>Feature sequence001 3243 757 gene locus_tag LOCUS_00010 3243 757 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_00010 3973 3302 gene locus_tag LOCUS_00020 gene lolD 3973 3302 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812422.1 protein_id gnl|my_center|LOCUS_00020 5178 3970 gene locus_tag LOCUS_00030 5178 3970 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_00030 6386 5175 gene locus_tag LOCUS_00040 6386 5175 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_00040 7894 6389 gene locus_tag LOCUS_00050 gene lysS 7894 6389 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933055.1 protein_id gnl|my_center|LOCUS_00050 9107 8028 gene locus_tag LOCUS_00060 gene prfB 9107 8028 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_00060 9481 12189 gene locus_tag LOCUS_00070 9481 12189 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 protein_id gnl|my_center|LOCUS_00070 13108 12335 gene locus_tag LOCUS_00080 gene cdaA 13108 12335 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_00080 13938 13105 gene locus_tag LOCUS_00090 gene folP 13938 13105 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_00090 16035 14008 gene locus_tag LOCUS_00100 gene ftsH 16035 14008 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_00100 16578 16054 gene locus_tag LOCUS_00110 gene hpt 16578 16054 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_00110 17969 16566 gene locus_tag LOCUS_00120 gene tilS 17969 16566 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_00120 18312 18737 gene locus_tag LOCUS_00130 18312 18737 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979129.1 protein_id gnl|my_center|LOCUS_00130 18787 19692 gene locus_tag LOCUS_00140 18787 19692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 20872 19805 gene locus_tag LOCUS_00150 20872 19805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775723.1 protein_id gnl|my_center|LOCUS_00150 21685 20996 gene locus_tag LOCUS_00160 21685 20996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22347 21685 gene locus_tag LOCUS_00170 22347 21685 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228657.1 protein_id gnl|my_center|LOCUS_00170 23001 22351 gene locus_tag LOCUS_00180 23001 22351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359491.1 protein_id gnl|my_center|LOCUS_00180 23316 23035 gene locus_tag LOCUS_00190 23316 23035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 25273 23318 gene locus_tag LOCUS_00200 25273 23318 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_00200 25744 25352 gene locus_tag LOCUS_00210 25744 25352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 27462 25771 gene locus_tag LOCUS_00220 27462 25771 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249802.1 protein_id gnl|my_center|LOCUS_00220 29283 27496 gene locus_tag LOCUS_00230 gene dxs 29283 27496 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880536.1 protein_id gnl|my_center|LOCUS_00230 29376 29385 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30007 29426 gene locus_tag LOCUS_00240 gene pdxT 30007 29426 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026851.1 protein_id gnl|my_center|LOCUS_00240 30888 30007 gene locus_tag LOCUS_00250 gene pdxS 30888 30007 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391558.1 protein_id gnl|my_center|LOCUS_00250 31744 30893 gene locus_tag LOCUS_00260 gene ispH 31744 30893 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_00260 32763 31741 gene locus_tag LOCUS_00270 32763 31741 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932853.1 protein_id gnl|my_center|LOCUS_00270 33791 32868 gene locus_tag LOCUS_00280 33791 32868 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190138.1 protein_id gnl|my_center|LOCUS_00280 35585 33804 gene locus_tag LOCUS_00290 35585 33804 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_00290 36873 35779 gene locus_tag LOCUS_00300 gene dprA 36873 35779 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_00300 37840 36866 gene locus_tag LOCUS_00310 gene obgE 37840 36866 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933866.1 protein_id gnl|my_center|LOCUS_00310 39184 37991 gene locus_tag LOCUS_00320 39184 37991 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_00320 39447 39223 gene locus_tag LOCUS_00330 39447 39223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 40082 39603 gene locus_tag LOCUS_00340 gene coaD 40082 39603 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545514.1 protein_id gnl|my_center|LOCUS_00340 40600 40085 gene locus_tag LOCUS_00350 40600 40085 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404806.1 protein_id gnl|my_center|LOCUS_00350 40904 40602 gene locus_tag LOCUS_00360 40904 40602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 41616 40897 gene locus_tag LOCUS_00370 41616 40897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 42660 41770 gene locus_tag LOCUS_00380 42660 41770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 43033 42674 gene locus_tag LOCUS_00390 43033 42674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 44169 43051 gene locus_tag LOCUS_00400 gene dnaJ 44169 43051 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_00400 44723 44166 gene locus_tag LOCUS_00410 44723 44166 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800555.1 protein_id gnl|my_center|LOCUS_00410 45751 44720 gene locus_tag LOCUS_00420 gene hrcA 45751 44720 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405071.1 protein_id gnl|my_center|LOCUS_00420 46695 45829 gene locus_tag LOCUS_00430 46695 45829 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839411.1 protein_id gnl|my_center|LOCUS_00430 47347 46688 gene locus_tag LOCUS_00440 gene ftsE 47347 46688 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768285.1 protein_id gnl|my_center|LOCUS_00440 48302 47361 gene locus_tag LOCUS_00450 48302 47361 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_00450 48886 48299 gene locus_tag LOCUS_00460 gene nadD 48886 48299 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_00460 49533 48883 gene locus_tag LOCUS_00470 49533 48883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 49909 50008 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53224 50240 gene locus_tag LOCUS_00480 53224 50240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 <55428 53227 gene locus_tag LOCUS_00490 <55428 53227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201328483.1:M6 family metalloprotease domain-containing protein >Feature sequence002 2 322 gene locus_tag LOCUS_00500 gene rpsH 2 322 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906299.1 protein_id gnl|my_center|LOCUS_00500 331 876 gene locus_tag LOCUS_00510 gene rplF 331 876 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_00510 882 1250 gene locus_tag LOCUS_00520 gene rplR 882 1250 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_00520 1247 1750 gene locus_tag LOCUS_00530 gene rpsE 1247 1750 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933825.1 protein_id gnl|my_center|LOCUS_00530 1754 1948 gene locus_tag LOCUS_00540 gene rpmD 1754 1948 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140433.1 protein_id gnl|my_center|LOCUS_00540 1945 2385 gene locus_tag LOCUS_00550 gene rplO 1945 2385 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081797.1 protein_id gnl|my_center|LOCUS_00550 2385 3725 gene locus_tag LOCUS_00560 gene secY 2385 3725 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933822.1 protein_id gnl|my_center|LOCUS_00560 3727 4485 gene locus_tag LOCUS_00570 gene map 3727 4485 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_00570 4609 4995 gene locus_tag LOCUS_00580 gene rpsM 4609 4995 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090788.1 protein_id gnl|my_center|LOCUS_00580 5009 5401 gene locus_tag LOCUS_00590 gene rpsK 5009 5401 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486671.1 protein_id gnl|my_center|LOCUS_00590 5415 6032 gene locus_tag LOCUS_00600 gene rpsD 5415 6032 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_00600 6052 7023 gene locus_tag LOCUS_00610 6052 7023 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061621.1 protein_id gnl|my_center|LOCUS_00610 7035 7517 gene locus_tag LOCUS_00620 7035 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 7528 8691 gene locus_tag LOCUS_00630 7528 8691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 8827 10410 gene locus_tag LOCUS_00640 gene hutU 8827 10410 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_00640 10424 11626 gene locus_tag LOCUS_00650 gene hutI 10424 11626 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203599.1 protein_id gnl|my_center|LOCUS_00650 13218 11647 gene locus_tag LOCUS_00660 13218 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 13427 13987 gene locus_tag LOCUS_00670 gene efp 13427 13987 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_00670 13984 14466 gene locus_tag LOCUS_00680 gene accB 13984 14466 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_00680 14525 15883 gene locus_tag LOCUS_00690 gene accC 14525 15883 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931851.1 protein_id gnl|my_center|LOCUS_00690 15899 16276 gene locus_tag LOCUS_00700 gene gcvH 15899 16276 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831963.1 protein_id gnl|my_center|LOCUS_00700 16317 17609 gene locus_tag LOCUS_00710 gene gcvPA 16317 17609 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933289.1 protein_id gnl|my_center|LOCUS_00710 17606 18352 gene locus_tag LOCUS_00720 17606 18352 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_00720 18354 18932 gene locus_tag LOCUS_00730 18354 18932 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880554.1 protein_id gnl|my_center|LOCUS_00730 18958 19851 gene locus_tag LOCUS_00740 gene xerD 18958 19851 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_00740 19845 20471 gene locus_tag LOCUS_00750 19845 20471 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_00750 20604 22307 gene locus_tag LOCUS_00760 20604 22307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 22335 22434 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22478 24220 gene locus_tag LOCUS_00770 gene mutL 22478 24220 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546175.1 protein_id gnl|my_center|LOCUS_00770 25244 24246 gene locus_tag LOCUS_00780 25244 24246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 25579 27216 gene locus_tag LOCUS_00790 25579 27216 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_00790 27254 29344 gene locus_tag LOCUS_00800 gene prlC 27254 29344 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 protein_id gnl|my_center|LOCUS_00800 29349 30563 gene locus_tag LOCUS_00810 gene rifK 29349 30563 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_00810 30705 30621 gene locus_tag LOCUS_t00010 30705 30621 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 30756 31259 gene locus_tag LOCUS_00820 gene smpB 30756 31259 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_00820 31265 32476 gene locus_tag LOCUS_00830 gene tyrS 31265 32476 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932250.1 protein_id gnl|my_center|LOCUS_00830 32561 32890 gene locus_tag LOCUS_00840 gene trxA 32561 32890 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_00840 32903 33829 gene locus_tag LOCUS_00850 gene trxB 32903 33829 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_00850 33905 34582 gene locus_tag LOCUS_00860 33905 34582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 34599 36119 gene locus_tag LOCUS_00870 gene gpmI 34599 36119 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_00870 36109 37092 gene locus_tag LOCUS_00880 gene rfaE1 36109 37092 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_00880 37157 38764 gene locus_tag LOCUS_00890 37157 38764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 38839 40005 gene locus_tag LOCUS_00900 38839 40005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 40005 40814 gene locus_tag LOCUS_00910 40005 40814 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226741.1 protein_id gnl|my_center|LOCUS_00910 40843 41400 gene locus_tag LOCUS_00920 40843 41400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 41402 42463 gene locus_tag LOCUS_00930 41402 42463 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_00930 42460 43440 gene locus_tag LOCUS_00940 42460 43440 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_00940 43433 44782 gene locus_tag LOCUS_00950 gene mtaB 43433 44782 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_00950 45067 45819 gene locus_tag LOCUS_00960 45067 45819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 45878 47218 gene locus_tag LOCUS_00970 gene trkA 45878 47218 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_00970 47225 48703 gene locus_tag LOCUS_00980 47225 48703 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_00980 48716 50161 gene locus_tag LOCUS_00990 48716 50161 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_00990 50166 51197 gene locus_tag LOCUS_01000 50166 51197 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_01000 51257 52303 gene locus_tag LOCUS_01010 51257 52303 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_01010 52300 52710 gene locus_tag LOCUS_01020 gene mce 52300 52710 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_01020 >Feature sequence003 430 107 gene locus_tag LOCUS_01030 430 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 608 3052 gene locus_tag LOCUS_01040 608 3052 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_01040 3049 4371 gene locus_tag LOCUS_01050 3049 4371 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_01050 4595 5194 gene locus_tag LOCUS_01060 4595 5194 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016134873.1 protein_id gnl|my_center|LOCUS_01060 5204 6991 gene locus_tag LOCUS_01070 5204 6991 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_01070 7001 8137 gene locus_tag LOCUS_01080 gene fadA 7001 8137 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070436.1 protein_id gnl|my_center|LOCUS_01080 8137 8787 gene locus_tag LOCUS_01090 8137 8787 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_01090 8849 11188 gene locus_tag LOCUS_01100 8849 11188 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 protein_id gnl|my_center|LOCUS_01100 12101 11214 gene locus_tag LOCUS_01110 12101 11214 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_01110 13188 12127 gene locus_tag LOCUS_01120 13188 12127 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_01120 14986 13190 gene locus_tag LOCUS_01130 14986 13190 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_01130 16354 14990 gene locus_tag LOCUS_01140 16354 14990 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_01140 17104 16376 gene locus_tag LOCUS_01150 17104 16376 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_01150 17787 17110 gene locus_tag LOCUS_01160 17787 17110 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_01160 19571 17802 gene locus_tag LOCUS_01170 gene aspS 19571 17802 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940622.1 protein_id gnl|my_center|LOCUS_01170 20025 19630 gene locus_tag LOCUS_01180 20025 19630 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_01180 21419 20025 gene locus_tag LOCUS_01190 gene atpD 21419 20025 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_01190 22319 21462 gene locus_tag LOCUS_01200 22319 21462 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_01200 23846 22320 gene locus_tag LOCUS_01210 gene atpA 23846 22320 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933688.1 protein_id gnl|my_center|LOCUS_01210 24404 23865 gene locus_tag LOCUS_01220 24404 23865 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243176.1 protein_id gnl|my_center|LOCUS_01220 24900 24382 gene locus_tag LOCUS_01230 24900 24382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 25233 24931 gene locus_tag LOCUS_01240 25233 24931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 26140 25286 gene locus_tag LOCUS_01250 26140 25286 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931715.1 protein_id gnl|my_center|LOCUS_01250 26445 26137 gene locus_tag LOCUS_01260 26445 26137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 26704 26447 gene locus_tag LOCUS_01270 26704 26447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 27138 26707 gene locus_tag LOCUS_01280 27138 26707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 27925 27131 gene locus_tag LOCUS_01290 27925 27131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 28813 27950 gene locus_tag LOCUS_01300 28813 27950 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_01300 29567 28770 gene locus_tag LOCUS_01310 29567 28770 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933511.1 protein_id gnl|my_center|LOCUS_01310 29655 29846 gene locus_tag LOCUS_01320 29655 29846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 29878 30897 gene locus_tag LOCUS_01330 29878 30897 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_01330 30900 30999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31016 32200 gene locus_tag LOCUS_01340 31016 32200 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772253.1 protein_id gnl|my_center|LOCUS_01340 32203 32571 gene locus_tag LOCUS_01350 32203 32571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 32667 34478 gene locus_tag LOCUS_01360 32667 34478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01360 35413 35477 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35882 35981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36208 36690 gene locus_tag LOCUS_01370 36208 36690 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 protein_id gnl|my_center|LOCUS_01370 36834 37451 gene locus_tag LOCUS_01380 36834 37451 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_01380 37549 38205 gene locus_tag LOCUS_01390 gene plsY 37549 38205 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724132.1 protein_id gnl|my_center|LOCUS_01390 39851 38202 gene locus_tag LOCUS_01400 39851 38202 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_01400 41172 39877 gene locus_tag LOCUS_01410 41172 39877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 42538 41165 gene locus_tag LOCUS_01420 42538 41165 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_01420 42918 42556 gene locus_tag LOCUS_01430 42918 42556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 43922 42930 gene locus_tag LOCUS_01440 43922 42930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 44352 44017 gene locus_tag LOCUS_01450 44352 44017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 45056 44415 gene locus_tag LOCUS_01460 45056 44415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 45433 45209 gene locus_tag LOCUS_01470 45433 45209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 46694 45567 gene locus_tag LOCUS_01480 46694 45567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 47774 46698 gene locus_tag LOCUS_01490 47774 46698 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_01490 49206 47785 gene locus_tag LOCUS_01500 49206 47785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 49718 49278 gene locus_tag LOCUS_01510 49718 49278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 50711 49773 gene locus_tag LOCUS_01520 50711 49773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 51439 50708 gene locus_tag LOCUS_01530 51439 50708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 >Feature sequence004 259 186 gene locus_tag LOCUS_t00020 259 186 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1849 464 gene locus_tag LOCUS_01540 gene cysS 1849 464 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_01540 2361 1849 gene locus_tag LOCUS_01550 2361 1849 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_01550 3262 2354 gene locus_tag LOCUS_01560 3262 2354 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880304.1 protein_id gnl|my_center|LOCUS_01560 3831 3262 gene locus_tag LOCUS_01570 gene gmhB 3831 3262 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259582.1 protein_id gnl|my_center|LOCUS_01570 4603 3824 gene locus_tag LOCUS_01580 4603 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 7202 4698 gene locus_tag LOCUS_01590 7202 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 4731 4830 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8304 7207 gene locus_tag LOCUS_01600 gene gcvT 8304 7207 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_01600 8968 8378 gene locus_tag LOCUS_01610 gene ruvA 8968 8378 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580359.1 protein_id gnl|my_center|LOCUS_01610 9450 8965 gene locus_tag LOCUS_01620 gene ruvC 9450 8965 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_01620 10197 9454 gene locus_tag LOCUS_01630 10197 9454 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_01630 10811 10365 gene locus_tag LOCUS_01640 10811 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 11563 10805 gene locus_tag LOCUS_01650 11563 10805 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_01650 13311 11560 gene locus_tag LOCUS_01660 13311 11560 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405278.1 protein_id gnl|my_center|LOCUS_01660 14059 13313 gene locus_tag LOCUS_01670 14059 13313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 15074 14043 gene locus_tag LOCUS_01680 15074 14043 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_01680 16070 15075 gene locus_tag LOCUS_01690 16070 15075 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_01690 16478 16242 gene locus_tag LOCUS_01700 gene tatA 16478 16242 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_01700 16784 16500 gene locus_tag LOCUS_01710 16784 16500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 17574 16843 gene locus_tag LOCUS_01720 gene pssA 17574 16843 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933008.1 protein_id gnl|my_center|LOCUS_01720 18227 17571 gene locus_tag LOCUS_01730 18227 17571 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_01730 19329 18235 gene locus_tag LOCUS_01740 19329 18235 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081291.1 protein_id gnl|my_center|LOCUS_01740 20060 19329 gene locus_tag LOCUS_01750 gene truA 20060 19329 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403435.1 protein_id gnl|my_center|LOCUS_01750 21454 20786 gene locus_tag LOCUS_01760 21454 20786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 22938 21430 gene locus_tag LOCUS_01770 gene lnt 22938 21430 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_01770 23348 22938 gene locus_tag LOCUS_01780 gene ruvX 23348 22938 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_01780 23668 23363 gene locus_tag LOCUS_01790 23668 23363 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403823.1 protein_id gnl|my_center|LOCUS_01790 25855 23669 gene locus_tag LOCUS_01800 25855 23669 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_01800 27222 25855 gene locus_tag LOCUS_01810 gene dnaB 27222 25855 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_01810 27890 27225 gene locus_tag LOCUS_01820 27890 27225 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931900.1 protein_id gnl|my_center|LOCUS_01820 28177 27890 gene locus_tag LOCUS_01830 28177 27890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 28746 28168 gene locus_tag LOCUS_01840 gene gmk 28746 28168 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082205.1 protein_id gnl|my_center|LOCUS_01840 29609 28746 gene locus_tag LOCUS_01850 29609 28746 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416240.1 protein_id gnl|my_center|LOCUS_01850 30754 29711 gene locus_tag LOCUS_01860 30754 29711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 33326 30744 gene locus_tag LOCUS_01870 gene mutS 33326 30744 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_01870 35230 33350 gene locus_tag LOCUS_01880 gene selB 35230 33350 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_01880 36609 35233 gene locus_tag LOCUS_01890 gene selA 36609 35233 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_01890 37840 36674 gene locus_tag LOCUS_01900 37840 36674 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_01900 38274 37936 gene locus_tag LOCUS_01910 gene rplS 38274 37936 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640385.1 protein_id gnl|my_center|LOCUS_01910 39001 38285 gene locus_tag LOCUS_01920 gene trmD 39001 38285 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967234.1 protein_id gnl|my_center|LOCUS_01920 >Feature sequence005 1103 417 gene locus_tag LOCUS_01930 1103 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 1252 1416 gene locus_tag LOCUS_01940 1252 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 1392 1401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1462 2118 gene locus_tag LOCUS_01950 1462 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 2256 4508 gene locus_tag LOCUS_01960 2256 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 4515 5267 gene locus_tag LOCUS_01970 4515 5267 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324393.1 protein_id gnl|my_center|LOCUS_01970 5395 5494 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5705 6265 gene locus_tag LOCUS_01980 5705 6265 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840180.1 protein_id gnl|my_center|LOCUS_01980 6277 7494 gene locus_tag LOCUS_01990 6277 7494 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_01990 7504 8154 gene locus_tag LOCUS_02000 7504 8154 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_02000 8157 8750 gene locus_tag LOCUS_02010 gene coaE 8157 8750 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881297.1 protein_id gnl|my_center|LOCUS_02010 9275 8751 gene locus_tag LOCUS_02020 9275 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 10301 9282 gene locus_tag LOCUS_02030 gene floA 10301 9282 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_02030 11649 10315 gene locus_tag LOCUS_02040 11649 10315 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_02040 11896 12666 gene locus_tag LOCUS_02050 11896 12666 CDS product lauroyl/myristoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027687.1 protein_id gnl|my_center|LOCUS_02050 12701 13276 gene locus_tag LOCUS_02060 12701 13276 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_02060 13279 13995 gene locus_tag LOCUS_02070 13279 13995 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941333.1 protein_id gnl|my_center|LOCUS_02070 16045 13985 gene locus_tag LOCUS_02080 16045 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 15116 15215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16788 16045 gene locus_tag LOCUS_02090 16788 16045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 17203 16769 gene locus_tag LOCUS_02100 17203 16769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 17997 17545 gene locus_tag LOCUS_02110 17997 17545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02110 18926 17994 gene locus_tag LOCUS_02120 18926 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02120 19945 18923 gene locus_tag LOCUS_02130 gene lpxD 19945 18923 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_02130 20434 19949 gene locus_tag LOCUS_02140 gene skp 20434 19949 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758966.1 protein_id gnl|my_center|LOCUS_02140 22922 20550 gene locus_tag LOCUS_02150 gene bamA 22922 20550 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_02150 23683 22919 gene locus_tag LOCUS_02160 23683 22919 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_02160 24957 24175 gene locus_tag LOCUS_02170 24957 24175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 26121 24973 gene locus_tag LOCUS_02180 26121 24973 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902811.1 protein_id gnl|my_center|LOCUS_02180 26485 26198 gene locus_tag LOCUS_02190 26485 26198 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_02190 26957 28144 gene locus_tag LOCUS_02200 26957 28144 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083122.1 protein_id gnl|my_center|LOCUS_02200 28278 28616 gene locus_tag LOCUS_02210 28278 28616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 28706 29191 gene locus_tag LOCUS_02220 28706 29191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 29194 30630 gene locus_tag LOCUS_02230 gene glpK 29194 30630 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931879.1 protein_id gnl|my_center|LOCUS_02230 31772 31092 gene locus_tag LOCUS_02240 31772 31092 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258166.1 protein_id gnl|my_center|LOCUS_02240 32076 31765 gene locus_tag LOCUS_02250 32076 31765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 32739 32077 gene locus_tag LOCUS_02260 gene elbB 32739 32077 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210143.1 protein_id gnl|my_center|LOCUS_02260 35311 32882 gene locus_tag LOCUS_02270 35311 32882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 36271 35324 gene locus_tag LOCUS_02280 gene queG 36271 35324 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_02280 36854 36297 gene locus_tag LOCUS_02290 36854 36297 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_02290 37643 36891 gene locus_tag LOCUS_02300 37643 36891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932861.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence006 39 587 gene locus_tag LOCUS_02310 39 587 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963846.1 protein_id gnl|my_center|LOCUS_02310 912 3713 gene locus_tag LOCUS_02320 912 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 3746 5257 gene locus_tag LOCUS_02330 3746 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 5402 7690 gene locus_tag LOCUS_02340 5402 7690 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613683.1 protein_id gnl|my_center|LOCUS_02340 8004 8222 gene locus_tag LOCUS_02350 8004 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 8368 8589 gene locus_tag LOCUS_02360 8368 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 8830 9069 gene locus_tag LOCUS_02370 8830 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 9164 9481 gene locus_tag LOCUS_02380 9164 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 9481 10023 gene locus_tag LOCUS_02390 gene def 9481 10023 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933121.1 protein_id gnl|my_center|LOCUS_02390 10035 10967 gene locus_tag LOCUS_02400 gene fmt 10035 10967 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_02400 11032 12282 gene locus_tag LOCUS_02410 gene rsmB 11032 12282 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_02410 12276 13058 gene locus_tag LOCUS_02420 12276 13058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 13074 13652 gene locus_tag LOCUS_02430 13074 13652 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404449.1 protein_id gnl|my_center|LOCUS_02430 13649 15721 gene locus_tag LOCUS_02440 13649 15721 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_02440 15714 16997 gene locus_tag LOCUS_02450 gene hflX 15714 16997 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933052.1 protein_id gnl|my_center|LOCUS_02450 17000 17530 gene locus_tag LOCUS_02460 17000 17530 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925475.1 protein_id gnl|my_center|LOCUS_02460 18238 17801 gene locus_tag LOCUS_02470 18238 17801 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071603.1 protein_id gnl|my_center|LOCUS_02470 20602 18248 gene locus_tag LOCUS_02480 20602 18248 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_02480 18251 18350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20691 22148 gene locus_tag LOCUS_02490 20691 22148 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_02490 22145 24490 gene locus_tag LOCUS_02500 22145 24490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 25132 24494 gene locus_tag LOCUS_02510 25132 24494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 25862 25119 gene locus_tag LOCUS_02520 25862 25119 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871978.1 protein_id gnl|my_center|LOCUS_02520 26046 26855 gene locus_tag LOCUS_02530 gene pyrF 26046 26855 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931823.1 protein_id gnl|my_center|LOCUS_02530 26848 27417 gene locus_tag LOCUS_02540 gene pyrE 26848 27417 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_02540 27414 28118 gene locus_tag LOCUS_02550 27414 28118 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_02550 28280 30154 gene locus_tag LOCUS_02560 28280 30154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 30142 30726 gene locus_tag LOCUS_02570 30142 30726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 >Feature sequence007 4 1182 gene locus_tag LOCUS_02580 4 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 1284 2423 gene locus_tag LOCUS_02590 gene sat 1284 2423 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141086.1 protein_id gnl|my_center|LOCUS_02590 2425 2973 gene locus_tag LOCUS_02600 gene cysC 2425 2973 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_02600 3009 4190 gene locus_tag LOCUS_02610 3009 4190 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839261.1 protein_id gnl|my_center|LOCUS_02610 4212 5183 gene locus_tag LOCUS_02620 4212 5183 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_02620 5265 5684 gene locus_tag LOCUS_02630 5265 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 5681 6070 gene locus_tag LOCUS_02640 5681 6070 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_02640 6960 6148 gene locus_tag LOCUS_02650 6960 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 8611 7433 gene locus_tag LOCUS_02660 gene ftsZ 8611 7433 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_02660 9951 8677 gene locus_tag LOCUS_02670 gene ftsA 9951 8677 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_02670 10748 9942 gene locus_tag LOCUS_02680 10748 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 11683 10745 gene locus_tag LOCUS_02690 gene murB 11683 10745 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_02690 13076 11685 gene locus_tag LOCUS_02700 gene murC 13076 11685 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403337.1 protein_id gnl|my_center|LOCUS_02700 13645 13073 gene locus_tag LOCUS_02710 13645 13073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02710 14181 13648 gene locus_tag LOCUS_02720 14181 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02720 15316 14171 gene locus_tag LOCUS_02730 gene spoVE 15316 14171 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_02730 16782 15313 gene locus_tag LOCUS_02740 gene murD 16782 15313 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403334.1 protein_id gnl|my_center|LOCUS_02740 17852 16695 gene locus_tag LOCUS_02750 gene mraY 17852 16695 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545877.1 protein_id gnl|my_center|LOCUS_02750 19195 17852 gene locus_tag LOCUS_02760 19195 17852 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443995.1 protein_id gnl|my_center|LOCUS_02760 20648 19185 gene locus_tag LOCUS_02770 gene murE 20648 19185 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693448.1 protein_id gnl|my_center|LOCUS_02770 22627 20648 gene locus_tag LOCUS_02780 22627 20648 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_02780 22976 22620 gene locus_tag LOCUS_02790 22976 22620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 23917 22973 gene locus_tag LOCUS_02800 gene rsmH 23917 22973 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_02800 24399 23920 gene locus_tag LOCUS_02810 gene mraZ 24399 23920 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180984760.1 protein_id gnl|my_center|LOCUS_02810 25117 24536 gene locus_tag LOCUS_02820 25117 24536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 25717 25148 gene locus_tag LOCUS_02830 25717 25148 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428485.1 protein_id gnl|my_center|LOCUS_02830 29622 25774 gene locus_tag LOCUS_02840 gene porU 29622 25774 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_02840 29723 31984 gene locus_tag LOCUS_02850 29723 31984 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence008 1214 780 gene locus_tag LOCUS_02860 1214 780 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932428.1 protein_id gnl|my_center|LOCUS_02860 1519 1265 gene locus_tag LOCUS_02870 1519 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 1872 1519 gene locus_tag LOCUS_02880 1872 1519 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_02880 2235 1876 gene locus_tag LOCUS_02890 2235 1876 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_02890 2645 2247 gene locus_tag LOCUS_02900 2645 2247 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003770811.1 protein_id gnl|my_center|LOCUS_02900 3973 2672 gene locus_tag LOCUS_02910 3973 2672 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_02910 4554 3973 gene locus_tag LOCUS_02920 gene sufT 4554 3973 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_02920 5001 4558 gene locus_tag LOCUS_02930 5001 4558 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_02930 6323 5001 gene locus_tag LOCUS_02940 gene sufD 6323 5001 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_02940 7087 6332 gene locus_tag LOCUS_02950 gene sufC 7087 6332 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_02950 8571 7123 gene locus_tag LOCUS_02960 gene sufB 8571 7123 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_02960 8926 8699 gene locus_tag LOCUS_02970 8926 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 10016 9090 gene locus_tag LOCUS_02980 gene selD 10016 9090 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011344950.1 protein_id gnl|my_center|LOCUS_02980 11080 10262 gene locus_tag LOCUS_02990 11080 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 11308 12381 gene locus_tag LOCUS_03000 11308 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 12279 12378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12395 12928 gene locus_tag LOCUS_03010 12395 12928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 12925 13941 gene locus_tag LOCUS_03020 12925 13941 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_03020 14029 15408 gene locus_tag LOCUS_03030 gene fumC 14029 15408 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_03030 15557 17695 gene locus_tag LOCUS_03040 15557 17695 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927193.1 protein_id gnl|my_center|LOCUS_03040 18945 17692 gene locus_tag LOCUS_03050 18945 17692 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 protein_id gnl|my_center|LOCUS_03050 20330 18942 gene locus_tag LOCUS_03060 20330 18942 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926921.1 protein_id gnl|my_center|LOCUS_03060 20548 20474 gene locus_tag LOCUS_t00030 20548 20474 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 20863 21342 gene locus_tag LOCUS_03070 20863 21342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 21339 21776 gene locus_tag LOCUS_03080 21339 21776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 22028 22240 gene locus_tag LOCUS_03090 22028 22240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 22249 22683 gene locus_tag LOCUS_03100 gene arfB 22249 22683 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_03100 22688 23194 gene locus_tag LOCUS_03110 22688 23194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 23598 23191 gene locus_tag LOCUS_03120 23598 23191 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948553.1 protein_id gnl|my_center|LOCUS_03120 24476 23664 gene locus_tag LOCUS_03130 gene mutM 24476 23664 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257743.1 protein_id gnl|my_center|LOCUS_03130 25457 24480 gene locus_tag LOCUS_03140 25457 24480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 26267 25551 gene locus_tag LOCUS_03150 26267 25551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 26782 26369 gene locus_tag LOCUS_03160 26782 26369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 26938 26863 gene locus_tag LOCUS_t00040 26938 26863 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 27621 27022 gene locus_tag LOCUS_03170 27621 27022 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_03170 28079 27618 gene locus_tag LOCUS_03180 28079 27618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 28600 28223 gene locus_tag LOCUS_03190 28600 28223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 29463 28681 gene locus_tag LOCUS_03200 29463 28681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 29420 29662 gene locus_tag LOCUS_03210 29420 29662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 29659 29979 gene locus_tag LOCUS_03220 29659 29979 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_03220 30049 30123 gene locus_tag LOCUS_t00050 30049 30123 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence009 921 22 gene locus_tag LOCUS_03230 921 22 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_03230 1192 1638 gene locus_tag LOCUS_03240 gene ndhC 1192 1638 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_03240 1639 2154 gene locus_tag LOCUS_03250 1639 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 2151 3296 gene locus_tag LOCUS_03260 2151 3296 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_03260 3296 4381 gene locus_tag LOCUS_03270 gene nuoH 3296 4381 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_03270 4389 5000 gene locus_tag LOCUS_03280 4389 5000 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932453.1 protein_id gnl|my_center|LOCUS_03280 4997 5494 gene locus_tag LOCUS_03290 4997 5494 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_03290 5491 5796 gene locus_tag LOCUS_03300 gene nuoK 5491 5796 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_03300 5793 7838 gene locus_tag LOCUS_03310 gene nuoL 5793 7838 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927227.1 protein_id gnl|my_center|LOCUS_03310 7860 9407 gene locus_tag LOCUS_03320 7860 9407 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_03320 9417 10895 gene locus_tag LOCUS_03330 9417 10895 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_03330 10977 11345 gene locus_tag LOCUS_03340 10977 11345 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_03340 11336 11824 gene locus_tag LOCUS_03350 11336 11824 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_03350 11829 12338 gene locus_tag LOCUS_03360 11829 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 12335 13540 gene locus_tag LOCUS_03370 gene nuoD 12335 13540 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_03370 13537 14019 gene locus_tag LOCUS_03380 gene nuoE 13537 14019 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_03380 14016 15317 gene locus_tag LOCUS_03390 gene nuoF 14016 15317 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396808.1 protein_id gnl|my_center|LOCUS_03390 15317 16939 gene locus_tag LOCUS_03400 15317 16939 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 protein_id gnl|my_center|LOCUS_03400 16939 17967 gene locus_tag LOCUS_03410 gene nuoH 16939 17967 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_03410 17969 18478 gene locus_tag LOCUS_03420 17969 18478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 18468 18968 gene locus_tag LOCUS_03430 18468 18968 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_03430 18968 19273 gene locus_tag LOCUS_03440 gene nuoK 18968 19273 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_03440 19275 21158 gene locus_tag LOCUS_03450 gene nuoL 19275 21158 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404195.1 protein_id gnl|my_center|LOCUS_03450 21155 22705 gene locus_tag LOCUS_03460 21155 22705 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_03460 22702 24198 gene locus_tag LOCUS_03470 22702 24198 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939629.1 protein_id gnl|my_center|LOCUS_03470 24206 25651 gene locus_tag LOCUS_03480 24206 25651 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_03480 25695 26240 gene locus_tag LOCUS_03490 25695 26240 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_03490 26846 27739 gene locus_tag LOCUS_03500 26846 27739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 27723 29093 gene locus_tag LOCUS_03510 27723 29093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 29151 30497 gene locus_tag LOCUS_03520 29151 30497 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529973.1 protein_id gnl|my_center|LOCUS_03520 >Feature sequence010 580 356 gene locus_tag LOCUS_03530 580 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 748 2001 gene locus_tag LOCUS_03540 748 2001 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926922.1 protein_id gnl|my_center|LOCUS_03540 1998 5606 gene locus_tag LOCUS_03550 1998 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 5718 6050 gene locus_tag LOCUS_03560 5718 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 6055 7314 gene locus_tag LOCUS_03570 gene hisS 6055 7314 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403603.1 protein_id gnl|my_center|LOCUS_03570 7395 9635 gene locus_tag LOCUS_03580 gene topA 7395 9635 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_03580 9638 10060 gene locus_tag LOCUS_03590 9638 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 10060 11373 gene locus_tag LOCUS_03600 10060 11373 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_03600 12582 11389 gene locus_tag LOCUS_03610 12582 11389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966815.1 protein_id gnl|my_center|LOCUS_03610 13352 12582 gene locus_tag LOCUS_03620 13352 12582 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_03620 13568 13667 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13965 14486 gene locus_tag LOCUS_03630 13965 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 15704 14505 gene locus_tag LOCUS_03640 15704 14505 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530099.1 protein_id gnl|my_center|LOCUS_03640 16515 15706 gene locus_tag LOCUS_03650 16515 15706 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_03650 16644 17633 gene locus_tag LOCUS_03660 16644 17633 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_03660 17636 18538 gene locus_tag LOCUS_03670 17636 18538 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_03670 19624 18545 gene locus_tag LOCUS_03680 19624 18545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 20583 19687 gene locus_tag LOCUS_03690 20583 19687 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_03690 20741 21511 gene locus_tag LOCUS_03700 20741 21511 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258710.1 protein_id gnl|my_center|LOCUS_03700 21545 22681 gene locus_tag LOCUS_03710 gene nifS 21545 22681 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_03710 22678 23790 gene locus_tag LOCUS_03720 gene mnmA 22678 23790 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_03720 23783 24538 gene locus_tag LOCUS_03730 23783 24538 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931943.1 protein_id gnl|my_center|LOCUS_03730 24522 25004 gene locus_tag LOCUS_03740 24522 25004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 25066 25617 gene locus_tag LOCUS_03750 25066 25617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 25614 26009 gene locus_tag LOCUS_03760 gene rsfS 25614 26009 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926804.1 protein_id gnl|my_center|LOCUS_03760 26048 27691 gene locus_tag LOCUS_03770 gene argS 26048 27691 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403746.1 protein_id gnl|my_center|LOCUS_03770 27694 28353 gene locus_tag LOCUS_03780 27694 28353 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763832.1 protein_id gnl|my_center|LOCUS_03780 28917 28648 gene locus_tag LOCUS_03790 28917 28648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 29289 28933 gene locus_tag LOCUS_tm00010 29289 28933 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence011 <1 730 gene locus_tag LOCUS_03800 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962383.1:cyclase family protein 730 1977 gene locus_tag LOCUS_03810 gene kynU 730 1977 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_03810 1983 3326 gene locus_tag LOCUS_03820 1983 3326 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036736.1 protein_id gnl|my_center|LOCUS_03820 3402 4439 gene locus_tag LOCUS_03830 3402 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 4324 4423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6070 6169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9628 6923 gene locus_tag LOCUS_03840 gene ppdK 9628 6923 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_03840 9823 11787 gene locus_tag LOCUS_03850 9823 11787 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391442.1 protein_id gnl|my_center|LOCUS_03850 11777 12232 gene locus_tag LOCUS_03860 11777 12232 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_03860 12229 12582 gene locus_tag LOCUS_03870 12229 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 12590 13459 gene locus_tag LOCUS_03880 12590 13459 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_03880 13456 14472 gene locus_tag LOCUS_03890 13456 14472 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 protein_id gnl|my_center|LOCUS_03890 14551 15723 gene locus_tag LOCUS_03900 14551 15723 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090552.1 protein_id gnl|my_center|LOCUS_03900 15766 16533 gene locus_tag LOCUS_03910 15766 16533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080269.1 protein_id gnl|my_center|LOCUS_03910 16526 17263 gene locus_tag LOCUS_03920 16526 17263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_03920 17293 19059 gene locus_tag LOCUS_03930 17293 19059 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_03930 19046 20710 gene locus_tag LOCUS_03940 19046 20710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 22262 20724 gene locus_tag LOCUS_03950 gene purH 22262 20724 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207145.1 protein_id gnl|my_center|LOCUS_03950 22858 22262 gene locus_tag LOCUS_03960 gene purN 22858 22262 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947399.1 protein_id gnl|my_center|LOCUS_03960 24167 22860 gene locus_tag LOCUS_03970 gene purD 24167 22860 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947400.1 protein_id gnl|my_center|LOCUS_03970 25648 24167 gene locus_tag LOCUS_03980 gene purF 25648 24167 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947401.1 protein_id gnl|my_center|LOCUS_03980 27003 25651 gene locus_tag LOCUS_03990 gene purB 27003 25651 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957828.1 protein_id gnl|my_center|LOCUS_03990 27388 26996 gene locus_tag LOCUS_04000 gene purE 27388 26996 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582680.1 protein_id gnl|my_center|LOCUS_04000 28353 27385 gene locus_tag LOCUS_04010 28353 27385 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946655.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence012 828 2129 gene locus_tag LOCUS_04020 828 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 2397 3416 gene locus_tag LOCUS_04030 gene ruvB 2397 3416 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_04030 3432 4484 gene locus_tag LOCUS_04040 gene queA 3432 4484 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932985.1 protein_id gnl|my_center|LOCUS_04040 4495 5187 gene locus_tag LOCUS_04050 gene ispD 4495 5187 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_04050 5177 5656 gene locus_tag LOCUS_04060 gene ispF 5177 5656 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393963.1 protein_id gnl|my_center|LOCUS_04060 5693 6502 gene locus_tag LOCUS_04070 gene ispE 5693 6502 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933161.1 protein_id gnl|my_center|LOCUS_04070 6553 6624 gene locus_tag LOCUS_t00060 6553 6624 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6656 7588 gene locus_tag LOCUS_04080 6656 7588 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838396.1 protein_id gnl|my_center|LOCUS_04080 7603 8304 gene locus_tag LOCUS_04090 7603 8304 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722740.1 protein_id gnl|my_center|LOCUS_04090 8301 8882 gene locus_tag LOCUS_04100 gene pth 8301 8882 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_04100 8882 10942 gene locus_tag LOCUS_04110 8882 10942 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_04110 10954 11343 gene locus_tag LOCUS_04120 10954 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 11356 11586 gene locus_tag LOCUS_04130 gene rpsR 11356 11586 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359407.1 protein_id gnl|my_center|LOCUS_04130 11604 12065 gene locus_tag LOCUS_04140 gene rplI 11604 12065 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_04140 15089 12138 gene locus_tag LOCUS_04150 15089 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 17443 15086 gene locus_tag LOCUS_04160 17443 15086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 17596 22851 gene locus_tag LOCUS_04170 17596 22851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 22887 24068 gene locus_tag LOCUS_04180 gene pgsB 22887 24068 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020724.1 protein_id gnl|my_center|LOCUS_04180 24061 24504 gene locus_tag LOCUS_04190 gene pgsC 24061 24504 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_04190 24497 25618 gene locus_tag LOCUS_04200 gene pgsW 24497 25618 CDS product poly-gamma-glutamate system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118209.1 protein_id gnl|my_center|LOCUS_04200 25596 26480 gene locus_tag LOCUS_04210 25596 26480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 26482 27534 gene locus_tag LOCUS_04220 26482 27534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence013 918 43 gene locus_tag LOCUS_04230 918 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 1906 1031 gene locus_tag LOCUS_04240 1906 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 4797 1993 gene locus_tag LOCUS_04250 4797 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 8125 4817 gene locus_tag LOCUS_04260 8125 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 11090 8238 gene locus_tag LOCUS_04270 11090 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 13342 11213 gene locus_tag LOCUS_04280 13342 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 14449 13418 gene locus_tag LOCUS_04290 14449 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 17595 14446 gene locus_tag LOCUS_04300 17595 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 21076 17627 gene locus_tag LOCUS_04310 21076 17627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 23138 21078 gene locus_tag LOCUS_04320 23138 21078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 25342 23342 gene locus_tag LOCUS_04330 25342 23342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 26043 25453 gene locus_tag LOCUS_04340 gene clpP 26043 25453 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_04340 27351 26077 gene locus_tag LOCUS_04350 gene tig 27351 26077 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405385.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence014 459 3506 gene locus_tag LOCUS_04360 459 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 3574 5808 gene locus_tag LOCUS_04370 gene priA 3574 5808 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_04370 5837 6721 gene locus_tag LOCUS_04380 5837 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 6870 8276 gene locus_tag LOCUS_04390 6870 8276 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023126.1 protein_id gnl|my_center|LOCUS_04390 8273 8737 gene locus_tag LOCUS_04400 8273 8737 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_04400 8782 9342 gene locus_tag LOCUS_04410 8782 9342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 10096 9365 gene locus_tag LOCUS_04420 10096 9365 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_04420 10111 11214 gene locus_tag LOCUS_04430 10111 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 11265 12467 gene locus_tag LOCUS_04440 11265 12467 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_04440 12609 13844 gene locus_tag LOCUS_04450 12609 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 14612 13890 gene locus_tag LOCUS_04460 14612 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 15400 14612 gene locus_tag LOCUS_04470 15400 14612 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479696.1 protein_id gnl|my_center|LOCUS_04470 15425 15524 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16569 15634 gene locus_tag LOCUS_04480 16569 15634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721785.1 protein_id gnl|my_center|LOCUS_04480 16823 17689 gene locus_tag LOCUS_04490 16823 17689 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228540.1 protein_id gnl|my_center|LOCUS_04490 18081 17713 gene locus_tag LOCUS_04500 18081 17713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 20153 18147 gene locus_tag LOCUS_04510 gene ligA 20153 18147 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_04510 20428 20156 gene locus_tag LOCUS_04520 20428 20156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 22077 20602 gene locus_tag LOCUS_04530 22077 20602 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403903.1 protein_id gnl|my_center|LOCUS_04530 23001 22147 gene locus_tag LOCUS_04540 23001 22147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 23975 22992 gene locus_tag LOCUS_04550 23975 22992 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_04550 25097 23985 gene locus_tag LOCUS_04560 25097 23985 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_04560 <26059 25202 gene locus_tag LOCUS_04570 <26059 25202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000486431.1:PQQ-dependent sugar dehydrogenase >Feature sequence015 1074 157 gene locus_tag LOCUS_04580 gene argF 1074 157 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_04580 2423 1086 gene locus_tag LOCUS_04590 gene hslU 2423 1086 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_04590 2961 2425 gene locus_tag LOCUS_04600 gene hslV 2961 2425 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114726.1 protein_id gnl|my_center|LOCUS_04600 3812 2958 gene locus_tag LOCUS_04610 3812 2958 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_04610 4753 3812 gene locus_tag LOCUS_04620 gene hflK 4753 3812 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_04620 6137 4788 gene locus_tag LOCUS_04630 6137 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 6885 6139 gene locus_tag LOCUS_04640 gene lptB 6885 6139 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927114.1 protein_id gnl|my_center|LOCUS_04640 7540 6878 gene locus_tag LOCUS_04650 7540 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 8610 7615 gene locus_tag LOCUS_04660 8610 7615 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_04660 9158 8607 gene locus_tag LOCUS_04670 9158 8607 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938916.1 protein_id gnl|my_center|LOCUS_04670 9972 9151 gene locus_tag LOCUS_04680 gene kdsA 9972 9151 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_04680 11591 9969 gene locus_tag LOCUS_04690 11591 9969 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_04690 12297 11584 gene locus_tag LOCUS_04700 gene kdsB 12297 11584 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_04700 13913 12489 gene locus_tag LOCUS_04710 13913 12489 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932670.1 protein_id gnl|my_center|LOCUS_04710 14045 14848 gene locus_tag LOCUS_04720 14045 14848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 15876 14821 gene locus_tag LOCUS_04730 15876 14821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 18773 15879 gene locus_tag LOCUS_04740 18773 15879 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927134.1 protein_id gnl|my_center|LOCUS_04740 16800 16899 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19147 18773 gene locus_tag LOCUS_04750 19147 18773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 21176 19158 gene locus_tag LOCUS_04760 gene recG 21176 19158 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403048.1 protein_id gnl|my_center|LOCUS_04760 22643 21315 gene locus_tag LOCUS_04770 22643 21315 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_04770 <25165 22640 gene locus_tag LOCUS_04780 <25165 22640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933216.1:valine--tRNA ligase >Feature sequence016 1353 787 gene locus_tag LOCUS_04790 1353 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2512 1313 gene locus_tag LOCUS_04800 2512 1313 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933163.1 protein_id gnl|my_center|LOCUS_04800 3500 2523 gene locus_tag LOCUS_04810 gene galE 3500 2523 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984071.1 protein_id gnl|my_center|LOCUS_04810 5495 3504 gene locus_tag LOCUS_04820 gene uvrB 5495 3504 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_04820 6618 5683 gene locus_tag LOCUS_04830 6618 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 9055 6608 gene locus_tag LOCUS_04840 9055 6608 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_04840 9955 9059 gene locus_tag LOCUS_04850 gene ftsY 9955 9059 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081293.1 protein_id gnl|my_center|LOCUS_04850 10530 9961 gene locus_tag LOCUS_04860 gene pgsA 10530 9961 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583815.1 protein_id gnl|my_center|LOCUS_04860 11839 10523 gene locus_tag LOCUS_04870 11839 10523 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986509.1 protein_id gnl|my_center|LOCUS_04870 13115 11832 gene locus_tag LOCUS_04880 13115 11832 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932280.1 protein_id gnl|my_center|LOCUS_04880 14191 13124 gene locus_tag LOCUS_04890 14191 13124 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_04890 15189 14203 gene locus_tag LOCUS_04900 15189 14203 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932877.1 protein_id gnl|my_center|LOCUS_04900 15943 15230 gene locus_tag LOCUS_04910 15943 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 16881 15949 gene locus_tag LOCUS_04920 gene meaB 16881 15949 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_04920 17616 16936 gene locus_tag LOCUS_04930 17616 16936 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_04930 17756 18010 gene locus_tag LOCUS_04940 gene rpsT 17756 18010 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258282.1 protein_id gnl|my_center|LOCUS_04940 19647 18160 gene locus_tag LOCUS_04950 gene guaB 19647 18160 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_04950 21048 19648 gene locus_tag LOCUS_04960 gene hutH 21048 19648 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902906.1 protein_id gnl|my_center|LOCUS_04960 23996 21174 gene locus_tag LOCUS_04970 gene dinG 23996 21174 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398920.1 protein_id gnl|my_center|LOCUS_04970 <25120 23996 gene locus_tag LOCUS_04980 <25120 23996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021498.1:digeranylgeranylglycerophospholipid reductase >Feature sequence017 478 1512 gene locus_tag LOCUS_04990 gene add 478 1512 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256408.1 protein_id gnl|my_center|LOCUS_04990 500 509 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1557 2000 gene locus_tag LOCUS_05000 1557 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 2589 2645 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2736 2811 gene locus_tag LOCUS_t00070 2736 2811 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2983 3546 gene locus_tag LOCUS_05010 2983 3546 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263795.1 protein_id gnl|my_center|LOCUS_05010 3817 3593 gene locus_tag LOCUS_05020 3817 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3978 4580 gene locus_tag LOCUS_05030 3978 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4574 4957 gene locus_tag LOCUS_05040 4574 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5708 5127 gene locus_tag LOCUS_05050 5708 5127 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883143.1 protein_id gnl|my_center|LOCUS_05050 5978 5754 gene locus_tag LOCUS_05060 gene infA 5978 5754 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_05060 6737 6132 gene locus_tag LOCUS_05070 6737 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 6994 8571 gene locus_tag LOCUS_05080 6994 8571 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_05080 8718 10442 gene locus_tag LOCUS_05090 8718 10442 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_05090 10453 11106 gene locus_tag LOCUS_05100 gene rpe 10453 11106 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_05100 11114 11569 gene locus_tag LOCUS_05110 11114 11569 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804783.1 protein_id gnl|my_center|LOCUS_05110 11570 12679 gene locus_tag LOCUS_05120 11570 12679 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_05120 13208 12699 gene locus_tag LOCUS_05130 13208 12699 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_05130 13371 13724 gene locus_tag LOCUS_05140 13371 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 13721 13957 gene locus_tag LOCUS_05150 13721 13957 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932528.1 protein_id gnl|my_center|LOCUS_05150 14635 14734 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14975 16300 gene locus_tag LOCUS_05160 gene nrfD 14975 16300 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_05160 16379 19231 gene locus_tag LOCUS_05170 16379 19231 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_05170 19371 20420 gene locus_tag LOCUS_05180 gene moaA 19371 20420 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933001.1 protein_id gnl|my_center|LOCUS_05180 20440 21381 gene locus_tag LOCUS_05190 gene moaCB 20440 21381 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932998.1 protein_id gnl|my_center|LOCUS_05190 21378 22115 gene locus_tag LOCUS_05200 21378 22115 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084806.1 protein_id gnl|my_center|LOCUS_05200 22112 23335 gene locus_tag LOCUS_05210 22112 23335 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927020.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence018 790 542 gene locus_tag LOCUS_05220 790 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1325 813 gene locus_tag LOCUS_05230 1325 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05230 2106 1333 gene locus_tag LOCUS_05240 2106 1333 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081090.1 protein_id gnl|my_center|LOCUS_05240 3485 2121 gene locus_tag LOCUS_05250 3485 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 4359 3487 gene locus_tag LOCUS_05260 4359 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 5480 4356 gene locus_tag LOCUS_05270 5480 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 5629 6564 gene locus_tag LOCUS_05280 gene phhA 5629 6564 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919486.1 protein_id gnl|my_center|LOCUS_05280 6693 7163 gene locus_tag LOCUS_05290 6693 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 7893 7237 gene locus_tag LOCUS_05300 7893 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 8352 7894 gene locus_tag LOCUS_05310 8352 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 8371 9930 gene locus_tag LOCUS_05320 8371 9930 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_05320 9971 10903 gene locus_tag LOCUS_05330 9971 10903 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_05330 10896 11945 gene locus_tag LOCUS_05340 10896 11945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 13710 12073 gene locus_tag LOCUS_05350 13710 12073 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_05350 13920 14453 gene locus_tag LOCUS_05360 13920 14453 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_05360 14719 16137 gene locus_tag LOCUS_05370 14719 16137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 16005 16104 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16203 16736 gene locus_tag LOCUS_05380 16203 16736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 18355 16784 gene locus_tag LOCUS_05390 18355 16784 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_05390 18950 20191 gene locus_tag LOCUS_05400 gene gdhA 18950 20191 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_05400 20235 20693 gene locus_tag LOCUS_05410 20235 20693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 20809 22569 gene locus_tag LOCUS_05420 gene frdA 20809 22569 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898925.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence019 369 611 gene locus_tag LOCUS_05430 369 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05430 588 597 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 631 1161 gene locus_tag LOCUS_05440 631 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05440 1197 2045 gene locus_tag LOCUS_05450 1197 2045 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_05450 2071 2514 gene locus_tag LOCUS_05460 2071 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2629 3585 gene locus_tag LOCUS_05470 gene mutY 2629 3585 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_05470 3582 4418 gene locus_tag LOCUS_05480 3582 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 4418 5089 gene locus_tag LOCUS_05490 4418 5089 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_05490 5143 6294 gene locus_tag LOCUS_05500 5143 6294 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_05500 6291 6983 gene locus_tag LOCUS_05510 6291 6983 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_05510 6983 7459 gene locus_tag LOCUS_05520 6983 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 8682 7456 gene locus_tag LOCUS_05530 8682 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 9683 8748 gene locus_tag LOCUS_05540 gene mdh 9683 8748 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942112.1 protein_id gnl|my_center|LOCUS_05540 10145 9891 gene locus_tag LOCUS_05550 gene rpmA 10145 9891 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964571.1 protein_id gnl|my_center|LOCUS_05550 10506 10150 gene locus_tag LOCUS_05560 10506 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 12096 10561 gene locus_tag LOCUS_05570 gene rng 12096 10561 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_05570 12579 16139 gene locus_tag LOCUS_05580 gene metH 12579 16139 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453805.1 protein_id gnl|my_center|LOCUS_05580 16129 16734 gene locus_tag LOCUS_05590 16129 16734 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_05590 16778 17560 gene locus_tag LOCUS_05600 16778 17560 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170039298.1 protein_id gnl|my_center|LOCUS_05600 17560 18537 gene locus_tag LOCUS_05610 17560 18537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 18627 19316 gene locus_tag LOCUS_05620 gene radC 18627 19316 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 protein_id gnl|my_center|LOCUS_05620 19255 21300 gene locus_tag LOCUS_05630 19255 21300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence020 956 102 gene locus_tag LOCUS_05640 956 102 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_05640 1183 959 gene locus_tag LOCUS_05650 1183 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2501 1260 gene locus_tag LOCUS_05660 gene xseA 2501 1260 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958100.1 protein_id gnl|my_center|LOCUS_05660 3403 2498 gene locus_tag LOCUS_05670 3403 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 3813 3526 gene locus_tag LOCUS_05680 3813 3526 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986832.1 protein_id gnl|my_center|LOCUS_05680 5154 3844 gene locus_tag LOCUS_05690 5154 3844 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941675.1 protein_id gnl|my_center|LOCUS_05690 5245 5344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6045 5560 gene locus_tag LOCUS_05700 6045 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 7223 6045 gene locus_tag LOCUS_05710 7223 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 7954 7220 gene locus_tag LOCUS_05720 7954 7220 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_05720 9234 7972 gene locus_tag LOCUS_05730 gene serS 9234 7972 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_05730 10939 9362 gene locus_tag LOCUS_05740 10939 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 12443 11112 gene locus_tag LOCUS_05750 12443 11112 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_05750 12868 12668 gene locus_tag LOCUS_05760 12868 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 13641 12856 gene locus_tag LOCUS_05770 13641 12856 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_05770 14784 13720 gene locus_tag LOCUS_05780 14784 13720 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_05780 15900 14797 gene locus_tag LOCUS_05790 15900 14797 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_05790 17357 15900 gene locus_tag LOCUS_05800 17357 15900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 18555 17641 gene locus_tag LOCUS_05810 18555 17641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 20368 19034 gene locus_tag LOCUS_05820 20368 19034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 <20900 20370 gene locus_tag LOCUS_05830 <20900 20370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851485.1:SLBB domain-containing protein >Feature sequence021 694 5 gene locus_tag LOCUS_05840 694 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05840 917 705 gene locus_tag LOCUS_05850 917 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 1704 925 gene locus_tag LOCUS_05860 1704 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 2988 2059 gene locus_tag LOCUS_05870 2988 2059 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_05870 4559 3003 gene locus_tag LOCUS_05880 4559 3003 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_05880 4800 5969 gene locus_tag LOCUS_05890 gene pepP 4800 5969 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693180.1 protein_id gnl|my_center|LOCUS_05890 7710 5962 gene locus_tag LOCUS_05900 7710 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 8330 7767 gene locus_tag LOCUS_05910 8330 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 8917 8336 gene locus_tag LOCUS_05920 8917 8336 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_05920 9902 8910 gene locus_tag LOCUS_05930 9902 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 11364 9907 gene locus_tag LOCUS_05940 gene putP 11364 9907 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 protein_id gnl|my_center|LOCUS_05940 12130 11366 gene locus_tag LOCUS_05950 12130 11366 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121390.1 protein_id gnl|my_center|LOCUS_05950 12806 12180 gene locus_tag LOCUS_05960 gene pgeF 12806 12180 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897820.1 protein_id gnl|my_center|LOCUS_05960 14586 12895 gene locus_tag LOCUS_05970 14586 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 16719 14881 gene locus_tag LOCUS_05980 gene glmS 16719 14881 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_05980 18289 16745 gene locus_tag LOCUS_05990 gene guaA 18289 16745 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404803.1 protein_id gnl|my_center|LOCUS_05990 19055 18276 gene locus_tag LOCUS_06000 gene surE 19055 18276 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_06000 19659 19048 gene locus_tag LOCUS_06010 19659 19048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06010 >Feature sequence022 1612 989 gene locus_tag LOCUS_06020 1612 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 2487 1609 gene locus_tag LOCUS_06030 gene lipA 2487 1609 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061389.1 protein_id gnl|my_center|LOCUS_06030 3755 2490 gene locus_tag LOCUS_06040 3755 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 5773 3755 gene locus_tag LOCUS_06050 5773 3755 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_06050 6460 5777 gene locus_tag LOCUS_06060 6460 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7850 6453 gene locus_tag LOCUS_06070 gene lpdA 7850 6453 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_06070 8722 7862 gene locus_tag LOCUS_06080 8722 7862 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_06080 9297 8722 gene locus_tag LOCUS_06090 gene folE 9297 8722 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633832.1 protein_id gnl|my_center|LOCUS_06090 9995 9294 gene locus_tag LOCUS_06100 9995 9294 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839717.1 protein_id gnl|my_center|LOCUS_06100 10402 9995 gene locus_tag LOCUS_06110 10402 9995 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_06110 11131 10490 gene locus_tag LOCUS_06120 gene nth 11131 10490 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_06120 11496 11134 gene locus_tag LOCUS_06130 11496 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 11920 11489 gene locus_tag LOCUS_06140 11920 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 12944 11904 gene locus_tag LOCUS_06150 12944 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 13420 12944 gene locus_tag LOCUS_06160 13420 12944 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125105.1 protein_id gnl|my_center|LOCUS_06160 14231 13509 gene locus_tag LOCUS_06170 14231 13509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 14773 14237 gene locus_tag LOCUS_06180 14773 14237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 16845 14791 gene locus_tag LOCUS_06190 16845 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 19747 16934 gene locus_tag LOCUS_06200 19747 16934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence023 1893 301 gene locus_tag LOCUS_06210 1893 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3057 1894 gene locus_tag LOCUS_06220 3057 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3796 3065 gene locus_tag LOCUS_06230 3796 3065 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_06230 3983 7135 gene locus_tag LOCUS_06240 3983 7135 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_06240 7304 8554 gene locus_tag LOCUS_06250 gene radA 7304 8554 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_06250 8591 9721 gene locus_tag LOCUS_06260 gene tgt 8591 9721 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583954.1 protein_id gnl|my_center|LOCUS_06260 9714 10178 gene locus_tag LOCUS_06270 9714 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 11399 10179 gene locus_tag LOCUS_06280 11399 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 12035 11415 gene locus_tag LOCUS_06290 12035 11415 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949054.1 protein_id gnl|my_center|LOCUS_06290 13185 12040 gene locus_tag LOCUS_06300 13185 12040 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258372.1 protein_id gnl|my_center|LOCUS_06300 13386 13213 gene locus_tag LOCUS_06310 13386 13213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06310 14600 13614 gene locus_tag LOCUS_06320 14600 13614 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674020.1 protein_id gnl|my_center|LOCUS_06320 15701 14613 gene locus_tag LOCUS_06330 gene hppD 15701 14613 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_06330 16811 15726 gene locus_tag LOCUS_06340 gene hisC 16811 15726 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_06340 18289 16883 gene locus_tag LOCUS_06350 18289 16883 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_06350 18469 19431 gene locus_tag LOCUS_06360 18469 19431 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958609.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence024 2381 66 gene locus_tag LOCUS_06370 gene xdhB 2381 66 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_06370 3837 2368 gene locus_tag LOCUS_06380 gene xdhA 3837 2368 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528241.1 protein_id gnl|my_center|LOCUS_06380 4291 3818 gene locus_tag LOCUS_06390 4291 3818 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387043.1 protein_id gnl|my_center|LOCUS_06390 4456 4381 gene locus_tag LOCUS_t00080 4456 4381 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4677 5342 gene locus_tag LOCUS_06400 4677 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 5418 11747 gene locus_tag LOCUS_06410 5418 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 11757 12695 gene locus_tag LOCUS_06420 11757 12695 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_06420 12692 13567 gene locus_tag LOCUS_06430 12692 13567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 13564 15171 gene locus_tag LOCUS_06440 13564 15171 CDS product FlgD immunoglobulin-like domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838502.1 protein_id gnl|my_center|LOCUS_06440 15144 16100 gene locus_tag LOCUS_06450 15144 16100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 16100 17008 gene locus_tag LOCUS_06460 16100 17008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 17005 17811 gene locus_tag LOCUS_06470 17005 17811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence025 2103 688 gene locus_tag LOCUS_06480 2103 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 3081 2248 gene locus_tag LOCUS_06490 3081 2248 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_06490 3203 3302 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4152 3403 gene locus_tag LOCUS_06500 gene recO 4152 3403 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 protein_id gnl|my_center|LOCUS_06500 5668 4193 gene locus_tag LOCUS_06510 gene proS 5668 4193 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_06510 5721 6533 gene locus_tag LOCUS_06520 5721 6533 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 protein_id gnl|my_center|LOCUS_06520 6620 7435 gene locus_tag LOCUS_06530 6620 7435 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087856.1 protein_id gnl|my_center|LOCUS_06530 7432 8829 gene locus_tag LOCUS_06540 gene mgtE 7432 8829 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 protein_id gnl|my_center|LOCUS_06540 8836 9960 gene locus_tag LOCUS_06550 8836 9960 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129003072.1 protein_id gnl|my_center|LOCUS_06550 9957 11099 gene locus_tag LOCUS_06560 9957 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 11151 11552 gene locus_tag LOCUS_06570 11151 11552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 14806 11573 gene locus_tag LOCUS_06580 gene carB 14806 11573 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_06580 15567 14809 gene locus_tag LOCUS_06590 15567 14809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 16400 15564 gene locus_tag LOCUS_06600 16400 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 17326 16406 gene locus_tag LOCUS_06610 17326 16406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207738.1 protein_id gnl|my_center|LOCUS_06610 18429 17323 gene locus_tag LOCUS_06620 gene carA 18429 17323 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence026 1044 2459 gene locus_tag LOCUS_06630 1044 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 3527 2436 gene locus_tag LOCUS_06640 gene lptG 3527 2436 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_06640 3714 5336 gene locus_tag LOCUS_06650 3714 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 6570 5368 gene locus_tag LOCUS_06660 6570 5368 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_06660 6684 7598 gene locus_tag LOCUS_06670 gene murQ 6684 7598 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837885.1 protein_id gnl|my_center|LOCUS_06670 7585 8715 gene locus_tag LOCUS_06680 7585 8715 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405142.1 protein_id gnl|my_center|LOCUS_06680 8728 10098 gene locus_tag LOCUS_06690 8728 10098 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_06690 10091 11065 gene locus_tag LOCUS_06700 10091 11065 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931948.1 protein_id gnl|my_center|LOCUS_06700 11070 12119 gene locus_tag LOCUS_06710 11070 12119 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_06710 12201 12761 gene locus_tag LOCUS_06720 12201 12761 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062451.1 protein_id gnl|my_center|LOCUS_06720 13418 12762 gene locus_tag LOCUS_06730 gene rnc 13418 12762 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933773.1 protein_id gnl|my_center|LOCUS_06730 14727 13483 gene locus_tag LOCUS_06740 gene fabF 14727 13483 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_06740 14964 14731 gene locus_tag LOCUS_06750 14964 14731 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830184.1 protein_id gnl|my_center|LOCUS_06750 15723 14980 gene locus_tag LOCUS_06760 gene fabG 15723 14980 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_06760 16591 15716 gene locus_tag LOCUS_06770 gene fabD 16591 15716 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933769.1 protein_id gnl|my_center|LOCUS_06770 17640 16639 gene locus_tag LOCUS_06780 17640 16639 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933768.1 protein_id gnl|my_center|LOCUS_06780 18653 17640 gene locus_tag LOCUS_06790 gene plsX 18653 17640 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence027 105 200 gene locus_tag LOCUS_t00090 105 200 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 365 880 gene locus_tag LOCUS_06800 365 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 1199 882 gene locus_tag LOCUS_06810 1199 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 1375 2490 gene locus_tag LOCUS_06820 1375 2490 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933368.1 protein_id gnl|my_center|LOCUS_06820 2430 4841 gene locus_tag LOCUS_06830 2430 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 5925 4861 gene locus_tag LOCUS_06840 gene add 5925 4861 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838307.1 protein_id gnl|my_center|LOCUS_06840 7837 5930 gene locus_tag LOCUS_06850 7837 5930 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_06850 8030 10315 gene locus_tag LOCUS_06860 8030 10315 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_06860 10471 13191 gene locus_tag LOCUS_06870 gene polA 10471 13191 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404381.1 protein_id gnl|my_center|LOCUS_06870 13316 14239 gene locus_tag LOCUS_06880 13316 14239 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940689.1 protein_id gnl|my_center|LOCUS_06880 14239 14964 gene locus_tag LOCUS_06890 14239 14964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 14961 15422 gene locus_tag LOCUS_06900 14961 15422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 15415 16377 gene locus_tag LOCUS_06910 15415 16377 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922076.1 protein_id gnl|my_center|LOCUS_06910 16370 17479 gene locus_tag LOCUS_06920 gene alr 16370 17479 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_06920 17499 17598 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence028 <1 1237 gene locus_tag LOCUS_06930 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021623.1:tetratricopeptide repeat protein 1320 2000 gene locus_tag LOCUS_06940 1320 2000 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249637.1 protein_id gnl|my_center|LOCUS_06940 1993 2361 gene locus_tag LOCUS_06950 gene acpS 1993 2361 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873555.1 protein_id gnl|my_center|LOCUS_06950 2358 3902 gene locus_tag LOCUS_06960 2358 3902 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_06960 2580 2619 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3889 4242 gene locus_tag LOCUS_06970 3889 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 4245 5498 gene locus_tag LOCUS_06980 gene murA 4245 5498 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_06980 5585 5676 gene locus_tag LOCUS_t00100 5585 5676 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5790 5878 gene locus_tag LOCUS_t00110 5790 5878 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5935 7380 gene locus_tag LOCUS_06990 gene gltX 5935 7380 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_06990 7377 9059 gene locus_tag LOCUS_07000 7377 9059 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_07000 9102 10427 gene locus_tag LOCUS_07010 9102 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 10439 10921 gene locus_tag LOCUS_07020 10439 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 10939 12858 gene locus_tag LOCUS_07030 10939 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 13014 13214 gene locus_tag LOCUS_07040 13014 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 13362 14597 gene locus_tag LOCUS_07050 13362 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 14731 14802 gene locus_tag LOCUS_t00120 14731 14802 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14806 14878 gene locus_tag LOCUS_t00130 14806 14878 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14890 14962 gene locus_tag LOCUS_t00140 14890 14962 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15026 15370 gene locus_tag LOCUS_07060 15026 15370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 15891 15990 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence029 2088 19 gene locus_tag LOCUS_07070 2088 19 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_07070 3745 2057 gene locus_tag LOCUS_07080 3745 2057 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021312.1 protein_id gnl|my_center|LOCUS_07080 6559 3764 gene locus_tag LOCUS_07090 gene cphA 6559 3764 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021315.1 protein_id gnl|my_center|LOCUS_07090 7419 6586 gene locus_tag LOCUS_07100 7419 6586 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016692.1 protein_id gnl|my_center|LOCUS_07100 8322 7576 gene locus_tag LOCUS_07110 8322 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 9417 8338 gene locus_tag LOCUS_07120 9417 8338 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172812.1 protein_id gnl|my_center|LOCUS_07120 9620 9417 gene locus_tag LOCUS_07130 9620 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 9682 9781 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11747 10203 gene locus_tag LOCUS_07140 11747 10203 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_07140 12154 11744 gene locus_tag LOCUS_07150 12154 11744 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_07150 12361 13164 gene locus_tag LOCUS_07160 12361 13164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 13283 14737 gene locus_tag LOCUS_07170 13283 14737 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224909.1 protein_id gnl|my_center|LOCUS_07170 14780 16189 gene locus_tag LOCUS_07180 14780 16189 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869171.1 protein_id gnl|my_center|LOCUS_07180 16218 17606 gene locus_tag LOCUS_07190 gene hydA 16218 17606 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence030 1635 379 gene locus_tag LOCUS_07200 gene ahcY 1635 379 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_07200 2860 1655 gene locus_tag LOCUS_07210 gene metK 2860 1655 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_07210 3845 2937 gene locus_tag LOCUS_07220 3845 2937 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_07220 4146 3856 gene locus_tag LOCUS_07230 4146 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 5765 4143 gene locus_tag LOCUS_07240 gene pckA 5765 4143 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148872.1 protein_id gnl|my_center|LOCUS_07240 6716 5781 gene locus_tag LOCUS_07250 gene xerC 6716 5781 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_07250 7668 6709 gene locus_tag LOCUS_07260 7668 6709 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_07260 8141 7671 gene locus_tag LOCUS_07270 gene lspA 8141 7671 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724127.1 protein_id gnl|my_center|LOCUS_07270 8532 8146 gene locus_tag LOCUS_07280 8532 8146 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926834.1 protein_id gnl|my_center|LOCUS_07280 11693 8535 gene locus_tag LOCUS_07290 gene ileS 11693 8535 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 protein_id gnl|my_center|LOCUS_07290 13282 11873 gene locus_tag LOCUS_07300 13282 11873 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_07300 <17590 13398 gene locus_tag LOCUS_07310 <17590 13398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence031 <1 1600 gene locus_tag LOCUS_07320 <1 1600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928901.1:TonB-dependent receptor 3333 1597 gene locus_tag LOCUS_07330 3333 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3938 3330 gene locus_tag LOCUS_07340 3938 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 4827 3859 gene locus_tag LOCUS_07350 4827 3859 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_07350 5033 5461 gene locus_tag LOCUS_07360 5033 5461 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_07360 5488 6927 gene locus_tag LOCUS_07370 gene rtcB 5488 6927 CDS product RNA ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228915.1 protein_id gnl|my_center|LOCUS_07370 6975 8558 gene locus_tag LOCUS_07380 6975 8558 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_07380 9399 8575 gene locus_tag LOCUS_07390 9399 8575 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_07390 10261 9401 gene locus_tag LOCUS_07400 10261 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 10932 10261 gene locus_tag LOCUS_07410 10932 10261 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942031.1 protein_id gnl|my_center|LOCUS_07410 11107 10907 gene locus_tag LOCUS_07420 11107 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 13177 11189 gene locus_tag LOCUS_07430 gene feoB 13177 11189 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_07430 13614 13174 gene locus_tag LOCUS_07440 13614 13174 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930868.1 protein_id gnl|my_center|LOCUS_07440 15972 13807 gene locus_tag LOCUS_07450 gene pcrA 15972 13807 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 protein_id gnl|my_center|LOCUS_07450 17019 15973 gene locus_tag LOCUS_07460 gene mltG 17019 15973 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545006.1 protein_id gnl|my_center|LOCUS_07460 17097 17384 gene locus_tag LOCUS_07470 17097 17384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence032 1522 212 gene locus_tag LOCUS_07480 1522 212 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_07480 3099 1528 gene locus_tag LOCUS_07490 gene serA 3099 1528 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_07490 4169 3099 gene locus_tag LOCUS_07500 4169 3099 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_07500 5392 4172 gene locus_tag LOCUS_07510 5392 4172 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_07510 5559 5948 gene locus_tag LOCUS_07520 5559 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 5987 6649 gene locus_tag LOCUS_07530 5987 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 7692 7165 gene locus_tag LOCUS_07540 7692 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 7698 9680 gene locus_tag LOCUS_07550 7698 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 9667 10461 gene locus_tag LOCUS_07560 9667 10461 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_07560 10633 11553 gene locus_tag LOCUS_07570 10633 11553 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787859.1 protein_id gnl|my_center|LOCUS_07570 11543 11983 gene locus_tag LOCUS_07580 11543 11983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 12057 12911 gene locus_tag LOCUS_07590 12057 12911 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_07590 13406 13783 gene locus_tag LOCUS_07600 13406 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 13776 15590 gene locus_tag LOCUS_07610 13776 15590 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_07610 15593 16726 gene locus_tag LOCUS_07620 15593 16726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence033 170 940 gene locus_tag LOCUS_07630 170 940 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_07630 960 2255 gene locus_tag LOCUS_07640 960 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_07640 2630 3583 gene locus_tag LOCUS_07650 2630 3583 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932928.1 protein_id gnl|my_center|LOCUS_07650 3573 4763 gene locus_tag LOCUS_07660 3573 4763 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_07660 4766 5914 gene locus_tag LOCUS_07670 4766 5914 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_07670 5911 6966 gene locus_tag LOCUS_07680 5911 6966 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_07680 7207 7653 gene locus_tag LOCUS_07690 gene nusB 7207 7653 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402806.1 protein_id gnl|my_center|LOCUS_07690 7678 10692 gene locus_tag LOCUS_07700 gene secA 7678 10692 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_07700 10907 14425 gene locus_tag LOCUS_07710 10907 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 14526 14610 gene locus_tag LOCUS_t00150 14526 14610 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14703 15566 gene locus_tag LOCUS_07720 14703 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 15566 16210 gene locus_tag LOCUS_07730 15566 16210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 16212 16997 gene locus_tag LOCUS_07740 16212 16997 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence034 1961 900 gene locus_tag LOCUS_07750 1961 900 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101281.1 protein_id gnl|my_center|LOCUS_07750 3007 1961 gene locus_tag LOCUS_07760 3007 1961 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808446.1 protein_id gnl|my_center|LOCUS_07760 4554 2998 gene locus_tag LOCUS_07770 4554 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 5957 4551 gene locus_tag LOCUS_07780 5957 4551 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_07780 8368 5954 gene locus_tag LOCUS_07790 8368 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 8617 9897 gene locus_tag LOCUS_07800 gene eno 8617 9897 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815650.1 protein_id gnl|my_center|LOCUS_07800 9930 10232 gene locus_tag LOCUS_07810 9930 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 10832 10245 gene locus_tag LOCUS_07820 10832 10245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 11535 10822 gene locus_tag LOCUS_07830 11535 10822 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895795.1 protein_id gnl|my_center|LOCUS_07830 12351 11542 gene locus_tag LOCUS_07840 12351 11542 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_07840 12847 12395 gene locus_tag LOCUS_07850 gene dtd 12847 12395 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_07850 16291 12851 gene locus_tag LOCUS_07860 gene dnaE 16291 12851 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence035 1270 392 gene locus_tag LOCUS_07870 gene prmC 1270 392 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_07870 2331 1267 gene locus_tag LOCUS_07880 gene prfA 2331 1267 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_07880 2622 2407 gene locus_tag LOCUS_07890 gene rpmE 2622 2407 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_07890 3812 2619 gene locus_tag LOCUS_07900 3812 2619 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_07900 4791 3838 gene locus_tag LOCUS_07910 4791 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 6087 4840 gene locus_tag LOCUS_07920 gene rho 6087 4840 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_07920 7465 6197 gene locus_tag LOCUS_07930 7465 6197 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544919.1 protein_id gnl|my_center|LOCUS_07930 8295 7489 gene locus_tag LOCUS_07940 gene murI 8295 7489 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_07940 9824 8304 gene locus_tag LOCUS_07950 9824 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 11581 9824 gene locus_tag LOCUS_07960 11581 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 13159 11819 gene locus_tag LOCUS_07970 gene preA 13159 11819 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_07970 14550 13171 gene locus_tag LOCUS_07980 14550 13171 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114904.1 protein_id gnl|my_center|LOCUS_07980 15861 14569 gene locus_tag LOCUS_07990 15861 14569 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_07990 16749 15883 gene locus_tag LOCUS_08000 16749 15883 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence036 1746 733 gene locus_tag LOCUS_08010 gene rfbB 1746 733 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_08010 2228 1746 gene locus_tag LOCUS_08020 2228 1746 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242881.1 protein_id gnl|my_center|LOCUS_08020 3541 2225 gene locus_tag LOCUS_08030 3541 2225 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_08030 5752 3611 gene locus_tag LOCUS_08040 5752 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 6767 5772 gene locus_tag LOCUS_08050 gene tsaD 6767 5772 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_08050 7744 6764 gene locus_tag LOCUS_08060 7744 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 9768 7780 gene locus_tag LOCUS_08070 9768 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 10449 9793 gene locus_tag LOCUS_08080 gene cmk 10449 9793 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357612.1 protein_id gnl|my_center|LOCUS_08080 11309 10557 gene locus_tag LOCUS_08090 11309 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 11877 11278 gene locus_tag LOCUS_08100 gene scpB 11877 11278 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932165.1 protein_id gnl|my_center|LOCUS_08100 12602 11877 gene locus_tag LOCUS_08110 12602 11877 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931830.1 protein_id gnl|my_center|LOCUS_08110 13576 12599 gene locus_tag LOCUS_08120 gene trpS 13576 12599 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_08120 13824 13573 gene locus_tag LOCUS_08130 13824 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 14951 14133 gene locus_tag LOCUS_08140 14951 14133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 >Feature sequence037 894 124 gene locus_tag LOCUS_08150 894 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1068 895 gene locus_tag LOCUS_08160 1068 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1390 1190 gene locus_tag LOCUS_08170 1390 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1694 1380 gene locus_tag LOCUS_08180 1694 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 2296 1703 gene locus_tag LOCUS_08190 2296 1703 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_08190 4207 2303 gene locus_tag LOCUS_08200 gene ctaD 4207 2303 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577418.1 protein_id gnl|my_center|LOCUS_08200 5006 4275 gene locus_tag LOCUS_08210 5006 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 6003 5053 gene locus_tag LOCUS_08220 6003 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 6877 6128 gene locus_tag LOCUS_08230 6877 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 7664 6921 gene locus_tag LOCUS_08240 7664 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 9338 7680 gene locus_tag LOCUS_08250 9338 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 9820 9365 gene locus_tag LOCUS_08260 9820 9365 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_08260 10764 10048 gene locus_tag LOCUS_08270 10764 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 13846 10841 gene locus_tag LOCUS_08280 13846 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 14970 13855 gene locus_tag LOCUS_08290 14970 13855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence038 2030 957 gene locus_tag LOCUS_08300 2030 957 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 protein_id gnl|my_center|LOCUS_08300 2904 2032 gene locus_tag LOCUS_08310 2904 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 3654 2938 gene locus_tag LOCUS_08320 3654 2938 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_08320 4541 3651 gene locus_tag LOCUS_08330 gene rfbD 4541 3651 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_08330 5774 4596 gene locus_tag LOCUS_08340 5774 4596 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_08340 7867 5771 gene locus_tag LOCUS_08350 gene rnr 7867 5771 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_08350 9234 7867 gene locus_tag LOCUS_08360 9234 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 12589 9221 gene locus_tag LOCUS_08370 12589 9221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 13496 12582 gene locus_tag LOCUS_08380 13496 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 14262 13480 gene locus_tag LOCUS_08390 gene lgt 14262 13480 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence039 <1 1560 gene locus_tag LOCUS_08400 <1 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase 1965 3617 gene locus_tag LOCUS_08410 1965 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 3622 4788 gene locus_tag LOCUS_08420 3622 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 4798 6924 gene locus_tag LOCUS_08430 4798 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 6996 8339 gene locus_tag LOCUS_08440 gene dacB 6996 8339 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957323.1 protein_id gnl|my_center|LOCUS_08440 8589 9455 gene locus_tag LOCUS_08450 8589 9455 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896305.1 protein_id gnl|my_center|LOCUS_08450 9683 9480 gene locus_tag LOCUS_08460 9683 9480 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643615.1 protein_id gnl|my_center|LOCUS_08460 10392 9694 gene locus_tag LOCUS_08470 10392 9694 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_08470 10422 11099 gene locus_tag LOCUS_08480 10422 11099 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428832.1 protein_id gnl|my_center|LOCUS_08480 11099 12067 gene locus_tag LOCUS_08490 11099 12067 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_08490 12454 12071 gene locus_tag LOCUS_08500 gene apaG 12454 12071 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970890.1 protein_id gnl|my_center|LOCUS_08500 <14219 12567 gene locus_tag LOCUS_08510 <14219 12567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_119597939.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence040 330 1304 gene locus_tag LOCUS_08520 gene waaF 330 1304 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197552.1 protein_id gnl|my_center|LOCUS_08520 1360 2094 gene locus_tag LOCUS_08530 1360 2094 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 protein_id gnl|my_center|LOCUS_08530 3064 2105 gene locus_tag LOCUS_08540 3064 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 3557 3087 gene locus_tag LOCUS_08550 3557 3087 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_08550 3798 5069 gene locus_tag LOCUS_08560 3798 5069 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_08560 5197 6384 gene locus_tag LOCUS_08570 5197 6384 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922349.1 protein_id gnl|my_center|LOCUS_08570 6406 7425 gene locus_tag LOCUS_08580 6406 7425 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038292.1 protein_id gnl|my_center|LOCUS_08580 8801 7422 gene locus_tag LOCUS_08590 8801 7422 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898767.1 protein_id gnl|my_center|LOCUS_08590 9433 8798 gene locus_tag LOCUS_08600 9433 8798 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202076.1 protein_id gnl|my_center|LOCUS_08600 11226 9421 gene locus_tag LOCUS_08610 11226 9421 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_08610 11420 13756 gene locus_tag LOCUS_08620 11420 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 13746 14084 gene locus_tag LOCUS_08630 13746 14084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence041 <1 501 gene locus_tag LOCUS_08640 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141486.1:rod shape-determining protein RodA 597 1370 gene locus_tag LOCUS_08650 597 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1405 2244 gene locus_tag LOCUS_08660 1405 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2350 3546 gene locus_tag LOCUS_08670 2350 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 3533 4804 gene locus_tag LOCUS_08680 3533 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4813 6093 gene locus_tag LOCUS_08690 4813 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 6135 7454 gene locus_tag LOCUS_08700 6135 7454 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933254.1 protein_id gnl|my_center|LOCUS_08700 7481 8338 gene locus_tag LOCUS_08710 7481 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 8322 9335 gene locus_tag LOCUS_08720 8322 9335 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_08720 9401 11422 gene locus_tag LOCUS_08730 9401 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 11590 13008 gene locus_tag LOCUS_08740 11590 13008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence042 1786 1859 gene locus_tag LOCUS_t00160 1786 1859 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1927 2526 gene locus_tag LOCUS_08750 1927 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2843 2520 gene locus_tag LOCUS_08760 2843 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2921 2995 gene locus_tag LOCUS_t00170 2921 2995 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3184 3897 gene locus_tag LOCUS_08770 3184 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927023.1 protein_id gnl|my_center|LOCUS_08770 4328 6037 gene locus_tag LOCUS_08780 gene recJ 4328 6037 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_08780 6034 7023 gene locus_tag LOCUS_08790 6034 7023 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_08790 7031 8200 gene locus_tag LOCUS_08800 gene acdA 7031 8200 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_08800 8204 10555 gene locus_tag LOCUS_08810 8204 10555 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964604.1 protein_id gnl|my_center|LOCUS_08810 10552 10986 gene locus_tag LOCUS_08820 10552 10986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 10983 12251 gene locus_tag LOCUS_08830 10983 12251 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080781.1 protein_id gnl|my_center|LOCUS_08830 12238 13011 gene locus_tag LOCUS_08840 gene mazG 12238 13011 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence043 11 580 gene locus_tag LOCUS_08850 11 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 685 1047 gene locus_tag LOCUS_08860 685 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1135 1210 gene locus_tag LOCUS_t00180 1135 1210 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1240 2631 gene locus_tag LOCUS_08870 1240 2631 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862691.1 protein_id gnl|my_center|LOCUS_08870 2732 3193 gene locus_tag LOCUS_08880 2732 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 3285 3947 gene locus_tag LOCUS_08890 3285 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3954 4541 gene locus_tag LOCUS_08900 3954 4541 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_08900 4585 4660 gene locus_tag LOCUS_t00190 4585 4660 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4727 7165 gene locus_tag LOCUS_08910 gene leuS 4727 7165 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_08910 8232 7225 gene locus_tag LOCUS_08920 8232 7225 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_08920 8987 8232 gene locus_tag LOCUS_08930 8987 8232 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_08930 9706 9044 gene locus_tag LOCUS_08940 9706 9044 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399300.1 protein_id gnl|my_center|LOCUS_08940 10973 9711 gene locus_tag LOCUS_08950 10973 9711 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_08950 11427 10975 gene locus_tag LOCUS_08960 11427 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 12032 11436 gene locus_tag LOCUS_08970 gene lexA 12032 11436 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582447.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence044 <1 1738 gene locus_tag LOCUS_08980 <1 1738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963312.1:DNA-directed RNA polymerase subunit beta note possible pseudo, frameshifted 1696 1715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1728 2711 gene locus_tag LOCUS_08990 1728 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08990 2728 2737 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2801 3343 gene locus_tag LOCUS_09000 2801 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09000 3361 7674 gene locus_tag LOCUS_09010 gene rpoC 3361 7674 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_09010 6433 6442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7697 8068 gene locus_tag LOCUS_09020 gene rpsL 7697 8068 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_09020 8079 8549 gene locus_tag LOCUS_09030 gene rpsG 8079 8549 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081843.1 protein_id gnl|my_center|LOCUS_09030 8546 10636 gene locus_tag LOCUS_09040 gene fusA 8546 10636 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_09040 10655 11845 gene locus_tag LOCUS_09050 gene tuf 10655 11845 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence045 256 636 gene locus_tag LOCUS_09060 256 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 798 711 gene locus_tag LOCUS_t00200 798 711 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1639 875 gene locus_tag LOCUS_09070 1639 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 3884 1944 gene locus_tag LOCUS_09080 3884 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 10951 3815 gene locus_tag LOCUS_09090 10951 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3974 4073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence046 1177 227 gene locus_tag LOCUS_09100 1177 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2949 1174 gene locus_tag LOCUS_09110 2949 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3526 2954 gene locus_tag LOCUS_09120 3526 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3969 3523 gene locus_tag LOCUS_09130 3969 3523 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_09130 4697 4077 gene locus_tag LOCUS_09140 4697 4077 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812732.1 protein_id gnl|my_center|LOCUS_09140 5947 4694 gene locus_tag LOCUS_09150 5947 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_09150 7863 5944 gene locus_tag LOCUS_09160 7863 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 11276 7860 gene locus_tag LOCUS_09170 11276 7860 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence047 2289 751 gene locus_tag LOCUS_09180 2289 751 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_09180 2490 2293 gene locus_tag LOCUS_09190 2490 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 2945 2496 gene locus_tag LOCUS_09200 2945 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 4041 2950 gene locus_tag LOCUS_09210 gene ispG 4041 2950 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886567.1 protein_id gnl|my_center|LOCUS_09210 5237 4092 gene locus_tag LOCUS_09220 5237 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6982 5282 gene locus_tag LOCUS_09230 6982 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 7082 7726 gene locus_tag LOCUS_09240 7082 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 8553 7732 gene locus_tag LOCUS_09250 8553 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 8758 8561 gene locus_tag LOCUS_09260 8758 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 10143 9070 gene locus_tag LOCUS_09270 gene rlmN 10143 9070 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_09270 10807 10148 gene locus_tag LOCUS_09280 10807 10148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence048 155 397 gene locus_tag LOCUS_09290 155 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 425 856 gene locus_tag LOCUS_09300 425 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 907 2334 gene locus_tag LOCUS_09310 907 2334 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_09310 2402 3280 gene locus_tag LOCUS_09320 2402 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3284 4078 gene locus_tag LOCUS_09330 3284 4078 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225423.1 protein_id gnl|my_center|LOCUS_09330 4207 5064 gene locus_tag LOCUS_09340 4207 5064 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444000.1 protein_id gnl|my_center|LOCUS_09340 5077 5499 gene locus_tag LOCUS_09350 5077 5499 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140739.1 protein_id gnl|my_center|LOCUS_09350 5499 6677 gene locus_tag LOCUS_09360 gene thiI 5499 6677 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_09360 6704 7021 gene locus_tag LOCUS_09370 6704 7021 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120685.1 protein_id gnl|my_center|LOCUS_09370 7080 7781 gene locus_tag LOCUS_09380 7080 7781 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_09380 7857 8174 gene locus_tag LOCUS_09390 gene glpE 7857 8174 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957677.1 protein_id gnl|my_center|LOCUS_09390 8334 8636 gene locus_tag LOCUS_09400 8334 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 9485 8643 gene locus_tag LOCUS_09410 9485 8643 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_09410 9646 10074 gene locus_tag LOCUS_09420 9646 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence049 778 305 gene locus_tag LOCUS_09430 778 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 2394 1255 gene locus_tag LOCUS_09440 2394 1255 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804855.1 protein_id gnl|my_center|LOCUS_09440 2604 4934 gene locus_tag LOCUS_09450 2604 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 5911 5204 gene locus_tag LOCUS_09460 5911 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 7412 6450 gene locus_tag LOCUS_09470 7412 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 9399 8170 gene locus_tag LOCUS_09480 9399 8170 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence050 760 2631 gene locus_tag LOCUS_09490 760 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2679 3917 gene locus_tag LOCUS_09500 2679 3917 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_09500 3866 5059 gene locus_tag LOCUS_09510 3866 5059 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403619.1 protein_id gnl|my_center|LOCUS_09510 5066 6583 gene locus_tag LOCUS_09520 gene metG 5066 6583 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_09520 6608 6943 gene locus_tag LOCUS_09530 6608 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09530 7057 7818 gene locus_tag LOCUS_09540 7057 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 7815 8606 gene locus_tag LOCUS_09550 gene rsmA 7815 8606 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768067.1 protein_id gnl|my_center|LOCUS_09550 8724 9560 gene locus_tag LOCUS_09560 8724 9560 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence051 58 465 gene locus_tag LOCUS_09570 58 465 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_09570 462 1175 gene locus_tag LOCUS_09580 462 1175 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879601.1 protein_id gnl|my_center|LOCUS_09580 1168 1560 gene locus_tag LOCUS_09590 1168 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1748 3106 gene locus_tag LOCUS_09600 1748 3106 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_09600 3110 3661 gene locus_tag LOCUS_09610 3110 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3753 4028 gene locus_tag LOCUS_09620 3753 4028 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_09620 5883 4045 gene locus_tag LOCUS_09630 5883 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 5974 6999 gene locus_tag LOCUS_09640 5974 6999 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_09640 8598 7018 gene locus_tag LOCUS_09650 8598 7018 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_09650 8847 8856 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9084 9093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9196 9123 gene locus_tag LOCUS_t00210 9196 9123 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9675 10574 gene locus_tag LOCUS_09660 9675 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence052 246 863 gene locus_tag LOCUS_09670 gene tmk 246 863 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583153.1 protein_id gnl|my_center|LOCUS_09670 860 2503 gene locus_tag LOCUS_09680 860 2503 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403544.1 protein_id gnl|my_center|LOCUS_09680 2594 2668 gene locus_tag LOCUS_t00220 2594 2668 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2699 4633 gene locus_tag LOCUS_09690 gene thrS 2699 4633 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_09690 4711 5133 gene locus_tag LOCUS_09700 gene infC 4711 5133 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_09700 5345 5692 gene locus_tag LOCUS_09710 gene rplT 5345 5692 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256290.1 protein_id gnl|my_center|LOCUS_09710 5823 6845 gene locus_tag LOCUS_09720 gene pheS 5823 6845 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933784.1 protein_id gnl|my_center|LOCUS_09720 6842 8872 gene locus_tag LOCUS_09730 gene pheT 6842 8872 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405510.1 protein_id gnl|my_center|LOCUS_09730 8875 9057 gene locus_tag LOCUS_09740 8875 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 9068 9367 gene locus_tag LOCUS_09750 9068 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 9420 10319 gene locus_tag LOCUS_09760 9420 10319 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903030.1 protein_id gnl|my_center|LOCUS_09760 10328 10402 gene locus_tag LOCUS_t00230 10328 10402 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence053 2124 1 gene locus_tag LOCUS_09770 2124 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 2478 2577 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3336 2818 gene locus_tag LOCUS_09780 3336 2818 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231280.1 protein_id gnl|my_center|LOCUS_09780 3990 3361 gene locus_tag LOCUS_09790 3990 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5020 4004 gene locus_tag LOCUS_09800 5020 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 6047 5109 gene locus_tag LOCUS_09810 6047 5109 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969990.1 protein_id gnl|my_center|LOCUS_09810 6304 6053 gene locus_tag LOCUS_09820 6304 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 6495 6301 gene locus_tag LOCUS_09830 6495 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 6790 6485 gene locus_tag LOCUS_09840 6790 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 7393 6800 gene locus_tag LOCUS_09850 7393 6800 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_09850 9250 7397 gene locus_tag LOCUS_09860 gene ctaD 9250 7397 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577418.1 protein_id gnl|my_center|LOCUS_09860 <10269 9400 gene locus_tag LOCUS_09870 <10269 9400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013062574.1:heme o synthase >Feature sequence054 113 1060 gene locus_tag LOCUS_09880 gene miaA 113 1060 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081395.1 protein_id gnl|my_center|LOCUS_09880 1279 1833 gene locus_tag LOCUS_09890 gene pyrR 1279 1833 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431186.1 protein_id gnl|my_center|LOCUS_09890 1833 2786 gene locus_tag LOCUS_09900 1833 2786 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_09900 2783 4069 gene locus_tag LOCUS_09910 2783 4069 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545202.1 protein_id gnl|my_center|LOCUS_09910 4238 4687 gene locus_tag LOCUS_09920 gene rplM 4238 4687 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_09920 4692 5090 gene locus_tag LOCUS_09930 gene rpsI 4692 5090 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079986.1 protein_id gnl|my_center|LOCUS_09930 5105 5932 gene locus_tag LOCUS_09940 gene rpsB 5105 5932 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_09940 5934 6551 gene locus_tag LOCUS_09950 gene tsf 5934 6551 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_09950 6569 7285 gene locus_tag LOCUS_09960 gene pyrH 6569 7285 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_09960 7288 7848 gene locus_tag LOCUS_09970 gene frr 7288 7848 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632773.1 protein_id gnl|my_center|LOCUS_09970 10146 7960 gene locus_tag LOCUS_09980 10146 7960 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583735.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence055 <1 1034 gene locus_tag LOCUS_09990 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201990.1:heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein 1845 1435 gene locus_tag LOCUS_10000 1845 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2383 2048 gene locus_tag LOCUS_10010 2383 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 3914 2385 gene locus_tag LOCUS_10020 3914 2385 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808163.1 protein_id gnl|my_center|LOCUS_10020 4666 3929 gene locus_tag LOCUS_10030 4666 3929 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_10030 6312 4663 gene locus_tag LOCUS_10040 6312 4663 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_10040 7159 6323 gene locus_tag LOCUS_10050 7159 6323 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_10050 7910 7557 gene locus_tag LOCUS_10060 7910 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 8022 7936 gene locus_tag LOCUS_t00240 8022 7936 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8145 8071 gene locus_tag LOCUS_t00250 8145 8071 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 8245 8766 gene locus_tag LOCUS_10070 8245 8766 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202425.1 protein_id gnl|my_center|LOCUS_10070 9227 8784 gene locus_tag LOCUS_10080 9227 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 9393 9320 gene locus_tag LOCUS_t00260 9393 9320 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9894 9448 gene locus_tag LOCUS_10090 9894 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence056 3173 3697 gene locus_tag LOCUS_10100 gene rpoE 3173 3697 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_10100 3694 4122 gene locus_tag LOCUS_10110 3694 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4119 4628 gene locus_tag LOCUS_10120 4119 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 4647 5489 gene locus_tag LOCUS_10130 gene nadC 4647 5489 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_10130 5503 6492 gene locus_tag LOCUS_10140 5503 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 6684 9335 gene locus_tag LOCUS_10150 6684 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 9483 9929 gene locus_tag LOCUS_10160 9483 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence057 116 313 gene locus_tag LOCUS_10170 116 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 545 1510 gene locus_tag LOCUS_10180 545 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1904 1545 gene locus_tag LOCUS_10190 1904 1545 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_10190 2926 1901 gene locus_tag LOCUS_10200 2926 1901 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_10200 3360 2923 gene locus_tag LOCUS_10210 3360 2923 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403203.1 protein_id gnl|my_center|LOCUS_10210 3541 3335 gene locus_tag LOCUS_10220 3541 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 4182 3541 gene locus_tag LOCUS_10230 4182 3541 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_10230 4691 4179 gene locus_tag LOCUS_10240 gene folK 4691 4179 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687713.1 protein_id gnl|my_center|LOCUS_10240 5046 4684 gene locus_tag LOCUS_10250 gene folB 5046 4684 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733322.1 protein_id gnl|my_center|LOCUS_10250 6817 5186 gene locus_tag LOCUS_10260 gene groL 6817 5186 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932217.1 protein_id gnl|my_center|LOCUS_10260 7138 6848 gene locus_tag LOCUS_10270 gene groES 7138 6848 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_10270 7738 7301 gene locus_tag LOCUS_10280 7738 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 8829 7792 gene locus_tag LOCUS_10290 8829 7792 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_10290 9679 8891 gene locus_tag LOCUS_10300 9679 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence058 <1 588 gene locus_tag LOCUS_10310 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258597.1:TIGR02206 family membrane protein 585 977 gene locus_tag LOCUS_10320 585 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 977 2353 gene locus_tag LOCUS_10330 977 2353 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_10330 2408 2692 gene locus_tag LOCUS_10340 2408 2692 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722457.1 protein_id gnl|my_center|LOCUS_10340 2911 3759 gene locus_tag LOCUS_10350 2911 3759 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 protein_id gnl|my_center|LOCUS_10350 4021 5337 gene locus_tag LOCUS_10360 4021 5337 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434259.1 protein_id gnl|my_center|LOCUS_10360 5334 7673 gene locus_tag LOCUS_10370 gene purL 5334 7673 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947405.1 protein_id gnl|my_center|LOCUS_10370 7745 7844 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7893 8555 gene locus_tag LOCUS_10380 7893 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence059 1459 1166 gene locus_tag LOCUS_10390 1459 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2326 1478 gene locus_tag LOCUS_10400 2326 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2775 2329 gene locus_tag LOCUS_10410 2775 2329 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_10410 3542 2772 gene locus_tag LOCUS_10420 3542 2772 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_10420 3839 3543 gene locus_tag LOCUS_10430 gene arsC 3839 3543 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314592.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10430 4057 5079 gene locus_tag LOCUS_10440 4057 5079 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964555.1 protein_id gnl|my_center|LOCUS_10440 5089 5883 gene locus_tag LOCUS_10450 gene mreC 5089 5883 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099559.1 protein_id gnl|my_center|LOCUS_10450 5876 6361 gene locus_tag LOCUS_10460 5876 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 6368 8137 gene locus_tag LOCUS_10470 gene mrdA 6368 8137 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932253.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence060 3690 3181 gene locus_tag LOCUS_10480 3690 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4120 5292 gene locus_tag LOCUS_10490 4120 5292 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259168.1 protein_id gnl|my_center|LOCUS_10490 6210 5395 gene locus_tag LOCUS_10500 6210 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 6563 6216 gene locus_tag LOCUS_10510 gene uraH 6563 6216 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094857.1 protein_id gnl|my_center|LOCUS_10510 7999 6560 gene locus_tag LOCUS_10520 7999 6560 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_10520 8412 7996 gene locus_tag LOCUS_10530 8412 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence061 3019 788 gene locus_tag LOCUS_10540 3019 788 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_10540 3047 3146 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6067 3323 gene locus_tag LOCUS_10550 6067 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 6819 6127 gene locus_tag LOCUS_10560 6819 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 8016 6829 gene locus_tag LOCUS_10570 8016 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 8351 8242 gene locus_tag LOCUS_r00010 8351 8242 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence062 1647 1330 gene locus_tag LOCUS_10580 1647 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2116 1634 gene locus_tag LOCUS_10590 2116 1634 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_10590 4190 2109 gene locus_tag LOCUS_10600 gene fusA 4190 2109 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931838.1 protein_id gnl|my_center|LOCUS_10600 4583 4296 gene locus_tag LOCUS_10610 4583 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 5668 4583 gene locus_tag LOCUS_10620 5668 4583 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_10620 7375 5684 gene locus_tag LOCUS_10630 7375 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 8057 7356 gene locus_tag LOCUS_10640 gene sfsA 8057 7356 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259140.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence063 3112 4941 gene locus_tag LOCUS_10650 3112 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 5059 5682 gene locus_tag LOCUS_10660 5059 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 5715 6710 gene locus_tag LOCUS_10670 5715 6710 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_10670 6720 7595 gene locus_tag LOCUS_10680 6720 7595 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence064 649 2 gene locus_tag LOCUS_10690 649 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1730 702 gene locus_tag LOCUS_10700 gene recA 1730 702 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_10700 2321 1740 gene locus_tag LOCUS_10710 gene thpR 2321 1740 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082411.1 protein_id gnl|my_center|LOCUS_10710 3526 2318 gene locus_tag LOCUS_10720 3526 2318 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438532.1 protein_id gnl|my_center|LOCUS_10720 3984 3523 gene locus_tag LOCUS_10730 3984 3523 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_10730 4593 3988 gene locus_tag LOCUS_10740 gene pgsA 4593 3988 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932027.1 protein_id gnl|my_center|LOCUS_10740 5183 4590 gene locus_tag LOCUS_10750 gene recR 5183 4590 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_10750 5518 5180 gene locus_tag LOCUS_10760 5518 5180 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869751.1 protein_id gnl|my_center|LOCUS_10760 7171 5537 gene locus_tag LOCUS_10770 gene dnaX 7171 5537 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence065 107 481 gene locus_tag LOCUS_10780 107 481 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_10780 581 4099 gene locus_tag LOCUS_10790 gene smc 581 4099 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403652.1 protein_id gnl|my_center|LOCUS_10790 4177 7122 gene locus_tag LOCUS_10800 4177 7122 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence066 241 1149 gene locus_tag LOCUS_10810 241 1149 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015631.1 protein_id gnl|my_center|LOCUS_10810 1146 2417 gene locus_tag LOCUS_10820 1146 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2490 3227 gene locus_tag LOCUS_10830 2490 3227 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_10830 3236 3589 gene locus_tag LOCUS_10840 3236 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 4442 3663 gene locus_tag LOCUS_10850 4442 3663 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_10850 4665 5207 gene locus_tag LOCUS_10860 gene fabA 4665 5207 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921547.1 protein_id gnl|my_center|LOCUS_10860 5220 6323 gene locus_tag LOCUS_10870 gene ychF 5220 6323 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203749.1 protein_id gnl|my_center|LOCUS_10870 6333 6824 gene locus_tag LOCUS_10880 6333 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence067 3848 1869 gene locus_tag LOCUS_10890 gene tkt 3848 1869 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_10890 6688 3857 gene locus_tag LOCUS_10900 gene uvrA 6688 3857 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence068 1185 2108 gene locus_tag LOCUS_10910 1185 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2173 3771 gene locus_tag LOCUS_10920 2173 3771 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_10920 3872 4573 gene locus_tag LOCUS_10930 3872 4573 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_10930 4618 4968 gene locus_tag LOCUS_10940 4618 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 4965 5384 gene locus_tag LOCUS_10950 4965 5384 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_10950 5381 6034 gene locus_tag LOCUS_10960 5381 6034 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179862255.1 protein_id gnl|my_center|LOCUS_10960 6416 6066 gene locus_tag LOCUS_10970 gene frdD 6416 6066 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407771.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence069 52 360 gene locus_tag LOCUS_10980 gene rpsJ 52 360 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567567.1 protein_id gnl|my_center|LOCUS_10980 394 981 gene locus_tag LOCUS_10990 gene rplC 394 981 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_10990 990 1619 gene locus_tag LOCUS_11000 gene rplD 990 1619 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_11000 1621 1944 gene locus_tag LOCUS_11010 gene rplW 1621 1944 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933840.1 protein_id gnl|my_center|LOCUS_11010 1944 2771 gene locus_tag LOCUS_11020 gene rplB 1944 2771 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_11020 2771 3040 gene locus_tag LOCUS_11030 gene rpsS 2771 3040 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_11030 3045 3392 gene locus_tag LOCUS_11040 gene rplV 3045 3392 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_11040 3491 4030 gene locus_tag LOCUS_11050 gene rpsC 3491 4030 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701310.1 protein_id gnl|my_center|LOCUS_11050 4030 4449 gene locus_tag LOCUS_11060 gene rplP 4030 4449 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545254.1 protein_id gnl|my_center|LOCUS_11060 4464 4685 gene locus_tag LOCUS_11070 gene rpmC 4464 4685 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357691.1 protein_id gnl|my_center|LOCUS_11070 4672 4950 gene locus_tag LOCUS_11080 gene rpsQ 4672 4950 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557078.1 protein_id gnl|my_center|LOCUS_11080 4978 5346 gene locus_tag LOCUS_11090 gene rplN 4978 5346 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114366.1 protein_id gnl|my_center|LOCUS_11090 5348 5656 gene locus_tag LOCUS_11100 gene rplX 5348 5656 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 protein_id gnl|my_center|LOCUS_11100 5665 6603 gene locus_tag LOCUS_11110 5665 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence070 2952 1312 gene locus_tag LOCUS_11120 2952 1312 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_11120 3929 2952 gene locus_tag LOCUS_11130 3929 2952 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_11130 4702 3932 gene locus_tag LOCUS_11140 4702 3932 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence071 142 1716 gene locus_tag LOCUS_11150 142 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1713 4475 gene locus_tag LOCUS_11160 1713 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 4472 5482 gene locus_tag LOCUS_11170 4472 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence072 337 789 gene locus_tag LOCUS_11180 337 789 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933079.1 protein_id gnl|my_center|LOCUS_11180 792 1925 gene locus_tag LOCUS_11190 792 1925 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197192.1 protein_id gnl|my_center|LOCUS_11190 1944 2957 gene locus_tag LOCUS_11200 1944 2957 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_11200 3405 2959 gene locus_tag LOCUS_11210 3405 2959 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 protein_id gnl|my_center|LOCUS_11210 3552 5978 gene locus_tag LOCUS_11220 3552 5978 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence073 978 1991 gene locus_tag LOCUS_11230 978 1991 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_11230 2727 1996 gene locus_tag LOCUS_11240 2727 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 3356 2724 gene locus_tag LOCUS_11250 3356 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 4433 3387 gene locus_tag LOCUS_11260 4433 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 5453 4461 gene locus_tag LOCUS_11270 gene wecB 5453 4461 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942883.1 protein_id gnl|my_center|LOCUS_11270 <6309 5524 gene locus_tag LOCUS_11280 <6309 5524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783855.1:ABC transporter ATP-binding protein >Feature sequence074 1575 253 gene locus_tag LOCUS_11290 gene lat 1575 253 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403564.1 protein_id gnl|my_center|LOCUS_11290 3110 1584 gene locus_tag LOCUS_11300 3110 1584 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_11300 4418 3474 gene locus_tag LOCUS_11310 4418 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4677 4516 gene locus_tag LOCUS_11320 4677 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 5635 4751 gene locus_tag LOCUS_11330 5635 4751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence075 <1 550 gene locus_tag LOCUS_11340 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583296.1:asparagine--tRNA ligase 484 999 gene locus_tag LOCUS_11350 484 999 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_11350 996 1277 gene locus_tag LOCUS_11360 996 1277 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404796.1 protein_id gnl|my_center|LOCUS_11360 1294 2907 gene locus_tag LOCUS_11370 1294 2907 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_11370 2909 3346 gene locus_tag LOCUS_11380 2909 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3738 5903 gene locus_tag LOCUS_11390 3738 5903 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence076 305 706 gene locus_tag LOCUS_11400 305 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 739 1584 gene locus_tag LOCUS_11410 739 1584 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_11410 1701 2597 gene locus_tag LOCUS_11420 1701 2597 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_11420 2685 4016 gene locus_tag LOCUS_11430 gene miaB 2685 4016 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552700.1 protein_id gnl|my_center|LOCUS_11430 4003 4332 gene locus_tag LOCUS_11440 4003 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 4329 5342 gene locus_tag LOCUS_11450 4329 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 5359 6237 gene locus_tag LOCUS_11460 5359 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence077 694 272 gene locus_tag LOCUS_11470 694 272 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933658.1 protein_id gnl|my_center|LOCUS_11470 1578 691 gene locus_tag LOCUS_11480 gene sucD 1578 691 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_11480 2744 1575 gene locus_tag LOCUS_11490 gene sucC 2744 1575 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403880.1 protein_id gnl|my_center|LOCUS_11490 3700 2741 gene locus_tag LOCUS_11500 gene arcC 3700 2741 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_11500 5013 3697 gene locus_tag LOCUS_11510 5013 3697 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_11510 <5905 5148 gene locus_tag LOCUS_11520 <5905 5148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962584.1:L-glutamate gamma-semialdehyde dehydrogenase >Feature sequence078 <1 1025 gene locus_tag LOCUS_11530 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969699.1:intradiol ring-cleavage dioxygenase 1185 3782 gene locus_tag LOCUS_11540 gene alaS 1185 3782 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_11540 3775 5223 gene locus_tag LOCUS_11550 gene gcvPB 3775 5223 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_11550 5220 5651 gene locus_tag LOCUS_11560 5220 5651 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868380.1 protein_id gnl|my_center|LOCUS_11560 5709 5897 gene locus_tag LOCUS_11570 5709 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence079 410 550 gene locus_tag LOCUS_11580 410 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 816 3035 gene locus_tag LOCUS_11590 816 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 3005 3014 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3025 3333 gene locus_tag LOCUS_11600 3025 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence080 909 142 gene locus_tag LOCUS_11610 909 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2797 902 gene locus_tag LOCUS_11620 2797 902 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545530.1 protein_id gnl|my_center|LOCUS_11620 4023 2815 gene locus_tag LOCUS_11630 4023 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence081 549 154 gene locus_tag LOCUS_11640 549 154 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_11640 1812 643 gene locus_tag LOCUS_11650 1812 643 CDS product phosphatidylinositol-specific phospholipase C1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920762.1 protein_id gnl|my_center|LOCUS_11650 2234 1812 gene locus_tag LOCUS_11660 2234 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2178 2366 gene locus_tag LOCUS_11670 2178 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 2535 2798 gene locus_tag LOCUS_11680 2535 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2805 4466 gene locus_tag LOCUS_11690 2805 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4504 5064 gene locus_tag LOCUS_11700 4504 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence082 1537 122 gene locus_tag LOCUS_11710 gene rlmD 1537 122 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986823.1 protein_id gnl|my_center|LOCUS_11710 2476 1613 gene locus_tag LOCUS_11720 2476 1613 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_11720 3945 2476 gene locus_tag LOCUS_11730 3945 2476 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_11730 4878 3949 gene locus_tag LOCUS_11740 gene deoC 4878 3949 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838655.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence083 990 580 gene locus_tag LOCUS_11750 990 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2402 1161 gene locus_tag LOCUS_11760 2402 1161 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964893.1 protein_id gnl|my_center|LOCUS_11760 3771 2476 gene locus_tag LOCUS_11770 3771 2476 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_11770 5020 3761 gene locus_tag LOCUS_11780 5020 3761 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence084 1637 300 gene locus_tag LOCUS_11790 gene gdhA 1637 300 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094817.1 protein_id gnl|my_center|LOCUS_11790 1901 2533 gene locus_tag LOCUS_11800 1901 2533 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541081.1 protein_id gnl|my_center|LOCUS_11800 2520 3698 gene locus_tag LOCUS_11810 2520 3698 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_11810 3701 4471 gene locus_tag LOCUS_11820 gene tpiA 3701 4471 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_11820 4476 4808 gene locus_tag LOCUS_11830 4476 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 4820 4904 gene locus_tag LOCUS_t00270 4820 4904 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 2593 41 gene locus_tag LOCUS_11840 2593 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 3387 2623 gene locus_tag LOCUS_11850 3387 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence086 102 1253 gene locus_tag LOCUS_11860 102 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1269 2582 gene locus_tag LOCUS_11870 1269 2582 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence087 781 2208 gene locus_tag LOCUS_11880 781 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2244 3269 gene locus_tag LOCUS_11890 2244 3269 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 protein_id gnl|my_center|LOCUS_11890 3281 4414 gene locus_tag LOCUS_11900 3281 4414 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence088 755 111 gene locus_tag LOCUS_11910 gene tsaB 755 111 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220976.1 protein_id gnl|my_center|LOCUS_11910 1183 752 gene locus_tag LOCUS_11920 gene tsaE 1183 752 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_11920 2748 1180 gene locus_tag LOCUS_11930 2748 1180 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_11930 <4410 2857 gene locus_tag LOCUS_11940 <4410 2857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence089 209 1372 gene locus_tag LOCUS_11950 209 1372 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_11950 1566 2174 gene locus_tag LOCUS_11960 1566 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2207 2968 gene locus_tag LOCUS_11970 2207 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence090 1419 325 gene locus_tag LOCUS_11980 1419 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 2319 1522 gene locus_tag LOCUS_11990 2319 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3223 2297 gene locus_tag LOCUS_12000 gene fliG 3223 2297 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460758.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence091 1793 102 gene locus_tag LOCUS_12010 gene ggt 1793 102 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254471.1 protein_id gnl|my_center|LOCUS_12010 2627 1887 gene locus_tag LOCUS_12020 2627 1887 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_12020 4030 2747 gene locus_tag LOCUS_12030 4030 2747 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390559.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence092 222 2159 gene locus_tag LOCUS_12040 gene acs 222 2159 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_12040 2567 4054 gene locus_tag LOCUS_12050 2567 4054 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence093 1853 579 gene locus_tag LOCUS_12060 1853 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 <4065 1871 gene locus_tag LOCUS_12070 <4065 1871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202099.1:TonB-dependent receptor >Feature sequence094 1255 227 gene locus_tag LOCUS_12080 1255 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1966 2065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2102 2347 gene locus_tag LOCUS_12090 2102 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2940 2749 gene locus_tag LOCUS_12100 2940 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2950 3195 gene locus_tag LOCUS_12110 2950 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 <4063 3170 gene locus_tag LOCUS_12120 <4063 3170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402849.1:transcription-repair coupling factor >Feature sequence095 153 409 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttgaatttatctaataaccaactcacaggagaaat 998 2755 gene locus_tag LOCUS_12130 998 2755 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839414.1 protein_id gnl|my_center|LOCUS_12130 3080 3760 gene locus_tag LOCUS_12140 3080 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence096 290 132 gene locus_tag LOCUS_12150 290 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence097 165 1370 gene locus_tag LOCUS_12160 165 1370 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404674.1 protein_id gnl|my_center|LOCUS_12160 1451 1879 gene locus_tag LOCUS_12170 1451 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1876 2196 gene locus_tag LOCUS_12180 1876 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence098 1494 7 gene locus_tag LOCUS_12190 1494 7 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_12190 2240 1491 gene locus_tag LOCUS_12200 gene djlA 2240 1491 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220839.1 protein_id gnl|my_center|LOCUS_12200 2755 2243 gene locus_tag LOCUS_12210 2755 2243 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_12210 <3518 2752 gene locus_tag LOCUS_12220 <3518 2752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870741.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence099 671 225 gene locus_tag LOCUS_12230 671 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1669 1013 gene locus_tag LOCUS_12240 1669 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1870 3063 gene locus_tag LOCUS_12250 1870 3063 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085398.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence100 342 1244 gene locus_tag LOCUS_12260 342 1244 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583958.1 protein_id gnl|my_center|LOCUS_12260 1265 1657 gene locus_tag LOCUS_12270 1265 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1668 3056 gene locus_tag LOCUS_12280 1668 3056 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence101 904 32 gene locus_tag LOCUS_12290 904 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2104 923 gene locus_tag LOCUS_12300 2104 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2211 3341 gene locus_tag LOCUS_12310 2211 3341 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545470.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence102 1987 848 gene locus_tag LOCUS_12320 1987 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 2988 1990 gene locus_tag LOCUS_12330 gene wecB 2988 1990 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942883.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence103 1211 18 gene locus_tag LOCUS_12340 1211 18 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_12340 1346 2458 gene locus_tag LOCUS_12350 1346 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 2892 2554 gene locus_tag LOCUS_12360 2892 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence104 513 205 gene locus_tag LOCUS_12370 513 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 239 248 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 799 563 gene locus_tag LOCUS_12380 799 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 <2660 850 gene locus_tag LOCUS_12390 <2660 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860393.1:HEAT repeat domain-containing protein >Feature sequence105 329 463 gene locus_tag LOCUS_12400 329 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1532 1927 gene locus_tag LOCUS_12410 1532 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1965 2270 gene locus_tag LOCUS_12420 1965 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2292 2522 gene locus_tag LOCUS_12430 2292 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence106 >Feature sequence107 1380 2375 gene locus_tag LOCUS_12440 1380 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence108 1803 16 gene locus_tag LOCUS_12450 1803 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 <2330 1815 gene locus_tag LOCUS_12460 <2330 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047983.1:glycerophosphodiester phosphodiesterase >Feature sequence109 168 1400 gene locus_tag LOCUS_12470 168 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1413 2288 gene locus_tag LOCUS_12480 1413 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence110 94 1905 gene locus_tag LOCUS_12490 gene lepA 94 1905 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence111 1540 305 gene locus_tag LOCUS_12500 1540 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500