>Feature sequence001 638 438 gene locus_tag LOCUS_00010 638 438 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393002.1 protein_id gnl|my_center|LOCUS_00010 1766 993 gene locus_tag LOCUS_00020 gene sigF 1766 993 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460233.1 protein_id gnl|my_center|LOCUS_00020 2243 1770 gene locus_tag LOCUS_00030 gene spoIIAB 2243 1770 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393006.1 protein_id gnl|my_center|LOCUS_00030 2592 2215 gene locus_tag LOCUS_00040 gene spoIIAA 2592 2215 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398633.1 protein_id gnl|my_center|LOCUS_00040 3996 2809 gene locus_tag LOCUS_00050 gene dacF 3996 2809 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831985.1 protein_id gnl|my_center|LOCUS_00050 5354 4065 gene locus_tag LOCUS_00060 gene deoB 5354 4065 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230444.1 protein_id gnl|my_center|LOCUS_00060 6335 5445 gene locus_tag LOCUS_00070 gene xerD 6335 5445 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_00070 7905 6787 gene locus_tag LOCUS_00080 gene ald 7905 6787 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459459.1 protein_id gnl|my_center|LOCUS_00080 8791 8195 gene locus_tag LOCUS_00090 gene spoIIM 8791 8195 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398593.1 protein_id gnl|my_center|LOCUS_00090 10260 8935 gene locus_tag LOCUS_00100 10260 8935 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246128.1 protein_id gnl|my_center|LOCUS_00100 10873 10202 gene locus_tag LOCUS_00110 10873 10202 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325125.1 protein_id gnl|my_center|LOCUS_00110 12173 10848 gene locus_tag LOCUS_00120 12173 10848 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896132.1 protein_id gnl|my_center|LOCUS_00120 12960 12163 gene locus_tag LOCUS_00130 12960 12163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272208.1 protein_id gnl|my_center|LOCUS_00130 14060 13176 gene locus_tag LOCUS_00140 14060 13176 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419210.1 protein_id gnl|my_center|LOCUS_00140 14815 14078 gene locus_tag LOCUS_00150 14815 14078 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438150.1 protein_id gnl|my_center|LOCUS_00150 15647 14787 gene locus_tag LOCUS_00160 15647 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16771 15644 gene locus_tag LOCUS_00170 gene steA 16771 15644 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_00170 17703 16930 gene locus_tag LOCUS_00180 gene spo0A 17703 16930 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_00180 19303 17963 gene locus_tag LOCUS_00190 gene spoIVB 19303 17963 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393015.1 protein_id gnl|my_center|LOCUS_00190 21317 19593 gene locus_tag LOCUS_00200 gene recN 21317 19593 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947750.1 protein_id gnl|my_center|LOCUS_00200 21820 21359 gene locus_tag LOCUS_00210 gene argR 21820 21359 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_00210 22861 21953 gene locus_tag LOCUS_00220 22861 21953 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_00220 23902 23000 gene locus_tag LOCUS_00230 23902 23000 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_00230 25824 23899 gene locus_tag LOCUS_00240 gene dxs 25824 23899 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_00240 26585 25971 gene locus_tag LOCUS_00250 26585 25971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393021.1 protein_id gnl|my_center|LOCUS_00250 28183 27404 gene locus_tag LOCUS_00260 28183 27404 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810943.1 protein_id gnl|my_center|LOCUS_00260 28401 28213 gene locus_tag LOCUS_00270 28401 28213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28728 28429 gene locus_tag LOCUS_00280 28728 28429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29936 28710 gene locus_tag LOCUS_00290 gene xseA 29936 28710 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393024.1 protein_id gnl|my_center|LOCUS_00290 30781 29942 gene locus_tag LOCUS_00300 gene folD 30781 29942 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_00300 32263 30875 gene locus_tag LOCUS_00310 gene gltA 32263 30875 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_00310 33099 32260 gene locus_tag LOCUS_00320 33099 32260 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_00320 33679 33209 gene locus_tag LOCUS_00330 gene nusB 33679 33209 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_00330 33947 33768 gene locus_tag LOCUS_00340 33947 33768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 34547 34002 gene locus_tag LOCUS_00350 34547 34002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 34957 34547 gene locus_tag LOCUS_00360 34957 34547 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_00360 35882 35208 gene locus_tag LOCUS_00370 35882 35208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36512 35886 gene locus_tag LOCUS_00380 36512 35886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 37394 36624 gene locus_tag LOCUS_00390 37394 36624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 38704 37421 gene locus_tag LOCUS_00400 gene spoIIIAE 38704 37421 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230230.1 protein_id gnl|my_center|LOCUS_00400 39130 38744 gene locus_tag LOCUS_00410 gene spoIIIAD 39130 38744 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359080.1 protein_id gnl|my_center|LOCUS_00410 39354 39157 gene locus_tag LOCUS_00420 gene spoIIIAC 39354 39157 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_00420 39887 39366 gene locus_tag LOCUS_00430 39887 39366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 41091 39778 gene locus_tag LOCUS_00440 41091 39778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 42092 41484 gene locus_tag LOCUS_00450 42092 41484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 42710 42150 gene locus_tag LOCUS_00460 gene efp 42710 42150 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_00460 43916 42729 gene locus_tag LOCUS_00470 43916 42729 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942664.1 protein_id gnl|my_center|LOCUS_00470 >Feature sequence002 1816 914 gene locus_tag LOCUS_00480 gene noc 1816 914 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_00480 2885 2106 gene locus_tag LOCUS_00490 gene rsmG 2885 2106 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393994.1 protein_id gnl|my_center|LOCUS_00490 4809 2959 gene locus_tag LOCUS_00500 gene mnmG 4809 2959 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393995.1 protein_id gnl|my_center|LOCUS_00500 6401 4815 gene locus_tag LOCUS_00510 gene mnmE 6401 4815 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_00510 7240 6617 gene locus_tag LOCUS_00520 7240 6617 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393997.1 protein_id gnl|my_center|LOCUS_00520 7905 7261 gene locus_tag LOCUS_00530 gene spoIIIJ 7905 7261 CDS product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727748.1 protein_id gnl|my_center|LOCUS_00530 8153 7920 gene locus_tag LOCUS_00540 gene yidD 8153 7920 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869455.1 protein_id gnl|my_center|LOCUS_00540 8528 8187 gene locus_tag LOCUS_00550 gene rnpA 8528 8187 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_00550 9139 10503 gene locus_tag LOCUS_00560 gene dnaA 9139 10503 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_00560 10814 10566 gene locus_tag LOCUS_00570 10814 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 11215 12363 gene locus_tag LOCUS_00580 gene dnaN 11215 12363 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_00580 12377 13672 gene locus_tag LOCUS_00590 gene recF 12377 13672 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_00590 13973 14395 gene locus_tag LOCUS_00600 13973 14395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 14498 14758 gene locus_tag LOCUS_00610 14498 14758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 14745 16649 gene locus_tag LOCUS_00620 gene gyrB 14745 16649 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_00620 16697 19141 gene locus_tag LOCUS_00630 gene gyrA 16697 19141 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_00630 19119 19610 gene locus_tag LOCUS_00640 19119 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 19658 21133 gene locus_tag LOCUS_00650 19658 21133 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582544.1 protein_id gnl|my_center|LOCUS_00650 21341 22000 gene locus_tag LOCUS_00660 21341 22000 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583891.1 protein_id gnl|my_center|LOCUS_00660 22104 22913 gene locus_tag LOCUS_00670 22104 22913 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_00670 22910 24130 gene locus_tag LOCUS_00680 gene mtnA 22910 24130 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_00680 24123 25481 gene locus_tag LOCUS_00690 gene serS 24123 25481 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947906.1 protein_id gnl|my_center|LOCUS_00690 25748 25837 gene locus_tag LOCUS_t00010 25748 25837 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25895 25987 gene locus_tag LOCUS_t00020 25895 25987 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 26115 26190 gene locus_tag LOCUS_t00030 26115 26190 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26230 26306 gene locus_tag LOCUS_t00040 26230 26306 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26425 26889 gene locus_tag LOCUS_00700 gene tadA 26425 26889 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391574.1 protein_id gnl|my_center|LOCUS_00700 26958 27050 gene locus_tag LOCUS_t00050 26958 27050 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27077 27169 gene locus_tag LOCUS_t00060 27077 27169 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27461 29362 gene locus_tag LOCUS_00710 27461 29362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 29387 29728 gene locus_tag LOCUS_00720 29387 29728 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_00720 29728 30333 gene locus_tag LOCUS_00730 gene recR 29728 30333 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_00730 30532 30831 gene locus_tag LOCUS_00740 30532 30831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 30847 31032 gene locus_tag LOCUS_00750 30847 31032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 31063 31338 gene locus_tag LOCUS_00760 31063 31338 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391580.1 protein_id gnl|my_center|LOCUS_00760 31499 32083 gene locus_tag LOCUS_00770 31499 32083 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_00770 32080 32514 gene locus_tag LOCUS_00780 32080 32514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 32517 33698 gene locus_tag LOCUS_00790 32517 33698 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_00790 33834 34769 gene locus_tag LOCUS_00800 33834 34769 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_00800 34851 36344 gene locus_tag LOCUS_00810 gene gltX 34851 36344 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_00810 36476 36550 gene locus_tag LOCUS_t00070 36476 36550 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 36896 37345 gene locus_tag LOCUS_00820 36896 37345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 37573 38079 gene locus_tag LOCUS_00830 37573 38079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 38249 38324 gene locus_tag LOCUS_t00080 38249 38324 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence003 3084 1945 gene locus_tag LOCUS_00840 3084 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 3403 4437 gene locus_tag LOCUS_00850 3403 4437 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895580.1 protein_id gnl|my_center|LOCUS_00850 4573 5739 gene locus_tag LOCUS_00860 4573 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 5819 6619 gene locus_tag LOCUS_00870 5819 6619 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_00870 6864 6727 gene locus_tag LOCUS_00880 6864 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 6969 8459 gene locus_tag LOCUS_00890 gene alaP 6969 8459 CDS product alanine permease AlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229105.1 protein_id gnl|my_center|LOCUS_00890 8965 8456 gene locus_tag LOCUS_00900 gene ilvN 8965 8456 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810756.1 protein_id gnl|my_center|LOCUS_00900 10795 8981 gene locus_tag LOCUS_00910 gene ilvB 10795 8981 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944692.1 protein_id gnl|my_center|LOCUS_00910 11760 12389 gene locus_tag LOCUS_00920 11760 12389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 13767 12523 gene locus_tag LOCUS_00930 gene ltrA 13767 12523 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_00930 15433 14561 gene locus_tag LOCUS_00940 15433 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 15986 15663 gene locus_tag LOCUS_00950 15986 15663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 18102 16456 gene locus_tag LOCUS_00960 18102 16456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 18616 18380 gene locus_tag LOCUS_00970 18616 18380 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_00970 20321 18651 gene locus_tag LOCUS_00980 20321 18651 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125454.1 protein_id gnl|my_center|LOCUS_00980 20606 20403 gene locus_tag LOCUS_00990 20606 20403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 20944 20669 gene locus_tag LOCUS_01000 20944 20669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 21566 21117 gene locus_tag LOCUS_01010 21566 21117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 22673 21669 gene locus_tag LOCUS_01020 22673 21669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 23819 22677 gene locus_tag LOCUS_01030 23819 22677 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_01030 24889 23852 gene locus_tag LOCUS_01040 gene aroF 24889 23852 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_01040 27594 25558 gene locus_tag LOCUS_01050 27594 25558 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392347.1 protein_id gnl|my_center|LOCUS_01050 28425 27664 gene locus_tag LOCUS_01060 28425 27664 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_01060 29438 28698 gene locus_tag LOCUS_01070 29438 28698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 29682 31091 gene locus_tag LOCUS_01080 29682 31091 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_01080 32355 31015 gene locus_tag LOCUS_01090 32355 31015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 33784 32339 gene locus_tag LOCUS_01100 gene putP 33784 32339 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 protein_id gnl|my_center|LOCUS_01100 34112 33909 gene locus_tag LOCUS_01110 34112 33909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 34768 34274 gene locus_tag LOCUS_01120 34768 34274 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_01120 35697 34804 gene locus_tag LOCUS_01130 35697 34804 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_01130 38135 35694 gene locus_tag LOCUS_01140 38135 35694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01140 >Feature sequence004 1889 582 gene locus_tag LOCUS_01150 1889 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 3635 1890 gene locus_tag LOCUS_01160 3635 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 4712 3768 gene locus_tag LOCUS_01170 gene prmC 4712 3768 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_01170 5793 4693 gene locus_tag LOCUS_01180 gene prfA 5793 4693 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199033.1 protein_id gnl|my_center|LOCUS_01180 7095 5914 gene locus_tag LOCUS_01190 7095 5914 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_01190 7282 7070 gene locus_tag LOCUS_01200 gene rpmE 7282 7070 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462249.1 protein_id gnl|my_center|LOCUS_01200 8804 7524 gene locus_tag LOCUS_01210 gene rho 8804 7524 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393879.1 protein_id gnl|my_center|LOCUS_01210 9715 9068 gene locus_tag LOCUS_01220 gene fsa 9715 9068 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356970.1 protein_id gnl|my_center|LOCUS_01220 10471 9719 gene locus_tag LOCUS_01230 10471 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393882.1 protein_id gnl|my_center|LOCUS_01230 15255 10570 gene locus_tag LOCUS_01240 15255 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 16382 15252 gene locus_tag LOCUS_01250 16382 15252 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391791.1 protein_id gnl|my_center|LOCUS_01250 17120 17992 gene locus_tag LOCUS_01260 17120 17992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 19014 18013 gene locus_tag LOCUS_01270 19014 18013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 19672 19259 gene locus_tag LOCUS_01280 19672 19259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 19905 21194 gene locus_tag LOCUS_01290 19905 21194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 21259 22794 gene locus_tag LOCUS_01300 21259 22794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 23159 22722 gene locus_tag LOCUS_01310 23159 22722 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392341.1 protein_id gnl|my_center|LOCUS_01310 23458 24078 gene locus_tag LOCUS_01320 23458 24078 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251082.1 protein_id gnl|my_center|LOCUS_01320 24266 25726 gene locus_tag LOCUS_01330 gene mttB 24266 25726 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_01330 25723 27882 gene locus_tag LOCUS_01340 25723 27882 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271940.1 protein_id gnl|my_center|LOCUS_01340 27882 28634 gene locus_tag LOCUS_01350 27882 28634 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392826.1 protein_id gnl|my_center|LOCUS_01350 28703 30163 gene locus_tag LOCUS_01360 gene mttB 28703 30163 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_01360 30330 30614 gene locus_tag LOCUS_01370 30330 30614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 31209 30694 gene locus_tag LOCUS_01380 31209 30694 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986929.1 protein_id gnl|my_center|LOCUS_01380 31991 31476 gene locus_tag LOCUS_01390 31991 31476 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932755.1 protein_id gnl|my_center|LOCUS_01390 32973 32200 gene locus_tag LOCUS_01400 32973 32200 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228886.1 protein_id gnl|my_center|LOCUS_01400 34290 33124 gene locus_tag LOCUS_01410 gene ahcY 34290 33124 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_01410 34635 35849 gene locus_tag LOCUS_01420 gene argC 34635 35849 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence005 1164 106 gene locus_tag LOCUS_01430 gene fabD 1164 106 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_01430 2276 1275 gene locus_tag LOCUS_01440 2276 1275 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_01440 3384 2269 gene locus_tag LOCUS_01450 gene plsX 3384 2269 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774380.1 protein_id gnl|my_center|LOCUS_01450 4043 3381 gene locus_tag LOCUS_01460 gene fapR 4043 3381 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813404.1 protein_id gnl|my_center|LOCUS_01460 4215 4817 gene locus_tag LOCUS_01470 gene rsmD 4215 4817 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_01470 4836 5312 gene locus_tag LOCUS_01480 gene coaD 4836 5312 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_01480 5360 6013 gene locus_tag LOCUS_01490 5360 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 7420 6041 gene locus_tag LOCUS_01500 gene spoVV 7420 6041 CDS product dipicolinic acid transporter SpoVV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245492.1 protein_id gnl|my_center|LOCUS_01500 7679 8275 gene locus_tag LOCUS_01510 7679 8275 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_01510 8634 9104 gene locus_tag LOCUS_01520 8634 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 9076 10776 gene locus_tag LOCUS_01530 9076 10776 CDS product IS200/IS605 family accessory protein TnpB-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147776474.1 protein_id gnl|my_center|LOCUS_01530 12436 11243 gene locus_tag LOCUS_01540 12436 11243 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392745.1 protein_id gnl|my_center|LOCUS_01540 13267 12551 gene locus_tag LOCUS_01550 13267 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 14289 13288 gene locus_tag LOCUS_01560 14289 13288 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256595.1 protein_id gnl|my_center|LOCUS_01560 14509 14829 gene locus_tag LOCUS_01570 14509 14829 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355819.1 protein_id gnl|my_center|LOCUS_01570 14862 16673 gene locus_tag LOCUS_01580 14862 16673 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941459.1 protein_id gnl|my_center|LOCUS_01580 16719 16943 gene locus_tag LOCUS_01590 16719 16943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 16948 17553 gene locus_tag LOCUS_01600 16948 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 17631 18779 gene locus_tag LOCUS_01610 17631 18779 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_01610 19084 18830 gene locus_tag LOCUS_01620 19084 18830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 19083 20282 gene locus_tag LOCUS_01630 19083 20282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 21201 20188 gene locus_tag LOCUS_01640 gene mch 21201 20188 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871160.1 protein_id gnl|my_center|LOCUS_01640 21751 21239 gene locus_tag LOCUS_01650 21751 21239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 21897 22955 gene locus_tag LOCUS_01660 21897 22955 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_01660 23946 22945 gene locus_tag LOCUS_01670 gene gpr 23946 22945 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_01670 24273 25451 gene locus_tag LOCUS_01680 24273 25451 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_01680 25658 26302 gene locus_tag LOCUS_01690 25658 26302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 26565 26314 gene locus_tag LOCUS_01700 26565 26314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 27186 26812 gene locus_tag LOCUS_01710 27186 26812 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_01710 27569 27760 gene locus_tag LOCUS_01720 gene rpmB 27569 27760 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392437.1 protein_id gnl|my_center|LOCUS_01720 28707 28276 gene locus_tag LOCUS_01730 28707 28276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 29490 28795 gene locus_tag LOCUS_01740 gene rpe 29490 28795 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 protein_id gnl|my_center|LOCUS_01740 30404 29466 gene locus_tag LOCUS_01750 gene rsgA 30404 29466 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392430.1 protein_id gnl|my_center|LOCUS_01750 32655 30583 gene locus_tag LOCUS_01760 gene pknB 32655 30583 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460521.1 protein_id gnl|my_center|LOCUS_01760 33462 32689 gene locus_tag LOCUS_01770 33462 32689 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_01770 34836 33463 gene locus_tag LOCUS_01780 gene rsmB 34836 33463 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_01780 35544 34861 gene locus_tag LOCUS_01790 35544 34861 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965031.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence006 1248 697 gene locus_tag LOCUS_01800 1248 697 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391746.1 protein_id gnl|my_center|LOCUS_01800 3459 3124 gene locus_tag LOCUS_01810 3459 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 4519 5814 gene locus_tag LOCUS_01820 4519 5814 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 protein_id gnl|my_center|LOCUS_01820 6711 5953 gene locus_tag LOCUS_01830 6711 5953 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719585.1 protein_id gnl|my_center|LOCUS_01830 7687 6893 gene locus_tag LOCUS_01840 7687 6893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_01840 8635 7754 gene locus_tag LOCUS_01850 8635 7754 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856992.1 protein_id gnl|my_center|LOCUS_01850 10034 8937 gene locus_tag LOCUS_01860 10034 8937 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_01860 10551 10117 gene locus_tag LOCUS_01870 10551 10117 CDS product HutP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944588.1 protein_id gnl|my_center|LOCUS_01870 10899 11540 gene locus_tag LOCUS_01880 10899 11540 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_01880 11515 13203 gene locus_tag LOCUS_01890 11515 13203 CDS product IS200/IS605 family accessory protein TnpB-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080495925.1 protein_id gnl|my_center|LOCUS_01890 13511 14890 gene locus_tag LOCUS_01900 13511 14890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 15054 15977 gene locus_tag LOCUS_01910 gene selD 15054 15977 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L4E1 protein_id gnl|my_center|LOCUS_01910 16089 16844 gene locus_tag LOCUS_01920 gene yedF 16089 16844 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391672.1 protein_id gnl|my_center|LOCUS_01920 17237 18265 gene locus_tag LOCUS_01930 17237 18265 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_01930 19447 18254 gene locus_tag LOCUS_01940 19447 18254 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_01940 20404 19679 gene locus_tag LOCUS_01950 20404 19679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01950 21801 20869 gene locus_tag LOCUS_01960 gene dppC 21801 20869 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245702.1 protein_id gnl|my_center|LOCUS_01960 22733 21798 gene locus_tag LOCUS_01970 gene oppB 22733 21798 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_01970 24608 22878 gene locus_tag LOCUS_01980 gene oppA 24608 22878 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232957.1 protein_id gnl|my_center|LOCUS_01980 25231 26154 gene locus_tag LOCUS_01990 25231 26154 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391666.1 protein_id gnl|my_center|LOCUS_01990 26274 27323 gene locus_tag LOCUS_02000 26274 27323 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111816.1 protein_id gnl|my_center|LOCUS_02000 28033 27419 gene locus_tag LOCUS_02010 28033 27419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 29070 28072 gene locus_tag LOCUS_02020 29070 28072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 34047 29344 gene locus_tag LOCUS_02030 34047 29344 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence007 286 1029 gene locus_tag LOCUS_02040 286 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 1962 1072 gene locus_tag LOCUS_02050 1962 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 2326 2586 gene locus_tag LOCUS_02060 2326 2586 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392468.1 protein_id gnl|my_center|LOCUS_02060 2757 6452 gene locus_tag LOCUS_02070 gene smc 2757 6452 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361019.1 protein_id gnl|my_center|LOCUS_02070 6449 7426 gene locus_tag LOCUS_02080 gene ftsY 6449 7426 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_02080 7638 8006 gene locus_tag LOCUS_02090 7638 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903280.1 protein_id gnl|my_center|LOCUS_02090 7996 9351 gene locus_tag LOCUS_02100 gene ffh 7996 9351 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_02100 9540 9815 gene locus_tag LOCUS_02110 gene rpsP 9540 9815 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357434.1 protein_id gnl|my_center|LOCUS_02110 9823 10056 gene locus_tag LOCUS_02120 9823 10056 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_02120 10057 10710 gene locus_tag LOCUS_02130 gene rimM 10057 10710 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_02130 10707 11477 gene locus_tag LOCUS_02140 gene trmD 10707 11477 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_02140 11455 11808 gene locus_tag LOCUS_02150 gene rplS 11455 11808 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_02150 11809 12441 gene locus_tag LOCUS_02160 gene lepB 11809 12441 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_02160 12438 13361 gene locus_tag LOCUS_02170 gene ylqF 12438 13361 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723890.1 protein_id gnl|my_center|LOCUS_02170 13673 14455 gene locus_tag LOCUS_02180 13673 14455 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219685422.1 protein_id gnl|my_center|LOCUS_02180 14463 14849 gene locus_tag LOCUS_02190 14463 14849 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_02190 15048 16859 gene locus_tag LOCUS_02200 15048 16859 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_02200 17064 18233 gene locus_tag LOCUS_02210 17064 18233 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_02210 18559 18284 gene locus_tag LOCUS_02220 18559 18284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 18488 19522 gene locus_tag LOCUS_02230 gene dprA 18488 19522 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02230 19443 21584 gene locus_tag LOCUS_02240 gene topA 19443 21584 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_02240 21581 22930 gene locus_tag LOCUS_02250 gene trmFO 21581 22930 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392541.1 protein_id gnl|my_center|LOCUS_02250 23007 23987 gene locus_tag LOCUS_02260 gene xerD 23007 23987 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_02260 24159 24707 gene locus_tag LOCUS_02270 gene hslV 24159 24707 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938868.1 protein_id gnl|my_center|LOCUS_02270 24761 26176 gene locus_tag LOCUS_02280 gene hslU 24761 26176 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392544.1 protein_id gnl|my_center|LOCUS_02280 26210 26992 gene locus_tag LOCUS_02290 gene codY 26210 26992 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774472.1 protein_id gnl|my_center|LOCUS_02290 27377 27790 gene locus_tag LOCUS_02300 gene flgB 27377 27790 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_02300 27790 28305 gene locus_tag LOCUS_02310 gene flgC 27790 28305 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965463.1 protein_id gnl|my_center|LOCUS_02310 28399 28758 gene locus_tag LOCUS_02320 28399 28758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 28800 30428 gene locus_tag LOCUS_02330 gene fliF 28800 30428 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870079.1 protein_id gnl|my_center|LOCUS_02330 30488 31507 gene locus_tag LOCUS_02340 gene fliG 30488 31507 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556889.1 protein_id gnl|my_center|LOCUS_02340 31565 32653 gene locus_tag LOCUS_02350 31565 32653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 >Feature sequence008 573 863 gene locus_tag LOCUS_02360 573 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 799 1206 gene locus_tag LOCUS_02370 799 1206 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393562.1 protein_id gnl|my_center|LOCUS_02370 1610 3670 gene locus_tag LOCUS_02380 1610 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 3849 5681 gene locus_tag LOCUS_02390 3849 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 5975 5820 gene locus_tag LOCUS_02400 5975 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 6484 6125 gene locus_tag LOCUS_02410 6484 6125 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_02410 6759 6478 gene locus_tag LOCUS_02420 6759 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 7385 6936 gene locus_tag LOCUS_02430 7385 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 7550 9052 gene locus_tag LOCUS_02440 7550 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 9052 12417 gene locus_tag LOCUS_02450 9052 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12509 13867 gene locus_tag LOCUS_02460 12509 13867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 14084 15058 gene locus_tag LOCUS_02470 14084 15058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 15444 16064 gene locus_tag LOCUS_02480 15444 16064 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392053.1 protein_id gnl|my_center|LOCUS_02480 16368 16619 gene locus_tag LOCUS_02490 16368 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 16603 17022 gene locus_tag LOCUS_02500 16603 17022 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393562.1 protein_id gnl|my_center|LOCUS_02500 18605 17064 gene locus_tag LOCUS_02510 18605 17064 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_02510 19509 20870 gene locus_tag LOCUS_02520 19509 20870 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393523.1 protein_id gnl|my_center|LOCUS_02520 20962 21516 gene locus_tag LOCUS_02530 20962 21516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 22576 21647 gene locus_tag LOCUS_02540 22576 21647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 23106 24413 gene locus_tag LOCUS_02550 23106 24413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 24522 27305 gene locus_tag LOCUS_02560 24522 27305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 27410 28033 gene locus_tag LOCUS_02570 27410 28033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 28959 28666 gene locus_tag LOCUS_02580 28959 28666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 28868 33055 gene locus_tag LOCUS_02590 28868 33055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 >Feature sequence009 2516 891 gene locus_tag LOCUS_02600 2516 891 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_02600 3155 2706 gene locus_tag LOCUS_02610 3155 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 5146 3185 gene locus_tag LOCUS_02620 gene argS 5146 3185 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_02620 6193 5246 gene locus_tag LOCUS_02630 gene speE 6193 5246 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393316.1 protein_id gnl|my_center|LOCUS_02630 6280 8364 gene locus_tag LOCUS_02640 6280 8364 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942207.1 protein_id gnl|my_center|LOCUS_02640 8500 9786 gene locus_tag LOCUS_02650 gene htrA 8500 9786 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967069.1 protein_id gnl|my_center|LOCUS_02650 11107 9797 gene locus_tag LOCUS_02660 11107 9797 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_02660 12377 11223 gene locus_tag LOCUS_02670 12377 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 14614 12422 gene locus_tag LOCUS_02680 14614 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 16655 14718 gene locus_tag LOCUS_02690 gene walK 16655 14718 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379340.1 protein_id gnl|my_center|LOCUS_02690 17468 16689 gene locus_tag LOCUS_02700 gene yycF 17468 16689 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_02700 18432 19838 gene locus_tag LOCUS_02710 gene lysA 18432 19838 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280679.1 protein_id gnl|my_center|LOCUS_02710 21396 20074 gene locus_tag LOCUS_02720 21396 20074 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393899.1 protein_id gnl|my_center|LOCUS_02720 22225 23286 gene locus_tag LOCUS_02730 22225 23286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 23428 24141 gene locus_tag LOCUS_02740 23428 24141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 25616 24201 gene locus_tag LOCUS_02750 25616 24201 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_02750 26127 26053 gene locus_tag LOCUS_t00090 26127 26053 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 26413 26339 gene locus_tag LOCUS_t00100 26413 26339 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 26753 26526 gene locus_tag LOCUS_02760 26753 26526 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048105191.1 protein_id gnl|my_center|LOCUS_02760 26983 26756 gene locus_tag LOCUS_02770 26983 26756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 27757 27683 gene locus_tag LOCUS_t00110 27757 27683 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27968 28519 gene locus_tag LOCUS_02780 27968 28519 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_02780 28592 29224 gene locus_tag LOCUS_02790 28592 29224 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 protein_id gnl|my_center|LOCUS_02790 30631 29348 gene locus_tag LOCUS_02800 gene purA 30631 29348 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 protein_id gnl|my_center|LOCUS_02800 32008 30671 gene locus_tag LOCUS_02810 gene dnaB 32008 30671 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391682.1 protein_id gnl|my_center|LOCUS_02810 <32893 32024 gene locus_tag LOCUS_02820 <32893 32024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391681.1:Lon family ATP-dependent protease >Feature sequence010 1206 520 gene locus_tag LOCUS_02830 1206 520 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902228.1 protein_id gnl|my_center|LOCUS_02830 2010 1291 gene locus_tag LOCUS_02840 2010 1291 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_02840 3147 2101 gene locus_tag LOCUS_02850 3147 2101 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_02850 3673 3149 gene locus_tag LOCUS_02860 3673 3149 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_02860 4539 3655 gene locus_tag LOCUS_02870 4539 3655 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532039.1 protein_id gnl|my_center|LOCUS_02870 6809 4530 gene locus_tag LOCUS_02880 6809 4530 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_02880 7132 6806 gene locus_tag LOCUS_02890 7132 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 8862 7135 gene locus_tag LOCUS_02900 8862 7135 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869524.1 protein_id gnl|my_center|LOCUS_02900 9819 8878 gene locus_tag LOCUS_02910 9819 8878 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867336.1 protein_id gnl|my_center|LOCUS_02910 11005 9839 gene locus_tag LOCUS_02920 11005 9839 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887889.1 protein_id gnl|my_center|LOCUS_02920 12080 11019 gene locus_tag LOCUS_02930 12080 11019 CDS product 3-hydroxy-3-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814048.1 protein_id gnl|my_center|LOCUS_02930 14440 12224 gene locus_tag LOCUS_02940 14440 12224 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_02940 15189 14467 gene locus_tag LOCUS_02950 15189 14467 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224884.1 protein_id gnl|my_center|LOCUS_02950 16386 15211 gene locus_tag LOCUS_02960 16386 15211 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868404.1 protein_id gnl|my_center|LOCUS_02960 16814 17122 gene locus_tag LOCUS_02970 16814 17122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 17112 17612 gene locus_tag LOCUS_02980 17112 17612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 19098 17887 gene locus_tag LOCUS_02990 19098 17887 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812525.1 protein_id gnl|my_center|LOCUS_02990 20482 19121 gene locus_tag LOCUS_03000 20482 19121 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809410.1 protein_id gnl|my_center|LOCUS_03000 21293 20574 gene locus_tag LOCUS_03010 21293 20574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 22317 21442 gene locus_tag LOCUS_03020 22317 21442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021222.1 protein_id gnl|my_center|LOCUS_03020 23057 22308 gene locus_tag LOCUS_03030 23057 22308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 23440 23039 gene locus_tag LOCUS_03040 23440 23039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 23979 23770 gene locus_tag LOCUS_03050 23979 23770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 24816 24082 gene locus_tag LOCUS_03060 24816 24082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 25603 25007 gene locus_tag LOCUS_03070 25603 25007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 26246 25656 gene locus_tag LOCUS_03080 26246 25656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 28296 26818 gene locus_tag LOCUS_03090 gene spoIVA 28296 26818 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_03090 30044 28848 gene locus_tag LOCUS_03100 gene gpsA 30044 28848 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005325.1 protein_id gnl|my_center|LOCUS_03100 30784 30143 gene locus_tag LOCUS_03110 gene plsY 30784 30143 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811145.1 protein_id gnl|my_center|LOCUS_03110 <31566 30881 gene locus_tag LOCUS_03120 <31566 30881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392835.1:ribosome biogenesis GTPase Der >Feature sequence011 228 2093 gene locus_tag LOCUS_03130 228 2093 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385259.1 protein_id gnl|my_center|LOCUS_03130 3103 2531 gene locus_tag LOCUS_03140 3103 2531 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392905.1 protein_id gnl|my_center|LOCUS_03140 3461 3204 gene locus_tag LOCUS_03150 3461 3204 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_03150 3679 3497 gene locus_tag LOCUS_03160 3679 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 7320 4003 gene locus_tag LOCUS_03170 7320 4003 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_03170 7582 7340 gene locus_tag LOCUS_03180 7582 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 8992 7583 gene locus_tag LOCUS_03190 8992 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 9165 9779 gene locus_tag LOCUS_03200 gene lexA 9165 9779 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_03200 11214 9799 gene locus_tag LOCUS_03210 11214 9799 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462282.1 protein_id gnl|my_center|LOCUS_03210 11622 12956 gene locus_tag LOCUS_03220 gene gabT 11622 12956 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964736.1 protein_id gnl|my_center|LOCUS_03220 13049 15031 gene locus_tag LOCUS_03230 13049 15031 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227894.1 protein_id gnl|my_center|LOCUS_03230 15424 16194 gene locus_tag LOCUS_03240 15424 16194 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392694.1 protein_id gnl|my_center|LOCUS_03240 16278 17309 gene locus_tag LOCUS_03250 16278 17309 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_03250 17388 18866 gene locus_tag LOCUS_03260 gene nupO 17388 18866 CDS product guanosine ABC transporter ATP-binding protein NupO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228830.1 protein_id gnl|my_center|LOCUS_03260 18854 19927 gene locus_tag LOCUS_03270 18854 19927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_03270 19927 20850 gene locus_tag LOCUS_03280 19927 20850 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_03280 21021 21656 gene locus_tag LOCUS_03290 21021 21656 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424384.1 protein_id gnl|my_center|LOCUS_03290 21649 23550 gene locus_tag LOCUS_03300 gene aor 21649 23550 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_03300 23770 23606 gene locus_tag LOCUS_03310 23770 23606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 24035 23838 gene locus_tag LOCUS_03320 24035 23838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 25786 25151 gene locus_tag LOCUS_03330 25786 25151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 27288 25783 gene locus_tag LOCUS_03340 27288 25783 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_03340 27968 27285 gene locus_tag LOCUS_03350 27968 27285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 29973 28048 gene locus_tag LOCUS_03360 29973 28048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 >Feature sequence012 1837 695 gene locus_tag LOCUS_03370 gene rpoD 1837 695 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_03370 3833 1884 gene locus_tag LOCUS_03380 gene dnaG 3833 1884 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_03380 4993 3935 gene locus_tag LOCUS_03390 4993 3935 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_03390 7943 5211 gene locus_tag LOCUS_03400 gene ppdK 7943 5211 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392144.1 protein_id gnl|my_center|LOCUS_03400 8974 8039 gene locus_tag LOCUS_03410 8974 8039 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392143.1 protein_id gnl|my_center|LOCUS_03410 11293 9038 gene locus_tag LOCUS_03420 gene glyS 11293 9038 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460837.1 protein_id gnl|my_center|LOCUS_03420 12152 11274 gene locus_tag LOCUS_03430 gene glyQ 12152 11274 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416656.1 protein_id gnl|my_center|LOCUS_03430 12967 12149 gene locus_tag LOCUS_03440 gene recO 12967 12149 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 protein_id gnl|my_center|LOCUS_03440 13958 12969 gene locus_tag LOCUS_03450 gene era 13958 12969 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 protein_id gnl|my_center|LOCUS_03450 14484 13930 gene locus_tag LOCUS_03460 14484 13930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 15154 14555 gene locus_tag LOCUS_03470 15154 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 17309 15126 gene locus_tag LOCUS_03480 17309 15126 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_03480 18406 17417 gene locus_tag LOCUS_03490 18406 17417 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392130.1 protein_id gnl|my_center|LOCUS_03490 19964 18729 gene locus_tag LOCUS_03500 gene yqfD 19964 18729 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392129.1 protein_id gnl|my_center|LOCUS_03500 20355 19996 gene locus_tag LOCUS_03510 20355 19996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 20822 20646 gene locus_tag LOCUS_03520 20822 20646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 22213 21110 gene locus_tag LOCUS_03530 22213 21110 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_03530 23928 22288 gene locus_tag LOCUS_03540 23928 22288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 24695 23925 gene locus_tag LOCUS_03550 24695 23925 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_03550 26056 24773 gene locus_tag LOCUS_03560 gene dnaJ 26056 24773 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874108.1 protein_id gnl|my_center|LOCUS_03560 27680 26085 gene locus_tag LOCUS_03570 27680 26085 CDS product TCP-1/cpn60 chaperonin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143737.1 protein_id gnl|my_center|LOCUS_03570 28795 27758 gene locus_tag LOCUS_03580 gene hrcA 28795 27758 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_03580 <29608 28913 gene locus_tag LOCUS_03590 <29608 28913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460876.1:radical SAM family heme chaperone HemW >Feature sequence013 468 821 gene locus_tag LOCUS_03600 468 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 996 1727 gene locus_tag LOCUS_03610 996 1727 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_03610 1846 3567 gene locus_tag LOCUS_03620 1846 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 4626 3601 gene locus_tag LOCUS_03630 4626 3601 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_03630 5168 5944 gene locus_tag LOCUS_03640 5168 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6397 6783 gene locus_tag LOCUS_03650 6397 6783 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_03650 6780 7211 gene locus_tag LOCUS_03660 6780 7211 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869443.1 protein_id gnl|my_center|LOCUS_03660 7232 8698 gene locus_tag LOCUS_03670 7232 8698 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_03670 8706 9095 gene locus_tag LOCUS_03680 8706 9095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 9191 9964 gene locus_tag LOCUS_03690 9191 9964 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869446.1 protein_id gnl|my_center|LOCUS_03690 10050 10556 gene locus_tag LOCUS_03700 10050 10556 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393221.1 protein_id gnl|my_center|LOCUS_03700 10587 11180 gene locus_tag LOCUS_03710 10587 11180 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_03710 11177 11557 gene locus_tag LOCUS_03720 11177 11557 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_03720 11734 14775 gene locus_tag LOCUS_03730 11734 14775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 14849 16630 gene locus_tag LOCUS_03740 14849 16630 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_03740 17356 16865 gene locus_tag LOCUS_03750 17356 16865 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393157.1 protein_id gnl|my_center|LOCUS_03750 17754 18263 gene locus_tag LOCUS_03760 17754 18263 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_03760 18729 18295 gene locus_tag LOCUS_03770 18729 18295 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880046.1 protein_id gnl|my_center|LOCUS_03770 19256 20905 gene locus_tag LOCUS_03780 19256 20905 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_03780 21731 21186 gene locus_tag LOCUS_03790 21731 21186 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670122.1 protein_id gnl|my_center|LOCUS_03790 23778 21916 gene locus_tag LOCUS_03800 23778 21916 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809608.1 protein_id gnl|my_center|LOCUS_03800 24375 23812 gene locus_tag LOCUS_03810 24375 23812 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_03810 25066 24569 gene locus_tag LOCUS_03820 25066 24569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 26025 25102 gene locus_tag LOCUS_03830 26025 25102 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392322.1 protein_id gnl|my_center|LOCUS_03830 26809 26036 gene locus_tag LOCUS_03840 26809 26036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 <27930 26806 gene locus_tag LOCUS_03850 <27930 26806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392263.1:chemotaxis protein CheA >Feature sequence014 780 391 gene locus_tag LOCUS_03860 780 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 924 3464 gene locus_tag LOCUS_03870 924 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3647 5050 gene locus_tag LOCUS_03880 3647 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 6374 5142 gene locus_tag LOCUS_03890 6374 5142 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_03890 6867 8567 gene locus_tag LOCUS_03900 6867 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 9296 8607 gene locus_tag LOCUS_03910 9296 8607 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081260.1 protein_id gnl|my_center|LOCUS_03910 10127 9300 gene locus_tag LOCUS_03920 10127 9300 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_03920 11032 10382 gene locus_tag LOCUS_03930 11032 10382 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_03930 12509 11334 gene locus_tag LOCUS_03940 gene sbnB 12509 11334 CDS product N-[(2S)-2-amino-2-carboxyethyl]-L-glutamate dehydrogenase SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078461.1 protein_id gnl|my_center|LOCUS_03940 13587 12730 gene locus_tag LOCUS_03950 13587 12730 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 protein_id gnl|my_center|LOCUS_03950 15220 13829 gene locus_tag LOCUS_03960 15220 13829 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518834.1 protein_id gnl|my_center|LOCUS_03960 16369 15311 gene locus_tag LOCUS_03970 16369 15311 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289464.1 protein_id gnl|my_center|LOCUS_03970 16820 18442 gene locus_tag LOCUS_03980 16820 18442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 18646 19470 gene locus_tag LOCUS_03990 18646 19470 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_03990 20060 19560 gene locus_tag LOCUS_04000 20060 19560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 21268 20063 gene locus_tag LOCUS_04010 21268 20063 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_04010 23018 21441 gene locus_tag LOCUS_04020 gene hutU 23018 21441 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 protein_id gnl|my_center|LOCUS_04020 24823 23159 gene locus_tag LOCUS_04030 gene hutH 24823 23159 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289292.1 protein_id gnl|my_center|LOCUS_04030 <26837 25012 gene locus_tag LOCUS_04040 <26837 25012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392052.1:histidinol-phosphate transaminase >Feature sequence015 1298 60 gene locus_tag LOCUS_04050 1298 60 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393148.1 protein_id gnl|my_center|LOCUS_04050 1631 1434 gene locus_tag LOCUS_04060 1631 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2432 2680 gene locus_tag LOCUS_04070 2432 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 2764 3756 gene locus_tag LOCUS_04080 2764 3756 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_04080 3800 4600 gene locus_tag LOCUS_04090 3800 4600 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_04090 4545 5411 gene locus_tag LOCUS_04100 4545 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 5428 6810 gene locus_tag LOCUS_04110 5428 6810 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_04110 6961 9048 gene locus_tag LOCUS_04120 6961 9048 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545932.1 protein_id gnl|my_center|LOCUS_04120 9051 10337 gene locus_tag LOCUS_04130 gene moaA 9051 10337 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461492.1 protein_id gnl|my_center|LOCUS_04130 10330 11616 gene locus_tag LOCUS_04140 10330 11616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 12836 11613 gene locus_tag LOCUS_04150 gene mobAB 12836 11613 CDS product bifunctional molybdenum cofactor guanylyltransferase MobA/molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943769.1 protein_id gnl|my_center|LOCUS_04150 13356 12856 gene locus_tag LOCUS_04160 13356 12856 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088110.1 protein_id gnl|my_center|LOCUS_04160 13601 15286 gene locus_tag LOCUS_04170 13601 15286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 15645 17183 gene locus_tag LOCUS_04180 gene guaA 15645 17183 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_04180 17266 17934 gene locus_tag LOCUS_04190 gene purE 17266 17934 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_04190 18077 19372 gene locus_tag LOCUS_04200 gene purB 18077 19372 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_04200 19401 20126 gene locus_tag LOCUS_04210 19401 20126 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393547.1 protein_id gnl|my_center|LOCUS_04210 20140 20427 gene locus_tag LOCUS_04220 gene purS 20140 20427 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140445.1 protein_id gnl|my_center|LOCUS_04220 20424 21134 gene locus_tag LOCUS_04230 gene purQ 20424 21134 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_04230 21162 21341 gene locus_tag LOCUS_04240 21162 21341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 21356 23671 gene locus_tag LOCUS_04250 gene purL 21356 23671 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_04250 23622 25103 gene locus_tag LOCUS_04260 gene purF 23622 25103 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785566.1 protein_id gnl|my_center|LOCUS_04260 25224 26408 gene locus_tag LOCUS_04270 gene purM 25224 26408 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_04270 >Feature sequence016 492 1172 gene locus_tag LOCUS_04280 492 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 1327 2934 gene locus_tag LOCUS_04290 1327 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2944 4068 gene locus_tag LOCUS_04300 gene sucC 2944 4068 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_04300 4059 4949 gene locus_tag LOCUS_04310 gene sucD 4059 4949 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 protein_id gnl|my_center|LOCUS_04310 5276 5677 gene locus_tag LOCUS_04320 5276 5677 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943409.1 protein_id gnl|my_center|LOCUS_04320 5857 7599 gene locus_tag LOCUS_04330 5857 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 7909 8712 gene locus_tag LOCUS_04340 7909 8712 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878408.1 protein_id gnl|my_center|LOCUS_04340 8721 9767 gene locus_tag LOCUS_04350 8721 9767 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388243.1 protein_id gnl|my_center|LOCUS_04350 9768 11114 gene locus_tag LOCUS_04360 9768 11114 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388548.1 protein_id gnl|my_center|LOCUS_04360 11191 12597 gene locus_tag LOCUS_04370 11191 12597 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_04370 12572 12745 gene locus_tag LOCUS_04380 12572 12745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 12967 14103 gene locus_tag LOCUS_04390 12967 14103 CDS product Acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245999.1 protein_id gnl|my_center|LOCUS_04390 14289 15140 gene locus_tag LOCUS_04400 14289 15140 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_04400 15154 16182 gene locus_tag LOCUS_04410 15154 16182 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_04410 16273 17133 gene locus_tag LOCUS_04420 16273 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 17447 17872 gene locus_tag LOCUS_04430 17447 17872 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_04430 17869 18873 gene locus_tag LOCUS_04440 gene meaB 17869 18873 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_04440 19052 21028 gene locus_tag LOCUS_04450 gene dnaK 19052 21028 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_04450 21097 21852 gene locus_tag LOCUS_04460 21097 21852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 21916 22245 gene locus_tag LOCUS_04470 21916 22245 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391614.1 protein_id gnl|my_center|LOCUS_04470 22389 22464 gene locus_tag LOCUS_t00120 22389 22464 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22900 22664 gene locus_tag LOCUS_04480 22900 22664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04480 23147 22848 gene locus_tag LOCUS_04490 23147 22848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04490 23179 23487 gene locus_tag LOCUS_04500 23179 23487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 23580 24248 gene locus_tag LOCUS_04510 23580 24248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 24417 24905 gene locus_tag LOCUS_04520 24417 24905 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633066.1 protein_id gnl|my_center|LOCUS_04520 25392 25844 gene locus_tag LOCUS_04530 25392 25844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 25774 26271 gene locus_tag LOCUS_04540 25774 26271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081148.1 protein_id gnl|my_center|LOCUS_04540 >Feature sequence017 753 250 gene locus_tag LOCUS_04550 753 250 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081119.1 protein_id gnl|my_center|LOCUS_04550 1525 1100 gene locus_tag LOCUS_04560 1525 1100 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357588.1 protein_id gnl|my_center|LOCUS_04560 1788 1970 gene locus_tag LOCUS_04570 1788 1970 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583141.1 protein_id gnl|my_center|LOCUS_04570 3395 2049 gene locus_tag LOCUS_04580 3395 2049 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391664.1 protein_id gnl|my_center|LOCUS_04580 6446 3546 gene locus_tag LOCUS_04590 6446 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 7036 6443 gene locus_tag LOCUS_04600 7036 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 7094 7555 gene locus_tag LOCUS_04610 7094 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 7640 7966 gene locus_tag LOCUS_04620 7640 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7974 8444 gene locus_tag LOCUS_04630 7974 8444 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054178561.1 protein_id gnl|my_center|LOCUS_04630 8742 8467 gene locus_tag LOCUS_04640 8742 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 9833 8997 gene locus_tag LOCUS_04650 gene pheA 9833 8997 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_04650 11373 10060 gene locus_tag LOCUS_04660 11373 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 12384 11536 gene locus_tag LOCUS_04670 gene cobB2 12384 11536 CDS product NAD-dependent protein deacylase Cob2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877626.1 protein_id gnl|my_center|LOCUS_04670 12856 14232 gene locus_tag LOCUS_04680 12856 14232 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_04680 14483 15502 gene locus_tag LOCUS_04690 14483 15502 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869831.1 protein_id gnl|my_center|LOCUS_04690 16340 15570 gene locus_tag LOCUS_04700 16340 15570 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_04700 17758 16478 gene locus_tag LOCUS_04710 17758 16478 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392521.1 protein_id gnl|my_center|LOCUS_04710 18900 17731 gene locus_tag LOCUS_04720 18900 17731 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392522.1 protein_id gnl|my_center|LOCUS_04720 19597 20520 gene locus_tag LOCUS_04730 gene proC 19597 20520 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_04730 20735 20448 gene locus_tag LOCUS_04740 20735 20448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 21724 20792 gene locus_tag LOCUS_04750 21724 20792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 22789 21746 gene locus_tag LOCUS_04760 22789 21746 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868837.1 protein_id gnl|my_center|LOCUS_04760 24121 23114 gene locus_tag LOCUS_04770 gene thiL 24121 23114 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392671.1 protein_id gnl|my_center|LOCUS_04770 25060 24227 gene locus_tag LOCUS_04780 gene thiM 25060 24227 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393513.1 protein_id gnl|my_center|LOCUS_04780 25965 25060 gene locus_tag LOCUS_04790 gene thiD 25965 25060 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence018 706 155 gene locus_tag LOCUS_04800 706 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 2213 678 gene locus_tag LOCUS_04810 2213 678 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459454.1 protein_id gnl|my_center|LOCUS_04810 2692 2267 gene locus_tag LOCUS_04820 2692 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3699 2719 gene locus_tag LOCUS_04830 3699 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 4375 3929 gene locus_tag LOCUS_04840 4375 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04840 4991 4329 gene locus_tag LOCUS_04850 4991 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04850 6155 5280 gene locus_tag LOCUS_04860 6155 5280 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_04860 6929 6162 gene locus_tag LOCUS_04870 6929 6162 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814961.1 protein_id gnl|my_center|LOCUS_04870 8350 6965 gene locus_tag LOCUS_04880 8350 6965 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731591.1 protein_id gnl|my_center|LOCUS_04880 9752 8403 gene locus_tag LOCUS_04890 9752 8403 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225694.1 protein_id gnl|my_center|LOCUS_04890 10796 9786 gene locus_tag LOCUS_04900 10796 9786 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_04900 11756 10839 gene locus_tag LOCUS_04910 gene garR 11756 10839 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 protein_id gnl|my_center|LOCUS_04910 12198 12431 gene locus_tag LOCUS_04920 12198 12431 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392534.1 protein_id gnl|my_center|LOCUS_04920 12736 12661 gene locus_tag LOCUS_t00130 12736 12661 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12995 12922 gene locus_tag LOCUS_t00140 12995 12922 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13135 13059 gene locus_tag LOCUS_t00150 13135 13059 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13862 13185 gene locus_tag LOCUS_04930 13862 13185 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_04930 14620 13877 gene locus_tag LOCUS_04940 gene rph 14620 13877 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392056.1 protein_id gnl|my_center|LOCUS_04940 15239 14607 gene locus_tag LOCUS_04950 15239 14607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 16590 15265 gene locus_tag LOCUS_04960 16590 15265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 17883 17416 gene locus_tag LOCUS_04970 gene smpB 17883 17416 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_04970 19370 18069 gene locus_tag LOCUS_04980 19370 18069 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_04980 20471 19524 gene locus_tag LOCUS_04990 20471 19524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 21487 20936 gene locus_tag LOCUS_05000 21487 20936 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768286.1 protein_id gnl|my_center|LOCUS_05000 21998 21507 gene locus_tag LOCUS_05010 21998 21507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 24018 22006 gene locus_tag LOCUS_05020 24018 22006 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_05020 24468 24232 gene locus_tag LOCUS_05030 gene secG 24468 24232 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936141.1 protein_id gnl|my_center|LOCUS_05030 24443 24643 gene locus_tag LOCUS_05040 24443 24643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 <25587 24645 gene locus_tag LOCUS_05050 <25587 24645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391810.1:phosphopyruvate hydratase >Feature sequence019 496 1206 gene locus_tag LOCUS_05060 496 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1598 2638 gene locus_tag LOCUS_05070 1598 2638 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393156.1 protein_id gnl|my_center|LOCUS_05070 2644 3012 gene locus_tag LOCUS_05080 2644 3012 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392925.1 protein_id gnl|my_center|LOCUS_05080 3047 3499 gene locus_tag LOCUS_05090 3047 3499 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392924.1 protein_id gnl|my_center|LOCUS_05090 3515 4354 gene locus_tag LOCUS_05100 3515 4354 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_05100 4499 5389 gene locus_tag LOCUS_05110 4499 5389 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_05110 5409 5843 gene locus_tag LOCUS_05120 5409 5843 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392929.1 protein_id gnl|my_center|LOCUS_05120 5858 7174 gene locus_tag LOCUS_05130 5858 7174 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359871.1 protein_id gnl|my_center|LOCUS_05130 7502 7272 gene locus_tag LOCUS_05140 7502 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 7466 7633 gene locus_tag LOCUS_05150 7466 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 8558 9016 gene locus_tag LOCUS_05160 8558 9016 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897586.1 protein_id gnl|my_center|LOCUS_05160 9122 10549 gene locus_tag LOCUS_05170 gene rocR 9122 10549 CDS product arginine utilization transcriptional regulator RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110073.1 protein_id gnl|my_center|LOCUS_05170 10776 12209 gene locus_tag LOCUS_05180 10776 12209 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_05180 12390 13517 gene locus_tag LOCUS_05190 12390 13517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 13546 14652 gene locus_tag LOCUS_05200 gene ald 13546 14652 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459459.1 protein_id gnl|my_center|LOCUS_05200 15592 14732 gene locus_tag LOCUS_05210 15592 14732 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_05210 16346 15711 gene locus_tag LOCUS_05220 16346 15711 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_05220 17735 16371 gene locus_tag LOCUS_05230 17735 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 18884 17874 gene locus_tag LOCUS_05240 18884 17874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 20099 18987 gene locus_tag LOCUS_05250 20099 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 21488 20331 gene locus_tag LOCUS_05260 21488 20331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 22684 21503 gene locus_tag LOCUS_05270 22684 21503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 23689 22721 gene locus_tag LOCUS_05280 23689 22721 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_05280 25023 24478 gene locus_tag LOCUS_05290 25023 24478 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence020 <1 741 gene locus_tag LOCUS_05300 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925146.1:V-type ATP synthase subunit A 881 2263 gene locus_tag LOCUS_05310 881 2263 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869607.1 protein_id gnl|my_center|LOCUS_05310 2307 2927 gene locus_tag LOCUS_05320 2307 2927 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015799.1 protein_id gnl|my_center|LOCUS_05320 2943 4211 gene locus_tag LOCUS_05330 gene murA 2943 4211 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411274.1 protein_id gnl|my_center|LOCUS_05330 4517 5506 gene locus_tag LOCUS_05340 gene spoIID 4517 5506 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_05340 5779 5585 gene locus_tag LOCUS_05350 5779 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 5745 6548 gene locus_tag LOCUS_05360 5745 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 7001 7297 gene locus_tag LOCUS_05370 gene spoIIID 7001 7297 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393849.1 protein_id gnl|my_center|LOCUS_05370 7382 8407 gene locus_tag LOCUS_05380 7382 8407 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_05380 9124 10137 gene locus_tag LOCUS_05390 9124 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 10172 10960 gene locus_tag LOCUS_05400 gene flgG 10172 10960 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_05400 10964 11515 gene locus_tag LOCUS_05410 10964 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 11487 12077 gene locus_tag LOCUS_05420 11487 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 12499 13794 gene locus_tag LOCUS_05430 gene metK 12499 13794 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392413.1 protein_id gnl|my_center|LOCUS_05430 14458 14859 gene locus_tag LOCUS_05440 14458 14859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 15249 15632 gene locus_tag LOCUS_05450 15249 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 15721 16158 gene locus_tag LOCUS_05460 15721 16158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 16288 17808 gene locus_tag LOCUS_05470 gene flgK 16288 17808 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_05470 17818 18687 gene locus_tag LOCUS_05480 gene flgL 17818 18687 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_05480 18975 19421 gene locus_tag LOCUS_05490 gene fliW 18975 19421 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510650.1 protein_id gnl|my_center|LOCUS_05490 19643 20014 gene locus_tag LOCUS_05500 19643 20014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 20514 21323 gene locus_tag LOCUS_05510 20514 21323 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 protein_id gnl|my_center|LOCUS_05510 21613 24024 gene locus_tag LOCUS_05520 21613 24024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 24248 24679 gene locus_tag LOCUS_05530 24248 24679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence021 1537 41 gene locus_tag LOCUS_05540 gene gcvPB 1537 41 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_05540 2877 1534 gene locus_tag LOCUS_05550 gene gcvPA 2877 1534 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_05550 3275 2877 gene locus_tag LOCUS_05560 gene gcvH 3275 2877 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_05560 4426 3329 gene locus_tag LOCUS_05570 gene gcvT 4426 3329 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_05570 7506 4990 gene locus_tag LOCUS_05580 7506 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 9675 8050 gene locus_tag LOCUS_05590 9675 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 10078 10824 gene locus_tag LOCUS_05600 gene sigK 10078 10824 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_05600 10983 11525 gene locus_tag LOCUS_05610 10983 11525 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_05610 11774 12493 gene locus_tag LOCUS_05620 11774 12493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 12517 13950 gene locus_tag LOCUS_05630 12517 13950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 14018 15373 gene locus_tag LOCUS_05640 14018 15373 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_05640 15567 16148 gene locus_tag LOCUS_05650 15567 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 16145 16897 gene locus_tag LOCUS_05660 16145 16897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 17002 17235 gene locus_tag LOCUS_05670 17002 17235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 17253 17675 gene locus_tag LOCUS_05680 17253 17675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 17669 18280 gene locus_tag LOCUS_05690 17669 18280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 18530 18694 gene locus_tag LOCUS_05700 18530 18694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 20029 18911 gene locus_tag LOCUS_05710 20029 18911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392352.1 protein_id gnl|my_center|LOCUS_05710 21345 20149 gene locus_tag LOCUS_05720 21345 20149 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393775.1 protein_id gnl|my_center|LOCUS_05720 22572 21493 gene locus_tag LOCUS_05730 22572 21493 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_05730 23332 22904 gene locus_tag LOCUS_05740 23332 22904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 >Feature sequence022 3165 1303 gene locus_tag LOCUS_05750 gene aspS 3165 1303 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_05750 4631 3318 gene locus_tag LOCUS_05760 gene hisS 4631 3318 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_05760 5310 4687 gene locus_tag LOCUS_05770 5310 4687 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_05770 5880 5434 gene locus_tag LOCUS_05780 gene dtd 5880 5434 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_05780 8069 5877 gene locus_tag LOCUS_05790 8069 5877 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_05790 8673 8161 gene locus_tag LOCUS_05800 8673 8161 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_05800 11588 8721 gene locus_tag LOCUS_05810 11588 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 12001 11585 gene locus_tag LOCUS_05820 12001 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 14249 12129 gene locus_tag LOCUS_05830 14249 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 15802 14246 gene locus_tag LOCUS_05840 15802 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 16826 15906 gene locus_tag LOCUS_05850 gene secF 16826 15906 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393192.1 protein_id gnl|my_center|LOCUS_05850 18154 16838 gene locus_tag LOCUS_05860 gene secD 18154 16838 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583952.1 protein_id gnl|my_center|LOCUS_05860 18246 18428 gene locus_tag LOCUS_05870 18246 18428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 19191 18406 gene locus_tag LOCUS_05880 19191 18406 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_05880 19667 19398 gene locus_tag LOCUS_05890 19667 19398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 20128 22116 gene locus_tag LOCUS_05900 20128 22116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 22420 22845 gene locus_tag LOCUS_05910 22420 22845 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393697.1 protein_id gnl|my_center|LOCUS_05910 22846 23340 gene locus_tag LOCUS_05920 22846 23340 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393698.1 protein_id gnl|my_center|LOCUS_05920 >Feature sequence023 1175 1798 gene locus_tag LOCUS_05930 gene ilvN 1175 1798 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_05930 1683 2675 gene locus_tag LOCUS_05940 gene ilvC 1683 2675 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_05940 2676 4259 gene locus_tag LOCUS_05950 2676 4259 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_05950 4364 6490 gene locus_tag LOCUS_05960 4364 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 6671 7570 gene locus_tag LOCUS_05970 gene ilvE 6671 7570 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_05970 7646 9361 gene locus_tag LOCUS_05980 gene ilvD 7646 9361 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_05980 9425 11128 gene locus_tag LOCUS_05990 gene ilvB 9425 11128 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_05990 12020 11238 gene locus_tag LOCUS_06000 12020 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 13357 12158 gene locus_tag LOCUS_06010 13357 12158 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031604.1 protein_id gnl|my_center|LOCUS_06010 15285 13495 gene locus_tag LOCUS_06020 15285 13495 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869546.1 protein_id gnl|my_center|LOCUS_06020 15560 16801 gene locus_tag LOCUS_06030 15560 16801 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064950.1 protein_id gnl|my_center|LOCUS_06030 17198 16815 gene locus_tag LOCUS_06040 17198 16815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 18965 17259 gene locus_tag LOCUS_06050 18965 17259 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_06050 19661 19296 gene locus_tag LOCUS_06060 19661 19296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 21282 20500 gene locus_tag LOCUS_06070 21282 20500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 22528 21452 gene locus_tag LOCUS_06080 gene cobT 22528 21452 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211350.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence024 117 758 gene locus_tag LOCUS_06090 117 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06090 951 736 gene locus_tag LOCUS_06100 951 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1783 2139 gene locus_tag LOCUS_06110 1783 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2409 2558 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctcctatatttacctgggaac 4114 2609 gene locus_tag LOCUS_06120 4114 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5003 4812 gene locus_tag LOCUS_06130 5003 4812 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878172.1 protein_id gnl|my_center|LOCUS_06130 5217 5450 gene locus_tag LOCUS_06140 5217 5450 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115477.1 protein_id gnl|my_center|LOCUS_06140 5640 6518 gene locus_tag LOCUS_06150 5640 6518 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393282.1 protein_id gnl|my_center|LOCUS_06150 6912 7118 gene locus_tag LOCUS_06160 6912 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 7402 8358 gene locus_tag LOCUS_06170 7402 8358 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870318.1 protein_id gnl|my_center|LOCUS_06170 8810 8466 gene locus_tag LOCUS_06180 8810 8466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 9556 9305 gene locus_tag LOCUS_06190 9556 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 10015 9605 gene locus_tag LOCUS_06200 10015 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 10276 10043 gene locus_tag LOCUS_06210 10276 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 10858 10415 gene locus_tag LOCUS_06220 10858 10415 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_06220 11290 10922 gene locus_tag LOCUS_06230 11290 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 12257 11640 gene locus_tag LOCUS_06240 12257 11640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 13973 12423 gene locus_tag LOCUS_06250 gene putP 13973 12423 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 protein_id gnl|my_center|LOCUS_06250 14124 13996 gene locus_tag LOCUS_06260 14124 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 14970 14749 gene locus_tag LOCUS_06270 14970 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 14970 17456 gene locus_tag LOCUS_06280 14970 17456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 17449 18864 gene locus_tag LOCUS_06290 17449 18864 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_06290 19104 19385 gene locus_tag LOCUS_06300 19104 19385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 19472 21337 gene locus_tag LOCUS_06310 gene nuoF 19472 21337 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence025 379 119 gene locus_tag LOCUS_06320 379 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 1125 2123 gene locus_tag LOCUS_06330 gene hydE 1125 2123 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_06330 3475 2312 gene locus_tag LOCUS_06340 gene arsB 3475 2312 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860358.1 protein_id gnl|my_center|LOCUS_06340 3648 3881 gene locus_tag LOCUS_06350 3648 3881 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065850.1 protein_id gnl|my_center|LOCUS_06350 4737 3901 gene locus_tag LOCUS_06360 4737 3901 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391928.1 protein_id gnl|my_center|LOCUS_06360 6116 4866 gene locus_tag LOCUS_06370 6116 4866 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 protein_id gnl|my_center|LOCUS_06370 7799 6279 gene locus_tag LOCUS_06380 7799 6279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_06380 8989 7913 gene locus_tag LOCUS_06390 8989 7913 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869312.1 protein_id gnl|my_center|LOCUS_06390 10158 9223 gene locus_tag LOCUS_06400 10158 9223 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_06400 11191 10151 gene locus_tag LOCUS_06410 11191 10151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975045.1 protein_id gnl|my_center|LOCUS_06410 11261 11401 gene locus_tag LOCUS_06420 11261 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 12563 11376 gene locus_tag LOCUS_06430 12563 11376 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777123.1 protein_id gnl|my_center|LOCUS_06430 13400 12690 gene locus_tag LOCUS_06440 13400 12690 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360115.1 protein_id gnl|my_center|LOCUS_06440 14865 13711 gene locus_tag LOCUS_06450 gene dinB 14865 13711 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_06450 15041 15137 gene locus_tag LOCUS_t00160 15041 15137 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 15221 16678 gene locus_tag LOCUS_06460 gene selA 15221 16678 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_06460 16823 18817 gene locus_tag LOCUS_06470 gene selB 16823 18817 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_06470 19998 18826 gene locus_tag LOCUS_06480 19998 18826 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_06480 20946 20125 gene locus_tag LOCUS_06490 gene ftsX 20946 20125 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391789.1 protein_id gnl|my_center|LOCUS_06490 21884 21009 gene locus_tag LOCUS_06500 gene ftsE 21884 21009 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768285.1 protein_id gnl|my_center|LOCUS_06500 <22725 22075 gene locus_tag LOCUS_06510 <22725 22075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903779.1:transketolase family protein >Feature sequence026 1583 381 gene locus_tag LOCUS_06520 1583 381 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031800.1 protein_id gnl|my_center|LOCUS_06520 1883 1758 gene locus_tag LOCUS_06530 1883 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3442 1880 gene locus_tag LOCUS_06540 3442 1880 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_06540 4037 3961 gene locus_tag LOCUS_t00170 4037 3961 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4132 4058 gene locus_tag LOCUS_t00180 4132 4058 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4287 4213 gene locus_tag LOCUS_t00190 4287 4213 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5666 4410 gene locus_tag LOCUS_06550 5666 4410 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_06550 7266 5824 gene locus_tag LOCUS_06560 7266 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 7926 8000 gene locus_tag LOCUS_t00200 7926 8000 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8019 8096 gene locus_tag LOCUS_t00210 8019 8096 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8132 8207 gene locus_tag LOCUS_t00220 8132 8207 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8515 10200 gene locus_tag LOCUS_06570 8515 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 10221 10898 gene locus_tag LOCUS_06580 10221 10898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222425.1 protein_id gnl|my_center|LOCUS_06580 10900 12072 gene locus_tag LOCUS_06590 10900 12072 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963643.1 protein_id gnl|my_center|LOCUS_06590 12373 12552 gene locus_tag LOCUS_06600 12373 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 12681 13895 gene locus_tag LOCUS_06610 12681 13895 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878251.1 protein_id gnl|my_center|LOCUS_06610 14173 14895 gene locus_tag LOCUS_06620 14173 14895 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479878.1 protein_id gnl|my_center|LOCUS_06620 15010 16221 gene locus_tag LOCUS_06630 15010 16221 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030796.1 protein_id gnl|my_center|LOCUS_06630 16382 17911 gene locus_tag LOCUS_06640 16382 17911 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_06640 17833 18555 gene locus_tag LOCUS_06650 17833 18555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 18668 20197 gene locus_tag LOCUS_06660 18668 20197 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456912.1 protein_id gnl|my_center|LOCUS_06660 20522 20319 gene locus_tag LOCUS_06670 20522 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 20800 21528 gene locus_tag LOCUS_06680 20800 21528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence027 1415 231 gene locus_tag LOCUS_06690 1415 231 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_06690 2956 1517 gene locus_tag LOCUS_06700 gene mttB 2956 1517 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 transl_except (pos:complement(1994..1996),aa:Pyl) note codon on position 321 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_06700 3633 2983 gene locus_tag LOCUS_06710 3633 2983 CDS product methyltransferase cognate corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065003.1 protein_id gnl|my_center|LOCUS_06710 5235 3781 gene locus_tag LOCUS_06720 gene mtgB 5235 3781 CDS product glycine betaine--corrinoid protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816521.1 protein_id gnl|my_center|LOCUS_06720 7349 5739 gene locus_tag LOCUS_06730 7349 5739 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462282.1 protein_id gnl|my_center|LOCUS_06730 9011 8364 gene locus_tag LOCUS_06740 9011 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 9607 10674 gene locus_tag LOCUS_06750 9607 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 10866 12044 gene locus_tag LOCUS_06760 10866 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 13538 12153 gene locus_tag LOCUS_06770 13538 12153 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_06770 14124 13915 gene locus_tag LOCUS_06780 14124 13915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 14383 15078 gene locus_tag LOCUS_06790 14383 15078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 16051 15236 gene locus_tag LOCUS_06800 16051 15236 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_06800 17068 16052 gene locus_tag LOCUS_06810 17068 16052 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_06810 17938 17129 gene locus_tag LOCUS_06820 17938 17129 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_06820 19433 18357 gene locus_tag LOCUS_06830 19433 18357 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_06830 20377 19430 gene locus_tag LOCUS_06840 20377 19430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_06840 <21672 20484 gene locus_tag LOCUS_06850 <21672 20484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258328.1:NEW3 domain-containing protein >Feature sequence028 <1 969 gene locus_tag LOCUS_06860 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542276.1:alanine racemase 1227 1901 gene locus_tag LOCUS_06870 1227 1901 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027219.1 protein_id gnl|my_center|LOCUS_06870 2178 1936 gene locus_tag LOCUS_06880 2178 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2328 3509 gene locus_tag LOCUS_06890 2328 3509 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_06890 3779 4672 gene locus_tag LOCUS_06900 3779 4672 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869388.1 protein_id gnl|my_center|LOCUS_06900 4669 5805 gene locus_tag LOCUS_06910 4669 5805 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869389.1 protein_id gnl|my_center|LOCUS_06910 5802 6605 gene locus_tag LOCUS_06920 5802 6605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080269.1 protein_id gnl|my_center|LOCUS_06920 6598 7302 gene locus_tag LOCUS_06930 6598 7302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_06930 7403 8704 gene locus_tag LOCUS_06940 7403 8704 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243289.1 protein_id gnl|my_center|LOCUS_06940 8701 9201 gene locus_tag LOCUS_06950 8701 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 9256 10266 gene locus_tag LOCUS_06960 9256 10266 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257541.1 protein_id gnl|my_center|LOCUS_06960 10320 10646 gene locus_tag LOCUS_06970 10320 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06970 10633 11751 gene locus_tag LOCUS_06980 10633 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 11736 12254 gene locus_tag LOCUS_06990 11736 12254 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869717.1 protein_id gnl|my_center|LOCUS_06990 12247 12519 gene locus_tag LOCUS_07000 12247 12519 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249076.1 protein_id gnl|my_center|LOCUS_07000 12512 13711 gene locus_tag LOCUS_07010 12512 13711 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215235.1 protein_id gnl|my_center|LOCUS_07010 13895 14782 gene locus_tag LOCUS_07020 gene dapA 13895 14782 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169452.1 protein_id gnl|my_center|LOCUS_07020 14797 16698 gene locus_tag LOCUS_07030 14797 16698 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 protein_id gnl|my_center|LOCUS_07030 16686 16937 gene locus_tag LOCUS_07040 16686 16937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 17020 18666 gene locus_tag LOCUS_07050 gene ilvD 17020 18666 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496775.1 protein_id gnl|my_center|LOCUS_07050 18799 19689 gene locus_tag LOCUS_07060 gene dapA 18799 19689 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_07060 19772 21223 gene locus_tag LOCUS_07070 19772 21223 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence029 230 1261 gene locus_tag LOCUS_07080 gene ytvI 230 1261 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081398.1 protein_id gnl|my_center|LOCUS_07080 1336 2553 gene locus_tag LOCUS_07090 1336 2553 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392555.1 protein_id gnl|my_center|LOCUS_07090 2550 3587 gene locus_tag LOCUS_07100 gene rseP 2550 3587 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_07100 3594 4727 gene locus_tag LOCUS_07110 gene ispG 3594 4727 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_07110 4760 5386 gene locus_tag LOCUS_07120 4760 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 5442 5591 gene locus_tag LOCUS_07130 5442 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 5792 6316 gene locus_tag LOCUS_07140 gene rimP 5792 6316 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_07140 6371 7573 gene locus_tag LOCUS_07150 gene nusA 6371 7573 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_07150 7592 7900 gene locus_tag LOCUS_07160 7592 7900 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583568.1 protein_id gnl|my_center|LOCUS_07160 7905 10958 gene locus_tag LOCUS_07170 gene infB 7905 10958 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541506.1 protein_id gnl|my_center|LOCUS_07170 11007 11288 gene locus_tag LOCUS_07180 11007 11288 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_07180 11351 11710 gene locus_tag LOCUS_07190 gene rbfA 11351 11710 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_07190 11703 12743 gene locus_tag LOCUS_07200 11703 12743 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_07200 12730 13833 gene locus_tag LOCUS_07210 12730 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 13935 14540 gene locus_tag LOCUS_07220 13935 14540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 14788 15057 gene locus_tag LOCUS_07230 gene rpsO 14788 15057 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_07230 15214 17874 gene locus_tag LOCUS_07240 15214 17874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 17965 18834 gene locus_tag LOCUS_07250 17965 18834 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881054.1 protein_id gnl|my_center|LOCUS_07250 18835 20124 gene locus_tag LOCUS_07260 18835 20124 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 protein_id gnl|my_center|LOCUS_07260 20138 20623 gene locus_tag LOCUS_07270 20138 20623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 20651 21118 gene locus_tag LOCUS_07280 20651 21118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence030 174 962 gene locus_tag LOCUS_07290 gene potB 174 962 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715500.1 protein_id gnl|my_center|LOCUS_07290 959 1744 gene locus_tag LOCUS_07300 959 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 1808 3022 gene locus_tag LOCUS_07310 1808 3022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_07310 3037 3108 gene locus_tag LOCUS_t00230 3037 3108 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 3212 3877 gene locus_tag LOCUS_07320 3212 3877 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_07320 3937 5160 gene locus_tag LOCUS_07330 gene pylC 3937 5160 CDS product 3-methylornithine--L-lysine ligase PylC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462268.1 protein_id gnl|my_center|LOCUS_07330 5117 5968 gene locus_tag LOCUS_07340 gene pylD 5117 5968 CDS product 3-methylornithyl-N6-L-lysine dehydrogenase PylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462267.1 protein_id gnl|my_center|LOCUS_07340 5985 6329 gene locus_tag LOCUS_07350 gene pylSn 5985 6329 CDS product pyrrolysine--tRNA(Pyl) ligase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462266.1 protein_id gnl|my_center|LOCUS_07350 6338 7741 gene locus_tag LOCUS_07360 gene mtbB 6338 7741 CDS product dimethylamine methyltransferase MtbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q8TTA5 transl_except (pos:7400..7402,aa:Pyl) note codon on position 355 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_07360 8377 9168 gene locus_tag LOCUS_07370 8377 9168 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_07370 9319 10155 gene locus_tag LOCUS_07380 gene pylSc 9319 10155 CDS product pyrrolysine--tRNA(Pyl) ligase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462270.1 protein_id gnl|my_center|LOCUS_07380 10569 10204 gene locus_tag LOCUS_07390 10569 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 10531 11337 gene locus_tag LOCUS_07400 10531 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 12026 11322 gene locus_tag LOCUS_07410 12026 11322 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062202.1 protein_id gnl|my_center|LOCUS_07410 12744 12010 gene locus_tag LOCUS_07420 12744 12010 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_07420 13777 12725 gene locus_tag LOCUS_07430 13777 12725 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_07430 14773 13886 gene locus_tag LOCUS_07440 14773 13886 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_07440 16329 15031 gene locus_tag LOCUS_07450 16329 15031 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_07450 17227 18624 gene locus_tag LOCUS_07460 gene mtbB 17227 18624 CDS product dimethylamine methyltransferase MtbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P0C0W5 transl_except (pos:18271..18273,aa:Pyl) note codon on position 349 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_07460 20355 18853 gene locus_tag LOCUS_07470 20355 18853 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225156.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence031 408 495 gene locus_tag LOCUS_t00240 408 495 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 611 695 gene locus_tag LOCUS_t00250 611 695 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1242 850 gene locus_tag LOCUS_07480 1242 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1602 3047 gene locus_tag LOCUS_07490 1602 3047 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392787.1 protein_id gnl|my_center|LOCUS_07490 3088 4329 gene locus_tag LOCUS_07500 gene hydF 3088 4329 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 protein_id gnl|my_center|LOCUS_07500 4419 4943 gene locus_tag LOCUS_07510 4419 4943 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_07510 6090 4978 gene locus_tag LOCUS_07520 6090 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 8354 6087 gene locus_tag LOCUS_07530 8354 6087 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_07530 10302 8485 gene locus_tag LOCUS_07540 10302 8485 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_07540 11097 10423 gene locus_tag LOCUS_07550 gene phoU 11097 10423 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_07550 12127 11291 gene locus_tag LOCUS_07560 gene pstB 12127 11291 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_07560 14171 12306 gene locus_tag LOCUS_07570 14171 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 15337 14423 gene locus_tag LOCUS_07580 15337 14423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 15746 15588 gene locus_tag LOCUS_07590 15746 15588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 16065 16544 gene locus_tag LOCUS_07600 16065 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 16975 16670 gene locus_tag LOCUS_07610 16975 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 17306 17127 gene locus_tag LOCUS_07620 17306 17127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 18469 17303 gene locus_tag LOCUS_07630 18469 17303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 19083 18466 gene locus_tag LOCUS_07640 19083 18466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 19287 19102 gene locus_tag LOCUS_07650 19287 19102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 20110 19709 gene locus_tag LOCUS_07660 20110 19709 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227979.1 protein_id gnl|my_center|LOCUS_07660 20405 20100 gene locus_tag LOCUS_07670 20405 20100 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362471.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence032 2280 271 gene locus_tag LOCUS_07680 gene uvrC 2280 271 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_07680 5159 2277 gene locus_tag LOCUS_07690 gene uvrA 5159 2277 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_07690 7264 5276 gene locus_tag LOCUS_07700 gene uvrB 7264 5276 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_07700 7445 8602 gene locus_tag LOCUS_07710 7445 8602 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393984.1 protein_id gnl|my_center|LOCUS_07710 9403 8516 gene locus_tag LOCUS_07720 9403 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 9765 10997 gene locus_tag LOCUS_07730 9765 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 11177 11839 gene locus_tag LOCUS_07740 11177 11839 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228227.1 protein_id gnl|my_center|LOCUS_07740 11977 13143 gene locus_tag LOCUS_07750 11977 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 13812 13390 gene locus_tag LOCUS_07760 13812 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 15535 14051 gene locus_tag LOCUS_07770 15535 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 15839 15570 gene locus_tag LOCUS_07780 15839 15570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 17274 16036 gene locus_tag LOCUS_07790 17274 16036 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963822.1 protein_id gnl|my_center|LOCUS_07790 18577 17378 gene locus_tag LOCUS_07800 18577 17378 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_07800 18489 18734 gene locus_tag LOCUS_07810 18489 18734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 19093 18752 gene locus_tag LOCUS_07820 19093 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 20065 19124 gene locus_tag LOCUS_07830 20065 19124 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546326.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence033 571 332 gene locus_tag LOCUS_07840 571 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 663 818 gene locus_tag LOCUS_07850 663 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2493 1249 gene locus_tag LOCUS_07860 gene xdhB 2493 1249 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_07860 4952 2490 gene locus_tag LOCUS_07870 4952 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 6499 5147 gene locus_tag LOCUS_07880 6499 5147 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897237.1 protein_id gnl|my_center|LOCUS_07880 7658 6483 gene locus_tag LOCUS_07890 7658 6483 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897227.1 protein_id gnl|my_center|LOCUS_07890 9394 7862 gene locus_tag LOCUS_07900 9394 7862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_07900 10763 9699 gene locus_tag LOCUS_07910 10763 9699 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969638.1 protein_id gnl|my_center|LOCUS_07910 11758 10817 gene locus_tag LOCUS_07920 11758 10817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356209.1 protein_id gnl|my_center|LOCUS_07920 12948 11761 gene locus_tag LOCUS_07930 12948 11761 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_07930 13913 12945 gene locus_tag LOCUS_07940 13913 12945 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_07940 15517 14504 gene locus_tag LOCUS_07950 15517 14504 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563822.1 protein_id gnl|my_center|LOCUS_07950 15959 16222 gene locus_tag LOCUS_07960 15959 16222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 16264 16434 gene locus_tag LOCUS_07970 16264 16434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07970 18039 17320 gene locus_tag LOCUS_07980 18039 17320 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392303.1 protein_id gnl|my_center|LOCUS_07980 18905 18060 gene locus_tag LOCUS_07990 18905 18060 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392302.1 protein_id gnl|my_center|LOCUS_07990 19159 18941 gene locus_tag LOCUS_08000 19159 18941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 19527 19132 gene locus_tag LOCUS_08010 19527 19132 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965516.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence034 776 339 gene locus_tag LOCUS_08020 776 339 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391650.1 protein_id gnl|my_center|LOCUS_08020 2513 1359 gene locus_tag LOCUS_08030 gene gbsB 2513 1359 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243227.1 protein_id gnl|my_center|LOCUS_08030 3530 2589 gene locus_tag LOCUS_08040 3530 2589 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_08040 5171 3552 gene locus_tag LOCUS_08050 5171 3552 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979926.1 protein_id gnl|my_center|LOCUS_08050 6790 5315 gene locus_tag LOCUS_08060 gene mtgB 6790 5315 CDS product glycine betaine--corrinoid protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816521.1 protein_id gnl|my_center|LOCUS_08060 8330 6876 gene locus_tag LOCUS_08070 gene mttB 8330 6876 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_08070 8988 8356 gene locus_tag LOCUS_08080 8988 8356 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_08080 10631 9168 gene locus_tag LOCUS_08090 gene mttB 10631 9168 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_08090 11498 10767 gene locus_tag LOCUS_08100 11498 10767 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_08100 12827 11511 gene locus_tag LOCUS_08110 12827 11511 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198760.1 protein_id gnl|my_center|LOCUS_08110 13152 13949 gene locus_tag LOCUS_08120 13152 13949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013597.1 protein_id gnl|my_center|LOCUS_08120 15418 13964 gene locus_tag LOCUS_08130 15418 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 17798 15411 gene locus_tag LOCUS_08140 17798 15411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 19009 17924 gene locus_tag LOCUS_08150 19009 17924 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_08150 19714 19136 gene locus_tag LOCUS_08160 19714 19136 CDS product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357138.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence035 572 495 gene locus_tag LOCUS_t00260 572 495 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 725 1900 gene locus_tag LOCUS_08170 725 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 2150 3463 gene locus_tag LOCUS_08180 2150 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 3470 6322 gene locus_tag LOCUS_08190 3470 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 6480 6872 gene locus_tag LOCUS_08200 gene speD 6480 6872 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460188.1 protein_id gnl|my_center|LOCUS_08200 7254 8264 gene locus_tag LOCUS_08210 7254 8264 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583847.1 protein_id gnl|my_center|LOCUS_08210 8281 8727 gene locus_tag LOCUS_08220 gene ndk 8281 8727 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_08220 8791 9687 gene locus_tag LOCUS_08230 8791 9687 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_08230 9788 11104 gene locus_tag LOCUS_08240 9788 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 11089 11970 gene locus_tag LOCUS_08250 gene mtnP 11089 11970 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868192.1 protein_id gnl|my_center|LOCUS_08250 12110 12838 gene locus_tag LOCUS_08260 gene gph 12110 12838 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532061.1 protein_id gnl|my_center|LOCUS_08260 12864 13535 gene locus_tag LOCUS_08270 12864 13535 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039230.1 protein_id gnl|my_center|LOCUS_08270 13529 14320 gene locus_tag LOCUS_08280 gene surE 13529 14320 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392658.1 protein_id gnl|my_center|LOCUS_08280 14641 15093 gene locus_tag LOCUS_08290 14641 15093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 15373 16587 gene locus_tag LOCUS_08300 15373 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 17353 16811 gene locus_tag LOCUS_08310 17353 16811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 17620 17387 gene locus_tag LOCUS_08320 17620 17387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 18261 18521 gene locus_tag LOCUS_08330 18261 18521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence036 181 534 gene locus_tag LOCUS_08340 181 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1153 656 gene locus_tag LOCUS_08350 gene rimI 1153 656 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_08350 2144 1140 gene locus_tag LOCUS_08360 2144 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 2652 2146 gene locus_tag LOCUS_08370 gene tsaE 2652 2146 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 protein_id gnl|my_center|LOCUS_08370 3463 2708 gene locus_tag LOCUS_08380 3463 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 4837 3554 gene locus_tag LOCUS_08390 4837 3554 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582490.1 protein_id gnl|my_center|LOCUS_08390 6642 4960 gene locus_tag LOCUS_08400 6642 4960 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_08400 7048 6605 gene locus_tag LOCUS_08410 7048 6605 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_08410 8072 7536 gene locus_tag LOCUS_08420 8072 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393800.1 protein_id gnl|my_center|LOCUS_08420 8416 8069 gene locus_tag LOCUS_08430 8416 8069 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393801.1 protein_id gnl|my_center|LOCUS_08430 10609 8546 gene locus_tag LOCUS_08440 gene glmS 10609 8546 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_08440 12641 11103 gene locus_tag LOCUS_08450 gene glmM 12641 11103 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393729.1 protein_id gnl|my_center|LOCUS_08450 13953 12706 gene locus_tag LOCUS_08460 13953 12706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 14957 13941 gene locus_tag LOCUS_08470 14957 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 15701 15054 gene locus_tag LOCUS_08480 15701 15054 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772968.1 protein_id gnl|my_center|LOCUS_08480 15948 16484 gene locus_tag LOCUS_08490 15948 16484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 16544 17059 gene locus_tag LOCUS_08500 16544 17059 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_08500 17491 17033 gene locus_tag LOCUS_08510 17491 17033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 17613 17858 gene locus_tag LOCUS_08520 17613 17858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 19111 18206 gene locus_tag LOCUS_08530 gene rapZ 19111 18206 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence037 <1 547 gene locus_tag LOCUS_08540 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022480.1:TIGR00725 family protein 804 1682 gene locus_tag LOCUS_08550 gene lexA 804 1682 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908066.1 protein_id gnl|my_center|LOCUS_08550 3123 1846 gene locus_tag LOCUS_08560 3123 1846 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_08560 4102 3233 gene locus_tag LOCUS_08570 4102 3233 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392445.1 protein_id gnl|my_center|LOCUS_08570 4969 4139 gene locus_tag LOCUS_08580 4969 4139 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392446.1 protein_id gnl|my_center|LOCUS_08580 5922 4966 gene locus_tag LOCUS_08590 5922 4966 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392447.1 protein_id gnl|my_center|LOCUS_08590 6430 5999 gene locus_tag LOCUS_08600 6430 5999 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392448.1 protein_id gnl|my_center|LOCUS_08600 9367 6701 gene locus_tag LOCUS_08610 9367 6701 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272523.1 protein_id gnl|my_center|LOCUS_08610 10732 10097 gene locus_tag LOCUS_08620 10732 10097 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_08620 11208 10879 gene locus_tag LOCUS_08630 11208 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 11489 11205 gene locus_tag LOCUS_08640 gene hfq 11489 11205 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392630.1 protein_id gnl|my_center|LOCUS_08640 12655 11738 gene locus_tag LOCUS_08650 gene miaA 12655 11738 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_08650 14015 12690 gene locus_tag LOCUS_08660 gene miaB 14015 12690 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_08660 14426 14208 gene locus_tag LOCUS_08670 14426 14208 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065065.1 protein_id gnl|my_center|LOCUS_08670 15117 14542 gene locus_tag LOCUS_08680 15117 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 15298 15555 gene locus_tag LOCUS_08690 15298 15555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 15877 17979 gene locus_tag LOCUS_08700 15877 17979 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_08700 17990 19060 gene locus_tag LOCUS_08710 17990 19060 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096596.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence038 1676 795 gene locus_tag LOCUS_08720 1676 795 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_08720 2011 1673 gene locus_tag LOCUS_08730 gene rplQ 2011 1673 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_08730 2965 2015 gene locus_tag LOCUS_08740 2965 2015 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_08740 3553 2981 gene locus_tag LOCUS_08750 gene rpsD 3553 2981 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_08750 4044 3655 gene locus_tag LOCUS_08760 gene rpsK 4044 3655 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393910.1 protein_id gnl|my_center|LOCUS_08760 4580 4179 gene locus_tag LOCUS_08770 gene rpsM 4580 4179 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_08770 4984 4766 gene locus_tag LOCUS_08780 gene infA 4984 4766 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393913.1 protein_id gnl|my_center|LOCUS_08780 5430 4966 gene locus_tag LOCUS_08790 5430 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 6371 5427 gene locus_tag LOCUS_08800 gene map 6371 5427 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_08800 7039 6368 gene locus_tag LOCUS_08810 7039 6368 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_08810 8423 7149 gene locus_tag LOCUS_08820 gene secY 8423 7149 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_08820 8867 8424 gene locus_tag LOCUS_08830 gene rplO 8867 8424 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393918.1 protein_id gnl|my_center|LOCUS_08830 9066 8854 gene locus_tag LOCUS_08840 9066 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 9735 9130 gene locus_tag LOCUS_08850 gene rpsE 9735 9130 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_08850 10155 9787 gene locus_tag LOCUS_08860 gene rplR 10155 9787 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421141.1 protein_id gnl|my_center|LOCUS_08860 10718 10179 gene locus_tag LOCUS_08870 gene rplF 10718 10179 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_08870 11129 10731 gene locus_tag LOCUS_08880 gene rpsH 11129 10731 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_08880 11384 11199 gene locus_tag LOCUS_08890 11384 11199 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966399.1 protein_id gnl|my_center|LOCUS_08890 12030 11416 gene locus_tag LOCUS_08900 gene rplE 12030 11416 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080831.1 protein_id gnl|my_center|LOCUS_08900 12420 12058 gene locus_tag LOCUS_08910 gene rplX 12420 12058 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_08910 12860 12492 gene locus_tag LOCUS_08920 gene rplN 12860 12492 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_08920 13334 12951 gene locus_tag LOCUS_08930 13334 12951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 13542 13339 gene locus_tag LOCUS_08940 gene rpmC 13542 13339 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_08940 13966 13532 gene locus_tag LOCUS_08950 gene rplP 13966 13532 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_08950 14671 13970 gene locus_tag LOCUS_08960 gene rpsC 14671 13970 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810152.1 protein_id gnl|my_center|LOCUS_08960 15046 14705 gene locus_tag LOCUS_08970 gene rplV 15046 14705 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_08970 15352 15068 gene locus_tag LOCUS_08980 gene rpsS 15352 15068 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_08980 16229 15402 gene locus_tag LOCUS_08990 gene rplB 16229 15402 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459099.1 protein_id gnl|my_center|LOCUS_08990 16539 16243 gene locus_tag LOCUS_09000 gene rplW 16539 16243 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_09000 16868 16539 gene locus_tag LOCUS_09010 16868 16539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 17812 17171 gene locus_tag LOCUS_09020 gene rplC 17812 17171 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393937.1 protein_id gnl|my_center|LOCUS_09020 18193 17888 gene locus_tag LOCUS_09030 gene rpsJ 18193 17888 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_09030 <19241 18226 gene locus_tag LOCUS_09040 <19241 18226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393939.1:elongation factor Tu >Feature sequence039 696 295 gene locus_tag LOCUS_09050 696 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 1287 739 gene locus_tag LOCUS_09060 1287 739 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_09060 2145 1303 gene locus_tag LOCUS_09070 2145 1303 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816933.1 protein_id gnl|my_center|LOCUS_09070 2742 2380 gene locus_tag LOCUS_09080 2742 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3916 2963 gene locus_tag LOCUS_09090 3916 2963 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_09090 4581 3913 gene locus_tag LOCUS_09100 4581 3913 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_09100 5490 4651 gene locus_tag LOCUS_09110 5490 4651 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_09110 6805 5468 gene locus_tag LOCUS_09120 6805 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 7998 6838 gene locus_tag LOCUS_09130 7998 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 8450 7995 gene locus_tag LOCUS_09140 8450 7995 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_09140 12970 8447 gene locus_tag LOCUS_09150 12970 8447 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392708.1 protein_id gnl|my_center|LOCUS_09150 13611 12973 gene locus_tag LOCUS_09160 13611 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 14165 13611 gene locus_tag LOCUS_09170 14165 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 16111 14162 gene locus_tag LOCUS_09180 16111 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 17436 16108 gene locus_tag LOCUS_09190 17436 16108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 18334 17537 gene locus_tag LOCUS_09200 18334 17537 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944231.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence040 <1 593 gene locus_tag LOCUS_09210 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393573.1:non-homologous end-joining DNA ligase 1421 2128 gene locus_tag LOCUS_09220 1421 2128 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774866.1 protein_id gnl|my_center|LOCUS_09220 2150 2686 gene locus_tag LOCUS_09230 2150 2686 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404491.1 protein_id gnl|my_center|LOCUS_09230 2773 4164 gene locus_tag LOCUS_09240 2773 4164 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392338.1 protein_id gnl|my_center|LOCUS_09240 4176 4991 gene locus_tag LOCUS_09250 4176 4991 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583818.1 protein_id gnl|my_center|LOCUS_09250 4981 5508 gene locus_tag LOCUS_09260 4981 5508 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_09260 5537 6580 gene locus_tag LOCUS_09270 5537 6580 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393336.1 protein_id gnl|my_center|LOCUS_09270 7030 7833 gene locus_tag LOCUS_09280 7030 7833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_09280 7826 8911 gene locus_tag LOCUS_09290 7826 8911 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_09290 8918 10405 gene locus_tag LOCUS_09300 8918 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 10541 11236 gene locus_tag LOCUS_09310 gene cmk 10541 11236 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_09310 11226 11816 gene locus_tag LOCUS_09320 11226 11816 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_09320 11806 14160 gene locus_tag LOCUS_09330 11806 14160 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392842.1 protein_id gnl|my_center|LOCUS_09330 14725 15417 gene locus_tag LOCUS_09340 14725 15417 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392840.1 protein_id gnl|my_center|LOCUS_09340 15332 16831 gene locus_tag LOCUS_09350 15332 16831 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392839.1 protein_id gnl|my_center|LOCUS_09350 16828 18054 gene locus_tag LOCUS_09360 16828 18054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence041 <1 747 gene locus_tag LOCUS_09370 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948146.1:RnfABCDGE type electron transport complex subunit D 755 1381 gene locus_tag LOCUS_09380 755 1381 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_09380 1378 1965 gene locus_tag LOCUS_09390 gene rsxA 1378 1965 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_09390 2046 2891 gene locus_tag LOCUS_09400 2046 2891 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_09400 3163 4068 gene locus_tag LOCUS_09410 3163 4068 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_09410 4281 4532 gene locus_tag LOCUS_09420 4281 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4532 5200 gene locus_tag LOCUS_09430 4532 5200 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_09430 5169 5879 gene locus_tag LOCUS_09440 gene radC 5169 5879 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392073.1 protein_id gnl|my_center|LOCUS_09440 5988 7028 gene locus_tag LOCUS_09450 5988 7028 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_09450 7044 7916 gene locus_tag LOCUS_09460 gene mreC 7044 7916 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135485.1 protein_id gnl|my_center|LOCUS_09460 7913 8425 gene locus_tag LOCUS_09470 7913 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 8433 10319 gene locus_tag LOCUS_09480 gene mrdA 8433 10319 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_09480 10407 11507 gene locus_tag LOCUS_09490 10407 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 11492 12286 gene locus_tag LOCUS_09500 gene minD 11492 12286 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_09500 12331 12615 gene locus_tag LOCUS_09510 gene minE 12331 12615 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392080.1 protein_id gnl|my_center|LOCUS_09510 12612 13784 gene locus_tag LOCUS_09520 gene rodA 12612 13784 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_09520 14197 14424 gene locus_tag LOCUS_09530 14197 14424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 15190 14717 gene locus_tag LOCUS_09540 gene aroQ 15190 14717 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942665.1 protein_id gnl|my_center|LOCUS_09540 17135 15318 gene locus_tag LOCUS_09550 17135 15318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 18296 17190 gene locus_tag LOCUS_09560 gene aroC 18296 17190 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence042 694 897 gene locus_tag LOCUS_09570 694 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1184 1109 gene locus_tag LOCUS_t00270 1184 1109 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1285 1210 gene locus_tag LOCUS_t00280 1285 1210 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1375 1290 gene locus_tag LOCUS_t00290 1375 1290 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3119 1728 gene locus_tag LOCUS_09580 3119 1728 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_09580 7924 3485 gene locus_tag LOCUS_09590 7924 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 11744 7893 gene locus_tag LOCUS_09600 gene addB 11744 7893 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392018.1 protein_id gnl|my_center|LOCUS_09600 13725 12025 gene locus_tag LOCUS_09610 13725 12025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 14162 13995 gene locus_tag LOCUS_09620 14162 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 14815 14300 gene locus_tag LOCUS_09630 14815 14300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 15599 14799 gene locus_tag LOCUS_09640 15599 14799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 16302 16147 gene locus_tag LOCUS_09650 16302 16147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 16574 16302 gene locus_tag LOCUS_09660 16574 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 16729 17412 gene locus_tag LOCUS_09670 16729 17412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence043 69 178 gene locus_tag LOCUS_r00010 69 178 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 763 1428 gene locus_tag LOCUS_09680 gene tmk 763 1428 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_09680 1540 1878 gene locus_tag LOCUS_09690 1540 1878 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832200.1 protein_id gnl|my_center|LOCUS_09690 1878 3074 gene locus_tag LOCUS_09700 1878 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 3135 3962 gene locus_tag LOCUS_09710 3135 3962 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_09710 3959 4753 gene locus_tag LOCUS_09720 gene rsmI 3959 4753 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_09720 5052 4804 gene locus_tag LOCUS_09730 5052 4804 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391595.1 protein_id gnl|my_center|LOCUS_09730 5213 7162 gene locus_tag LOCUS_09740 gene metG 5213 7162 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_09740 7180 8067 gene locus_tag LOCUS_09750 7180 8067 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_09750 8158 9045 gene locus_tag LOCUS_09760 gene rsmA 8158 9045 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_09760 9060 9530 gene locus_tag LOCUS_09770 9060 9530 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773636.1 protein_id gnl|my_center|LOCUS_09770 9924 10217 gene locus_tag LOCUS_09780 9924 10217 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391605.1 protein_id gnl|my_center|LOCUS_09780 10258 10470 gene locus_tag LOCUS_09790 10258 10470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 10604 11605 gene locus_tag LOCUS_09800 10604 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391744.1 protein_id gnl|my_center|LOCUS_09800 11628 12449 gene locus_tag LOCUS_09810 11628 12449 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_09810 12446 15472 gene locus_tag LOCUS_09820 gene cphA 12446 15472 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814969.1 protein_id gnl|my_center|LOCUS_09820 15691 16770 gene locus_tag LOCUS_09830 gene ispE 15691 16770 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 protein_id gnl|my_center|LOCUS_09830 16982 17752 gene locus_tag LOCUS_09840 16982 17752 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391622.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence044 131 1189 gene locus_tag LOCUS_09850 gene disA 131 1189 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393302.1 protein_id gnl|my_center|LOCUS_09850 1550 1233 gene locus_tag LOCUS_09860 1550 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048365.1 protein_id gnl|my_center|LOCUS_09860 1738 1663 gene locus_tag LOCUS_t00300 1738 1663 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2050 2526 gene locus_tag LOCUS_09870 2050 2526 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_09870 2919 4037 gene locus_tag LOCUS_09880 2919 4037 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_09880 4034 5395 gene locus_tag LOCUS_09890 4034 5395 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_09890 5620 6546 gene locus_tag LOCUS_09900 5620 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 7087 7815 gene locus_tag LOCUS_09910 gene cysE 7087 7815 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_09910 7778 9334 gene locus_tag LOCUS_09920 gene cysS 7778 9334 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869759.1 protein_id gnl|my_center|LOCUS_09920 9581 9739 gene locus_tag LOCUS_09930 9581 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 9693 10415 gene locus_tag LOCUS_09940 gene thyX 9693 10415 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459086.1 protein_id gnl|my_center|LOCUS_09940 10412 11218 gene locus_tag LOCUS_09950 gene rlmB 10412 11218 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_09950 11465 12154 gene locus_tag LOCUS_09960 gene sigH 11465 12154 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_09960 12269 12343 gene locus_tag LOCUS_t00310 12269 12343 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13128 12415 gene locus_tag LOCUS_09970 13128 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09970 13334 13125 gene locus_tag LOCUS_09980 13334 13125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09980 13573 13256 gene locus_tag LOCUS_09990 13573 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09990 14596 14198 gene locus_tag LOCUS_10000 14596 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 15001 14636 gene locus_tag LOCUS_10010 15001 14636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 16376 17287 gene locus_tag LOCUS_10020 16376 17287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence045 121 507 gene locus_tag LOCUS_10030 121 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 615 1868 gene locus_tag LOCUS_10040 615 1868 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188697727.1 protein_id gnl|my_center|LOCUS_10040 1858 2175 gene locus_tag LOCUS_10050 1858 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2209 2826 gene locus_tag LOCUS_10060 2209 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2823 3848 gene locus_tag LOCUS_10070 2823 3848 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003321939.1 protein_id gnl|my_center|LOCUS_10070 4113 4394 gene locus_tag LOCUS_10080 4113 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4404 4595 gene locus_tag LOCUS_10090 4404 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4868 4713 gene locus_tag LOCUS_10100 4868 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 8929 7886 gene locus_tag LOCUS_10110 8929 7886 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986974.1 protein_id gnl|my_center|LOCUS_10110 9786 8935 gene locus_tag LOCUS_10120 9786 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 12330 10939 gene locus_tag LOCUS_10130 12330 10939 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_10130 13488 12346 gene locus_tag LOCUS_10140 13488 12346 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_10140 14247 13495 gene locus_tag LOCUS_10150 14247 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 15335 14244 gene locus_tag LOCUS_10160 15335 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10160 15749 15540 gene locus_tag LOCUS_10170 15749 15540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 16112 15822 gene locus_tag LOCUS_10180 16112 15822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 16495 16001 gene locus_tag LOCUS_10190 16495 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 16854 16516 gene locus_tag LOCUS_10200 16854 16516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence046 2237 1344 gene locus_tag LOCUS_10210 2237 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 3061 2363 gene locus_tag LOCUS_10220 3061 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3209 3619 gene locus_tag LOCUS_10230 3209 3619 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867519.1 protein_id gnl|my_center|LOCUS_10230 3717 5558 gene locus_tag LOCUS_10240 gene for 3717 5558 CDS product tungsten-containing formaldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868317.1 protein_id gnl|my_center|LOCUS_10240 5770 6738 gene locus_tag LOCUS_10250 gene mch 5770 6738 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871160.1 protein_id gnl|my_center|LOCUS_10250 6849 7304 gene locus_tag LOCUS_10260 6849 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 7575 8540 gene locus_tag LOCUS_10270 7575 8540 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_10270 8671 9456 gene locus_tag LOCUS_10280 8671 9456 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_10280 9567 10733 gene locus_tag LOCUS_10290 9567 10733 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_10290 10759 11964 gene locus_tag LOCUS_10300 10759 11964 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_10300 11995 12492 gene locus_tag LOCUS_10310 11995 12492 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061298.1 protein_id gnl|my_center|LOCUS_10310 12545 13879 gene locus_tag LOCUS_10320 12545 13879 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_10320 14131 15369 gene locus_tag LOCUS_10330 14131 15369 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869553.1 protein_id gnl|my_center|LOCUS_10330 15703 16581 gene locus_tag LOCUS_10340 15703 16581 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870169.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence047 1038 58 gene locus_tag LOCUS_10350 gene xerC 1038 58 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141123.1 protein_id gnl|my_center|LOCUS_10350 1338 1264 gene locus_tag LOCUS_t00320 1338 1264 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1428 1353 gene locus_tag LOCUS_t00330 1428 1353 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1525 1449 gene locus_tag LOCUS_t00340 1525 1449 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1602 1527 gene locus_tag LOCUS_t00350 1602 1527 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3175 1886 gene locus_tag LOCUS_10360 3175 1886 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_10360 3412 3326 gene locus_tag LOCUS_t00360 3412 3326 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3931 3536 gene locus_tag LOCUS_10370 3931 3536 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391640.1 protein_id gnl|my_center|LOCUS_10370 4513 4058 gene locus_tag LOCUS_10380 4513 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5048 4515 gene locus_tag LOCUS_10390 5048 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 5386 5078 gene locus_tag LOCUS_10400 5386 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 6425 5481 gene locus_tag LOCUS_10410 6425 5481 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391635.1 protein_id gnl|my_center|LOCUS_10410 6986 6696 gene locus_tag LOCUS_10420 6986 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 7569 7291 gene locus_tag LOCUS_10430 7569 7291 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043860.1 protein_id gnl|my_center|LOCUS_10430 8836 7691 gene locus_tag LOCUS_10440 8836 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 10470 8833 gene locus_tag LOCUS_10450 10470 8833 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_10450 11242 10679 gene locus_tag LOCUS_10460 gene spoVT 11242 10679 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_10460 15197 11484 gene locus_tag LOCUS_10470 gene mfd 15197 11484 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_10470 15675 15184 gene locus_tag LOCUS_10480 15675 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 16322 15666 gene locus_tag LOCUS_10490 gene pth 16322 15666 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_10490 17010 16381 gene locus_tag LOCUS_10500 17010 16381 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence048 949 452 gene locus_tag LOCUS_10510 gene lspA 949 452 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_10510 1302 946 gene locus_tag LOCUS_10520 1302 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4260 1441 gene locus_tag LOCUS_10530 gene ileS 4260 1441 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_10530 4665 4351 gene locus_tag LOCUS_10540 4665 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 5155 4658 gene locus_tag LOCUS_10550 gene divIVA 5155 4658 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131611.1 protein_id gnl|my_center|LOCUS_10550 6011 5307 gene locus_tag LOCUS_10560 6011 5307 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_10560 7342 6134 gene locus_tag LOCUS_10570 7342 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 8447 7506 gene locus_tag LOCUS_10580 gene pgeF 8447 7506 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_10580 8764 8492 gene locus_tag LOCUS_10590 8764 8492 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_10590 10054 9161 gene locus_tag LOCUS_10600 10054 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 10954 10184 gene locus_tag LOCUS_10610 gene sigG 10954 10184 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944988.1 protein_id gnl|my_center|LOCUS_10610 11883 11143 gene locus_tag LOCUS_10620 gene sigE 11883 11143 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774280.1 protein_id gnl|my_center|LOCUS_10620 12953 11880 gene locus_tag LOCUS_10630 12953 11880 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460687.1 protein_id gnl|my_center|LOCUS_10630 14221 13163 gene locus_tag LOCUS_10640 gene ftsZ 14221 13163 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_10640 15495 14254 gene locus_tag LOCUS_10650 gene ftsA 15495 14254 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392368.1 protein_id gnl|my_center|LOCUS_10650 15970 15608 gene locus_tag LOCUS_10660 15970 15608 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392367.1 protein_id gnl|my_center|LOCUS_10660 17002 16217 gene locus_tag LOCUS_10670 17002 16217 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393733.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence049 525 1385 gene locus_tag LOCUS_10680 525 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1382 2614 gene locus_tag LOCUS_10690 1382 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2615 3931 gene locus_tag LOCUS_10700 2615 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3928 5532 gene locus_tag LOCUS_10710 3928 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 5737 8835 gene locus_tag LOCUS_10720 5737 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 8972 9973 gene locus_tag LOCUS_10730 8972 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 10415 11917 gene locus_tag LOCUS_10740 10415 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 12022 12441 gene locus_tag LOCUS_10750 12022 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 12578 12877 gene locus_tag LOCUS_10760 12578 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 13245 14564 gene locus_tag LOCUS_10770 13245 14564 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074039.1 protein_id gnl|my_center|LOCUS_10770 15164 15355 gene locus_tag LOCUS_10780 15164 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 15485 16207 gene locus_tag LOCUS_10790 15485 16207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10790 16241 16567 gene locus_tag LOCUS_10800 16241 16567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10800 >Feature sequence050 1539 223 gene locus_tag LOCUS_10810 1539 223 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362074.1 protein_id gnl|my_center|LOCUS_10810 1839 1570 gene locus_tag LOCUS_10820 1839 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2576 3127 gene locus_tag LOCUS_10830 2576 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 3341 4015 gene locus_tag LOCUS_10840 3341 4015 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_10840 4012 5433 gene locus_tag LOCUS_10850 4012 5433 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392987.1 protein_id gnl|my_center|LOCUS_10850 5941 7302 gene locus_tag LOCUS_10860 5941 7302 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_10860 7483 8529 gene locus_tag LOCUS_10870 7483 8529 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064624.1 protein_id gnl|my_center|LOCUS_10870 8607 10505 gene locus_tag LOCUS_10880 8607 10505 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_10880 10559 11842 gene locus_tag LOCUS_10890 10559 11842 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728152.1 protein_id gnl|my_center|LOCUS_10890 13074 12250 gene locus_tag LOCUS_10900 13074 12250 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_10900 13372 14229 gene locus_tag LOCUS_10910 13372 14229 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_10910 14242 14712 gene locus_tag LOCUS_10920 14242 14712 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_10920 14709 16970 gene locus_tag LOCUS_10930 14709 16970 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence051 1007 462 gene locus_tag LOCUS_10940 gene cobO 1007 462 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948638.1 protein_id gnl|my_center|LOCUS_10940 1739 1041 gene locus_tag LOCUS_10950 1739 1041 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392339.1 protein_id gnl|my_center|LOCUS_10950 1917 2603 gene locus_tag LOCUS_10960 1917 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 5162 2610 gene locus_tag LOCUS_10970 5162 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 5316 5179 gene locus_tag LOCUS_10980 5316 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 6380 5373 gene locus_tag LOCUS_10990 6380 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 7672 6539 gene locus_tag LOCUS_11000 7672 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 8069 7800 gene locus_tag LOCUS_11010 8069 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 8953 8219 gene locus_tag LOCUS_11020 8953 8219 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_11020 9846 9061 gene locus_tag LOCUS_11030 9846 9061 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_11030 11526 9856 gene locus_tag LOCUS_11040 11526 9856 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_11040 12570 11668 gene locus_tag LOCUS_11050 gene dapA 12570 11668 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460382.1 protein_id gnl|my_center|LOCUS_11050 13912 12635 gene locus_tag LOCUS_11060 gene dapG 13912 12635 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808827.1 protein_id gnl|my_center|LOCUS_11060 15018 14002 gene locus_tag LOCUS_11070 15018 14002 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392580.1 protein_id gnl|my_center|LOCUS_11070 15678 15085 gene locus_tag LOCUS_11080 15678 15085 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_11080 16658 15675 gene locus_tag LOCUS_11090 gene dpsA 16658 15675 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392578.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence052 1037 891 gene locus_tag LOCUS_11100 1037 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1685 1392 gene locus_tag LOCUS_11110 gene yajC 1685 1392 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393195.1 protein_id gnl|my_center|LOCUS_11110 2899 1814 gene locus_tag LOCUS_11120 gene tgt 2899 1814 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_11120 4300 3098 gene locus_tag LOCUS_11130 gene queA 4300 3098 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_11130 5966 4218 gene locus_tag LOCUS_11140 5966 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 6929 6141 gene locus_tag LOCUS_11150 gene sigI 6929 6141 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498572.1 protein_id gnl|my_center|LOCUS_11150 7239 7015 gene locus_tag LOCUS_11160 7239 7015 CDS product DUF2905 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371041.1 protein_id gnl|my_center|LOCUS_11160 7988 7422 gene locus_tag LOCUS_11170 7988 7422 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_11170 9152 8013 gene locus_tag LOCUS_11180 gene ruvB 9152 8013 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_11180 10032 9211 gene locus_tag LOCUS_11190 gene ruvA 10032 9211 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245442.1 protein_id gnl|my_center|LOCUS_11190 10514 10029 gene locus_tag LOCUS_11200 gene ruvC 10514 10029 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_11200 11376 10732 gene locus_tag LOCUS_11210 11376 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 12303 11548 gene locus_tag LOCUS_11220 12303 11548 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_11220 12941 12363 gene locus_tag LOCUS_11230 12941 12363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 13774 13040 gene locus_tag LOCUS_11240 13774 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 15184 13961 gene locus_tag LOCUS_11250 gene tyrS 15184 13961 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence053 <1 835 gene locus_tag LOCUS_11260 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392286.1:flagellar filament capping protein FliD 923 1297 gene locus_tag LOCUS_11270 gene fliS 923 1297 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869575.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11270 1359 1940 gene locus_tag LOCUS_11280 1359 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2293 2496 gene locus_tag LOCUS_11290 gene cspC 2293 2496 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_11290 3103 3624 gene locus_tag LOCUS_11300 gene raiA 3103 3624 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_11300 3778 4926 gene locus_tag LOCUS_11310 3778 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 5030 5695 gene locus_tag LOCUS_11320 5030 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272208.1 protein_id gnl|my_center|LOCUS_11320 5962 7269 gene locus_tag LOCUS_11330 5962 7269 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459114.1 protein_id gnl|my_center|LOCUS_11330 7372 8781 gene locus_tag LOCUS_11340 7372 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 8741 9307 gene locus_tag LOCUS_11350 8741 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 9318 9503 gene locus_tag LOCUS_11360 9318 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 9472 10380 gene locus_tag LOCUS_11370 9472 10380 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_11370 10660 12033 gene locus_tag LOCUS_11380 gene gltA 10660 12033 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_11380 12151 13389 gene locus_tag LOCUS_11390 gene preA 12151 13389 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_11390 13534 14409 gene locus_tag LOCUS_11400 13534 14409 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_11400 14595 15035 gene locus_tag LOCUS_11410 14595 15035 CDS product HutP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813550.1 protein_id gnl|my_center|LOCUS_11410 15241 16452 gene locus_tag LOCUS_11420 15241 16452 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence054 2568 490 gene locus_tag LOCUS_11430 gene fusA 2568 490 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_11430 3226 2756 gene locus_tag LOCUS_11440 gene rpsG 3226 2756 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545233.1 protein_id gnl|my_center|LOCUS_11440 3634 3260 gene locus_tag LOCUS_11450 gene rpsL 3634 3260 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869933.1 protein_id gnl|my_center|LOCUS_11450 4031 3777 gene locus_tag LOCUS_11460 4031 3777 CDS product 50S ribosomal protein L7Ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393943.1 protein_id gnl|my_center|LOCUS_11460 8000 4152 gene locus_tag LOCUS_11470 gene rpoC 8000 4152 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773568.1 protein_id gnl|my_center|LOCUS_11470 12237 8119 gene locus_tag LOCUS_11480 gene rpoB 12237 8119 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147554.1 protein_id gnl|my_center|LOCUS_11480 13074 12685 gene locus_tag LOCUS_11490 gene rplL 13074 12685 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_11490 13673 13131 gene locus_tag LOCUS_11500 gene rplJ 13673 13131 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_11500 14936 14235 gene locus_tag LOCUS_11510 gene rplA 14936 14235 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_11510 15411 14986 gene locus_tag LOCUS_11520 gene rplK 15411 14986 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393949.1 protein_id gnl|my_center|LOCUS_11520 16004 15480 gene locus_tag LOCUS_11530 gene nusG 16004 15480 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810198.1 protein_id gnl|my_center|LOCUS_11530 16250 16029 gene locus_tag LOCUS_11540 16250 16029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence055 763 572 gene locus_tag LOCUS_11550 763 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1389 760 gene locus_tag LOCUS_11560 1389 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2087 2515 gene locus_tag LOCUS_11570 2087 2515 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965770.1 protein_id gnl|my_center|LOCUS_11570 2519 3046 gene locus_tag LOCUS_11580 2519 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 3350 4078 gene locus_tag LOCUS_11590 gene cwlD 3350 4078 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 protein_id gnl|my_center|LOCUS_11590 4248 5354 gene locus_tag LOCUS_11600 4248 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 5621 7597 gene locus_tag LOCUS_11610 gene thrS 5621 7597 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393260.1 protein_id gnl|my_center|LOCUS_11610 8005 8574 gene locus_tag LOCUS_11620 gene infC 8005 8574 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_11620 8985 9350 gene locus_tag LOCUS_11630 gene rplT 8985 9350 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393257.1 protein_id gnl|my_center|LOCUS_11630 9575 10849 gene locus_tag LOCUS_11640 9575 10849 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048134.1 protein_id gnl|my_center|LOCUS_11640 11064 11720 gene locus_tag LOCUS_11650 11064 11720 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_11650 11710 12582 gene locus_tag LOCUS_11660 11710 12582 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_11660 13054 14112 gene locus_tag LOCUS_11670 gene pheS 13054 14112 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence056 51 1094 gene locus_tag LOCUS_11680 51 1094 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_11680 1101 2036 gene locus_tag LOCUS_11690 1101 2036 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_11690 2450 2268 gene locus_tag LOCUS_11700 2450 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3500 2598 gene locus_tag LOCUS_11710 3500 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 3765 4862 gene locus_tag LOCUS_11720 3765 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5105 4911 gene locus_tag LOCUS_11730 5105 4911 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545767.1 protein_id gnl|my_center|LOCUS_11730 5523 5092 gene locus_tag LOCUS_11740 5523 5092 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_11740 6045 6320 gene locus_tag LOCUS_11750 6045 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 7003 6317 gene locus_tag LOCUS_11760 7003 6317 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_11760 7920 7000 gene locus_tag LOCUS_11770 7920 7000 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_11770 9054 7924 gene locus_tag LOCUS_11780 9054 7924 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_11780 9341 9051 gene locus_tag LOCUS_11790 9341 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 10423 9536 gene locus_tag LOCUS_11800 gene panB 10423 9536 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_11800 11443 10649 gene locus_tag LOCUS_11810 gene fabG 11443 10649 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_11810 12819 11641 gene locus_tag LOCUS_11820 gene pepQ 12819 11641 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411039.1 protein_id gnl|my_center|LOCUS_11820 14153 12972 gene locus_tag LOCUS_11830 14153 12972 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_11830 15002 14298 gene locus_tag LOCUS_11840 15002 14298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_11840 15717 14995 gene locus_tag LOCUS_11850 15717 14995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence057 1966 1286 gene locus_tag LOCUS_11860 1966 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3321 2491 gene locus_tag LOCUS_11870 gene speE 3321 2491 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393316.1 protein_id gnl|my_center|LOCUS_11870 3649 3371 gene locus_tag LOCUS_11880 3649 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 5270 3858 gene locus_tag LOCUS_11890 5270 3858 CDS product N-acyl-D-glutamate deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930249.1 protein_id gnl|my_center|LOCUS_11890 6772 5405 gene locus_tag LOCUS_11900 6772 5405 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477816.1 protein_id gnl|my_center|LOCUS_11900 8770 6992 gene locus_tag LOCUS_11910 8770 6992 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_11910 9194 8763 gene locus_tag LOCUS_11920 9194 8763 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869225.1 protein_id gnl|my_center|LOCUS_11920 10903 9530 gene locus_tag LOCUS_11930 gene ygjG 10903 9530 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830312.1 protein_id gnl|my_center|LOCUS_11930 13117 11327 gene locus_tag LOCUS_11940 13117 11327 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986542.1 protein_id gnl|my_center|LOCUS_11940 14436 13114 gene locus_tag LOCUS_11950 14436 13114 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809800.1 protein_id gnl|my_center|LOCUS_11950 15429 14482 gene locus_tag LOCUS_11960 15429 14482 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392344.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence058 1249 605 gene locus_tag LOCUS_11970 1249 605 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207649561.1 protein_id gnl|my_center|LOCUS_11970 2170 1307 gene locus_tag LOCUS_11980 2170 1307 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393187.1 protein_id gnl|my_center|LOCUS_11980 3491 2139 gene locus_tag LOCUS_11990 gene opuCA 3491 2139 CDS product osmoprotectant ABC transporter ATP-binding protein OpuCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243370.1 protein_id gnl|my_center|LOCUS_11990 3608 3958 gene locus_tag LOCUS_12000 3608 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 4450 4202 gene locus_tag LOCUS_12010 4450 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 4605 5657 gene locus_tag LOCUS_12020 gene trpD 4605 5657 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_12020 5891 6736 gene locus_tag LOCUS_12030 5891 6736 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022932.1 protein_id gnl|my_center|LOCUS_12030 6733 7506 gene locus_tag LOCUS_12040 6733 7506 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_12040 7472 8827 gene locus_tag LOCUS_12050 gene trpB 7472 8827 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173169.1 protein_id gnl|my_center|LOCUS_12050 8824 9627 gene locus_tag LOCUS_12060 gene trpA 8824 9627 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256579.1 protein_id gnl|my_center|LOCUS_12060 11713 9722 gene locus_tag LOCUS_12070 11713 9722 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393552.1 protein_id gnl|my_center|LOCUS_12070 11859 14252 gene locus_tag LOCUS_12080 11859 14252 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944365.1 protein_id gnl|my_center|LOCUS_12080 14529 14314 gene locus_tag LOCUS_12090 14529 14314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 14630 15649 gene locus_tag LOCUS_12100 14630 15649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence059 212 787 gene locus_tag LOCUS_12110 gene pyrR 212 787 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583925.1 protein_id gnl|my_center|LOCUS_12110 854 1051 gene locus_tag LOCUS_12120 854 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1054 1983 gene locus_tag LOCUS_12130 1054 1983 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_12130 1980 3347 gene locus_tag LOCUS_12140 1980 3347 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_12140 3462 4352 gene locus_tag LOCUS_12150 3462 4352 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_12150 4342 5301 gene locus_tag LOCUS_12160 4342 5301 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_12160 5264 6016 gene locus_tag LOCUS_12170 gene pyrF 5264 6016 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_12170 6240 6818 gene locus_tag LOCUS_12180 gene pyrE 6240 6818 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_12180 9074 6858 gene locus_tag LOCUS_12190 9074 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 9154 9456 gene locus_tag LOCUS_12200 9154 9456 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393534.1 protein_id gnl|my_center|LOCUS_12200 10360 9449 gene locus_tag LOCUS_12210 10360 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 11040 12170 gene locus_tag LOCUS_12220 11040 12170 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 protein_id gnl|my_center|LOCUS_12220 12192 12899 gene locus_tag LOCUS_12230 gene hisG 12192 12899 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817216.1 protein_id gnl|my_center|LOCUS_12230 12926 15091 gene locus_tag LOCUS_12240 12926 15091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence060 <1 762 gene locus_tag LOCUS_12250 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388404.1:phosphoribosylamine--glycine ligase 792 1313 gene locus_tag LOCUS_12260 792 1313 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_12260 1332 2468 gene locus_tag LOCUS_12270 1332 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 2458 4512 gene locus_tag LOCUS_12280 gene pcrA 2458 4512 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_12280 4509 6740 gene locus_tag LOCUS_12290 gene ligA 4509 6740 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_12290 6791 7198 gene locus_tag LOCUS_12300 6791 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7195 8706 gene locus_tag LOCUS_12310 gene gatA 7195 8706 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_12310 8699 10141 gene locus_tag LOCUS_12320 gene gatB 8699 10141 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_12320 10150 11262 gene locus_tag LOCUS_12330 10150 11262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 11441 12952 gene locus_tag LOCUS_12340 gene rlmD 11441 12952 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105019.1 protein_id gnl|my_center|LOCUS_12340 13115 13348 gene locus_tag LOCUS_12350 13115 13348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 13407 13649 gene locus_tag LOCUS_12360 13407 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 15081 13744 gene locus_tag LOCUS_12370 15081 13744 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence061 34 1047 gene locus_tag LOCUS_12380 34 1047 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459468.1 protein_id gnl|my_center|LOCUS_12380 1271 2401 gene locus_tag LOCUS_12390 gene cofH 1271 2401 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 protein_id gnl|my_center|LOCUS_12390 2402 3145 gene locus_tag LOCUS_12400 gene npdG 2402 3145 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_12400 3154 4047 gene locus_tag LOCUS_12410 3154 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 4076 6022 gene locus_tag LOCUS_12420 4076 6022 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_12420 6109 6993 gene locus_tag LOCUS_12430 6109 6993 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007717423.1 protein_id gnl|my_center|LOCUS_12430 8512 7346 gene locus_tag LOCUS_12440 8512 7346 CDS product acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531219.1 protein_id gnl|my_center|LOCUS_12440 9748 8531 gene locus_tag LOCUS_12450 9748 8531 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886532.1 protein_id gnl|my_center|LOCUS_12450 10516 9791 gene locus_tag LOCUS_12460 10516 9791 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_12460 12167 10743 gene locus_tag LOCUS_12470 12167 10743 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_12470 14304 12427 gene locus_tag LOCUS_12480 14304 12427 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439994.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence062 591 905 gene locus_tag LOCUS_12490 gene rplU 591 905 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869646.1 protein_id gnl|my_center|LOCUS_12490 1404 1772 gene locus_tag LOCUS_12500 gene rpmA 1404 1772 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_12500 1885 2952 gene locus_tag LOCUS_12510 gene obgE 1885 2952 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000496111.1 protein_id gnl|my_center|LOCUS_12510 3089 3718 gene locus_tag LOCUS_12520 gene nadD 3089 3718 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_12520 4032 4289 gene locus_tag LOCUS_12530 4032 4289 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945172.1 protein_id gnl|my_center|LOCUS_12530 4458 5108 gene locus_tag LOCUS_12540 gene yqeK 4458 5108 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057165.1 protein_id gnl|my_center|LOCUS_12540 5306 6559 gene locus_tag LOCUS_12550 5306 6559 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048020.1 protein_id gnl|my_center|LOCUS_12550 6543 6962 gene locus_tag LOCUS_12560 gene rsfS 6543 6962 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392104.1 protein_id gnl|my_center|LOCUS_12560 7123 7198 gene locus_tag LOCUS_t00370 7123 7198 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7458 8564 gene locus_tag LOCUS_12570 7458 8564 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_12570 8730 9527 gene locus_tag LOCUS_12580 8730 9527 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_12580 10495 9710 gene locus_tag LOCUS_12590 10495 9710 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_12590 10701 11867 gene locus_tag LOCUS_12600 10701 11867 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391607.1 protein_id gnl|my_center|LOCUS_12600 11864 12106 gene locus_tag LOCUS_12610 11864 12106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 12103 12480 gene locus_tag LOCUS_12620 12103 12480 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393696.1 protein_id gnl|my_center|LOCUS_12620 12588 13268 gene locus_tag LOCUS_12630 12588 13268 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_12630 13435 13932 gene locus_tag LOCUS_12640 13435 13932 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461601.1 protein_id gnl|my_center|LOCUS_12640 14088 14273 gene locus_tag LOCUS_12650 14088 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935738.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence063 588 376 gene locus_tag LOCUS_12660 588 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 808 581 gene locus_tag LOCUS_12670 808 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 997 2022 gene locus_tag LOCUS_12680 997 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2566 2387 gene locus_tag LOCUS_12690 2566 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 2864 2607 gene locus_tag LOCUS_12700 2864 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3099 2944 gene locus_tag LOCUS_12710 3099 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12710 3922 3188 gene locus_tag LOCUS_12720 gene thiE 3922 3188 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_12720 4210 4404 gene locus_tag LOCUS_12730 4210 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 6435 5398 gene locus_tag LOCUS_12740 6435 5398 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064307.1 protein_id gnl|my_center|LOCUS_12740 7125 6451 gene locus_tag LOCUS_12750 7125 6451 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424384.1 protein_id gnl|my_center|LOCUS_12750 7717 7166 gene locus_tag LOCUS_12760 7717 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 9257 7842 gene locus_tag LOCUS_12770 9257 7842 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_12770 11149 9254 gene locus_tag LOCUS_12780 11149 9254 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_12780 11654 11151 gene locus_tag LOCUS_12790 11654 11151 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_12790 12899 12003 gene locus_tag LOCUS_12800 gene speB 12899 12003 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_12800 13420 14808 gene locus_tag LOCUS_12810 13420 14808 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence064 1320 148 gene locus_tag LOCUS_12820 1320 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2357 1476 gene locus_tag LOCUS_12830 2357 1476 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584123.1 protein_id gnl|my_center|LOCUS_12830 3133 2714 gene locus_tag LOCUS_12840 3133 2714 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892241.1 protein_id gnl|my_center|LOCUS_12840 4731 3244 gene locus_tag LOCUS_12850 4731 3244 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877513.1 protein_id gnl|my_center|LOCUS_12850 6546 4771 gene locus_tag LOCUS_12860 gene oadA 6546 4771 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_12860 7824 6760 gene locus_tag LOCUS_12870 7824 6760 CDS product xanthine/uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986539.1 protein_id gnl|my_center|LOCUS_12870 8180 8452 gene locus_tag LOCUS_12880 8180 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8639 9298 gene locus_tag LOCUS_12890 8639 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 9431 9691 gene locus_tag LOCUS_12900 9431 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 10752 9688 gene locus_tag LOCUS_12910 10752 9688 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174053.1 protein_id gnl|my_center|LOCUS_12910 12105 10753 gene locus_tag LOCUS_12920 12105 10753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 13502 12213 gene locus_tag LOCUS_12930 13502 12213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 14406 13861 gene locus_tag LOCUS_12940 14406 13861 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944684.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence065 1679 1179 gene locus_tag LOCUS_12950 gene rplI 1679 1179 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391680.1 protein_id gnl|my_center|LOCUS_12950 2700 1687 gene locus_tag LOCUS_12960 2700 1687 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434254.1 protein_id gnl|my_center|LOCUS_12960 3399 3166 gene locus_tag LOCUS_12970 gene rpsR 3399 3166 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_12970 3870 3466 gene locus_tag LOCUS_12980 gene ssb 3870 3466 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272405.1 protein_id gnl|my_center|LOCUS_12980 4211 3927 gene locus_tag LOCUS_12990 gene rpsF 4211 3927 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462318.1 protein_id gnl|my_center|LOCUS_12990 5825 4554 gene locus_tag LOCUS_13000 gene ychF 5825 4554 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037200879.1 protein_id gnl|my_center|LOCUS_13000 6181 5891 gene locus_tag LOCUS_13010 6181 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 7094 6162 gene locus_tag LOCUS_13020 7094 6162 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966986.1 protein_id gnl|my_center|LOCUS_13020 8006 7293 gene locus_tag LOCUS_13030 8006 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 8555 8097 gene locus_tag LOCUS_13040 8555 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 8853 9524 gene locus_tag LOCUS_13050 gene yyaC 8853 9524 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393985.1 protein_id gnl|my_center|LOCUS_13050 9997 9746 gene locus_tag LOCUS_13060 9997 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 10695 10045 gene locus_tag LOCUS_13070 10695 10045 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_13070 11649 10711 gene locus_tag LOCUS_13080 11649 10711 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227672.1 protein_id gnl|my_center|LOCUS_13080 12253 11789 gene locus_tag LOCUS_13090 12253 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 13474 12296 gene locus_tag LOCUS_13100 13474 12296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 14053 13586 gene locus_tag LOCUS_13110 14053 13586 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398925.1 protein_id gnl|my_center|LOCUS_13110 14016 14189 gene locus_tag LOCUS_13120 14016 14189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence066 1946 201 gene locus_tag LOCUS_13130 1946 201 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_13130 5140 2276 gene locus_tag LOCUS_13140 5140 2276 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861450.1 protein_id gnl|my_center|LOCUS_13140 6194 5553 gene locus_tag LOCUS_13150 6194 5553 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424384.1 protein_id gnl|my_center|LOCUS_13150 7515 6232 gene locus_tag LOCUS_13160 7515 6232 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974552.1 protein_id gnl|my_center|LOCUS_13160 8959 7598 gene locus_tag LOCUS_13170 8959 7598 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_13170 10957 9023 gene locus_tag LOCUS_13180 10957 9023 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_13180 12281 11208 gene locus_tag LOCUS_13190 12281 11208 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_13190 13049 12324 gene locus_tag LOCUS_13200 13049 12324 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245732.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence067 2458 152 gene locus_tag LOCUS_13210 2458 152 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_13210 2939 2460 gene locus_tag LOCUS_13220 2939 2460 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_13220 3847 2936 gene locus_tag LOCUS_13230 gene xdhB 3847 2936 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459192.1 protein_id gnl|my_center|LOCUS_13230 5182 3893 gene locus_tag LOCUS_13240 gene dctM 5182 3893 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085927.1 protein_id gnl|my_center|LOCUS_13240 5696 5214 gene locus_tag LOCUS_13250 5696 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13250 6800 5709 gene locus_tag LOCUS_13260 6800 5709 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721134.1 protein_id gnl|my_center|LOCUS_13260 8568 6913 gene locus_tag LOCUS_13270 8568 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 9818 8625 gene locus_tag LOCUS_13280 gene kbl 9818 8625 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036153.1 protein_id gnl|my_center|LOCUS_13280 10174 9815 gene locus_tag LOCUS_13290 10174 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 11367 10156 gene locus_tag LOCUS_13300 11367 10156 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582831.1 protein_id gnl|my_center|LOCUS_13300 <13828 12171 gene locus_tag LOCUS_13310 <13828 12171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249942.1:carbon starvation protein A >Feature sequence068 289 726 gene locus_tag LOCUS_13320 289 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1031 1306 gene locus_tag LOCUS_13330 1031 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13330 1800 2102 gene locus_tag LOCUS_13340 1800 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2671 4017 gene locus_tag LOCUS_13350 gene mgtE 2671 4017 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680769.1 protein_id gnl|my_center|LOCUS_13350 4570 5673 gene locus_tag LOCUS_13360 4570 5673 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991766.1 protein_id gnl|my_center|LOCUS_13360 5769 5891 gene locus_tag LOCUS_13370 5769 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 7056 7334 gene locus_tag LOCUS_13380 7056 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 7773 7594 gene locus_tag LOCUS_13390 7773 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 8281 9258 gene locus_tag LOCUS_13400 8281 9258 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186989.1 protein_id gnl|my_center|LOCUS_13400 9265 10008 gene locus_tag LOCUS_13410 9265 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 10073 10942 gene locus_tag LOCUS_13420 10073 10942 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_13420 10939 11766 gene locus_tag LOCUS_13430 10939 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13430 11768 12559 gene locus_tag LOCUS_13440 11768 12559 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392229.1 protein_id gnl|my_center|LOCUS_13440 12576 13559 gene locus_tag LOCUS_13450 12576 13559 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048331.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence069 21 332 gene locus_tag LOCUS_13460 21 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 493 2472 gene locus_tag LOCUS_13470 493 2472 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 protein_id gnl|my_center|LOCUS_13470 2627 5416 gene locus_tag LOCUS_13480 2627 5416 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_13480 5422 6465 gene locus_tag LOCUS_13490 5422 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 6558 7865 gene locus_tag LOCUS_13500 6558 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 8917 7889 gene locus_tag LOCUS_13510 8917 7889 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846205.1 protein_id gnl|my_center|LOCUS_13510 9807 8893 gene locus_tag LOCUS_13520 9807 8893 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_13520 10293 11105 gene locus_tag LOCUS_13530 10293 11105 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_13530 11869 11135 gene locus_tag LOCUS_13540 11869 11135 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812013.1 protein_id gnl|my_center|LOCUS_13540 12117 13643 gene locus_tag LOCUS_13550 gene rimO 12117 13643 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence070 1066 122 gene locus_tag LOCUS_13560 1066 122 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_13560 2178 1066 gene locus_tag LOCUS_13570 2178 1066 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_13570 3759 2215 gene locus_tag LOCUS_13580 3759 2215 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_13580 4088 4837 gene locus_tag LOCUS_13590 gene fabG 4088 4837 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_13590 5016 6374 gene locus_tag LOCUS_13600 5016 6374 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_13600 6349 7968 gene locus_tag LOCUS_13610 6349 7968 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_13610 8028 8984 gene locus_tag LOCUS_13620 gene arcC 8028 8984 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_13620 8986 10296 gene locus_tag LOCUS_13630 8986 10296 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393148.1 protein_id gnl|my_center|LOCUS_13630 10479 11462 gene locus_tag LOCUS_13640 gene argF 10479 11462 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_13640 11581 12948 gene locus_tag LOCUS_13650 11581 12948 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897229.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence071 559 86 gene locus_tag LOCUS_13660 559 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1122 562 gene locus_tag LOCUS_13670 1122 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2164 1331 gene locus_tag LOCUS_13680 2164 1331 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_13680 2903 2367 gene locus_tag LOCUS_13690 gene nuoE 2903 2367 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_13690 5695 2900 gene locus_tag LOCUS_13700 gene fdhF 5695 2900 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_13700 7557 5692 gene locus_tag LOCUS_13710 gene nuoF 7557 5692 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_13710 7814 8791 gene locus_tag LOCUS_13720 7814 8791 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391611.1 protein_id gnl|my_center|LOCUS_13720 8944 9723 gene locus_tag LOCUS_13730 8944 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 11265 9787 gene locus_tag LOCUS_13740 gene guaB 11265 9787 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541542.1 protein_id gnl|my_center|LOCUS_13740 11745 11281 gene locus_tag LOCUS_13750 11745 11281 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198843.1 protein_id gnl|my_center|LOCUS_13750 13060 11816 gene locus_tag LOCUS_13760 13060 11816 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence072 <1 484 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccctcgtaggtaggctgcaaac 1860 1558 gene locus_tag LOCUS_13770 gene cas2 1860 1558 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013193.1 protein_id gnl|my_center|LOCUS_13770 3173 2178 gene locus_tag LOCUS_13780 gene cas1b 3173 2178 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545370.1 protein_id gnl|my_center|LOCUS_13780 4175 3453 gene locus_tag LOCUS_13790 4175 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 6748 4253 gene locus_tag LOCUS_13800 6748 4253 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_13800 7530 6751 gene locus_tag LOCUS_13810 7530 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 8503 7535 gene locus_tag LOCUS_13820 gene cas7b 8503 7535 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_13820 10417 8522 gene locus_tag LOCUS_13830 gene cas8b 10417 8522 CDS product type I-B CRISPR-associated protein Cas8b/Csh1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181363066.1 protein_id gnl|my_center|LOCUS_13830 12060 10768 gene locus_tag LOCUS_13840 12060 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 12675 12142 gene locus_tag LOCUS_13850 12675 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence073 1187 126 gene locus_tag LOCUS_13860 1187 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391696.1 protein_id gnl|my_center|LOCUS_13860 2099 1530 gene locus_tag LOCUS_13870 2099 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 5451 2293 gene locus_tag LOCUS_13880 5451 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 7156 5441 gene locus_tag LOCUS_13890 7156 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 8661 7366 gene locus_tag LOCUS_13900 8661 7366 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096581549.1 protein_id gnl|my_center|LOCUS_13900 10738 8678 gene locus_tag LOCUS_13910 10738 8678 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393690.1 protein_id gnl|my_center|LOCUS_13910 11132 10746 gene locus_tag LOCUS_13920 11132 10746 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393689.1 protein_id gnl|my_center|LOCUS_13920 11410 12669 gene locus_tag LOCUS_13930 11410 12669 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence074 3059 1743 gene locus_tag LOCUS_13940 gene coaBC 3059 1743 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_13940 3268 3056 gene locus_tag LOCUS_13950 gene rpoZ 3268 3056 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811864.1 protein_id gnl|my_center|LOCUS_13950 3966 3265 gene locus_tag LOCUS_13960 gene gmk 3966 3265 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_13960 4272 4000 gene locus_tag LOCUS_13970 4272 4000 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_13970 4630 4313 gene locus_tag LOCUS_13980 gene mihF 4630 4313 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_13980 5533 4646 gene locus_tag LOCUS_13990 5533 4646 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_13990 6766 5573 gene locus_tag LOCUS_14000 6766 5573 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_14000 7728 6778 gene locus_tag LOCUS_14010 gene dapF 7728 6778 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_14010 10859 7977 gene locus_tag LOCUS_14020 10859 7977 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392406.1 protein_id gnl|my_center|LOCUS_14020 11072 11557 gene locus_tag LOCUS_14030 11072 11557 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060824.1 protein_id gnl|my_center|LOCUS_14030 11508 11927 gene locus_tag LOCUS_14040 11508 11927 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094555.1 protein_id gnl|my_center|LOCUS_14040 12619 12296 gene locus_tag LOCUS_14050 12619 12296 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence075 1687 164 gene locus_tag LOCUS_14060 1687 164 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869054.1 protein_id gnl|my_center|LOCUS_14060 2535 1705 gene locus_tag LOCUS_14070 2535 1705 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_14070 3737 2601 gene locus_tag LOCUS_14080 3737 2601 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_14080 5374 3800 gene locus_tag LOCUS_14090 gene gcvPB 5374 3800 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_14090 6771 5371 gene locus_tag LOCUS_14100 gene gcvPA 6771 5371 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868897.1 protein_id gnl|my_center|LOCUS_14100 6942 6784 gene locus_tag LOCUS_14110 6942 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 8239 6929 gene locus_tag LOCUS_14120 8239 6929 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974552.1 protein_id gnl|my_center|LOCUS_14120 9811 8300 gene locus_tag LOCUS_14130 9811 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 10046 9840 gene locus_tag LOCUS_14140 10046 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 10561 11763 gene locus_tag LOCUS_14150 gene istA 10561 11763 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_14150 12217 12609 gene locus_tag LOCUS_14160 12217 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 13044 12835 gene locus_tag LOCUS_14170 13044 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14170 >Feature sequence076 1265 321 gene locus_tag LOCUS_14180 gene ligD 1265 321 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392997.1 protein_id gnl|my_center|LOCUS_14180 2313 1462 gene locus_tag LOCUS_14190 2313 1462 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392998.1 protein_id gnl|my_center|LOCUS_14190 2867 2319 gene locus_tag LOCUS_14200 gene ytfJ 2867 2319 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392871.1 protein_id gnl|my_center|LOCUS_14200 3457 3275 gene locus_tag LOCUS_14210 3457 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3558 4400 gene locus_tag LOCUS_14220 3558 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14220 4369 5184 gene locus_tag LOCUS_14230 4369 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14230 5264 6337 gene locus_tag LOCUS_14240 5264 6337 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392970.1 protein_id gnl|my_center|LOCUS_14240 6334 7560 gene locus_tag LOCUS_14250 6334 7560 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_14250 7580 7798 gene locus_tag LOCUS_14260 7580 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 7899 7699 gene locus_tag LOCUS_14270 7899 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 8226 8540 gene locus_tag LOCUS_14280 8226 8540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 8547 9254 gene locus_tag LOCUS_14290 8547 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 10075 9815 gene locus_tag LOCUS_14300 10075 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 10745 10407 gene locus_tag LOCUS_14310 10745 10407 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392910.1 protein_id gnl|my_center|LOCUS_14310 11107 10712 gene locus_tag LOCUS_14320 11107 10712 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460531.1 protein_id gnl|my_center|LOCUS_14320 11462 11223 gene locus_tag LOCUS_14330 11462 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 11618 11845 gene locus_tag LOCUS_14340 11618 11845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 12500 12132 gene locus_tag LOCUS_14350 12500 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 12727 12500 gene locus_tag LOCUS_14360 12727 12500 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence077 668 1441 gene locus_tag LOCUS_14370 668 1441 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_14370 1438 2961 gene locus_tag LOCUS_14380 1438 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2966 5980 gene locus_tag LOCUS_14390 gene polA 2966 5980 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404381.1 protein_id gnl|my_center|LOCUS_14390 6371 7009 gene locus_tag LOCUS_14400 gene ytaF 6371 7009 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963457.1 protein_id gnl|my_center|LOCUS_14400 7035 7643 gene locus_tag LOCUS_14410 gene coaE 7035 7643 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_14410 7787 8413 gene locus_tag LOCUS_14420 7787 8413 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393337.1 protein_id gnl|my_center|LOCUS_14420 8590 9549 gene locus_tag LOCUS_14430 8590 9549 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_14430 11215 9731 gene locus_tag LOCUS_14440 11215 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 11757 12194 gene locus_tag LOCUS_14450 11757 12194 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812126.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence078 2206 530 gene locus_tag LOCUS_14460 gene gpmI 2206 530 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_14460 4328 2274 gene locus_tag LOCUS_14470 4328 2274 CDS product bifunctional phosphoglycerate kinase/triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081072.1 protein_id gnl|my_center|LOCUS_14470 5372 4362 gene locus_tag LOCUS_14480 gene gap 5372 4362 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_14480 5622 5816 gene locus_tag LOCUS_14490 5622 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 7316 5883 gene locus_tag LOCUS_14500 gene rpoN 7316 5883 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391805.1 protein_id gnl|my_center|LOCUS_14500 8402 7428 gene locus_tag LOCUS_14510 8402 7428 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392700.1 protein_id gnl|my_center|LOCUS_14510 8998 8807 gene locus_tag LOCUS_14520 8998 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 10572 9172 gene locus_tag LOCUS_14530 gene argH 10572 9172 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_14530 11906 10635 gene locus_tag LOCUS_14540 11906 10635 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142927.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence079 1373 1191 gene locus_tag LOCUS_14550 1373 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2306 3793 gene locus_tag LOCUS_14560 gene mttB 2306 3793 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_14560 3786 4439 gene locus_tag LOCUS_14570 3786 4439 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_14570 4443 5999 gene locus_tag LOCUS_14580 gene rocR 4443 5999 CDS product arginine utilization transcriptional regulator RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110073.1 protein_id gnl|my_center|LOCUS_14580 8026 6200 gene locus_tag LOCUS_14590 8026 6200 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_14590 9505 8261 gene locus_tag LOCUS_14600 9505 8261 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583737.1 protein_id gnl|my_center|LOCUS_14600 10435 9578 gene locus_tag LOCUS_14610 10435 9578 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462252.1 protein_id gnl|my_center|LOCUS_14610 11353 10607 gene locus_tag LOCUS_14620 11353 10607 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_14620 12146 11370 gene locus_tag LOCUS_14630 12146 11370 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080269.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence080 1434 661 gene locus_tag LOCUS_14640 1434 661 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_14640 1653 1486 gene locus_tag LOCUS_14650 1653 1486 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_14650 1876 1631 gene locus_tag LOCUS_14660 1876 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 2437 1880 gene locus_tag LOCUS_14670 gene frr 2437 1880 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_14670 3158 2427 gene locus_tag LOCUS_14680 gene pyrH 3158 2427 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_14680 3762 3142 gene locus_tag LOCUS_14690 gene tsf 3762 3142 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_14690 4482 3784 gene locus_tag LOCUS_14700 gene rpsB 4482 3784 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_14700 4694 4488 gene locus_tag LOCUS_14710 4694 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5074 4808 gene locus_tag LOCUS_14720 5074 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 5940 5155 gene locus_tag LOCUS_14730 5940 5155 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392315.1 protein_id gnl|my_center|LOCUS_14730 6880 6029 gene locus_tag LOCUS_14740 6880 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 8994 6880 gene locus_tag LOCUS_14750 gene flhA 8994 6880 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870057.1 protein_id gnl|my_center|LOCUS_14750 10326 9088 gene locus_tag LOCUS_14760 gene flhB 10326 9088 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870058.1 protein_id gnl|my_center|LOCUS_14760 11117 10299 gene locus_tag LOCUS_14770 gene fliR 11117 10299 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_14770 11419 11150 gene locus_tag LOCUS_14780 gene fliQ 11419 11150 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_14780 <12135 11435 gene locus_tag LOCUS_14790 <12135 11435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081361032.1:flagellar type III secretion system pore protein FliP >Feature sequence081 170 985 gene locus_tag LOCUS_14800 170 985 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_14800 1106 1918 gene locus_tag LOCUS_14810 gene truA 1106 1918 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_14810 2087 2554 gene locus_tag LOCUS_14820 gene rplM 2087 2554 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_14820 2547 2939 gene locus_tag LOCUS_14830 gene rpsI 2547 2939 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_14830 3317 3141 gene locus_tag LOCUS_14840 3317 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3424 4023 gene locus_tag LOCUS_14850 gene cwlD 3424 4023 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 protein_id gnl|my_center|LOCUS_14850 4382 5812 gene locus_tag LOCUS_14860 gene amrA 4382 5812 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_14860 5812 6858 gene locus_tag LOCUS_14870 gene amrS 5812 6858 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393777.1 protein_id gnl|my_center|LOCUS_14870 6944 7891 gene locus_tag LOCUS_14880 gene argF 6944 7891 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_14880 8032 9510 gene locus_tag LOCUS_14890 8032 9510 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_14890 9564 10577 gene locus_tag LOCUS_14900 9564 10577 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306812.1 protein_id gnl|my_center|LOCUS_14900 11396 10728 gene locus_tag LOCUS_14910 11396 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 11277 11810 gene locus_tag LOCUS_14920 11277 11810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence082 1260 562 gene locus_tag LOCUS_14930 1260 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1377 1628 gene locus_tag LOCUS_14940 1377 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3126 2086 gene locus_tag LOCUS_14950 3126 2086 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461038.1 protein_id gnl|my_center|LOCUS_14950 3975 3415 gene locus_tag LOCUS_14960 3975 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 4102 4344 gene locus_tag LOCUS_14970 4102 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5815 4700 gene locus_tag LOCUS_14980 5815 4700 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_14980 6271 5822 gene locus_tag LOCUS_14990 6271 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 7121 6261 gene locus_tag LOCUS_15000 7121 6261 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_15000 8103 7216 gene locus_tag LOCUS_15010 8103 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 9227 8907 gene locus_tag LOCUS_15020 9227 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 10380 10054 gene locus_tag LOCUS_15030 10380 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15030 10565 10398 gene locus_tag LOCUS_15040 10565 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 10802 10596 gene locus_tag LOCUS_15050 10802 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 10946 11137 gene locus_tag LOCUS_15060 10946 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 <12066 11274 gene locus_tag LOCUS_15070 <12066 11274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006523900.1:mannose-1-phosphate guanylyltransferase >Feature sequence083 13 1437 gene locus_tag LOCUS_15080 13 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1425 2693 gene locus_tag LOCUS_15090 1425 2693 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_15090 2693 2998 gene locus_tag LOCUS_15100 2693 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 3159 4592 gene locus_tag LOCUS_15110 3159 4592 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_15110 4613 5965 gene locus_tag LOCUS_15120 4613 5965 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263119.1 protein_id gnl|my_center|LOCUS_15120 5970 7370 gene locus_tag LOCUS_15130 gene lpdA 5970 7370 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_227018667.1 protein_id gnl|my_center|LOCUS_15130 7342 8241 gene locus_tag LOCUS_15140 7342 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 8406 9359 gene locus_tag LOCUS_15150 gene lipA 8406 9359 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_15150 9488 10444 gene locus_tag LOCUS_15160 gene mch 9488 10444 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871160.1 protein_id gnl|my_center|LOCUS_15160 11778 10753 gene locus_tag LOCUS_15170 11778 10753 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869312.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence084 601 1788 gene locus_tag LOCUS_15180 601 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_15180 2387 1791 gene locus_tag LOCUS_15190 2387 1791 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838224.1 protein_id gnl|my_center|LOCUS_15190 3346 2462 gene locus_tag LOCUS_15200 gene pstA 3346 2462 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391661.1 protein_id gnl|my_center|LOCUS_15200 4312 3377 gene locus_tag LOCUS_15210 gene pstC 4312 3377 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391660.1 protein_id gnl|my_center|LOCUS_15210 4438 4581 gene locus_tag LOCUS_15220 4438 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 5495 4557 gene locus_tag LOCUS_15230 5495 4557 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 protein_id gnl|my_center|LOCUS_15230 5807 6082 gene locus_tag LOCUS_15240 5807 6082 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_15240 6079 6870 gene locus_tag LOCUS_15250 6079 6870 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392919.1 protein_id gnl|my_center|LOCUS_15250 6920 8326 gene locus_tag LOCUS_15260 6920 8326 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392918.1 protein_id gnl|my_center|LOCUS_15260 9822 8491 gene locus_tag LOCUS_15270 9822 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 11621 11052 gene locus_tag LOCUS_15280 11621 11052 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence085 607 38 gene locus_tag LOCUS_15290 607 38 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937344.1 protein_id gnl|my_center|LOCUS_15290 1719 775 gene locus_tag LOCUS_15300 1719 775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969640.1 protein_id gnl|my_center|LOCUS_15300 3065 1716 gene locus_tag LOCUS_15310 3065 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 4153 3065 gene locus_tag LOCUS_15320 4153 3065 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850162.1 protein_id gnl|my_center|LOCUS_15320 4897 4235 gene locus_tag LOCUS_15330 4897 4235 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424384.1 protein_id gnl|my_center|LOCUS_15330 6674 5112 gene locus_tag LOCUS_15340 6674 5112 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964022.1 protein_id gnl|my_center|LOCUS_15340 7788 7321 gene locus_tag LOCUS_15350 gene ribE 7788 7321 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392435.1 protein_id gnl|my_center|LOCUS_15350 9028 7829 gene locus_tag LOCUS_15360 9028 7829 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_15360 10106 9357 gene locus_tag LOCUS_15370 gene ribE 10106 9357 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258063.1 protein_id gnl|my_center|LOCUS_15370 11270 10194 gene locus_tag LOCUS_15380 gene ribD 11270 10194 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_15380 11593 11408 gene locus_tag LOCUS_15390 11593 11408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 11775 11590 gene locus_tag LOCUS_15400 11775 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence086 1977 1240 gene locus_tag LOCUS_15410 1977 1240 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_15410 3457 2066 gene locus_tag LOCUS_15420 gene murD 3457 2066 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_15420 4861 3647 gene locus_tag LOCUS_15430 4861 3647 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_15430 5927 4989 gene locus_tag LOCUS_15440 5927 4989 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393069.1 protein_id gnl|my_center|LOCUS_15440 6183 6734 gene locus_tag LOCUS_15450 6183 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 6963 8081 gene locus_tag LOCUS_15460 6963 8081 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869047.1 protein_id gnl|my_center|LOCUS_15460 9392 8070 gene locus_tag LOCUS_15470 9392 8070 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_15470 10337 9504 gene locus_tag LOCUS_15480 10337 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 11243 10761 gene locus_tag LOCUS_15490 11243 10761 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842896.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence087 1017 1154 gene locus_tag LOCUS_15500 1017 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1505 2020 gene locus_tag LOCUS_15510 1505 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2405 2046 gene locus_tag LOCUS_15520 2405 2046 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_15520 2802 2425 gene locus_tag LOCUS_15530 gene crcB 2802 2425 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870206.1 protein_id gnl|my_center|LOCUS_15530 3279 3019 gene locus_tag LOCUS_15540 3279 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3554 3276 gene locus_tag LOCUS_15550 3554 3276 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054876196.1 protein_id gnl|my_center|LOCUS_15550 3770 4615 gene locus_tag LOCUS_15560 gene panC 3770 4615 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_15560 6916 4988 gene locus_tag LOCUS_15570 6916 4988 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_15570 6980 7198 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ataatctatttgagtcgctgact 8145 8933 gene locus_tag LOCUS_15580 8145 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 9221 9033 gene locus_tag LOCUS_15590 9221 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 9591 10148 gene locus_tag LOCUS_15600 9591 10148 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362795.1 protein_id gnl|my_center|LOCUS_15600 10392 10745 gene locus_tag LOCUS_15610 10392 10745 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393003.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence088 3539 2475 gene locus_tag LOCUS_15620 3539 2475 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_15620 4191 3673 gene locus_tag LOCUS_15630 4191 3673 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_15630 4776 4285 gene locus_tag LOCUS_15640 4776 4285 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289036.1 protein_id gnl|my_center|LOCUS_15640 5978 5037 gene locus_tag LOCUS_15650 gene trxB 5978 5037 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_15650 8055 5986 gene locus_tag LOCUS_15660 gene fusA 8055 5986 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_15660 10466 8055 gene locus_tag LOCUS_15670 10466 8055 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_15670 10587 10405 gene locus_tag LOCUS_15680 10587 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 10687 10854 gene locus_tag LOCUS_15690 10687 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence089 91 393 gene locus_tag LOCUS_15700 91 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 490 762 gene locus_tag LOCUS_15710 490 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 3399 1624 gene locus_tag LOCUS_15720 3399 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 3770 3396 gene locus_tag LOCUS_15730 3770 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 4052 3837 gene locus_tag LOCUS_15740 4052 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 4220 5515 gene locus_tag LOCUS_15750 4220 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 6242 6042 gene locus_tag LOCUS_15760 6242 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 6360 8093 gene locus_tag LOCUS_15770 6360 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 8606 10255 gene locus_tag LOCUS_15780 gene tilS 8606 10255 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence090 1077 817 gene locus_tag LOCUS_15790 gene spoVS 1077 817 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459952.1 protein_id gnl|my_center|LOCUS_15790 2276 1482 gene locus_tag LOCUS_15800 2276 1482 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_15800 2831 2301 gene locus_tag LOCUS_15810 2831 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392596.1 protein_id gnl|my_center|LOCUS_15810 4575 2893 gene locus_tag LOCUS_15820 gene rny 4575 2893 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_15820 6048 5017 gene locus_tag LOCUS_15830 gene recA 6048 5017 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_15830 6786 6178 gene locus_tag LOCUS_15840 gene thpR 6786 6178 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_15840 8050 6776 gene locus_tag LOCUS_15850 8050 6776 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_15850 9135 8122 gene locus_tag LOCUS_15860 9135 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 9241 10815 gene locus_tag LOCUS_15870 9241 10815 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_15870 11149 10808 gene locus_tag LOCUS_15880 11149 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence091 2747 423 gene locus_tag LOCUS_15890 2747 423 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966917.1 protein_id gnl|my_center|LOCUS_15890 3979 3161 gene locus_tag LOCUS_15900 3979 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 4856 4236 gene locus_tag LOCUS_15910 4856 4236 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393497.1 protein_id gnl|my_center|LOCUS_15910 5459 4956 gene locus_tag LOCUS_15920 5459 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 5624 5902 gene locus_tag LOCUS_15930 5624 5902 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140124.1 protein_id gnl|my_center|LOCUS_15930 6096 7910 gene locus_tag LOCUS_15940 6096 7910 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861887.1 protein_id gnl|my_center|LOCUS_15940 9394 8039 gene locus_tag LOCUS_15950 9394 8039 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584139.1 protein_id gnl|my_center|LOCUS_15950 10088 9492 gene locus_tag LOCUS_15960 10088 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 10107 10256 gene locus_tag LOCUS_15970 10107 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 10616 10888 gene locus_tag LOCUS_15980 10616 10888 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393237.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence092 <1 1046 gene locus_tag LOCUS_15990 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391745.1:germination protein YpeB 1481 1807 gene locus_tag LOCUS_16000 1481 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1933 3804 gene locus_tag LOCUS_16010 gene aor 1933 3804 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_16010 4950 3811 gene locus_tag LOCUS_16020 gene hypE 4950 3811 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810719.1 protein_id gnl|my_center|LOCUS_16020 6262 5117 gene locus_tag LOCUS_16030 gene hypD 6262 5117 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393664.1 protein_id gnl|my_center|LOCUS_16030 6515 6285 gene locus_tag LOCUS_16040 6515 6285 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250951.1 protein_id gnl|my_center|LOCUS_16040 9281 6621 gene locus_tag LOCUS_16050 gene hypF 9281 6621 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393666.1 protein_id gnl|my_center|LOCUS_16050 9928 9233 gene locus_tag LOCUS_16060 gene hypB 9928 9233 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_16060 10344 9955 gene locus_tag LOCUS_16070 10344 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence093 2068 782 gene locus_tag LOCUS_16080 2068 782 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089219.1 protein_id gnl|my_center|LOCUS_16080 3604 2387 gene locus_tag LOCUS_16090 3604 2387 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_16090 4691 3639 gene locus_tag LOCUS_16100 gene bcd 4691 3639 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 protein_id gnl|my_center|LOCUS_16100 6684 5278 gene locus_tag LOCUS_16110 6684 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 6653 6847 gene locus_tag LOCUS_16120 6653 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 7712 6987 gene locus_tag LOCUS_16130 7712 6987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_16130 8508 7738 gene locus_tag LOCUS_16140 8508 7738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_16140 9410 8508 gene locus_tag LOCUS_16150 9410 8508 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674209.1 protein_id gnl|my_center|LOCUS_16150 10285 9407 gene locus_tag LOCUS_16160 10285 9407 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104449.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence094 1560 1015 gene locus_tag LOCUS_16170 1560 1015 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391695.1 protein_id gnl|my_center|LOCUS_16170 3127 1727 gene locus_tag LOCUS_16180 gene hydA 3127 1727 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_16180 4785 3220 gene locus_tag LOCUS_16190 4785 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 5079 7166 gene locus_tag LOCUS_16200 5079 7166 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_16200 7739 7257 gene locus_tag LOCUS_16210 7739 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 8252 7767 gene locus_tag LOCUS_16220 8252 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 8943 8422 gene locus_tag LOCUS_16230 8943 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 9392 10741 gene locus_tag LOCUS_16240 gene rsxC 9392 10741 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence095 232 480 gene locus_tag LOCUS_16250 232 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 368 937 gene locus_tag LOCUS_16260 368 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1646 1957 gene locus_tag LOCUS_16270 1646 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 2653 3915 gene locus_tag LOCUS_16280 2653 3915 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_16280 3948 4322 gene locus_tag LOCUS_16290 3948 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 4374 5570 gene locus_tag LOCUS_16300 4374 5570 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031134.1 protein_id gnl|my_center|LOCUS_16300 5742 6320 gene locus_tag LOCUS_16310 5742 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 6295 7800 gene locus_tag LOCUS_16320 6295 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 7801 8700 gene locus_tag LOCUS_16330 7801 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 8752 10269 gene locus_tag LOCUS_16340 8752 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence096 2003 420 gene locus_tag LOCUS_16350 2003 420 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546886.1 protein_id gnl|my_center|LOCUS_16350 2704 2000 gene locus_tag LOCUS_16360 2704 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 4581 2716 gene locus_tag LOCUS_16370 gene nuoF 4581 2716 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_16370 5116 4547 gene locus_tag LOCUS_16380 gene nuoE 5116 4547 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817340.1 protein_id gnl|my_center|LOCUS_16380 5427 6632 gene locus_tag LOCUS_16390 5427 6632 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943684.1 protein_id gnl|my_center|LOCUS_16390 7117 8496 gene locus_tag LOCUS_16400 gene ygjG 7117 8496 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297164.1 protein_id gnl|my_center|LOCUS_16400 8810 10354 gene locus_tag LOCUS_16410 8810 10354 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence097 3866 1122 gene locus_tag LOCUS_16420 3866 1122 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_16420 4746 4048 gene locus_tag LOCUS_16430 4746 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391776.1 protein_id gnl|my_center|LOCUS_16430 5315 4833 gene locus_tag LOCUS_16440 5315 4833 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679998.1 protein_id gnl|my_center|LOCUS_16440 6592 5471 gene locus_tag LOCUS_16450 6592 5471 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090946.1 protein_id gnl|my_center|LOCUS_16450 9298 6836 gene locus_tag LOCUS_16460 gene lon 9298 6836 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_16460 <10396 9634 gene locus_tag LOCUS_16470 <10396 9634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392067.1:ATP-dependent protease LonB >Feature sequence098 1579 113 gene locus_tag LOCUS_16480 gene panF 1579 113 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104834.1 protein_id gnl|my_center|LOCUS_16480 1874 1572 gene locus_tag LOCUS_16490 1874 1572 CDS product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800721.1 protein_id gnl|my_center|LOCUS_16490 3328 2039 gene locus_tag LOCUS_16500 3328 2039 CDS product acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531219.1 protein_id gnl|my_center|LOCUS_16500 5559 3658 gene locus_tag LOCUS_16510 5559 3658 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_16510 5754 5572 gene locus_tag LOCUS_16520 5754 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 6320 5865 gene locus_tag LOCUS_16530 6320 5865 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078417.1 protein_id gnl|my_center|LOCUS_16530 6838 6587 gene locus_tag LOCUS_16540 6838 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 7473 6835 gene locus_tag LOCUS_16550 7473 6835 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257178.1 protein_id gnl|my_center|LOCUS_16550 9025 7574 gene locus_tag LOCUS_16560 9025 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 <10267 9120 gene locus_tag LOCUS_16570 <10267 9120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228370.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence099 1 960 gene locus_tag LOCUS_16580 1 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1565 4534 gene locus_tag LOCUS_16590 1565 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 4603 6219 gene locus_tag LOCUS_16600 4603 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 6216 7175 gene locus_tag LOCUS_16610 gene ftcD 6216 7175 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681237.1 protein_id gnl|my_center|LOCUS_16610 7207 8658 gene locus_tag LOCUS_16620 gene hutI 7207 8658 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence100 <1 1044 gene locus_tag LOCUS_16630 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227894.1:aldehyde ferredoxin oxidoreductase family protein 1200 1418 gene locus_tag LOCUS_16640 1200 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1959 2231 gene locus_tag LOCUS_16650 1959 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2233 2478 gene locus_tag LOCUS_16660 2233 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2601 4610 gene locus_tag LOCUS_16670 2601 4610 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776441.1 protein_id gnl|my_center|LOCUS_16670 4762 6645 gene locus_tag LOCUS_16680 gene cooS 4762 6645 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879343.1 protein_id gnl|my_center|LOCUS_16680 6758 6964 gene locus_tag LOCUS_16690 6758 6964 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_16690 7030 7581 gene locus_tag LOCUS_16700 7030 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 <10208 7708 gene locus_tag LOCUS_16710 <10208 7708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_124797038.1:putative glycoside hydrolase >Feature sequence101 2400 1933 gene locus_tag LOCUS_16720 2400 1933 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228021.1 protein_id gnl|my_center|LOCUS_16720 3530 2457 gene locus_tag LOCUS_16730 gene mltG 3530 2457 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_16730 3953 3555 gene locus_tag LOCUS_16740 3953 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 4505 4068 gene locus_tag LOCUS_16750 gene ruvX 4505 4068 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964987.1 protein_id gnl|my_center|LOCUS_16750 5697 4684 gene locus_tag LOCUS_16760 5697 4684 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393143.1 protein_id gnl|my_center|LOCUS_16760 6828 5728 gene locus_tag LOCUS_16770 gene fbp 6828 5728 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393749.1 protein_id gnl|my_center|LOCUS_16770 7554 6913 gene locus_tag LOCUS_16780 7554 6913 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080389.1 protein_id gnl|my_center|LOCUS_16780 7993 7709 gene locus_tag LOCUS_16790 7993 7709 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_16790 <9974 8070 gene locus_tag LOCUS_16800 <9974 8070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393146.1:alanine--tRNA ligase >Feature sequence102 <1 1634 gene locus_tag LOCUS_16810 <1 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877166.1:formylmethanofuran dehydrogenase subunit A 1625 2521 gene locus_tag LOCUS_16820 gene fhcD 1625 2521 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020069.1 protein_id gnl|my_center|LOCUS_16820 2909 3133 gene locus_tag LOCUS_16830 2909 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 3159 4589 gene locus_tag LOCUS_16840 gene actP 3159 4589 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704067.1 protein_id gnl|my_center|LOCUS_16840 4992 5552 gene locus_tag LOCUS_16850 4992 5552 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_16850 5965 6041 gene locus_tag LOCUS_t00380 5965 6041 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6170 6246 gene locus_tag LOCUS_t00390 6170 6246 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6293 6367 gene locus_tag LOCUS_t00400 6293 6367 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6406 6480 gene locus_tag LOCUS_t00410 6406 6480 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7101 8201 gene locus_tag LOCUS_16860 7101 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 8198 8362 gene locus_tag LOCUS_16870 8198 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence103 <1 661 gene locus_tag LOCUS_16880 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259189.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ 939 1841 gene locus_tag LOCUS_16890 gene argB 939 1841 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_16890 1883 3199 gene locus_tag LOCUS_16900 1883 3199 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_16900 3778 5343 gene locus_tag LOCUS_16910 3778 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 5340 6401 gene locus_tag LOCUS_16920 5340 6401 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583801.1 protein_id gnl|my_center|LOCUS_16920 6501 6719 gene locus_tag LOCUS_16930 6501 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 6920 9538 gene locus_tag LOCUS_16940 6920 9538 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259686.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence104 <1 612 gene locus_tag LOCUS_16950 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966601.1:Nramp family divalent metal transporter 851 2323 gene locus_tag LOCUS_16960 851 2323 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819246.1 protein_id gnl|my_center|LOCUS_16960 2412 3494 gene locus_tag LOCUS_16970 2412 3494 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_16970 3951 3478 gene locus_tag LOCUS_16980 3951 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 4973 4032 gene locus_tag LOCUS_16990 4973 4032 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_16990 5517 5897 gene locus_tag LOCUS_17000 5517 5897 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870063.1 protein_id gnl|my_center|LOCUS_17000 5937 6410 gene locus_tag LOCUS_17010 5937 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 6431 7600 gene locus_tag LOCUS_17020 gene fliM 6431 7600 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666990.1 protein_id gnl|my_center|LOCUS_17020 7597 8181 gene locus_tag LOCUS_17030 7597 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence105 891 2276 gene locus_tag LOCUS_17040 891 2276 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869440.1 protein_id gnl|my_center|LOCUS_17040 3496 2435 gene locus_tag LOCUS_17050 3496 2435 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392883.1 protein_id gnl|my_center|LOCUS_17050 4602 3496 gene locus_tag LOCUS_17060 4602 3496 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392884.1 protein_id gnl|my_center|LOCUS_17060 5731 4484 gene locus_tag LOCUS_17070 5731 4484 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768231.1 protein_id gnl|my_center|LOCUS_17070 7438 5852 gene locus_tag LOCUS_17080 7438 5852 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811050.1 protein_id gnl|my_center|LOCUS_17080 7830 7471 gene locus_tag LOCUS_17090 gene spoVAE 7830 7471 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392887.1 protein_id gnl|my_center|LOCUS_17090 9096 7897 gene locus_tag LOCUS_17100 gene spoVAD 9096 7897 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence106 <1 1676 gene locus_tag LOCUS_17110 <1 1676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943934.1:phosphoglucomutase/phosphomannomutase family protein 1682 2008 gene locus_tag LOCUS_17120 1682 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2064 3275 gene locus_tag LOCUS_17130 2064 3275 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_17130 3761 3336 gene locus_tag LOCUS_17140 3761 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4305 3979 gene locus_tag LOCUS_17150 4305 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 4590 6059 gene locus_tag LOCUS_17160 4590 6059 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947936.1 protein_id gnl|my_center|LOCUS_17160 6035 6847 gene locus_tag LOCUS_17170 6035 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 6999 7778 gene locus_tag LOCUS_17180 6999 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 <9197 7918 gene locus_tag LOCUS_17190 <9197 7918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272458.1:calcium-transporting P-type ATPase, PMR1-type >Feature sequence107 2915 2019 gene locus_tag LOCUS_17200 2915 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 4246 3047 gene locus_tag LOCUS_17210 gene icd 4246 3047 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878150.1 protein_id gnl|my_center|LOCUS_17210 6121 4841 gene locus_tag LOCUS_17220 gene larA 6121 4841 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_17220 6548 6189 gene locus_tag LOCUS_17230 6548 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 7037 7630 gene locus_tag LOCUS_17240 7037 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533295.1 protein_id gnl|my_center|LOCUS_17240 7801 7613 gene locus_tag LOCUS_17250 7801 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 8643 8158 gene locus_tag LOCUS_17260 8643 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence108 <1 1337 gene locus_tag LOCUS_17270 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393382.1:aconitate hydratase 1429 2115 gene locus_tag LOCUS_17280 1429 2115 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_17280 3213 2188 gene locus_tag LOCUS_17290 3213 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 3531 3256 gene locus_tag LOCUS_17300 3531 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 4974 3706 gene locus_tag LOCUS_17310 4974 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 7761 4990 gene locus_tag LOCUS_17320 7761 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 8310 7807 gene locus_tag LOCUS_17330 8310 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence109 573 1424 gene locus_tag LOCUS_17340 573 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1952 3100 gene locus_tag LOCUS_17350 1952 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3448 3263 gene locus_tag LOCUS_17360 3448 3263 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230573.1 protein_id gnl|my_center|LOCUS_17360 4290 3652 gene locus_tag LOCUS_17370 4290 3652 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424384.1 protein_id gnl|my_center|LOCUS_17370 5863 4259 gene locus_tag LOCUS_17380 5863 4259 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_17380 7752 5836 gene locus_tag LOCUS_17390 7752 5836 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271912.1 protein_id gnl|my_center|LOCUS_17390 8813 7887 gene locus_tag LOCUS_17400 8813 7887 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925213.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence110 1254 358 gene locus_tag LOCUS_17410 1254 358 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869438.1 protein_id gnl|my_center|LOCUS_17410 2868 1714 gene locus_tag LOCUS_17420 2868 1714 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869553.1 protein_id gnl|my_center|LOCUS_17420 3968 3525 gene locus_tag LOCUS_17430 gene hutP 3968 3525 CDS product hut operon transcriptional regulator HutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243875.1 protein_id gnl|my_center|LOCUS_17430 4257 4015 gene locus_tag LOCUS_17440 4257 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 5164 4199 gene locus_tag LOCUS_17450 gene sdaAA 5164 4199 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_17450 5917 5243 gene locus_tag LOCUS_17460 gene sdaAB 5917 5243 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393445.1 protein_id gnl|my_center|LOCUS_17460 6581 6192 gene locus_tag LOCUS_17470 6581 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 8260 6803 gene locus_tag LOCUS_17480 gene mttB 8260 6803 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_17480 >Feature sequence111 984 37 gene locus_tag LOCUS_17490 gene mch 984 37 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876411.1 protein_id gnl|my_center|LOCUS_17490 1766 1230 gene locus_tag LOCUS_17500 1766 1230 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393500.1 protein_id gnl|my_center|LOCUS_17500 3256 1832 gene locus_tag LOCUS_17510 3256 1832 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_17510 4168 3425 gene locus_tag LOCUS_17520 4168 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 5197 4295 gene locus_tag LOCUS_17530 5197 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17530 6099 5194 gene locus_tag LOCUS_17540 6099 5194 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_17540 6994 6194 gene locus_tag LOCUS_17550 6994 6194 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065199.1 protein_id gnl|my_center|LOCUS_17550 <8383 7012 gene locus_tag LOCUS_17560 <8383 7012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546166.1:aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein >Feature sequence112 1833 682 gene locus_tag LOCUS_17570 gene nifV 1833 682 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583977.1 protein_id gnl|my_center|LOCUS_17570 3703 2210 gene locus_tag LOCUS_17580 3703 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 4356 5657 gene locus_tag LOCUS_17590 4356 5657 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_17590 5988 6974 gene locus_tag LOCUS_17600 gene thrC 5988 6974 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence113 273 413 gene locus_tag LOCUS_17610 273 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 724 452 gene locus_tag LOCUS_17620 724 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1840 776 gene locus_tag LOCUS_17630 1840 776 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970710.1 protein_id gnl|my_center|LOCUS_17630 3492 2152 gene locus_tag LOCUS_17640 3492 2152 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_17640 3866 3591 gene locus_tag LOCUS_17650 3866 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 4576 3863 gene locus_tag LOCUS_17660 4576 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 5346 4573 gene locus_tag LOCUS_17670 5346 4573 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424384.1 protein_id gnl|my_center|LOCUS_17670 5633 7138 gene locus_tag LOCUS_17680 gene nupO 5633 7138 CDS product guanosine ABC transporter ATP-binding protein NupO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228830.1 protein_id gnl|my_center|LOCUS_17680 7135 8202 gene locus_tag LOCUS_17690 7135 8202 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence114 1635 325 gene locus_tag LOCUS_17700 1635 325 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929488.1 protein_id gnl|my_center|LOCUS_17700 2472 2666 gene locus_tag LOCUS_17710 2472 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 4016 2646 gene locus_tag LOCUS_17720 4016 2646 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978991.1 protein_id gnl|my_center|LOCUS_17720 4542 4225 gene locus_tag LOCUS_17730 4542 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 5499 4735 gene locus_tag LOCUS_17740 5499 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 6547 5471 gene locus_tag LOCUS_17750 6547 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 7227 6544 gene locus_tag LOCUS_17760 7227 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 7672 7394 gene locus_tag LOCUS_17770 7672 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence115 <1 1208 gene locus_tag LOCUS_17780 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112315.1:aspartate aminotransferase family protein 1259 3130 gene locus_tag LOCUS_17790 1259 3130 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_17790 4044 5534 gene locus_tag LOCUS_17800 4044 5534 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270301.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence116 871 2394 gene locus_tag LOCUS_17810 871 2394 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055169.1 protein_id gnl|my_center|LOCUS_17810 2655 2503 gene locus_tag LOCUS_17820 2655 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2922 2746 gene locus_tag LOCUS_17830 2922 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3356 3072 gene locus_tag LOCUS_17840 3356 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 3346 3612 gene locus_tag LOCUS_17850 3346 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 3641 3889 gene locus_tag LOCUS_17860 3641 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3879 4301 gene locus_tag LOCUS_17870 3879 4301 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407268.1 protein_id gnl|my_center|LOCUS_17870 4413 4294 gene locus_tag LOCUS_17880 4413 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4851 4555 gene locus_tag LOCUS_17890 4851 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 6223 5657 gene locus_tag LOCUS_17900 6223 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 6772 7680 gene locus_tag LOCUS_17910 6772 7680 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence117 <1 729 gene locus_tag LOCUS_17920 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003396717.1:[Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein 689 1867 gene locus_tag LOCUS_17930 689 1867 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_17930 1887 2381 gene locus_tag LOCUS_17940 gene nuoE 1887 2381 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_17940 2378 4363 gene locus_tag LOCUS_17950 gene nuoF 2378 4363 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_17950 4365 6506 gene locus_tag LOCUS_17960 4365 6506 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_17960 6598 7203 gene locus_tag LOCUS_17970 6598 7203 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582936.1 protein_id gnl|my_center|LOCUS_17970 7238 7480 gene locus_tag LOCUS_17980 7238 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence118 269 781 gene locus_tag LOCUS_17990 269 781 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_17990 1586 1128 gene locus_tag LOCUS_18000 1586 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1808 1659 gene locus_tag LOCUS_18010 1808 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1923 2759 gene locus_tag LOCUS_18020 1923 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2932 3858 gene locus_tag LOCUS_18030 2932 3858 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922006.1 protein_id gnl|my_center|LOCUS_18030 3855 5306 gene locus_tag LOCUS_18040 3855 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 6380 5409 gene locus_tag LOCUS_18050 6380 5409 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949162.1 protein_id gnl|my_center|LOCUS_18050 7357 6377 gene locus_tag LOCUS_18060 gene pdhA 7357 6377 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence119 1616 642 gene locus_tag LOCUS_18070 gene pdhA 1616 642 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_18070 3133 1790 gene locus_tag LOCUS_18080 gene lpdA 3133 1790 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_18080 3887 3114 gene locus_tag LOCUS_18090 3887 3114 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223980.1 protein_id gnl|my_center|LOCUS_18090 4854 3889 gene locus_tag LOCUS_18100 4854 3889 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886148.1 protein_id gnl|my_center|LOCUS_18100 6107 5049 gene locus_tag LOCUS_18110 gene bdhA 6107 5049 CDS product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645822.1 protein_id gnl|my_center|LOCUS_18110 7334 6162 gene locus_tag LOCUS_18120 7334 6162 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582490.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence120 2291 87 gene locus_tag LOCUS_18130 gene acsB 2291 87 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811727.1 protein_id gnl|my_center|LOCUS_18130 4326 2311 gene locus_tag LOCUS_18140 gene cooS 4326 2311 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459810.1 protein_id gnl|my_center|LOCUS_18140 5081 4362 gene locus_tag LOCUS_18150 5081 4362 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437313.1 protein_id gnl|my_center|LOCUS_18150 6430 5684 gene locus_tag LOCUS_18160 gene lgt 6430 5684 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_18160 7253 6912 gene locus_tag LOCUS_18170 gene trxA 7253 6912 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence121 453 692 gene locus_tag LOCUS_18180 453 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 685 927 gene locus_tag LOCUS_18190 685 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1093 1443 gene locus_tag LOCUS_18200 1093 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 6931 1808 gene locus_tag LOCUS_18210 6931 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077139241.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence122 2043 511 gene locus_tag LOCUS_18220 2043 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 2812 2057 gene locus_tag LOCUS_18230 2812 2057 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_18230 3706 2825 gene locus_tag LOCUS_18240 gene shyC 3706 2825 CDS product NAD(P)-dependent hydrogenase/sulfhydrogenase 2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868070.1 protein_id gnl|my_center|LOCUS_18240 4757 3696 gene locus_tag LOCUS_18250 gene hydB 4757 3696 CDS product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251022.1 protein_id gnl|my_center|LOCUS_18250 5271 5924 gene locus_tag LOCUS_18260 5271 5924 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983265.1 protein_id gnl|my_center|LOCUS_18260 6944 6081 gene locus_tag LOCUS_18270 6944 6081 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703481.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence123 1003 824 gene locus_tag LOCUS_18280 1003 824 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583928.1 protein_id gnl|my_center|LOCUS_18280 1780 1214 gene locus_tag LOCUS_18290 1780 1214 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_18290 1918 2280 gene locus_tag LOCUS_18300 gene aroH 1918 2280 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172959.1 protein_id gnl|my_center|LOCUS_18300 2469 3551 gene locus_tag LOCUS_18310 gene aroF 2469 3551 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_18310 3535 6045 gene locus_tag LOCUS_18320 3535 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 6036 7088 gene locus_tag LOCUS_18330 6036 7088 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence124 684 845 gene locus_tag LOCUS_18340 684 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 842 1696 gene locus_tag LOCUS_18350 842 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1733 1879 gene locus_tag LOCUS_18360 1733 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 3038 2088 gene locus_tag LOCUS_18370 gene cysK 3038 2088 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022680.1 protein_id gnl|my_center|LOCUS_18370 4377 3064 gene locus_tag LOCUS_18380 4377 3064 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_18380 5178 4738 gene locus_tag LOCUS_18390 5178 4738 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_18390 5871 5395 gene locus_tag LOCUS_18400 5871 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 6740 6348 gene locus_tag LOCUS_18410 6740 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence125 603 328 gene locus_tag LOCUS_18420 603 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 1188 1400 gene locus_tag LOCUS_18430 1188 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 3031 1517 gene locus_tag LOCUS_18440 3031 1517 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393615.1 protein_id gnl|my_center|LOCUS_18440 5947 5696 gene locus_tag LOCUS_18450 5947 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence126 54 1733 gene locus_tag LOCUS_18460 54 1733 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_18460 1735 2151 gene locus_tag LOCUS_18470 gene mce 1735 2151 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_18470 2310 3860 gene locus_tag LOCUS_18480 2310 3860 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_18480 4013 4486 gene locus_tag LOCUS_18490 4013 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 5042 4746 gene locus_tag LOCUS_18500 5042 4746 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_18500 5235 5666 gene locus_tag LOCUS_18510 gene mraZ 5235 5666 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_18510 5732 6658 gene locus_tag LOCUS_18520 gene rsmH 5732 6658 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence127 1337 84 gene locus_tag LOCUS_18530 gene gudB 1337 84 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225172.1 protein_id gnl|my_center|LOCUS_18530 2085 1540 gene locus_tag LOCUS_18540 2085 1540 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_18540 2909 2082 gene locus_tag LOCUS_18550 gene korB 2909 2082 CDS product 2-oxoglutarate synthase subunit KorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876665.1 protein_id gnl|my_center|LOCUS_18550 4047 2902 gene locus_tag LOCUS_18560 4047 2902 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 protein_id gnl|my_center|LOCUS_18560 4327 4031 gene locus_tag LOCUS_18570 4327 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 5289 4390 gene locus_tag LOCUS_18580 5289 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 6723 5803 gene locus_tag LOCUS_18590 6723 5803 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881142.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence128 511 218 gene locus_tag LOCUS_18600 511 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 968 513 gene locus_tag LOCUS_18610 968 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1917 973 gene locus_tag LOCUS_18620 gene fliM 1917 973 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666990.1 protein_id gnl|my_center|LOCUS_18620 2737 1886 gene locus_tag LOCUS_18630 2737 1886 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_18630 3647 2709 gene locus_tag LOCUS_18640 3647 2709 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_18640 4076 3870 gene locus_tag LOCUS_18650 4076 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 5659 4082 gene locus_tag LOCUS_18660 gene flgE 5659 4082 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_18660 6268 5804 gene locus_tag LOCUS_18670 6268 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 6747 6265 gene locus_tag LOCUS_18680 6747 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence129 1939 233 gene locus_tag LOCUS_18690 1939 233 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_18690 2816 1941 gene locus_tag LOCUS_18700 2816 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4809 2947 gene locus_tag LOCUS_18710 4809 2947 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542452.1 protein_id gnl|my_center|LOCUS_18710 5829 4951 gene locus_tag LOCUS_18720 5829 4951 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816555.1 protein_id gnl|my_center|LOCUS_18720 6590 5826 gene locus_tag LOCUS_18730 6590 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence130 310 396 gene locus_tag LOCUS_t00420 310 396 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 674 1657 gene locus_tag LOCUS_18740 gene trpS 674 1657 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460225.1 protein_id gnl|my_center|LOCUS_18740 1765 3267 gene locus_tag LOCUS_18750 gene tig 1765 3267 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460919.1 protein_id gnl|my_center|LOCUS_18750 3434 4057 gene locus_tag LOCUS_18760 gene clpP 3434 4057 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_18760 4073 5335 gene locus_tag LOCUS_18770 gene clpX 4073 5335 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_18770 5648 5400 gene locus_tag LOCUS_18780 5648 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence131 520 1821 gene locus_tag LOCUS_18790 gene glnA 520 1821 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_18790 1839 2675 gene locus_tag LOCUS_18800 gene nadE 1839 2675 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808614.1 protein_id gnl|my_center|LOCUS_18800 3126 2887 gene locus_tag LOCUS_18810 3126 2887 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774132.1 protein_id gnl|my_center|LOCUS_18810 4446 3529 gene locus_tag LOCUS_18820 4446 3529 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_18820 4739 6202 gene locus_tag LOCUS_18830 gene mttB 4739 6202 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_18830 >Feature sequence132 898 158 gene locus_tag LOCUS_18840 898 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1263 1054 gene locus_tag LOCUS_18850 1263 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1531 1776 gene locus_tag LOCUS_18860 1531 1776 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393299.1 protein_id gnl|my_center|LOCUS_18860 2114 1800 gene locus_tag LOCUS_18870 2114 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 2433 2194 gene locus_tag LOCUS_18880 2433 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2975 2610 gene locus_tag LOCUS_18890 2975 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 3327 2866 gene locus_tag LOCUS_18900 3327 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 4513 3422 gene locus_tag LOCUS_18910 4513 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 5362 4748 gene locus_tag LOCUS_18920 5362 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 5728 5970 gene locus_tag LOCUS_18930 5728 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence133 2452 2147 gene locus_tag LOCUS_18940 2452 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 5735 4680 gene locus_tag LOCUS_18950 5735 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence134 1429 296 gene locus_tag LOCUS_18960 1429 296 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_18960 2720 1488 gene locus_tag LOCUS_18970 2720 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 3627 2725 gene locus_tag LOCUS_18980 3627 2725 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258568.1 protein_id gnl|my_center|LOCUS_18980 4765 3644 gene locus_tag LOCUS_18990 4765 3644 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104262.1 protein_id gnl|my_center|LOCUS_18990 6017 4833 gene locus_tag LOCUS_19000 6017 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence135 741 16 gene locus_tag LOCUS_19010 741 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 927 1130 gene locus_tag LOCUS_19020 927 1130 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228387.1 protein_id gnl|my_center|LOCUS_19020 1133 2800 gene locus_tag LOCUS_19030 1133 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2863 3282 gene locus_tag LOCUS_19040 2863 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3879 3454 gene locus_tag LOCUS_19050 3879 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 4087 3869 gene locus_tag LOCUS_19060 4087 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 5321 5521 gene locus_tag LOCUS_19070 5321 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence136 1749 541 gene locus_tag LOCUS_19080 1749 541 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_19080 2849 1767 gene locus_tag LOCUS_19090 2849 1767 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_19090 3439 2846 gene locus_tag LOCUS_19100 3439 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 5412 3430 gene locus_tag LOCUS_19110 5412 3430 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927008.1 protein_id gnl|my_center|LOCUS_19110 <6263 5414 gene locus_tag LOCUS_19120 <6263 5414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392331.1:CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein >Feature sequence137 1500 337 gene locus_tag LOCUS_19130 gene yiaY 1500 337 CDS product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705363.1 protein_id gnl|my_center|LOCUS_19130 3215 1803 gene locus_tag LOCUS_19140 gene lpdA 3215 1803 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809814.1 protein_id gnl|my_center|LOCUS_19140 4126 3284 gene locus_tag LOCUS_19150 4126 3284 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436933.1 protein_id gnl|my_center|LOCUS_19150 5175 4123 gene locus_tag LOCUS_19160 5175 4123 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860937.1 protein_id gnl|my_center|LOCUS_19160 <6192 5168 gene locus_tag LOCUS_19170 <6192 5168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436928.1:radical SAM protein >Feature sequence138 1777 320 gene locus_tag LOCUS_19180 1777 320 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966122.1 protein_id gnl|my_center|LOCUS_19180 3106 1982 gene locus_tag LOCUS_19190 3106 1982 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_19190 3867 3103 gene locus_tag LOCUS_19200 gene nagR 3867 3103 CDS product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 protein_id gnl|my_center|LOCUS_19200 4750 3965 gene locus_tag LOCUS_19210 4750 3965 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877622.1 protein_id gnl|my_center|LOCUS_19210 5508 5284 gene locus_tag LOCUS_19220 5508 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence139 2514 709 gene locus_tag LOCUS_19230 2514 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2965 2651 gene locus_tag LOCUS_19240 2965 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 3367 3155 gene locus_tag LOCUS_19250 3367 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4816 3710 gene locus_tag LOCUS_19260 4816 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence140 3 581 gene locus_tag LOCUS_19270 3 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 514 1374 gene locus_tag LOCUS_19280 514 1374 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_19280 1381 2115 gene locus_tag LOCUS_19290 1381 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2203 2622 gene locus_tag LOCUS_19300 2203 2622 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_19300 3336 2662 gene locus_tag LOCUS_19310 3336 2662 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_19310 3410 4588 gene locus_tag LOCUS_19320 gene dusB 3410 4588 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_19320 4965 5777 gene locus_tag LOCUS_19330 4965 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence141 <1 532 gene locus_tag LOCUS_19340 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948773.1:lysine exporter LysO family protein 571 2568 gene locus_tag LOCUS_19350 571 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 3940 2744 gene locus_tag LOCUS_19360 3940 2744 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 protein_id gnl|my_center|LOCUS_19360 4294 4509 gene locus_tag LOCUS_19370 4294 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 4678 4484 gene locus_tag LOCUS_19380 4678 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 4608 5069 gene locus_tag LOCUS_19390 4608 5069 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence142 <1 1059 gene locus_tag LOCUS_19400 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392083.1:chaperonin GroEL 1373 1795 gene locus_tag LOCUS_19410 1373 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1839 2882 gene locus_tag LOCUS_19420 1839 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2910 4025 gene locus_tag LOCUS_19430 gene holA 2910 4025 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_19430 5717 3969 gene locus_tag LOCUS_19440 5717 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence143 <1 1508 gene locus_tag LOCUS_19450 <1 1508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393212.1:PBP1A family penicillin-binding protein 4198 1517 gene locus_tag LOCUS_19460 4198 1517 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542519.1 protein_id gnl|my_center|LOCUS_19460 4815 4159 gene locus_tag LOCUS_19470 4815 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 5412 4822 gene locus_tag LOCUS_19480 5412 4822 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460066.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence144 <1 860 gene locus_tag LOCUS_19490 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_107018483.1:restriction endonuclease 864 1034 gene locus_tag LOCUS_19500 864 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 1389 3011 gene locus_tag LOCUS_19510 1389 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2942 4879 gene locus_tag LOCUS_19520 2942 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 4876 5592 gene locus_tag LOCUS_19530 4876 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence145 236 1198 gene locus_tag LOCUS_19540 236 1198 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948817.1 protein_id gnl|my_center|LOCUS_19540 1214 1990 gene locus_tag LOCUS_19550 1214 1990 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_19550 2523 2143 gene locus_tag LOCUS_19560 2523 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2641 2516 gene locus_tag LOCUS_19570 2641 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2697 2873 gene locus_tag LOCUS_19580 2697 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 3047 3724 gene locus_tag LOCUS_19590 3047 3724 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424384.1 protein_id gnl|my_center|LOCUS_19590 3795 4919 gene locus_tag LOCUS_19600 3795 4919 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence146 1841 576 gene locus_tag LOCUS_19610 gene murA 1841 576 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_19610 2847 1843 gene locus_tag LOCUS_19620 gene murB 2847 1843 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_19620 4360 2813 gene locus_tag LOCUS_19630 gene murC 4360 2813 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_19630 <5557 4447 gene locus_tag LOCUS_19640 <5557 4447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392362.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase >Feature sequence147 482 997 gene locus_tag LOCUS_19650 482 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2400 1198 gene locus_tag LOCUS_19660 2400 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 3067 2576 gene locus_tag LOCUS_19670 3067 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 4060 3575 gene locus_tag LOCUS_19680 4060 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 4785 4567 gene locus_tag LOCUS_19690 4785 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 <5397 4782 gene locus_tag LOCUS_19700 <5397 4782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393059.1:A24 family peptidase >Feature sequence148 278 2521 gene locus_tag LOCUS_19710 278 2521 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_19710 2579 5221 gene locus_tag LOCUS_19720 2579 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence149 1317 445 gene locus_tag LOCUS_19730 1317 445 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258159.1 protein_id gnl|my_center|LOCUS_19730 2149 1310 gene locus_tag LOCUS_19740 gene csx7 2149 1310 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258158.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19740 2597 2139 gene locus_tag LOCUS_19750 2597 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3804 2563 gene locus_tag LOCUS_19760 3804 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 4496 3783 gene locus_tag LOCUS_19770 4496 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence150 789 2204 gene locus_tag LOCUS_19780 789 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2230 3015 gene locus_tag LOCUS_19790 2230 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4154 3174 gene locus_tag LOCUS_19800 4154 3174 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545553.1 protein_id gnl|my_center|LOCUS_19800 4684 4460 gene locus_tag LOCUS_19810 4684 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 4700 4942 gene locus_tag LOCUS_19820 4700 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence151 1479 1198 gene locus_tag LOCUS_19830 1479 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 3830 1962 gene locus_tag LOCUS_19840 3830 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 4812 4375 gene locus_tag LOCUS_19850 4812 4375 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393982.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence152 1438 1256 gene locus_tag LOCUS_19860 1438 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3031 1730 gene locus_tag LOCUS_19870 3031 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3869 3540 gene locus_tag LOCUS_19880 3869 3540 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392117.1 protein_id gnl|my_center|LOCUS_19880 4072 4353 gene locus_tag LOCUS_19890 gene groES 4072 4353 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392082.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence153 1996 908 gene locus_tag LOCUS_19900 1996 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2348 3211 gene locus_tag LOCUS_19910 2348 3211 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392390.1 protein_id gnl|my_center|LOCUS_19910 <4996 3221 gene locus_tag LOCUS_19920 <4996 3221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460092.1:ASKHA domain-containing protein >Feature sequence154 2261 717 gene locus_tag LOCUS_19930 2261 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2716 3381 gene locus_tag LOCUS_19940 2716 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533295.1 protein_id gnl|my_center|LOCUS_19940 3718 3461 gene locus_tag LOCUS_19950 3718 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 4776 4117 gene locus_tag LOCUS_19960 4776 4117 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435816.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence155 1654 206 gene locus_tag LOCUS_19970 1654 206 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879422.1 protein_id gnl|my_center|LOCUS_19970 2028 1660 gene locus_tag LOCUS_19980 2028 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2801 2025 gene locus_tag LOCUS_19990 2801 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence156 567 16 gene locus_tag LOCUS_20000 567 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 1389 649 gene locus_tag LOCUS_20010 1389 649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_20010 2370 1522 gene locus_tag LOCUS_20020 2370 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 3063 2494 gene locus_tag LOCUS_20030 gene scpB 3063 2494 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_20030 3922 3053 gene locus_tag LOCUS_20040 3922 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 4559 3930 gene locus_tag LOCUS_20050 4559 3930 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence157 <1 724 gene locus_tag LOCUS_20060 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18TV3:trimethylamine methyltransferase MttB 791 1231 gene locus_tag LOCUS_20070 791 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 1885 1601 gene locus_tag LOCUS_20080 1885 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2952 2236 gene locus_tag LOCUS_20090 2952 2236 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_20090 4657 3065 gene locus_tag LOCUS_20100 4657 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence158 1 333 gene locus_tag LOCUS_20110 1 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 358 489 gene locus_tag LOCUS_20120 358 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 689 2242 gene locus_tag LOCUS_20130 689 2242 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_20130 2239 3561 gene locus_tag LOCUS_20140 2239 3561 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392972.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence159 505 1053 gene locus_tag LOCUS_20150 505 1053 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_20150 1078 1674 gene locus_tag LOCUS_20160 1078 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 1703 3031 gene locus_tag LOCUS_20170 1703 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 3018 3359 gene locus_tag LOCUS_20180 3018 3359 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence160 704 1825 gene locus_tag LOCUS_20190 704 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2081 3025 gene locus_tag LOCUS_20200 gene cofD 2081 3025 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_20200 3940 3152 gene locus_tag LOCUS_20210 gene cofE 3940 3152 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence161 629 276 gene locus_tag LOCUS_20220 629 276 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062280560.1 protein_id gnl|my_center|LOCUS_20220 933 616 gene locus_tag LOCUS_20230 933 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393803.1 protein_id gnl|my_center|LOCUS_20230 2198 1077 gene locus_tag LOCUS_20240 2198 1077 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393247.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence162 1468 431 gene locus_tag LOCUS_20250 1468 431 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869312.1 protein_id gnl|my_center|LOCUS_20250 2410 1634 gene locus_tag LOCUS_20260 2410 1634 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083078.1 protein_id gnl|my_center|LOCUS_20260 2602 3045 gene locus_tag LOCUS_20270 2602 3045 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393697.1 protein_id gnl|my_center|LOCUS_20270 3116 3304 gene locus_tag LOCUS_20280 3116 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 <4392 3600 gene locus_tag LOCUS_20290 <4392 3600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002362058.1:amino acid permease >Feature sequence163 212 2050 gene locus_tag LOCUS_20300 212 2050 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922133.1 protein_id gnl|my_center|LOCUS_20300 2047 2328 gene locus_tag LOCUS_20310 2047 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2425 2787 gene locus_tag LOCUS_20320 2425 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 3356 4030 gene locus_tag LOCUS_20330 3356 4030 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393416.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence164 2119 800 gene locus_tag LOCUS_20340 2119 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2605 2123 gene locus_tag LOCUS_20350 2605 2123 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255064.1 protein_id gnl|my_center|LOCUS_20350 2761 2606 gene locus_tag LOCUS_20360 2761 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 3846 2806 gene locus_tag LOCUS_20370 gene tsaD 3846 2806 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414585.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence165 1614 442 gene locus_tag LOCUS_20380 gene nifS 1614 442 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_20380 2106 1654 gene locus_tag LOCUS_20390 2106 1654 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_20390 3896 2517 gene locus_tag LOCUS_20400 3896 2517 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence166 2250 1204 gene locus_tag LOCUS_20410 2250 1204 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460323.1 protein_id gnl|my_center|LOCUS_20410 2527 2291 gene locus_tag LOCUS_20420 2527 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2812 2582 gene locus_tag LOCUS_20430 2812 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 4011 2884 gene locus_tag LOCUS_20440 gene mnmA 4011 2884 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence167 1203 382 gene locus_tag LOCUS_20450 1203 382 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_20450 2220 1435 gene locus_tag LOCUS_20460 2220 1435 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272779.1 protein_id gnl|my_center|LOCUS_20460 3362 2217 gene locus_tag LOCUS_20470 gene prfB 3362 2217 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence168 496 287 gene locus_tag LOCUS_20480 496 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 534 2189 gene locus_tag LOCUS_20490 534 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2407 2802 gene locus_tag LOCUS_20500 2407 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2822 3124 gene locus_tag LOCUS_20510 2822 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 3221 3790 gene locus_tag LOCUS_20520 3221 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence169 1255 383 gene locus_tag LOCUS_20530 1255 383 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_20530 1808 2308 gene locus_tag LOCUS_20540 gene nrdR 1808 2308 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence170 <1 542 gene locus_tag LOCUS_20550 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583299.1:branched-chain amino acid ABC transporter permease 601 1386 gene locus_tag LOCUS_20560 601 1386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583300.1 protein_id gnl|my_center|LOCUS_20560 1373 2104 gene locus_tag LOCUS_20570 1373 2104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_20570 2256 3131 gene locus_tag LOCUS_20580 2256 3131 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074017151.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence171 1585 158 gene locus_tag LOCUS_20590 gene hydG 1585 158 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393235.1 protein_id gnl|my_center|LOCUS_20590 2152 3330 gene locus_tag LOCUS_20600 2152 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20600 3231 3758 gene locus_tag LOCUS_20610 3231 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20610 3911 3837 gene locus_tag LOCUS_t00430 3911 3837 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence172 529 47 gene locus_tag LOCUS_20620 gene greA 529 47 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_20620 932 555 gene locus_tag LOCUS_20630 932 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 1729 953 gene locus_tag LOCUS_20640 1729 953 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_20640 2283 1870 gene locus_tag LOCUS_20650 2283 1870 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140937.1 protein_id gnl|my_center|LOCUS_20650 3449 2280 gene locus_tag LOCUS_20660 3449 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence173 396 115 gene locus_tag LOCUS_20670 396 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 1436 603 gene locus_tag LOCUS_20680 1436 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1836 2204 gene locus_tag LOCUS_20690 gene folB 1836 2204 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230465.1 protein_id gnl|my_center|LOCUS_20690 2831 2229 gene locus_tag LOCUS_20700 2831 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 3123 3272 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attcgtcacattccaaagt >Feature sequence174 1628 171 gene locus_tag LOCUS_20710 1628 171 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484770.1 protein_id gnl|my_center|LOCUS_20710 3475 1625 gene locus_tag LOCUS_20720 3475 1625 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095325.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence175 <1 1606 gene locus_tag LOCUS_20730 <1 1606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948084.1:adenine deaminase 1783 2838 gene locus_tag LOCUS_20740 1783 2838 CDS product xanthine/uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986539.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence176 15 887 gene locus_tag LOCUS_20750 15 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 951 1271 gene locus_tag LOCUS_20760 951 1271 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869719.1 protein_id gnl|my_center|LOCUS_20760 1268 2386 gene locus_tag LOCUS_20770 1268 2386 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146532.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20770 2379 3227 gene locus_tag LOCUS_20780 2379 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence177 2094 310 gene locus_tag LOCUS_20790 2094 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 3034 2270 gene locus_tag LOCUS_20800 3034 2270 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570194.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence178 1378 2766 gene locus_tag LOCUS_20810 gene glmU 1378 2766 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898727.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence179 629 414 gene locus_tag LOCUS_20820 629 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2013 808 gene locus_tag LOCUS_20830 gene wecB 2013 808 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_20830 3180 2059 gene locus_tag LOCUS_20840 3180 2059 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence180 <1 1217 gene locus_tag LOCUS_20850 <1 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257621.1:vitamin B12-dependent ribonucleotide reductase 1455 1183 gene locus_tag LOCUS_20860 1455 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2249 1518 gene locus_tag LOCUS_20870 2249 1518 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584037.1 protein_id gnl|my_center|LOCUS_20870 <3438 2267 gene locus_tag LOCUS_20880 <3438 2267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392817.1:aspartate kinase >Feature sequence181 478 275 gene locus_tag LOCUS_20890 478 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 <3425 500 gene locus_tag LOCUS_20900 <3425 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393372.1:DNA polymerase III subunit alpha >Feature sequence182 366 1262 gene locus_tag LOCUS_20910 366 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 <3392 1446 gene locus_tag LOCUS_20920 <3392 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_113974941.1:aminotransferase class III-fold pyridoxal phosphate-dependent enzyme >Feature sequence183 650 886 gene locus_tag LOCUS_20930 650 886 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391740.1 protein_id gnl|my_center|LOCUS_20930 858 1289 gene locus_tag LOCUS_20940 858 1289 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094558.1 protein_id gnl|my_center|LOCUS_20940 1603 1803 gene locus_tag LOCUS_20950 1603 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1897 2181 gene locus_tag LOCUS_20960 1897 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2567 3049 gene locus_tag LOCUS_20970 2567 3049 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966687.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence184 203 328 gene locus_tag LOCUS_20980 203 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 1168 572 gene locus_tag LOCUS_20990 1168 572 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048167.1 protein_id gnl|my_center|LOCUS_20990 1535 1762 gene locus_tag LOCUS_21000 1535 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 1926 2002 gene locus_tag LOCUS_t00440 1926 2002 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2376 2633 gene locus_tag LOCUS_21010 2376 2633 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106005636.1 protein_id gnl|my_center|LOCUS_21010 2614 3051 gene locus_tag LOCUS_21020 2614 3051 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393562.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence185 1856 654 gene locus_tag LOCUS_21030 1856 654 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_21030 2613 2759 gene locus_tag LOCUS_21040 2613 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2977 3213 gene locus_tag LOCUS_21050 2977 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence186 1628 1065 gene locus_tag LOCUS_21060 1628 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2956 1625 gene locus_tag LOCUS_21070 2956 1625 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940104.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence187 1001 285 gene locus_tag LOCUS_21080 1001 285 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_21080 2312 1059 gene locus_tag LOCUS_21090 2312 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence188 1131 2048 gene locus_tag LOCUS_21100 1131 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2005 2607 gene locus_tag LOCUS_21110 2005 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 2748 2867 gene locus_tag LOCUS_21120 2748 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence189 1973 606 gene locus_tag LOCUS_21130 1973 606 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_21130 <3057 2204 gene locus_tag LOCUS_21140 <3057 2204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030796.1:FAD-dependent oxidoreductase >Feature sequence190 106 1458 gene locus_tag LOCUS_21150 gene acsC 106 1458 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence191 <1 983 gene locus_tag LOCUS_21160 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391743.1:cysteine desulfurase family protein 1149 2540 gene locus_tag LOCUS_21170 gene thiI 1149 2540 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence192 1070 207 gene locus_tag LOCUS_21180 1070 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2787 1138 gene locus_tag LOCUS_21190 2787 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence193 210 1715 gene locus_tag LOCUS_21200 gene lysS 210 1715 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence194 1752 775 gene locus_tag LOCUS_21210 1752 775 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_21210 2286 2044 gene locus_tag LOCUS_21220 2286 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence195 607 1422 gene locus_tag LOCUS_21230 gene mraY 607 1422 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392359.1 protein_id gnl|my_center|LOCUS_21230 1431 2609 gene locus_tag LOCUS_21240 gene spoVE 1431 2609 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence196 <1 843 gene locus_tag LOCUS_21250 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_174848112.1:dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase 1242 2399 gene locus_tag LOCUS_21260 gene pseC 1242 2399 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence197 829 1083 gene locus_tag LOCUS_21270 829 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence198 459 1703 gene locus_tag LOCUS_21280 459 1703 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891591.1 protein_id gnl|my_center|LOCUS_21280 2047 2172 gene locus_tag LOCUS_21290 2047 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence199 <1 582 gene locus_tag LOCUS_21300 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476549.1:RNA-guided endonuclease TnpB family protein 858 1028 gene locus_tag LOCUS_21310 858 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1012 1788 gene locus_tag LOCUS_21320 gene soj 1012 1788 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_21320 1757 2659 gene locus_tag LOCUS_21330 1757 2659 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence200 <1 1557 gene locus_tag LOCUS_21340 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460880.1:murein biosynthesis integral membrane protein MurJ 2372 1968 gene locus_tag LOCUS_21350 2372 1968 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392211.1 protein_id gnl|my_center|LOCUS_21350 2629 2372 gene locus_tag LOCUS_21360 2629 2372 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936586.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence201 2 475 gene locus_tag LOCUS_21370 2 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 472 924 gene locus_tag LOCUS_21380 gene fliJ 472 924 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392296.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence202 <2507 1476 gene locus_tag LOCUS_21390 <2507 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393251.1:phenylalanine--tRNA ligase subunit beta >Feature sequence203 588 779 gene locus_tag LOCUS_21400 588 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2183 828 gene locus_tag LOCUS_21410 gene thiC 2183 828 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence204 <1 1710 gene locus_tag LOCUS_21420 <1 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392836.1:DUF512 domain-containing protein >Feature sequence205 <2425 143 gene locus_tag LOCUS_21430 <2425 143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920401.1:M28 family metallopeptidase >Feature sequence206 1544 294 gene locus_tag LOCUS_21440 1544 294 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_21440 <2425 1572 gene locus_tag LOCUS_21450 <2425 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003522141.1:sarcosine oxidase subunit beta family protein >Feature sequence207 <1 665 gene locus_tag LOCUS_21460 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392714.1:ASKHA domain-containing protein 681 1427 gene locus_tag LOCUS_21470 681 1427 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392713.1 protein_id gnl|my_center|LOCUS_21470 1483 1812 gene locus_tag LOCUS_21480 1483 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21480 >Feature sequence208 1503 1261 gene locus_tag LOCUS_21490 gene acpP 1503 1261 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_21490 <2238 1678 gene locus_tag LOCUS_21500 <2238 1678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460500.1:3-oxoacyl-[acyl-carrier-protein] reductase >Feature sequence209 516 1406 gene locus_tag LOCUS_21510 516 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence210 <1 1006 gene locus_tag LOCUS_21520 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939034.1:DNA cytosine methyltransferase 1148 1330 gene locus_tag LOCUS_21530 1148 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 1387 1704 gene locus_tag LOCUS_21540 1387 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence211 141 287 gene locus_tag LOCUS_21550 141 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 571 708 gene locus_tag LOCUS_21560 571 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 698 1135 gene locus_tag LOCUS_21570 698 1135 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250660.1 protein_id gnl|my_center|LOCUS_21570 1366 1440 gene locus_tag LOCUS_t00450 1366 1440 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence212 >Feature sequence213 295 576 gene locus_tag LOCUS_21580 295 576 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392102.1 protein_id gnl|my_center|LOCUS_21580 1657 767 gene locus_tag LOCUS_21590 1657 767 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence214 901 695 gene locus_tag LOCUS_21600 901 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 1797 1192 gene locus_tag LOCUS_21610 gene sfsA 1797 1192 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391969.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence215 <1 531 gene locus_tag LOCUS_21620 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940804.1:primosomal protein N' 591 1175 gene locus_tag LOCUS_21630 591 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence216 64 486 gene locus_tag LOCUS_21640 64 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 640 1398 gene locus_tag LOCUS_21650 640 1398 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393968.1 protein_id gnl|my_center|LOCUS_21650 >Feature sequence217 746 1606 gene locus_tag LOCUS_21660 746 1606 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393282.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence218 1053 40 gene locus_tag LOCUS_21670 1053 40 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence219 <1 960 gene locus_tag LOCUS_21680 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816487.1:translation elongation factor 4 >Feature sequence220