|my_center|LOCUS_08830 6642 7178 gene locus_tag LOCUS_08840 6642 7178 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_08840 7168 8256 gene locus_tag LOCUS_08850 7168 8256 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_08850 8282 10759 gene locus_tag LOCUS_08860 gene clpC 8282 10759 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_08860 10984 12192 gene locus_tag LOCUS_08870 gene radA 10984 12192 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989380.1 protein_id gnl|my_center|LOCUS_08870 12598 12200 gene locus_tag LOCUS_08880 12598 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048365.1 protein_id gnl|my_center|LOCUS_08880 12710 12636 gene locus_tag LOCUS_t00210 12710 12636 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13253 12777 gene locus_tag LOCUS_08890 13253 12777 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_08890 13521 14642 gene locus_tag LOCUS_08900 13521 14642 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_08900 14629 15948 gene locus_tag LOCUS_08910 gene ispF 14629 15948 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869748.1 protein_id gnl|my_center|LOCUS_08910 15951 17393 gene locus_tag LOCUS_08920 gene cysS 15951 17393 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869759.1 protein_id gnl|my_center|LOCUS_08920 17393 18298 gene locus_tag LOCUS_08930 gene thyX 17393 18298 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546288.1 protein_id gnl|my_center|LOCUS_08930 18373 19122 gene locus_tag LOCUS_08940 gene rlmB 18373 19122 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_08940 19263 19943 gene locus_tag LOCUS_08950 gene sigH 19263 19943 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_08950 20033 20108 gene locus_tag LOCUS_t00220 20033 20108 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20424 20509 gene locus_tag LOCUS_t00230 20424 20509 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 20521 20597 gene locus_tag LOCUS_t00240 20521 20597 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 20644 20719 gene locus_tag LOCUS_t00250 20644 20719 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence21 2171 627 gene locus_tag LOCUS_08960 2171 627 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392591.1 protein_id gnl|my_center|LOCUS_08960 2701 2168 gene locus_tag LOCUS_08970 2701 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3807 2905 gene locus_tag LOCUS_08980 3807 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3927 6239 gene locus_tag LOCUS_08990 gene mrfA 3927 6239 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_08990 6208 7461 gene locus_tag LOCUS_09000 6208 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 7516 8241 gene locus_tag LOCUS_09010 7516 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 9415 8258 gene locus_tag LOCUS_09020 9415 8258 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_09020 10363 9494 gene locus_tag LOCUS_09030 10363 9494 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_09030 11699 10383 gene locus_tag LOCUS_09040 gene asnS 11699 10383 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_09040 14471 11766 gene locus_tag LOCUS_09050 14471 11766 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_09050 15836 14496 gene locus_tag LOCUS_09060 15836 14496 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_09060 16672 15833 gene locus_tag LOCUS_09070 16672 15833 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_09070 17080 16703 gene locus_tag LOCUS_09080 17080 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 17147 18895 gene locus_tag LOCUS_09090 17147 18895 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_09090 19810 18902 gene locus_tag LOCUS_09100 19810 18902 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_09100 20634 19807 gene locus_tag LOCUS_09110 20634 19807 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence22 2228 147 gene locus_tag LOCUS_09120 gene fusA 2228 147 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_09120 2736 2266 gene locus_tag LOCUS_09130 gene rpsG 2736 2266 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 protein_id gnl|my_center|LOCUS_09130 3130 2759 gene locus_tag LOCUS_09140 gene rpsL 3130 2759 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966418.1 protein_id gnl|my_center|LOCUS_09140 3406 3134 gene locus_tag LOCUS_09150 3406 3134 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459096.1 protein_id gnl|my_center|LOCUS_09150 4560 3523 gene locus_tag LOCUS_09160 4560 3523 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_09160 5319 4657 gene locus_tag LOCUS_09170 5319 4657 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392252.1 protein_id gnl|my_center|LOCUS_09170 8853 5347 gene locus_tag LOCUS_09180 gene rpoC 8853 5347 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773568.1 protein_id gnl|my_center|LOCUS_09180 12774 8875 gene locus_tag LOCUS_09190 gene rpoB 12774 8875 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147554.1 protein_id gnl|my_center|LOCUS_09190 13883 12996 gene locus_tag LOCUS_09200 gene dapA 13883 12996 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460382.1 protein_id gnl|my_center|LOCUS_09200 15167 13917 gene locus_tag LOCUS_09210 gene dapG 15167 13917 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392581.1 protein_id gnl|my_center|LOCUS_09210 16174 15164 gene locus_tag LOCUS_09220 16174 15164 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583723.1 protein_id gnl|my_center|LOCUS_09220 16705 16325 gene locus_tag LOCUS_09230 gene rplL 16705 16325 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459089.1 protein_id gnl|my_center|LOCUS_09230 17263 16727 gene locus_tag LOCUS_09240 gene rplJ 17263 16727 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_09240 18180 17482 gene locus_tag LOCUS_09250 gene rplA 18180 17482 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_09250 18700 18278 gene locus_tag LOCUS_09260 gene rplK 18700 18278 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393949.1 protein_id gnl|my_center|LOCUS_09260 19253 18711 gene locus_tag LOCUS_09270 gene nusG 19253 18711 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_09270 19517 19302 gene locus_tag LOCUS_09280 19517 19302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 19618 19543 gene locus_tag LOCUS_t00260 19618 19543 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 20089 19958 gene locus_tag LOCUS_09290 20089 19958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence23 <1 1299 gene locus_tag LOCUS_09300 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705197.1:sodium-dependent transporter 2716 1346 gene locus_tag LOCUS_09310 2716 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 3713 2736 gene locus_tag LOCUS_09320 gene glpX 3713 2736 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_09320 4190 6067 gene locus_tag LOCUS_09330 4190 6067 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837459.1 protein_id gnl|my_center|LOCUS_09330 6242 7201 gene locus_tag LOCUS_09340 6242 7201 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534167.1 protein_id gnl|my_center|LOCUS_09340 7202 8170 gene locus_tag LOCUS_09350 7202 8170 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 protein_id gnl|my_center|LOCUS_09350 8183 9223 gene locus_tag LOCUS_09360 8183 9223 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159554.1 protein_id gnl|my_center|LOCUS_09360 9220 10161 gene locus_tag LOCUS_09370 9220 10161 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049552588.1 protein_id gnl|my_center|LOCUS_09370 10751 10257 gene locus_tag LOCUS_09380 10751 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 12058 10814 gene locus_tag LOCUS_09390 gene nagA 12058 10814 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_09390 13381 12119 gene locus_tag LOCUS_09400 13381 12119 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909244.1 protein_id gnl|my_center|LOCUS_09400 13664 14209 gene locus_tag LOCUS_09410 13664 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 15332 14289 gene locus_tag LOCUS_09420 15332 14289 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 protein_id gnl|my_center|LOCUS_09420 16052 15453 gene locus_tag LOCUS_09430 16052 15453 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_09430 17733 16321 gene locus_tag LOCUS_09440 17733 16321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 18291 19559 gene locus_tag LOCUS_09450 gene serS 18291 19559 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence24 110 988 gene locus_tag LOCUS_09460 110 988 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_09460 1964 2338 gene locus_tag LOCUS_09470 1964 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 3425 2574 gene locus_tag LOCUS_09480 3425 2574 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289273.1 protein_id gnl|my_center|LOCUS_09480 4033 3779 gene locus_tag LOCUS_09490 4033 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3950 5281 gene locus_tag LOCUS_09500 3950 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 5285 5983 gene locus_tag LOCUS_09510 5285 5983 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435381.1 protein_id gnl|my_center|LOCUS_09510 5980 7173 gene locus_tag LOCUS_09520 5980 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 7395 10013 gene locus_tag LOCUS_09530 7395 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 12316 10280 gene locus_tag LOCUS_09540 12316 10280 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146467.1 protein_id gnl|my_center|LOCUS_09540 12598 14559 gene locus_tag LOCUS_09550 gene ade 12598 14559 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 protein_id gnl|my_center|LOCUS_09550 14765 15085 gene locus_tag LOCUS_09560 14765 15085 CDS product putative heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725735.1 protein_id gnl|my_center|LOCUS_09560 15333 15730 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggaatggtgcatgtggtgcgccattt 17965 16088 gene locus_tag LOCUS_09570 17965 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816571.1 protein_id gnl|my_center|LOCUS_09570 <18669 17962 gene locus_tag LOCUS_09580 <18669 17962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816573.1:ABC transporter ATP-binding protein >Feature sequence25 282 55 gene locus_tag LOCUS_09590 282 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2243 681 gene locus_tag LOCUS_09600 2243 681 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890798.1 protein_id gnl|my_center|LOCUS_09600 4964 2376 gene locus_tag LOCUS_09610 4964 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 6590 5001 gene locus_tag LOCUS_09620 6590 5001 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_09620 9072 6625 gene locus_tag LOCUS_09630 9072 6625 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_09630 9760 9125 gene locus_tag LOCUS_09640 9760 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 10031 9744 gene locus_tag LOCUS_09650 10031 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 11438 10056 gene locus_tag LOCUS_09660 11438 10056 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_09660 13692 11467 gene locus_tag LOCUS_09670 13692 11467 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_09670 15766 13856 gene locus_tag LOCUS_09680 15766 13856 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_09680 17171 15861 gene locus_tag LOCUS_09690 17171 15861 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_09690 17613 17248 gene locus_tag LOCUS_09700 17613 17248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 <18363 17580 gene locus_tag LOCUS_09710 <18363 17580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994209.1:glycoside hydrolase family 43 protein >Feature sequence26 387 677 gene locus_tag LOCUS_09720 387 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2591 1029 gene locus_tag LOCUS_09730 2591 1029 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405420.1 protein_id gnl|my_center|LOCUS_09730 3297 2719 gene locus_tag LOCUS_09740 3297 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 4497 3559 gene locus_tag LOCUS_09750 4497 3559 CDS product DUF1177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391755.1 protein_id gnl|my_center|LOCUS_09750 5438 4623 gene locus_tag LOCUS_09760 5438 4623 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931966.1 protein_id gnl|my_center|LOCUS_09760 6596 5463 gene locus_tag LOCUS_09770 6596 5463 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814320.1 protein_id gnl|my_center|LOCUS_09770 7616 6645 gene locus_tag LOCUS_09780 7616 6645 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_09780 8605 7619 gene locus_tag LOCUS_09790 8605 7619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867269.1 protein_id gnl|my_center|LOCUS_09790 9513 8611 gene locus_tag LOCUS_09800 9513 8611 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383587.1 protein_id gnl|my_center|LOCUS_09800 10533 9514 gene locus_tag LOCUS_09810 10533 9514 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385664.1 protein_id gnl|my_center|LOCUS_09810 12324 10663 gene locus_tag LOCUS_09820 12324 10663 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385666.1 protein_id gnl|my_center|LOCUS_09820 12957 12712 gene locus_tag LOCUS_09830 12957 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 14359 13151 gene locus_tag LOCUS_09840 14359 13151 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_09840 15489 14500 gene locus_tag LOCUS_09850 15489 14500 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_09850 16282 15626 gene locus_tag LOCUS_09860 16282 15626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 16804 17553 gene locus_tag LOCUS_09870 gene cobB 16804 17553 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846381.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence27 370 83 gene locus_tag LOCUS_09880 370 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 451 600 gene locus_tag LOCUS_09890 451 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 987 1427 gene locus_tag LOCUS_09900 987 1427 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_09900 1865 2698 gene locus_tag LOCUS_09910 gene hag 1865 2698 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_09910 2791 3648 gene locus_tag LOCUS_09920 gene hag 2791 3648 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_09920 3844 4572 gene locus_tag LOCUS_09930 3844 4572 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459753.1 protein_id gnl|my_center|LOCUS_09930 4726 5193 gene locus_tag LOCUS_09940 4726 5193 CDS product DUF4363 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964828.1 protein_id gnl|my_center|LOCUS_09940 6058 5207 gene locus_tag LOCUS_09950 6058 5207 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169470.1 protein_id gnl|my_center|LOCUS_09950 7183 6371 gene locus_tag LOCUS_09960 7183 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 8447 7431 gene locus_tag LOCUS_09970 8447 7431 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_09970 9480 8440 gene locus_tag LOCUS_09980 9480 8440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868769.1 protein_id gnl|my_center|LOCUS_09980 9718 9500 gene locus_tag LOCUS_09990 9718 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 11220 9715 gene locus_tag LOCUS_10000 11220 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 12493 11570 gene locus_tag LOCUS_10010 12493 11570 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_10010 13480 12509 gene locus_tag LOCUS_10020 13480 12509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_10020 15182 13554 gene locus_tag LOCUS_10030 15182 13554 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_10030 16108 15926 gene locus_tag LOCUS_10040 16108 15926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence28 401 697 gene locus_tag LOCUS_10050 401 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 846 1418 gene locus_tag LOCUS_10060 gene spmA 846 1418 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398980.1 protein_id gnl|my_center|LOCUS_10060 1509 2048 gene locus_tag LOCUS_10070 1509 2048 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 protein_id gnl|my_center|LOCUS_10070 2910 2029 gene locus_tag LOCUS_10080 2910 2029 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_10080 3279 3740 gene locus_tag LOCUS_10090 3279 3740 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_10090 3792 4553 gene locus_tag LOCUS_10100 3792 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4543 4791 gene locus_tag LOCUS_10110 4543 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4775 6616 gene locus_tag LOCUS_10120 4775 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 6726 7769 gene locus_tag LOCUS_10130 6726 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 7783 9600 gene locus_tag LOCUS_10140 7783 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 9883 9617 gene locus_tag LOCUS_10150 9883 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 10335 10114 gene locus_tag LOCUS_10160 10335 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 10512 11453 gene locus_tag LOCUS_10170 10512 11453 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 protein_id gnl|my_center|LOCUS_10170 11508 12542 gene locus_tag LOCUS_10180 11508 12542 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_10180 12544 13335 gene locus_tag LOCUS_10190 12544 13335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677519.1 protein_id gnl|my_center|LOCUS_10190 13525 14025 gene locus_tag LOCUS_10200 13525 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 14057 14800 gene locus_tag LOCUS_10210 gene cmk 14057 14800 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_10210 14785 15384 gene locus_tag LOCUS_10220 14785 15384 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence29 1 186 gene locus_tag LOCUS_10230 1 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 113 1261 gene locus_tag LOCUS_10240 113 1261 CDS product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392526.1 protein_id gnl|my_center|LOCUS_10240 1248 2471 gene locus_tag LOCUS_10250 1248 2471 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_10250 2541 2774 gene locus_tag LOCUS_10260 2541 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3730 2780 gene locus_tag LOCUS_10270 3730 2780 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_10270 4861 3875 gene locus_tag LOCUS_10280 4861 3875 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392639.1 protein_id gnl|my_center|LOCUS_10280 5837 4983 gene locus_tag LOCUS_10290 gene dapF 5837 4983 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_10290 6128 7375 gene locus_tag LOCUS_10300 6128 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393396.1 protein_id gnl|my_center|LOCUS_10300 7907 7446 gene locus_tag LOCUS_10310 7907 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 8705 7965 gene locus_tag LOCUS_10320 8705 7965 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461616.1 protein_id gnl|my_center|LOCUS_10320 9105 8887 gene locus_tag LOCUS_10330 9105 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 10024 9302 gene locus_tag LOCUS_10340 10024 9302 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_10340 10670 10011 gene locus_tag LOCUS_10350 10670 10011 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392641.1 protein_id gnl|my_center|LOCUS_10350 11632 10814 gene locus_tag LOCUS_10360 11632 10814 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_10360 12216 12788 gene locus_tag LOCUS_10370 12216 12788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 12801 13067 gene locus_tag LOCUS_10380 12801 13067 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_10380 13074 13691 gene locus_tag LOCUS_10390 13074 13691 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392905.1 protein_id gnl|my_center|LOCUS_10390 13923 15257 gene locus_tag LOCUS_10400 13923 15257 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812346.1 protein_id gnl|my_center|LOCUS_10400 15655 15407 gene locus_tag LOCUS_10410 15655 15407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence30 <1 1493 gene locus_tag LOCUS_10420 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392842.1:bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 1740 2381 gene locus_tag LOCUS_10430 1740 2381 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392840.1 protein_id gnl|my_center|LOCUS_10430 2371 3516 gene locus_tag LOCUS_10440 2371 3516 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392839.1 protein_id gnl|my_center|LOCUS_10440 3662 3850 gene locus_tag LOCUS_10450 3662 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 3871 4614 gene locus_tag LOCUS_10460 3871 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4574 5956 gene locus_tag LOCUS_10470 4574 5956 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_10470 5962 7329 gene locus_tag LOCUS_10480 gene der 5962 7329 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_10480 7326 7949 gene locus_tag LOCUS_10490 gene plsY 7326 7949 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_10490 7946 8986 gene locus_tag LOCUS_10500 7946 8986 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392833.1 protein_id gnl|my_center|LOCUS_10500 9172 10650 gene locus_tag LOCUS_10510 gene spoIVA 9172 10650 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 protein_id gnl|my_center|LOCUS_10510 11017 12195 gene locus_tag LOCUS_10520 11017 12195 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_10520 14285 12360 gene locus_tag LOCUS_10530 14285 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 14798 14517 gene locus_tag LOCUS_10540 14798 14517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence31 <1 1354 gene locus_tag LOCUS_10550 <1 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392083.1:chaperonin GroEL 1546 1355 gene locus_tag LOCUS_10560 1546 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1835 3406 gene locus_tag LOCUS_10570 1835 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3449 4609 gene locus_tag LOCUS_10580 3449 4609 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_10580 4983 7616 gene locus_tag LOCUS_10590 4983 7616 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_10590 7737 8969 gene locus_tag LOCUS_10600 7737 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 9208 10092 gene locus_tag LOCUS_10610 9208 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 10466 10206 gene locus_tag LOCUS_10620 gene rpsT 10466 10206 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228460.1 protein_id gnl|my_center|LOCUS_10620 11493 10651 gene locus_tag LOCUS_10630 11493 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 11976 11497 gene locus_tag LOCUS_10640 11976 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 13561 12017 gene locus_tag LOCUS_10650 13561 12017 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_10650 <14867 13747 gene locus_tag LOCUS_10660 <14867 13747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392069.1:valine--tRNA ligase >Feature sequence32 747 454 gene locus_tag LOCUS_10670 gene groES 747 454 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392082.1 protein_id gnl|my_center|LOCUS_10670 1666 938 gene locus_tag LOCUS_10680 1666 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 4459 1877 gene locus_tag LOCUS_10690 gene leuS 4459 1877 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_10690 6917 5196 gene locus_tag LOCUS_10700 6917 5196 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_10700 8606 7257 gene locus_tag LOCUS_10710 8606 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 10038 8749 gene locus_tag LOCUS_10720 10038 8749 CDS product tetraprenyl-beta-curcumene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460171.1 protein_id gnl|my_center|LOCUS_10720 10963 10091 gene locus_tag LOCUS_10730 10963 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 11551 13191 gene locus_tag LOCUS_10740 11551 13191 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963689.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence33 2541 1528 gene locus_tag LOCUS_10750 2541 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3298 2585 gene locus_tag LOCUS_10760 3298 2585 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814029.1 protein_id gnl|my_center|LOCUS_10760 3729 4079 gene locus_tag LOCUS_10770 3729 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 4428 4114 gene locus_tag LOCUS_10780 4428 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6797 4749 gene locus_tag LOCUS_10790 gene brxL 6797 4749 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_10790 9154 6800 gene locus_tag LOCUS_10800 gene pglZ 9154 6800 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_10800 10731 9310 gene locus_tag LOCUS_10810 10731 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 11421 11104 gene locus_tag LOCUS_10820 11421 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 12062 11514 gene locus_tag LOCUS_10830 12062 11514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 12207 12608 gene locus_tag LOCUS_10840 12207 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence34 <1 575 gene locus_tag LOCUS_10850 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393920.1:30S ribosomal protein S5 562 1005 gene locus_tag LOCUS_10860 gene rplO 562 1005 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869910.1 protein_id gnl|my_center|LOCUS_10860 1007 2269 gene locus_tag LOCUS_10870 gene secY 1007 2269 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_10870 2280 2945 gene locus_tag LOCUS_10880 2280 2945 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_10880 2949 3692 gene locus_tag LOCUS_10890 gene map 2949 3692 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_10890 3740 3958 gene locus_tag LOCUS_10900 gene infA 3740 3958 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393913.1 protein_id gnl|my_center|LOCUS_10900 4128 4499 gene locus_tag LOCUS_10910 gene rpsM 4128 4499 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_10910 4520 4909 gene locus_tag LOCUS_10920 gene rpsK 4520 4909 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393910.1 protein_id gnl|my_center|LOCUS_10920 4922 5542 gene locus_tag LOCUS_10930 gene rpsD 4922 5542 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_10930 5584 6537 gene locus_tag LOCUS_10940 5584 6537 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_10940 6554 6904 gene locus_tag LOCUS_10950 gene rplQ 6554 6904 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393907.1 protein_id gnl|my_center|LOCUS_10950 6916 7779 gene locus_tag LOCUS_10960 6916 7779 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_10960 7755 8621 gene locus_tag LOCUS_10970 7755 8621 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_10970 8618 9448 gene locus_tag LOCUS_10980 8618 9448 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_10980 9462 10238 gene locus_tag LOCUS_10990 gene truA 9462 10238 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_10990 10302 10739 gene locus_tag LOCUS_11000 gene rplM 10302 10739 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258261.1 protein_id gnl|my_center|LOCUS_11000 10741 11127 gene locus_tag LOCUS_11010 gene rpsI 10741 11127 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_11010 11200 11913 gene locus_tag LOCUS_11020 11200 11913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence35 601 1392 gene locus_tag LOCUS_11030 601 1392 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172511.1 protein_id gnl|my_center|LOCUS_11030 1352 2191 gene locus_tag LOCUS_11040 1352 2191 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_11040 2235 3218 gene locus_tag LOCUS_11050 2235 3218 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545386.1 protein_id gnl|my_center|LOCUS_11050 3326 4018 gene locus_tag LOCUS_11060 gene ftsE 3326 4018 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815584.1 protein_id gnl|my_center|LOCUS_11060 4015 4899 gene locus_tag LOCUS_11070 gene ftsX 4015 4899 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 protein_id gnl|my_center|LOCUS_11070 4918 6069 gene locus_tag LOCUS_11080 4918 6069 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_11080 6321 7445 gene locus_tag LOCUS_11090 6321 7445 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_11090 7470 8744 gene locus_tag LOCUS_11100 7470 8744 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963822.1 protein_id gnl|my_center|LOCUS_11100 8844 10862 gene locus_tag LOCUS_11110 gene uvrB 8844 10862 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence36 1522 965 gene locus_tag LOCUS_11120 1522 965 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_11120 2380 1538 gene locus_tag LOCUS_11130 2380 1538 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816933.1 protein_id gnl|my_center|LOCUS_11130 3792 2407 gene locus_tag LOCUS_11140 gene aspA 3792 2407 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230430.1 protein_id gnl|my_center|LOCUS_11140 5396 3951 gene locus_tag LOCUS_11150 5396 3951 CDS product DUF3887 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582879.1 protein_id gnl|my_center|LOCUS_11150 5650 6915 gene locus_tag LOCUS_11160 5650 6915 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103770.1 protein_id gnl|my_center|LOCUS_11160 8111 6954 gene locus_tag LOCUS_11170 8111 6954 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_11170 9179 8280 gene locus_tag LOCUS_11180 9179 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 9916 9353 gene locus_tag LOCUS_11190 9916 9353 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_11190 10526 10065 gene locus_tag LOCUS_11200 10526 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11200 >Feature sequence37 1623 979 gene locus_tag LOCUS_11210 1623 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3041 2965 gene locus_tag LOCUS_t00270 3041 2965 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4048 3491 gene locus_tag LOCUS_11220 4048 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4342 6033 gene locus_tag LOCUS_11230 gene metG 4342 6033 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338224.1 protein_id gnl|my_center|LOCUS_11230 6334 7071 gene locus_tag LOCUS_11240 gene nagB 6334 7071 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_11240 7231 7797 gene locus_tag LOCUS_11250 7231 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 8308 9126 gene locus_tag LOCUS_11260 8308 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256164.1 protein_id gnl|my_center|LOCUS_11260 9140 9763 gene locus_tag LOCUS_11270 9140 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 9781 10620 gene locus_tag LOCUS_11280 9781 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 10636 11235 gene locus_tag LOCUS_11290 10636 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence38 153 335 gene locus_tag LOCUS_11300 153 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 495 755 gene locus_tag LOCUS_11310 495 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1606 1785 gene locus_tag LOCUS_11320 1606 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3516 2188 gene locus_tag LOCUS_11330 3516 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4229 3513 gene locus_tag LOCUS_11340 4229 3513 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363160.1 protein_id gnl|my_center|LOCUS_11340 4564 5379 gene locus_tag LOCUS_11350 gene murI 4564 5379 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_11350 5535 5693 gene locus_tag LOCUS_11360 5535 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 5963 5754 gene locus_tag LOCUS_11370 5963 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 7063 5933 gene locus_tag LOCUS_11380 7063 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 7355 10066 gene locus_tag LOCUS_11390 7355 10066 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence39 1284 100 gene locus_tag LOCUS_11400 1284 100 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393775.1 protein_id gnl|my_center|LOCUS_11400 1991 1395 gene locus_tag LOCUS_11410 1991 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2848 1988 gene locus_tag LOCUS_11420 2848 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 3495 2863 gene locus_tag LOCUS_11430 3495 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 4300 3524 gene locus_tag LOCUS_11440 4300 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256164.1 protein_id gnl|my_center|LOCUS_11440 4661 4873 gene locus_tag LOCUS_11450 4661 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 6429 4807 gene locus_tag LOCUS_11460 6429 4807 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048385.1 protein_id gnl|my_center|LOCUS_11460 6679 7626 gene locus_tag LOCUS_11470 6679 7626 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878840.1 protein_id gnl|my_center|LOCUS_11470 8722 7610 gene locus_tag LOCUS_11480 8722 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 9715 8807 gene locus_tag LOCUS_11490 9715 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 10340 9819 gene locus_tag LOCUS_11500 10340 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 10579 10503 gene locus_tag LOCUS_t00280 10579 10503 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10660 10587 gene locus_tag LOCUS_t00290 10660 10587 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10761 10686 gene locus_tag LOCUS_t00300 10761 10686 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence40 95 19 gene locus_tag LOCUS_t00310 95 19 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 690 1229 gene locus_tag LOCUS_11510 690 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1234 1662 gene locus_tag LOCUS_11520 1234 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1918 2457 gene locus_tag LOCUS_11530 1918 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 3949 2555 gene locus_tag LOCUS_11540 3949 2555 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_11540 5791 4031 gene locus_tag LOCUS_11550 5791 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6513 5929 gene locus_tag LOCUS_11560 6513 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047726.1 protein_id gnl|my_center|LOCUS_11560 6648 6899 gene locus_tag LOCUS_11570 6648 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 7498 6983 gene locus_tag LOCUS_11580 7498 6983 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545049.1 protein_id gnl|my_center|LOCUS_11580 9000 7525 gene locus_tag LOCUS_11590 gene gltX 9000 7525 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_11590 10050 9109 gene locus_tag LOCUS_11600 10050 9109 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_11600 <10784 10062 gene locus_tag LOCUS_11610 <10784 10062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582673.1:transketolase C-terminal domain-containing protein >Feature sequence41 1073 1555 gene locus_tag LOCUS_11620 1073 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2557 1607 gene locus_tag LOCUS_11630 gene fabK 2557 1607 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392462.1 protein_id gnl|my_center|LOCUS_11630 4280 2703 gene locus_tag LOCUS_11640 4280 2703 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_11640 5292 4546 gene locus_tag LOCUS_11650 5292 4546 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256951.1 protein_id gnl|my_center|LOCUS_11650 5548 6186 gene locus_tag LOCUS_11660 5548 6186 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_11660 6362 8434 gene locus_tag LOCUS_11670 6362 8434 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 protein_id gnl|my_center|LOCUS_11670 8492 9346 gene locus_tag LOCUS_11680 8492 9346 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080391.1 protein_id gnl|my_center|LOCUS_11680 9480 9701 gene locus_tag LOCUS_11690 9480 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 <10623 9755 gene locus_tag LOCUS_11700 <10623 9755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244994.1:small-conductance mechanosensitive channel protein MscT >Feature sequence42 835 1407 gene locus_tag LOCUS_11710 835 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1469 3247 gene locus_tag LOCUS_11720 1469 3247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_11720 3244 5268 gene locus_tag LOCUS_11730 3244 5268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 protein_id gnl|my_center|LOCUS_11730 6113 5412 gene locus_tag LOCUS_11740 6113 5412 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393416.1 protein_id gnl|my_center|LOCUS_11740 6287 6625 gene locus_tag LOCUS_11750 6287 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 6758 7096 gene locus_tag LOCUS_11760 6758 7096 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184004.1 protein_id gnl|my_center|LOCUS_11760 7089 7676 gene locus_tag LOCUS_11770 7089 7676 CDS product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459652.1 protein_id gnl|my_center|LOCUS_11770 7680 8102 gene locus_tag LOCUS_11780 7680 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 8294 8016 gene locus_tag LOCUS_11790 8294 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 8547 8356 gene locus_tag LOCUS_11800 8547 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 8859 9317 gene locus_tag LOCUS_11810 8859 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 9304 9498 gene locus_tag LOCUS_11820 9304 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 9495 9992 gene locus_tag LOCUS_11830 9495 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence43 1288 614 gene locus_tag LOCUS_11840 1288 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11840 1651 1576 gene locus_tag LOCUS_t00320 1651 1576 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2122 1751 gene locus_tag LOCUS_11850 gene rsfS 2122 1751 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392104.1 protein_id gnl|my_center|LOCUS_11850 3534 2218 gene locus_tag LOCUS_11860 3534 2218 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048020.1 protein_id gnl|my_center|LOCUS_11860 4081 3509 gene locus_tag LOCUS_11870 gene yqeK 4081 3509 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_11870 4569 4315 gene locus_tag LOCUS_11880 4569 4315 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_11880 5261 4635 gene locus_tag LOCUS_11890 gene nadD 5261 4635 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_11890 6402 5377 gene locus_tag LOCUS_11900 6402 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 6803 6498 gene locus_tag LOCUS_11910 gene rpmA 6803 6498 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_11910 7082 6870 gene locus_tag LOCUS_11920 7082 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 7623 7210 gene locus_tag LOCUS_11930 7623 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 9368 7635 gene locus_tag LOCUS_11940 9368 7635 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_11940 10159 9452 gene locus_tag LOCUS_11950 10159 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11950 >Feature sequence44 451 756 gene locus_tag LOCUS_11960 gene ortA 451 756 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860811.1 protein_id gnl|my_center|LOCUS_11960 758 2173 gene locus_tag LOCUS_11970 gene ortB 758 2173 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 protein_id gnl|my_center|LOCUS_11970 2173 2541 gene locus_tag LOCUS_11980 2173 2541 CDS product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 protein_id gnl|my_center|LOCUS_11980 2538 4796 gene locus_tag LOCUS_11990 gene oraE 2538 4796 CDS product D-ornithine 4,5-aminomutase subunit OraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895465.1 protein_id gnl|my_center|LOCUS_11990 4786 6153 gene locus_tag LOCUS_12000 4786 6153 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_12000 6150 7229 gene locus_tag LOCUS_12010 6150 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 7219 8625 gene locus_tag LOCUS_12020 gene amrA 7219 8625 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_12020 8651 9664 gene locus_tag LOCUS_12030 gene amrS 8651 9664 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence45 717 454 gene locus_tag LOCUS_12040 gene cas2 717 454 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817554.1 protein_id gnl|my_center|LOCUS_12040 1858 863 gene locus_tag LOCUS_12050 gene cas1b 1858 863 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817555.1 protein_id gnl|my_center|LOCUS_12050 2550 1993 gene locus_tag LOCUS_12060 gene cas4 2550 1993 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460582.1 protein_id gnl|my_center|LOCUS_12060 4829 2601 gene locus_tag LOCUS_12070 4829 2601 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_12070 5499 4780 gene locus_tag LOCUS_12080 gene cas5b 5499 4780 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082347.1 protein_id gnl|my_center|LOCUS_12080 6401 5496 gene locus_tag LOCUS_12090 gene cas7b 6401 5496 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082348.1 protein_id gnl|my_center|LOCUS_12090 6859 6419 gene locus_tag LOCUS_12100 6859 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 8289 6862 gene locus_tag LOCUS_12110 8289 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 9134 8367 gene locus_tag LOCUS_12120 gene cas6 9134 8367 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272867.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence46 1632 460 gene locus_tag LOCUS_12130 1632 460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_12130 3324 1681 gene locus_tag LOCUS_12140 3324 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3759 5381 gene locus_tag LOCUS_12150 gene speA 3759 5381 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244780.1 protein_id gnl|my_center|LOCUS_12150 5366 6058 gene locus_tag LOCUS_12160 gene tmk 5366 6058 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_12160 6055 6381 gene locus_tag LOCUS_12170 6055 6381 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832200.1 protein_id gnl|my_center|LOCUS_12170 6417 7415 gene locus_tag LOCUS_12180 gene holB 6417 7415 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169577.1 protein_id gnl|my_center|LOCUS_12180 7457 8263 gene locus_tag LOCUS_12190 7457 8263 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_12190 8263 9015 gene locus_tag LOCUS_12200 gene rsmI 8263 9015 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_12200 9340 9071 gene locus_tag LOCUS_12210 9340 9071 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence47 <1 155 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq catccctcataggtaggctaagac 658 395 gene locus_tag LOCUS_12220 gene cas2 658 395 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013193.1 protein_id gnl|my_center|LOCUS_12220 1723 728 gene locus_tag LOCUS_12230 gene cas1b 1723 728 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817555.1 protein_id gnl|my_center|LOCUS_12230 2358 1801 gene locus_tag LOCUS_12240 gene cas4 2358 1801 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460582.1 protein_id gnl|my_center|LOCUS_12240 4681 2414 gene locus_tag LOCUS_12250 4681 2414 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_12250 5351 4632 gene locus_tag LOCUS_12260 gene cas5b 5351 4632 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082347.1 protein_id gnl|my_center|LOCUS_12260 6253 5348 gene locus_tag LOCUS_12270 gene cas7b 6253 5348 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082348.1 protein_id gnl|my_center|LOCUS_12270 6712 6272 gene locus_tag LOCUS_12280 6712 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 7083 6715 gene locus_tag LOCUS_12290 7083 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 8995 8225 gene locus_tag LOCUS_12300 gene cas6 8995 8225 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272867.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence48 1575 436 gene locus_tag LOCUS_12310 1575 436 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949066.1 protein_id gnl|my_center|LOCUS_12310 1867 1613 gene locus_tag LOCUS_12320 1867 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1788 2711 gene locus_tag LOCUS_12330 1788 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2722 3807 gene locus_tag LOCUS_12340 2722 3807 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_12340 3822 4145 gene locus_tag LOCUS_12350 3822 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4142 4684 gene locus_tag LOCUS_12360 4142 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 4737 5279 gene locus_tag LOCUS_12370 4737 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 5276 5827 gene locus_tag LOCUS_12380 5276 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 5866 6921 gene locus_tag LOCUS_12390 5866 6921 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_12390 7544 7020 gene locus_tag LOCUS_12400 7544 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 8634 7621 gene locus_tag LOCUS_12410 8634 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 9252 9177 gene locus_tag LOCUS_t00330 9252 9177 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9337 9264 gene locus_tag LOCUS_t00340 9337 9264 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence49 637 2130 gene locus_tag LOCUS_12420 637 2130 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_12420 2133 2804 gene locus_tag LOCUS_12430 2133 2804 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272632.1 protein_id gnl|my_center|LOCUS_12430 2880 3344 gene locus_tag LOCUS_12440 2880 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3492 3977 gene locus_tag LOCUS_12450 3492 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3980 5755 gene locus_tag LOCUS_12460 3980 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 5769 6110 gene locus_tag LOCUS_12470 5769 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 6236 6760 gene locus_tag LOCUS_12480 6236 6760 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_12480 6822 7388 gene locus_tag LOCUS_12490 6822 7388 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_12490 7366 7737 gene locus_tag LOCUS_12500 7366 7737 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence50 482 691 gene locus_tag LOCUS_12510 482 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1540 731 gene locus_tag LOCUS_12520 1540 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1795 2379 gene locus_tag LOCUS_12530 1795 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2581 5448 gene locus_tag LOCUS_12540 2581 5448 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054625.1 protein_id gnl|my_center|LOCUS_12540 5597 6568 gene locus_tag LOCUS_12550 gene cysK 5597 6568 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393469.1 protein_id gnl|my_center|LOCUS_12550 7627 6662 gene locus_tag LOCUS_12560 7627 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence51 631 810 gene locus_tag LOCUS_12570 631 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1544 879 gene locus_tag LOCUS_12580 1544 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1849 1562 gene locus_tag LOCUS_12590 1849 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 5173 2003 gene locus_tag LOCUS_12600 5173 2003 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392203.1 protein_id gnl|my_center|LOCUS_12600 5537 5929 gene locus_tag LOCUS_12610 5537 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5991 6353 gene locus_tag LOCUS_12620 5991 6353 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813961.1 protein_id gnl|my_center|LOCUS_12620 6603 7112 gene locus_tag LOCUS_12630 6603 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 7667 7101 gene locus_tag LOCUS_12640 7667 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 8267 7752 gene locus_tag LOCUS_12650 8267 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence52 472 107 gene locus_tag LOCUS_12660 gene rplR 472 107 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_12660 1034 501 gene locus_tag LOCUS_12670 gene rplF 1034 501 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966397.1 protein_id gnl|my_center|LOCUS_12670 1452 1057 gene locus_tag LOCUS_12680 gene rpsH 1452 1057 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_12680 1652 1467 gene locus_tag LOCUS_12690 1652 1467 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_12690 2216 1665 gene locus_tag LOCUS_12700 gene rplE 2216 1665 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393925.1 protein_id gnl|my_center|LOCUS_12700 2524 2213 gene locus_tag LOCUS_12710 gene rplX 2524 2213 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_12710 2916 2548 gene locus_tag LOCUS_12720 gene rplN 2916 2548 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_12720 3191 2913 gene locus_tag LOCUS_12730 gene rpsQ 3191 2913 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421156.1 protein_id gnl|my_center|LOCUS_12730 3404 3195 gene locus_tag LOCUS_12740 gene rpmC 3404 3195 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357691.1 protein_id gnl|my_center|LOCUS_12740 3846 3385 gene locus_tag LOCUS_12750 gene rplP 3846 3385 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_12750 4506 3850 gene locus_tag LOCUS_12760 gene rpsC 4506 3850 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_12760 4852 4511 gene locus_tag LOCUS_12770 gene rplV 4852 4511 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048353.1 protein_id gnl|my_center|LOCUS_12770 5155 4871 gene locus_tag LOCUS_12780 gene rpsS 5155 4871 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_12780 5815 5180 gene locus_tag LOCUS_12790 gene rplB 5815 5180 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_12790 6323 6033 gene locus_tag LOCUS_12800 gene rplW 6323 6033 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_12800 6943 6320 gene locus_tag LOCUS_12810 gene rplD 6943 6320 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_12810 7588 6968 gene locus_tag LOCUS_12820 gene rplC 7588 6968 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393937.1 protein_id gnl|my_center|LOCUS_12820 7940 7620 gene locus_tag LOCUS_12830 gene rpsJ 7940 7620 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_12830 8068 7937 gene locus_tag LOCUS_12840 8068 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence53 2662 374 gene locus_tag LOCUS_12850 2662 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3388 2663 gene locus_tag LOCUS_12860 3388 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 4233 3391 gene locus_tag LOCUS_12870 4233 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 <7079 4245 gene locus_tag LOCUS_12880 <7079 4245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047792.1:phage tail tape measure protein >Feature sequence54 497 1303 gene locus_tag LOCUS_12890 497 1303 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015684.1 protein_id gnl|my_center|LOCUS_12890 1564 1382 gene locus_tag LOCUS_12900 1564 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2072 1506 gene locus_tag LOCUS_12910 2072 1506 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986538.1 protein_id gnl|my_center|LOCUS_12910 3288 2203 gene locus_tag LOCUS_12920 3288 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3859 5280 gene locus_tag LOCUS_12930 3859 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6824 6411 gene locus_tag LOCUS_12940 6824 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence55 79 1797 gene locus_tag LOCUS_12950 79 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1894 2823 gene locus_tag LOCUS_12960 gene oppB 1894 2823 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_12960 2827 3750 gene locus_tag LOCUS_12970 2827 3750 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048146.1 protein_id gnl|my_center|LOCUS_12970 3764 4852 gene locus_tag LOCUS_12980 3764 4852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966892.1 protein_id gnl|my_center|LOCUS_12980 4845 5798 gene locus_tag LOCUS_12990 4845 5798 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966891.1 protein_id gnl|my_center|LOCUS_12990 6402 6010 gene locus_tag LOCUS_13000 6402 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence56 550 2181 gene locus_tag LOCUS_13010 gene pruA 550 2181 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_13010 2414 4009 gene locus_tag LOCUS_13020 2414 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 4348 5931 gene locus_tag LOCUS_13030 4348 5931 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence57 382 2820 gene locus_tag LOCUS_13040 382 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2831 4837 gene locus_tag LOCUS_13050 2831 4837 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761956.1 protein_id gnl|my_center|LOCUS_13050 5488 6138 gene locus_tag LOCUS_13060 5488 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence58 445 936 gene locus_tag LOCUS_13070 445 936 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167022.1 protein_id gnl|my_center|LOCUS_13070 2354 975 gene locus_tag LOCUS_13080 2354 975 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682416.1 protein_id gnl|my_center|LOCUS_13080 2607 4457 gene locus_tag LOCUS_13090 2607 4457 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947911.1 protein_id gnl|my_center|LOCUS_13090 4681 4460 gene locus_tag LOCUS_13100 4681 4460 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence59 916 650 gene locus_tag LOCUS_13110 916 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1127 2398 gene locus_tag LOCUS_13120 gene mnmA 1127 2398 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460325.1 protein_id gnl|my_center|LOCUS_13120 2723 4231 gene locus_tag LOCUS_13130 2723 4231 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867262.1 protein_id gnl|my_center|LOCUS_13130 4203 5045 gene locus_tag LOCUS_13140 4203 5045 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence60 1982 627 gene locus_tag LOCUS_13150 1982 627 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_13150 2350 3504 gene locus_tag LOCUS_13160 2350 3504 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence61 306 2039 gene locus_tag LOCUS_13170 gene dnaX 306 2039 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121572.1 protein_id gnl|my_center|LOCUS_13170 2055 2384 gene locus_tag LOCUS_13180 2055 2384 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_13180 2389 2994 gene locus_tag LOCUS_13190 gene recR 2389 2994 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_13190 3167 3922 gene locus_tag LOCUS_13200 3167 3922 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 protein_id gnl|my_center|LOCUS_13200 <4886 4044 gene locus_tag LOCUS_13210 <4886 4044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437125.1:cation diffusion facilitator family transporter >Feature sequence62 1092 241 gene locus_tag LOCUS_13220 1092 241 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811618.1 protein_id gnl|my_center|LOCUS_13220 2538 1429 gene locus_tag LOCUS_13230 2538 1429 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868879.1 protein_id gnl|my_center|LOCUS_13230 3643 2531 gene locus_tag LOCUS_13240 3643 2531 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_13240 <4278 3640 gene locus_tag LOCUS_13250 <4278 3640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868877.1:sugar ABC transporter ATP-binding protein >Feature sequence63 1098 322 gene locus_tag LOCUS_13260 1098 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1432 1187 gene locus_tag LOCUS_13270 1432 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1612 1466 gene locus_tag LOCUS_13280 1612 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1794 1663 gene locus_tag LOCUS_13290 1794 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 2874 1876 gene locus_tag LOCUS_13300 2874 1876 CDS product protein rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222005.1 protein_id gnl|my_center|LOCUS_13300 <4230 3161 gene locus_tag LOCUS_13310 <4230 3161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000122374.1:MobV family relaxase >Feature sequence64 443 120 gene locus_tag LOCUS_13320 443 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 769 440 gene locus_tag LOCUS_13330 769 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1238 894 gene locus_tag LOCUS_13340 1238 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2223 1156 gene locus_tag LOCUS_13350 2223 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 2774 2226 gene locus_tag LOCUS_13360 2774 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3095 2784 gene locus_tag LOCUS_13370 3095 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 3711 3106 gene locus_tag LOCUS_13380 3711 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 4003 3713 gene locus_tag LOCUS_13390 4003 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence65 1059 865 gene locus_tag LOCUS_13400 1059 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1241 1053 gene locus_tag LOCUS_13410 1241 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1761 1531 gene locus_tag LOCUS_13420 1761 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2734 1754 gene locus_tag LOCUS_13430 2734 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2993 2748 gene locus_tag LOCUS_13440 2993 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence66 720 97 gene locus_tag LOCUS_13450 720 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1572 736 gene locus_tag LOCUS_13460 1572 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2257 1595 gene locus_tag LOCUS_13470 2257 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3085 2303 gene locus_tag LOCUS_13480 3085 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256164.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence67 2567 594 gene locus_tag LOCUS_13490 gene thrS 2567 594 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence68 320 691 gene locus_tag LOCUS_13500 320 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 691 2478 gene locus_tag LOCUS_13510 691 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2483 3013 gene locus_tag LOCUS_13520 2483 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence69 570 400 gene locus_tag LOCUS_13530 570 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1066 914 gene locus_tag LOCUS_13540 1066 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2438 1362 gene locus_tag LOCUS_13550 2438 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence70 1164 493 gene locus_tag LOCUS_13560 1164 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1517 1164 gene locus_tag LOCUS_13570 1517 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272167.1 protein_id gnl|my_center|LOCUS_13570 2440 1538 gene locus_tag LOCUS_13580 2440 1538 CDS product DUF6045 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272168.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence71 855 502 gene locus_tag LOCUS_13590 855 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1042 1167 gene locus_tag LOCUS_13600 1042 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1928 1257 gene locus_tag LOCUS_13610 1928 1257 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197905.1 protein_id gnl|my_center|LOCUS_13610 <2629 1874 gene locus_tag LOCUS_13620 <2629 1874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949041.1:RluA family pseudouridine synthase >Feature sequence72 1277 2458 gene locus_tag LOCUS_13630 1277 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 2567 2493 gene locus_tag LOCUS_t00350 2567 2493 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence73 >Feature sequence74 379 8 gene locus_tag LOCUS_13640 379 8 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459275.1 protein_id gnl|my_center|LOCUS_13640 648 2087 gene locus_tag LOCUS_13650 648 2087 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence75 2219 1059 gene locus_tag LOCUS_13660 2219 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence76 214 1458 gene locus_tag LOCUS_13670 214 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1532 2146 gene locus_tag LOCUS_13680 1532 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence77 523 230 gene locus_tag LOCUS_13690 523 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1008 565 gene locus_tag LOCUS_13700 1008 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence78 1354 659 gene locus_tag LOCUS_13710 1354 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence79 119 742 gene locus_tag LOCUS_13720 119 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence80 1915 1520 gene locus_tag LOCUS_13730 1915 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence81 <1934 677 gene locus_tag LOCUS_13740 <1934 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932291.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase >Feature sequence82 >Feature sequence83 595 260 gene locus_tag LOCUS_13750 595 260 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392924.1 protein_id gnl|my_center|LOCUS_13750 1095 592 gene locus_tag LOCUS_13760 1095 592 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393157.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence84 407 1786 gene locus_tag LOCUS_13770 407 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence85 565 885 gene locus_tag LOCUS_13780 565 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13780 1047 1676 gene locus_tag LOCUS_13790 1047 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13790 >Feature sequence86 243 953 gene locus_tag LOCUS_13800 243 953 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_13800 1455 1021 gene locus_tag LOCUS_13810 1455 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence87 >Feature sequence88 198 443 gene locus_tag LOCUS_13820 198 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066280.1 protein_id gnl|my_center|LOCUS_13820 428 700 gene locus_tag LOCUS_13830 428 700 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052725800.1 protein_id gnl|my_center|LOCUS_13830