>Feature sequence1 873 325 gene locus_tag LOCUS_00010 873 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3007 1373 gene locus_tag LOCUS_00020 gene thsA 3007 1373 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876429.1 protein_id gnl|my_center|LOCUS_00020 3691 3191 gene locus_tag LOCUS_00030 3691 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892171.1 protein_id gnl|my_center|LOCUS_00030 5340 3856 gene locus_tag LOCUS_00040 5340 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6568 5522 gene locus_tag LOCUS_00050 gene asd 6568 5522 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_00050 7490 6669 gene locus_tag LOCUS_00060 gene dapB 7490 6669 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876435.1 protein_id gnl|my_center|LOCUS_00060 8183 7617 gene locus_tag LOCUS_00070 8183 7617 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197538709.1 protein_id gnl|my_center|LOCUS_00070 9234 8341 gene locus_tag LOCUS_00080 gene dapA 9234 8341 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_00080 10451 9231 gene locus_tag LOCUS_00090 10451 9231 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 protein_id gnl|my_center|LOCUS_00090 10706 10518 gene locus_tag LOCUS_00100 10706 10518 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876438.1 protein_id gnl|my_center|LOCUS_00100 11005 10712 gene locus_tag LOCUS_00110 11005 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11879 10998 gene locus_tag LOCUS_00120 11879 10998 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061249.1 protein_id gnl|my_center|LOCUS_00120 12695 12952 gene locus_tag LOCUS_00130 12695 12952 CDS product MJ0307 family thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876442.1 protein_id gnl|my_center|LOCUS_00130 12996 14090 gene locus_tag LOCUS_00140 gene cbiD 12996 14090 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876443.1 protein_id gnl|my_center|LOCUS_00140 14119 15189 gene locus_tag LOCUS_00150 14119 15189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15294 15764 gene locus_tag LOCUS_00160 gene moaC 15294 15764 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943324.1 protein_id gnl|my_center|LOCUS_00160 15821 17893 gene locus_tag LOCUS_00170 gene hel308 15821 17893 CDS product ATP-dependent DNA helicase Hel308 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876445.1 protein_id gnl|my_center|LOCUS_00170 17945 18490 gene locus_tag LOCUS_00180 17945 18490 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876447.1 protein_id gnl|my_center|LOCUS_00180 18894 18592 gene locus_tag LOCUS_00190 18894 18592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19557 18943 gene locus_tag LOCUS_00200 19557 18943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20120 19782 gene locus_tag LOCUS_00210 20120 19782 CDS product DUF2098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060902.1 protein_id gnl|my_center|LOCUS_00210 20437 20186 gene locus_tag LOCUS_00220 20437 20186 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892157.1 protein_id gnl|my_center|LOCUS_00220 20608 21666 gene locus_tag LOCUS_00230 20608 21666 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876451.1 protein_id gnl|my_center|LOCUS_00230 21775 23403 gene locus_tag LOCUS_00240 21775 23403 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061250.1 protein_id gnl|my_center|LOCUS_00240 23416 24081 gene locus_tag LOCUS_00250 gene deoC 23416 24081 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060904.1 protein_id gnl|my_center|LOCUS_00250 24173 24523 gene locus_tag LOCUS_00260 24173 24523 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061251.1 protein_id gnl|my_center|LOCUS_00260 24697 26343 gene locus_tag LOCUS_00270 24697 26343 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_00270 27170 26397 gene locus_tag LOCUS_00280 27170 26397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 27405 28052 gene locus_tag LOCUS_00290 27405 28052 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022715.1 protein_id gnl|my_center|LOCUS_00290 28241 29119 gene locus_tag LOCUS_00300 28241 29119 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022717.1 protein_id gnl|my_center|LOCUS_00300 29218 29934 gene locus_tag LOCUS_00310 29218 29934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 29961 30548 gene locus_tag LOCUS_00320 29961 30548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 30633 31274 gene locus_tag LOCUS_00330 30633 31274 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867949.1 protein_id gnl|my_center|LOCUS_00330 31326 32180 gene locus_tag LOCUS_00340 31326 32180 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877416.1 protein_id gnl|my_center|LOCUS_00340 32229 33368 gene locus_tag LOCUS_00350 32229 33368 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061331.1 protein_id gnl|my_center|LOCUS_00350 35035 33884 gene locus_tag LOCUS_00360 35035 33884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 35186 35806 gene locus_tag LOCUS_00370 35186 35806 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868327.1 protein_id gnl|my_center|LOCUS_00370 36588 36268 gene locus_tag LOCUS_00380 36588 36268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 36816 36610 gene locus_tag LOCUS_00390 36816 36610 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_00390 37304 36840 gene locus_tag LOCUS_00400 37304 36840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 37980 37432 gene locus_tag LOCUS_00410 gene mtrA 37980 37432 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060961.1 protein_id gnl|my_center|LOCUS_00410 38251 38916 gene locus_tag LOCUS_00420 38251 38916 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876687.1 protein_id gnl|my_center|LOCUS_00420 40244 39129 gene locus_tag LOCUS_00430 gene cofH 40244 39129 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 protein_id gnl|my_center|LOCUS_00430 40314 40604 gene locus_tag LOCUS_00440 40314 40604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 41094 40687 gene locus_tag LOCUS_00450 41094 40687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 41695 41105 gene locus_tag LOCUS_00460 41695 41105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 42143 41745 gene locus_tag LOCUS_00470 42143 41745 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876265.1 protein_id gnl|my_center|LOCUS_00470 42459 42530 gene locus_tag LOCUS_t00010 42459 42530 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 42535 42608 gene locus_tag LOCUS_t00020 42535 42608 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 42705 42902 gene locus_tag LOCUS_00480 42705 42902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 43465 42926 gene locus_tag LOCUS_00490 43465 42926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 44400 43663 gene locus_tag LOCUS_00500 44400 43663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 45800 44520 gene locus_tag LOCUS_00510 45800 44520 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876459.1 protein_id gnl|my_center|LOCUS_00510 46564 45911 gene locus_tag LOCUS_00520 46564 45911 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876460.1 protein_id gnl|my_center|LOCUS_00520 47161 46565 gene locus_tag LOCUS_00530 47161 46565 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876461.1 protein_id gnl|my_center|LOCUS_00530 47754 47266 gene locus_tag LOCUS_00540 gene hacB 47754 47266 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876462.1 protein_id gnl|my_center|LOCUS_00540 48814 47825 gene locus_tag LOCUS_00550 48814 47825 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876463.1 protein_id gnl|my_center|LOCUS_00550 50373 48880 gene locus_tag LOCUS_00560 50373 48880 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060907.1 protein_id gnl|my_center|LOCUS_00560 50683 51261 gene locus_tag LOCUS_00570 50683 51261 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060908.1 protein_id gnl|my_center|LOCUS_00570 52351 51323 gene locus_tag LOCUS_00580 52351 51323 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876467.1 protein_id gnl|my_center|LOCUS_00580 53509 52481 gene locus_tag LOCUS_00590 53509 52481 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876468.1 protein_id gnl|my_center|LOCUS_00590 54936 53626 gene locus_tag LOCUS_00600 gene wecB 54936 53626 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_00600 56251 54989 gene locus_tag LOCUS_00610 56251 54989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 57356 56544 gene locus_tag LOCUS_00620 gene truA 57356 56544 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876473.1 protein_id gnl|my_center|LOCUS_00620 57893 57366 gene locus_tag LOCUS_00630 57893 57366 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877414.1 protein_id gnl|my_center|LOCUS_00630 58003 58551 gene locus_tag LOCUS_00640 58003 58551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 58829 59062 gene locus_tag LOCUS_00650 58829 59062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 59195 59905 gene locus_tag LOCUS_00660 gene hisA 59195 59905 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060911.1 protein_id gnl|my_center|LOCUS_00660 61194 59947 gene locus_tag LOCUS_00670 61194 59947 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876099.1 protein_id gnl|my_center|LOCUS_00670 61374 62843 gene locus_tag LOCUS_00680 61374 62843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 62882 63325 gene locus_tag LOCUS_00690 62882 63325 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876477.1 protein_id gnl|my_center|LOCUS_00690 65111 63411 gene locus_tag LOCUS_00700 65111 63411 CDS product pseudomurein-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876051.1 protein_id gnl|my_center|LOCUS_00700 65402 65962 gene locus_tag LOCUS_00710 65402 65962 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876494.1 protein_id gnl|my_center|LOCUS_00710 66427 66005 gene locus_tag LOCUS_00720 66427 66005 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485814.1 protein_id gnl|my_center|LOCUS_00720 67403 66405 gene locus_tag LOCUS_00730 67403 66405 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876491.1 protein_id gnl|my_center|LOCUS_00730 67688 68101 gene locus_tag LOCUS_00740 67688 68101 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060824.1 protein_id gnl|my_center|LOCUS_00740 68098 68529 gene locus_tag LOCUS_00750 68098 68529 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876102.1 protein_id gnl|my_center|LOCUS_00750 69152 68592 gene locus_tag LOCUS_00760 69152 68592 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_00760 70511 69213 gene locus_tag LOCUS_00770 70511 69213 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876489.1 protein_id gnl|my_center|LOCUS_00770 70994 71335 gene locus_tag LOCUS_00780 70994 71335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 71574 73100 gene locus_tag LOCUS_00790 71574 73100 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876488.1 protein_id gnl|my_center|LOCUS_00790 73103 73489 gene locus_tag LOCUS_00800 73103 73489 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876487.1 protein_id gnl|my_center|LOCUS_00800 74360 73515 gene locus_tag LOCUS_00810 74360 73515 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060749.1 protein_id gnl|my_center|LOCUS_00810 75148 74456 gene locus_tag LOCUS_00820 75148 74456 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870604.1 protein_id gnl|my_center|LOCUS_00820 76223 75369 gene locus_tag LOCUS_00830 76223 75369 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060749.1 protein_id gnl|my_center|LOCUS_00830 77080 76280 gene locus_tag LOCUS_00840 gene cbiQ 77080 76280 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060748.1 protein_id gnl|my_center|LOCUS_00840 77420 77115 gene locus_tag LOCUS_00850 77420 77115 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870602.1 protein_id gnl|my_center|LOCUS_00850 77966 77421 gene locus_tag LOCUS_00860 77966 77421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 77965 78156 gene locus_tag LOCUS_00870 77965 78156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 78527 78294 gene locus_tag LOCUS_00880 78527 78294 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876887.1 protein_id gnl|my_center|LOCUS_00880 78696 79346 gene locus_tag LOCUS_00890 gene pyrF 78696 79346 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060747.1 protein_id gnl|my_center|LOCUS_00890 79883 79266 gene locus_tag LOCUS_00900 79883 79266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 80135 81346 gene locus_tag LOCUS_00910 80135 81346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 82327 81404 gene locus_tag LOCUS_00920 82327 81404 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060746.1 protein_id gnl|my_center|LOCUS_00920 83341 82460 gene locus_tag LOCUS_00930 83341 82460 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060745.1 protein_id gnl|my_center|LOCUS_00930 83786 84238 gene locus_tag LOCUS_00940 83786 84238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 84547 85233 gene locus_tag LOCUS_00950 gene npdG 84547 85233 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_00950 85392 86261 gene locus_tag LOCUS_00960 85392 86261 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_00960 86474 87214 gene locus_tag LOCUS_00970 86474 87214 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 protein_id gnl|my_center|LOCUS_00970 87254 88015 gene locus_tag LOCUS_00980 87254 88015 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722299.1 protein_id gnl|my_center|LOCUS_00980 88456 89508 gene locus_tag LOCUS_00990 88456 89508 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869499.1 protein_id gnl|my_center|LOCUS_00990 89520 90488 gene locus_tag LOCUS_01000 89520 90488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01000 90491 90667 gene locus_tag LOCUS_01010 90491 90667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01010 90724 91161 gene locus_tag LOCUS_01020 90724 91161 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_01020 91307 91453 gene locus_tag LOCUS_01030 91307 91453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01030 92278 91880 gene locus_tag LOCUS_01040 92278 91880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 92386 93099 gene locus_tag LOCUS_01050 92386 93099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 93984 93166 gene locus_tag LOCUS_01060 93984 93166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 94746 94414 gene locus_tag LOCUS_01070 94746 94414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 95293 95021 gene locus_tag LOCUS_01080 gene albA 95293 95021 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061063.1 protein_id gnl|my_center|LOCUS_01080 95663 99445 gene locus_tag LOCUS_01090 95663 99445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 99435 99887 gene locus_tag LOCUS_01100 99435 99887 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_01100 99904 101112 gene locus_tag LOCUS_01110 99904 101112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 101205 101975 gene locus_tag LOCUS_01120 101205 101975 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330364.1 protein_id gnl|my_center|LOCUS_01120 102003 103985 gene locus_tag LOCUS_01130 gene feoB 102003 103985 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060770.1 protein_id gnl|my_center|LOCUS_01130 104113 104964 gene locus_tag LOCUS_01140 gene rnhC 104113 104964 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883701.1 protein_id gnl|my_center|LOCUS_01140 104954 106654 gene locus_tag LOCUS_01150 104954 106654 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876189.1 protein_id gnl|my_center|LOCUS_01150 106712 106939 gene locus_tag LOCUS_01160 106712 106939 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023253.1 protein_id gnl|my_center|LOCUS_01160 106944 107099 gene locus_tag LOCUS_01170 106944 107099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 107239 108003 gene locus_tag LOCUS_01180 107239 108003 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892471.1 protein_id gnl|my_center|LOCUS_01180 108102 108461 gene locus_tag LOCUS_01190 108102 108461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 109703 108588 gene locus_tag LOCUS_01200 109703 108588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 110331 109954 gene locus_tag LOCUS_01210 110331 109954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 111315 110425 gene locus_tag LOCUS_01220 111315 110425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 111764 111312 gene locus_tag LOCUS_01230 111764 111312 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_01230 112089 112418 gene locus_tag LOCUS_01240 112089 112418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 112492 113064 gene locus_tag LOCUS_01250 112492 113064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 113150 113287 gene locus_tag LOCUS_01260 113150 113287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 113487 114626 gene locus_tag LOCUS_01270 113487 114626 CDS product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 protein_id gnl|my_center|LOCUS_01270 114648 114809 gene locus_tag LOCUS_01280 114648 114809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 114934 115101 gene locus_tag LOCUS_01290 114934 115101 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061197.1 protein_id gnl|my_center|LOCUS_01290 115116 116300 gene locus_tag LOCUS_01300 115116 116300 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061196.1 protein_id gnl|my_center|LOCUS_01300 117173 116373 gene locus_tag LOCUS_01310 117173 116373 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875914.1 protein_id gnl|my_center|LOCUS_01310 117418 119175 gene locus_tag LOCUS_01320 117418 119175 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876115.1 protein_id gnl|my_center|LOCUS_01320 119316 120809 gene locus_tag LOCUS_01330 119316 120809 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877273.1 protein_id gnl|my_center|LOCUS_01330 121009 121857 gene locus_tag LOCUS_01340 121009 121857 CDS product DUF5591 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061115.1 protein_id gnl|my_center|LOCUS_01340 122059 122349 gene locus_tag LOCUS_01350 122059 122349 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061319.1 protein_id gnl|my_center|LOCUS_01350 122351 122890 gene locus_tag LOCUS_01360 122351 122890 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877270.1 protein_id gnl|my_center|LOCUS_01360 123005 123079 gene locus_tag LOCUS_t00030 123005 123079 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 124132 123092 gene locus_tag LOCUS_01370 gene trpD 124132 123092 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877269.1 protein_id gnl|my_center|LOCUS_01370 125003 124188 gene locus_tag LOCUS_01380 gene trpA 125003 124188 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750470.1 protein_id gnl|my_center|LOCUS_01380 126181 125000 gene locus_tag LOCUS_01390 gene trpB 126181 125000 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877267.1 protein_id gnl|my_center|LOCUS_01390 126871 126212 gene locus_tag LOCUS_01400 126871 126212 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877266.1 protein_id gnl|my_center|LOCUS_01400 127674 126868 gene locus_tag LOCUS_01410 127674 126868 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877265.1 protein_id gnl|my_center|LOCUS_01410 128249 127674 gene locus_tag LOCUS_01420 128249 127674 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877264.1 protein_id gnl|my_center|LOCUS_01420 129610 128255 gene locus_tag LOCUS_01430 gene trpE 129610 128255 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_01430 129829 130332 gene locus_tag LOCUS_01440 129829 130332 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061113.1 protein_id gnl|my_center|LOCUS_01440 132050 130371 gene locus_tag LOCUS_01450 132050 130371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 132566 132336 gene locus_tag LOCUS_01460 132566 132336 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877257.1 protein_id gnl|my_center|LOCUS_01460 132694 134010 gene locus_tag LOCUS_01470 132694 134010 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892604.1 protein_id gnl|my_center|LOCUS_01470 135133 134090 gene locus_tag LOCUS_01480 135133 134090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 136055 135222 gene locus_tag LOCUS_01490 136055 135222 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061059.1 protein_id gnl|my_center|LOCUS_01490 136159 136911 gene locus_tag LOCUS_01500 136159 136911 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286637.1 protein_id gnl|my_center|LOCUS_01500 136912 138051 gene locus_tag LOCUS_01510 136912 138051 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733783.1 protein_id gnl|my_center|LOCUS_01510 139367 138441 gene locus_tag LOCUS_01520 139367 138441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877252.1 protein_id gnl|my_center|LOCUS_01520 140478 139420 gene locus_tag LOCUS_01530 140478 139420 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061107.1 protein_id gnl|my_center|LOCUS_01530 140647 140976 gene locus_tag LOCUS_01540 140647 140976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 141087 142391 gene locus_tag LOCUS_01550 141087 142391 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877248.1 protein_id gnl|my_center|LOCUS_01550 142845 142402 gene locus_tag LOCUS_01560 142845 142402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 143292 145466 gene locus_tag LOCUS_01570 143292 145466 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061106.1 protein_id gnl|my_center|LOCUS_01570 145753 147006 gene locus_tag LOCUS_01580 gene ahcY 145753 147006 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877244.1 protein_id gnl|my_center|LOCUS_01580 147058 147672 gene locus_tag LOCUS_01590 147058 147672 CDS product DUF2119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061105.1 protein_id gnl|my_center|LOCUS_01590 148732 147746 gene locus_tag LOCUS_01600 gene fen 148732 147746 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877241.1 protein_id gnl|my_center|LOCUS_01600 149317 148784 gene locus_tag LOCUS_01610 149317 148784 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877240.1 protein_id gnl|my_center|LOCUS_01610 150646 149402 gene locus_tag LOCUS_01620 gene hacA 150646 149402 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061104.1 protein_id gnl|my_center|LOCUS_01620 151872 150697 gene locus_tag LOCUS_01630 151872 150697 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877238.1 protein_id gnl|my_center|LOCUS_01630 152599 152063 gene locus_tag LOCUS_01640 gene cyaB 152599 152063 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 protein_id gnl|my_center|LOCUS_01640 153121 152717 gene locus_tag LOCUS_01650 153121 152717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 153379 153924 gene locus_tag LOCUS_01660 153379 153924 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877235.1 protein_id gnl|my_center|LOCUS_01660 153964 155865 gene locus_tag LOCUS_01670 153964 155865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 155890 157440 gene locus_tag LOCUS_01680 155890 157440 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875834.1 protein_id gnl|my_center|LOCUS_01680 158076 158714 gene locus_tag LOCUS_01690 158076 158714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 158756 160366 gene locus_tag LOCUS_01700 158756 160366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 160419 161714 gene locus_tag LOCUS_01710 160419 161714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01710 161735 164179 gene locus_tag LOCUS_01720 161735 164179 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876179.1 protein_id gnl|my_center|LOCUS_01720 164189 164701 gene locus_tag LOCUS_01730 164189 164701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 165140 171463 gene locus_tag LOCUS_01740 165140 171463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 172223 173179 gene locus_tag LOCUS_01750 172223 173179 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_01750 173515 173300 gene locus_tag LOCUS_01760 173515 173300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 173736 173515 gene locus_tag LOCUS_01770 173736 173515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 174089 173907 gene locus_tag LOCUS_01780 174089 173907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01780 174295 174095 gene locus_tag LOCUS_01790 174295 174095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01790 174815 175246 gene locus_tag LOCUS_01800 174815 175246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 175823 177169 gene locus_tag LOCUS_01810 gene albA 175823 177169 CDS product subtilosin maturase AlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242599.1 protein_id gnl|my_center|LOCUS_01810 177162 178091 gene locus_tag LOCUS_01820 177162 178091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878632.1 protein_id gnl|my_center|LOCUS_01820 178088 178807 gene locus_tag LOCUS_01830 178088 178807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 178846 180525 gene locus_tag LOCUS_01840 178846 180525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582944.1 protein_id gnl|my_center|LOCUS_01840 180731 181699 gene locus_tag LOCUS_01850 gene galE 180731 181699 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_01850 181976 181749 gene locus_tag LOCUS_01860 181976 181749 CDS product TIGR00304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060854.1 protein_id gnl|my_center|LOCUS_01860 182505 182017 gene locus_tag LOCUS_01870 182505 182017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 183239 182727 gene locus_tag LOCUS_01880 183239 182727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 183355 183819 gene locus_tag LOCUS_01890 183355 183819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 183832 184344 gene locus_tag LOCUS_01900 183832 184344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330367.1 protein_id gnl|my_center|LOCUS_01900 185368 184403 gene locus_tag LOCUS_01910 185368 184403 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060851.1 protein_id gnl|my_center|LOCUS_01910 185903 185436 gene locus_tag LOCUS_01920 185903 185436 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060850.1 protein_id gnl|my_center|LOCUS_01920 187514 185952 gene locus_tag LOCUS_01930 187514 185952 CDS product DUF530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876227.1 protein_id gnl|my_center|LOCUS_01930 189490 187511 gene locus_tag LOCUS_01940 gene metG 189490 187511 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876226.1 protein_id gnl|my_center|LOCUS_01940 189733 191094 gene locus_tag LOCUS_01950 gene priL 189733 191094 CDS product DNA primase large subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876225.1 protein_id gnl|my_center|LOCUS_01950 191105 192085 gene locus_tag LOCUS_01960 gene priS 191105 192085 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061231.1 protein_id gnl|my_center|LOCUS_01960 193488 192106 gene locus_tag LOCUS_01970 gene cca 193488 192106 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876223.1 protein_id gnl|my_center|LOCUS_01970 194592 193564 gene locus_tag LOCUS_01980 194592 193564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 195447 194896 gene locus_tag LOCUS_01990 gene thpR 195447 194896 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_01990 196670 195546 gene locus_tag LOCUS_02000 196670 195546 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060849.1 protein_id gnl|my_center|LOCUS_02000 197528 196734 gene locus_tag LOCUS_02010 197528 196734 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_02010 197791 198408 gene locus_tag LOCUS_02020 197791 198408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 199831 198512 gene locus_tag LOCUS_02030 gene aspS 199831 198512 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875865.1 protein_id gnl|my_center|LOCUS_02030 201291 200002 gene locus_tag LOCUS_02040 gene hisD 201291 200002 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060775.1 protein_id gnl|my_center|LOCUS_02040 201574 201918 gene locus_tag LOCUS_02050 201574 201918 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875863.1 protein_id gnl|my_center|LOCUS_02050 202090 203478 gene locus_tag LOCUS_02060 202090 203478 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060774.1 protein_id gnl|my_center|LOCUS_02060 203512 204057 gene locus_tag LOCUS_02070 203512 204057 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875861.1 protein_id gnl|my_center|LOCUS_02070 204179 205822 gene locus_tag LOCUS_02080 gene thsA 204179 205822 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876429.1 protein_id gnl|my_center|LOCUS_02080 206104 208005 gene locus_tag LOCUS_02090 gene acs 206104 208005 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_02090 208120 208716 gene locus_tag LOCUS_02100 208120 208716 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060771.1 protein_id gnl|my_center|LOCUS_02100 209189 208806 gene locus_tag LOCUS_02110 209189 208806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 209742 209305 gene locus_tag LOCUS_02120 209742 209305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 210032 210739 gene locus_tag LOCUS_02130 210032 210739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 211790 210807 gene locus_tag LOCUS_02140 211790 210807 CDS product alpha/beta fold hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877422.1 protein_id gnl|my_center|LOCUS_02140 212042 211803 gene locus_tag LOCUS_02150 212042 211803 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877421.1 protein_id gnl|my_center|LOCUS_02150 212195 213571 gene locus_tag LOCUS_02160 212195 213571 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_02160 213671 213958 gene locus_tag LOCUS_02170 213671 213958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 214044 214328 gene locus_tag LOCUS_02180 214044 214328 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812401.1 protein_id gnl|my_center|LOCUS_02180 214747 214358 gene locus_tag LOCUS_02190 214747 214358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 214882 215052 gene locus_tag LOCUS_02200 214882 215052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 215561 215160 gene locus_tag LOCUS_02210 215561 215160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 215754 215927 gene locus_tag LOCUS_02220 215754 215927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 215932 216161 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatcctaatttagtctgattttagc 216452 216276 gene locus_tag LOCUS_02230 216452 216276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 216474 217472 gene locus_tag LOCUS_02240 216474 217472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 217533 217937 gene locus_tag LOCUS_02250 217533 217937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 218466 218323 gene locus_tag LOCUS_02260 218466 218323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 218764 224764 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatcctaatttagtctgattttagc 225383 225120 gene locus_tag LOCUS_02270 gene cas2 225383 225120 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060963.1 protein_id gnl|my_center|LOCUS_02270 226368 225385 gene locus_tag LOCUS_02280 gene cas1b 226368 225385 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060964.1 protein_id gnl|my_center|LOCUS_02280 226887 226369 gene locus_tag LOCUS_02290 gene cas4 226887 226369 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876709.1 protein_id gnl|my_center|LOCUS_02290 227048 226914 gene locus_tag LOCUS_02300 227048 226914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 227399 227133 gene locus_tag LOCUS_02310 227399 227133 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860386.1 protein_id gnl|my_center|LOCUS_02310 227585 227403 gene locus_tag LOCUS_02320 227585 227403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 227742 228296 gene locus_tag LOCUS_02330 227742 228296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545563.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02330 228418 229005 gene locus_tag LOCUS_02340 228418 229005 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_02340 229078 229491 gene locus_tag LOCUS_02350 229078 229491 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060824.1 protein_id gnl|my_center|LOCUS_02350 229488 229910 gene locus_tag LOCUS_02360 229488 229910 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876102.1 protein_id gnl|my_center|LOCUS_02360 230397 229969 gene locus_tag LOCUS_02370 230397 229969 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248971.1 protein_id gnl|my_center|LOCUS_02370 230669 230394 gene locus_tag LOCUS_02380 230669 230394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 231020 232726 gene locus_tag LOCUS_02390 231020 232726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 232802 233683 gene locus_tag LOCUS_02400 232802 233683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 236450 233778 gene locus_tag LOCUS_02410 gene cas3 236450 233778 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296333.1 protein_id gnl|my_center|LOCUS_02410 237289 236450 gene locus_tag LOCUS_02420 gene cas5 237289 236450 CDS product CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876711.1 protein_id gnl|my_center|LOCUS_02420 238574 237306 gene locus_tag LOCUS_02430 gene cas7i 238574 237306 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485770.1 protein_id gnl|my_center|LOCUS_02430 238881 238591 gene locus_tag LOCUS_02440 238881 238591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876713.1 protein_id gnl|my_center|LOCUS_02440 240867 238894 gene locus_tag LOCUS_02450 240867 238894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876714.1 protein_id gnl|my_center|LOCUS_02450 241595 240864 gene locus_tag LOCUS_02460 gene cas6 241595 240864 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750454.1 protein_id gnl|my_center|LOCUS_02460 242997 241696 gene locus_tag LOCUS_02470 242997 241696 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038543.1 protein_id gnl|my_center|LOCUS_02470 243866 243378 gene locus_tag LOCUS_02480 243866 243378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 244059 245372 gene locus_tag LOCUS_02490 244059 245372 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875743.1 protein_id gnl|my_center|LOCUS_02490 245655 246947 gene locus_tag LOCUS_02500 245655 246947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 248660 247383 gene locus_tag LOCUS_02510 248660 247383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 248860 249435 gene locus_tag LOCUS_02520 248860 249435 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060893.1 protein_id gnl|my_center|LOCUS_02520 249466 249849 gene locus_tag LOCUS_02530 249466 249849 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876395.1 protein_id gnl|my_center|LOCUS_02530 250114 250602 gene locus_tag LOCUS_02540 250114 250602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876397.1 protein_id gnl|my_center|LOCUS_02540 250715 252892 gene locus_tag LOCUS_02550 250715 252892 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060894.1 protein_id gnl|my_center|LOCUS_02550 253283 252978 gene locus_tag LOCUS_02560 253283 252978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 254308 253358 gene locus_tag LOCUS_02570 254308 253358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 255154 255351 gene locus_tag LOCUS_02580 255154 255351 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_02580 256028 255432 gene locus_tag LOCUS_02590 256028 255432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 256398 256517 gene locus_tag LOCUS_02600 256398 256517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 256926 256783 gene locus_tag LOCUS_02610 256926 256783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 257752 257153 gene locus_tag LOCUS_02620 257752 257153 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485759.1 protein_id gnl|my_center|LOCUS_02620 258322 257855 gene locus_tag LOCUS_02630 258322 257855 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876403.1 protein_id gnl|my_center|LOCUS_02630 259589 258312 gene locus_tag LOCUS_02640 gene aroA 259589 258312 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 protein_id gnl|my_center|LOCUS_02640 262341 259693 gene locus_tag LOCUS_02650 gene valS 262341 259693 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 protein_id gnl|my_center|LOCUS_02650 262937 263305 gene locus_tag LOCUS_02660 262937 263305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02660 263465 263767 gene locus_tag LOCUS_02670 263465 263767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02670 264425 264790 gene locus_tag LOCUS_02680 264425 264790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 264949 266598 gene locus_tag LOCUS_02690 gene pheT 264949 266598 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876408.1 protein_id gnl|my_center|LOCUS_02690 266649 267017 gene locus_tag LOCUS_02700 266649 267017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 267567 267148 gene locus_tag LOCUS_02710 267567 267148 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867144.1 protein_id gnl|my_center|LOCUS_02710 267955 267554 gene locus_tag LOCUS_02720 267955 267554 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391729.1 protein_id gnl|my_center|LOCUS_02720 268692 268189 gene locus_tag LOCUS_02730 268692 268189 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060743.1 protein_id gnl|my_center|LOCUS_02730 269179 268769 gene locus_tag LOCUS_02740 269179 268769 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876409.1 protein_id gnl|my_center|LOCUS_02740 269836 269306 gene locus_tag LOCUS_02750 gene pyrI 269836 269306 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_02750 271163 269850 gene locus_tag LOCUS_02760 271163 269850 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876482.1 protein_id gnl|my_center|LOCUS_02760 272002 271160 gene locus_tag LOCUS_02770 272002 271160 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870766.1 protein_id gnl|my_center|LOCUS_02770 273277 272267 gene locus_tag LOCUS_02780 gene argC 273277 272267 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 protein_id gnl|my_center|LOCUS_02780 274267 273350 gene locus_tag LOCUS_02790 gene argB 274267 273350 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875822.1 protein_id gnl|my_center|LOCUS_02790 275512 274319 gene locus_tag LOCUS_02800 gene argJ 275512 274319 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330363.1 protein_id gnl|my_center|LOCUS_02800 276015 275707 gene locus_tag LOCUS_02810 276015 275707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 277328 276090 gene locus_tag LOCUS_02820 277328 276090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060765.1 protein_id gnl|my_center|LOCUS_02820 278354 277329 gene locus_tag LOCUS_02830 278354 277329 CDS product Zc3h12a-like ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060764.1 protein_id gnl|my_center|LOCUS_02830 279107 278361 gene locus_tag LOCUS_02840 279107 278361 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877328.1 protein_id gnl|my_center|LOCUS_02840 279496 279143 gene locus_tag LOCUS_02850 279496 279143 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875816.1 protein_id gnl|my_center|LOCUS_02850 281484 279496 gene locus_tag LOCUS_02860 gene tgtA 281484 279496 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060763.1 protein_id gnl|my_center|LOCUS_02860 282776 281562 gene locus_tag LOCUS_02870 282776 281562 CDS product MnmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875814.1 protein_id gnl|my_center|LOCUS_02870 282949 283176 gene locus_tag LOCUS_02880 282949 283176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 283201 283602 gene locus_tag LOCUS_02890 283201 283602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 283699 284283 gene locus_tag LOCUS_02900 283699 284283 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_02900 284531 284731 gene locus_tag LOCUS_02910 284531 284731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 284712 285014 gene locus_tag LOCUS_02920 284712 285014 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_02920 285151 285885 gene locus_tag LOCUS_02930 285151 285885 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892786.1 protein_id gnl|my_center|LOCUS_02930 285914 286279 gene locus_tag LOCUS_02940 285914 286279 CDS product DUF2304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875776.1 protein_id gnl|my_center|LOCUS_02940 287438 286314 gene locus_tag LOCUS_02950 287438 286314 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_02950 288896 287466 gene locus_tag LOCUS_02960 288896 287466 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_02960 290060 288951 gene locus_tag LOCUS_02970 290060 288951 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_02970 291292 290081 gene locus_tag LOCUS_02980 291292 290081 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870572.1 protein_id gnl|my_center|LOCUS_02980 291999 291340 gene locus_tag LOCUS_02990 291999 291340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 293246 292029 gene locus_tag LOCUS_03000 293246 292029 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870572.1 protein_id gnl|my_center|LOCUS_03000 294253 293243 gene locus_tag LOCUS_03010 294253 293243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 294599 294952 gene locus_tag LOCUS_03020 294599 294952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 294955 295134 gene locus_tag LOCUS_03030 294955 295134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 295945 295223 gene locus_tag LOCUS_03040 295945 295223 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 protein_id gnl|my_center|LOCUS_03040 297080 295938 gene locus_tag LOCUS_03050 297080 295938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_03050 297688 297329 gene locus_tag LOCUS_03060 297688 297329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 298115 297831 gene locus_tag LOCUS_03070 298115 297831 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_03070 298472 299161 gene locus_tag LOCUS_03080 298472 299161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 299245 300465 gene locus_tag LOCUS_03090 299245 300465 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875779.1 protein_id gnl|my_center|LOCUS_03090 300720 301433 gene locus_tag LOCUS_03100 300720 301433 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875780.1 protein_id gnl|my_center|LOCUS_03100 301546 303033 gene locus_tag LOCUS_03110 gene guaB 301546 303033 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871141.1 protein_id gnl|my_center|LOCUS_03110 303126 303680 gene locus_tag LOCUS_03120 303126 303680 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892791.1 protein_id gnl|my_center|LOCUS_03120 304146 303907 gene locus_tag LOCUS_03130 304146 303907 CDS product pseudomurein-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060751.1 protein_id gnl|my_center|LOCUS_03130 305078 304314 gene locus_tag LOCUS_03140 305078 304314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875784.1 protein_id gnl|my_center|LOCUS_03140 305667 305104 gene locus_tag LOCUS_03150 gene cbiT 305667 305104 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875785.1 protein_id gnl|my_center|LOCUS_03150 306334 305783 gene locus_tag LOCUS_03160 306334 305783 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060752.1 protein_id gnl|my_center|LOCUS_03160 307594 306434 gene locus_tag LOCUS_03170 307594 306434 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875787.1 protein_id gnl|my_center|LOCUS_03170 308260 307733 gene locus_tag LOCUS_03180 308260 307733 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060754.1 protein_id gnl|my_center|LOCUS_03180 308432 310162 gene locus_tag LOCUS_03190 308432 310162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060755.1 protein_id gnl|my_center|LOCUS_03190 310316 310711 gene locus_tag LOCUS_03200 310316 310711 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875792.1 protein_id gnl|my_center|LOCUS_03200 310890 311048 gene locus_tag LOCUS_03210 310890 311048 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295425.1 protein_id gnl|my_center|LOCUS_03210 311064 311234 gene locus_tag LOCUS_03220 311064 311234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 311297 311458 gene locus_tag LOCUS_03230 311297 311458 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_03230 311546 312052 gene locus_tag LOCUS_03240 311546 312052 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_03240 312245 312931 gene locus_tag LOCUS_03250 312245 312931 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875798.1 protein_id gnl|my_center|LOCUS_03250 312951 313568 gene locus_tag LOCUS_03260 312951 313568 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060758.1 protein_id gnl|my_center|LOCUS_03260 313691 314662 gene locus_tag LOCUS_03270 313691 314662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 315184 314675 gene locus_tag LOCUS_03280 315184 314675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 315503 316807 gene locus_tag LOCUS_03290 315503 316807 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877457.1 protein_id gnl|my_center|LOCUS_03290 316875 317306 gene locus_tag LOCUS_03300 316875 317306 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_03300 318318 317440 gene locus_tag LOCUS_03310 318318 317440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 318463 322968 gene locus_tag LOCUS_03320 318463 322968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 323019 323339 gene locus_tag LOCUS_03330 323019 323339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 323297 323647 gene locus_tag LOCUS_03340 323297 323647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 323891 324547 gene locus_tag LOCUS_03350 323891 324547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 324837 333731 gene locus_tag LOCUS_03360 324837 333731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 333760 334542 gene locus_tag LOCUS_03370 333760 334542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 334643 335029 gene locus_tag LOCUS_03380 334643 335029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03380 335033 335422 gene locus_tag LOCUS_03390 335033 335422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03390 336181 335435 gene locus_tag LOCUS_03400 gene thiD 336181 335435 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876253.1 protein_id gnl|my_center|LOCUS_03400 336897 336229 gene locus_tag LOCUS_03410 gene cofC 336897 336229 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876252.1 protein_id gnl|my_center|LOCUS_03410 337600 336914 gene locus_tag LOCUS_03420 337600 336914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 339048 337639 gene locus_tag LOCUS_03430 gene proS 339048 337639 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060857.1 protein_id gnl|my_center|LOCUS_03430 339206 340258 gene locus_tag LOCUS_03440 339206 340258 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876249.1 protein_id gnl|my_center|LOCUS_03440 340824 340285 gene locus_tag LOCUS_03450 340824 340285 CDS product PsbP-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750442.1 protein_id gnl|my_center|LOCUS_03450 341388 340852 gene locus_tag LOCUS_03460 341388 340852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 341569 342003 gene locus_tag LOCUS_03470 341569 342003 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876248.1 protein_id gnl|my_center|LOCUS_03470 342093 342761 gene locus_tag LOCUS_03480 gene rpiA 342093 342761 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060856.1 protein_id gnl|my_center|LOCUS_03480 343110 343652 gene locus_tag LOCUS_03490 343110 343652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 343715 344542 gene locus_tag LOCUS_03500 343715 344542 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060918.1 protein_id gnl|my_center|LOCUS_03500 345436 344825 gene locus_tag LOCUS_03510 345436 344825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 346152 345487 gene locus_tag LOCUS_03520 346152 345487 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_03520 346282 346641 gene locus_tag LOCUS_03530 346282 346641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 346727 347509 gene locus_tag LOCUS_03540 346727 347509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 349232 347514 gene locus_tag LOCUS_03550 349232 347514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 349443 349679 gene locus_tag LOCUS_03560 349443 349679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 349844 352114 gene locus_tag LOCUS_03570 349844 352114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 352168 352587 gene locus_tag LOCUS_03580 352168 352587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 352684 353943 gene locus_tag LOCUS_03590 gene mmp10 352684 353943 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876794.1 protein_id gnl|my_center|LOCUS_03590 354055 355311 gene locus_tag LOCUS_03600 gene mmp10 354055 355311 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876794.1 protein_id gnl|my_center|LOCUS_03600 355330 356559 gene locus_tag LOCUS_03610 gene mmp10 355330 356559 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876794.1 protein_id gnl|my_center|LOCUS_03610 358674 357529 gene locus_tag LOCUS_03620 358674 357529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 360310 359348 gene locus_tag LOCUS_03630 360310 359348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 360452 362989 gene locus_tag LOCUS_03640 360452 362989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 363268 364215 gene locus_tag LOCUS_03650 363268 364215 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868306.1 protein_id gnl|my_center|LOCUS_03650 364823 365044 gene locus_tag LOCUS_03660 364823 365044 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876887.1 protein_id gnl|my_center|LOCUS_03660 365197 365364 gene locus_tag LOCUS_03670 365197 365364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 365645 365361 gene locus_tag LOCUS_03680 365645 365361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 367981 365915 gene locus_tag LOCUS_03690 367981 365915 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470194.1 protein_id gnl|my_center|LOCUS_03690 368874 367984 gene locus_tag LOCUS_03700 368874 367984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 369332 369102 gene locus_tag LOCUS_03710 369332 369102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 369558 369779 gene locus_tag LOCUS_03720 369558 369779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 370682 369849 gene locus_tag LOCUS_03730 370682 369849 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_03730 371188 371745 gene locus_tag LOCUS_03740 371188 371745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 372317 371814 gene locus_tag LOCUS_03750 372317 371814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 372791 372366 gene locus_tag LOCUS_03760 372791 372366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 373468 373073 gene locus_tag LOCUS_03770 373468 373073 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979747.1 protein_id gnl|my_center|LOCUS_03770 373713 373465 gene locus_tag LOCUS_03780 373713 373465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 373961 374095 gene locus_tag LOCUS_03790 373961 374095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 374283 374801 gene locus_tag LOCUS_03800 374283 374801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 374970 375635 gene locus_tag LOCUS_03810 374970 375635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 376026 375706 gene locus_tag LOCUS_03820 376026 375706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 376385 376122 gene locus_tag LOCUS_03830 376385 376122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 377535 377894 gene locus_tag LOCUS_03840 377535 377894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 377936 378184 gene locus_tag LOCUS_03850 377936 378184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 378135 378755 gene locus_tag LOCUS_03860 378135 378755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03860 378829 380046 gene locus_tag LOCUS_03870 378829 380046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 380340 381848 gene locus_tag LOCUS_03880 380340 381848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 381871 385614 gene locus_tag LOCUS_03890 381871 385614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 385611 386894 gene locus_tag LOCUS_03900 385611 386894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 386925 387818 gene locus_tag LOCUS_03910 386925 387818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 387901 390462 gene locus_tag LOCUS_03920 387901 390462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 390475 392367 gene locus_tag LOCUS_03930 390475 392367 CDS product DUF2357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876141.1 protein_id gnl|my_center|LOCUS_03930 392662 392844 gene locus_tag LOCUS_03940 392662 392844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 392952 393890 gene locus_tag LOCUS_03950 392952 393890 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_03950 394007 394177 gene locus_tag LOCUS_03960 394007 394177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 394461 394318 gene locus_tag LOCUS_03970 394461 394318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 394836 396023 gene locus_tag LOCUS_03980 394836 396023 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065244.1 protein_id gnl|my_center|LOCUS_03980 396181 396489 gene locus_tag LOCUS_03990 396181 396489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 396706 396915 gene locus_tag LOCUS_04000 396706 396915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 396882 397322 gene locus_tag LOCUS_04010 396882 397322 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048201672.1 protein_id gnl|my_center|LOCUS_04010 397522 397340 gene locus_tag LOCUS_04020 397522 397340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 397791 398570 gene locus_tag LOCUS_04030 397791 398570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 398596 399711 gene locus_tag LOCUS_04040 398596 399711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04040 399714 400349 gene locus_tag LOCUS_04050 399714 400349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04050 400812 400384 gene locus_tag LOCUS_04060 400812 400384 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250661.1 protein_id gnl|my_center|LOCUS_04060 401233 400802 gene locus_tag LOCUS_04070 401233 400802 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391729.1 protein_id gnl|my_center|LOCUS_04070 401837 401244 gene locus_tag LOCUS_04080 401837 401244 CDS product CRISPR-associated transcriptional regulator Csa3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061223.1 protein_id gnl|my_center|LOCUS_04080 402128 402445 gene locus_tag LOCUS_04090 402128 402445 CDS product DUF4064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876159.1 protein_id gnl|my_center|LOCUS_04090 402462 402884 gene locus_tag LOCUS_04100 402462 402884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876158.1 protein_id gnl|my_center|LOCUS_04100 402932 403285 gene locus_tag LOCUS_04110 402932 403285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 403300 404223 gene locus_tag LOCUS_04120 403300 404223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876151.1 protein_id gnl|my_center|LOCUS_04120 404473 404225 gene locus_tag LOCUS_04130 404473 404225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 404717 405277 gene locus_tag LOCUS_04140 404717 405277 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875693.1 protein_id gnl|my_center|LOCUS_04140 407305 405734 gene locus_tag LOCUS_04150 407305 405734 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025727111.1 protein_id gnl|my_center|LOCUS_04150 408038 407697 gene locus_tag LOCUS_04160 408038 407697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 408448 408035 gene locus_tag LOCUS_04170 408448 408035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 408577 408753 gene locus_tag LOCUS_04180 408577 408753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 408707 408880 gene locus_tag LOCUS_04190 408707 408880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 409418 409137 gene locus_tag LOCUS_04200 409418 409137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 409797 410216 gene locus_tag LOCUS_04210 409797 410216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 410293 410670 gene locus_tag LOCUS_04220 410293 410670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 410948 411850 gene locus_tag LOCUS_04230 410948 411850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 412631 411975 gene locus_tag LOCUS_04240 412631 411975 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875755.1 protein_id gnl|my_center|LOCUS_04240 413359 412754 gene locus_tag LOCUS_04250 413359 412754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 413487 414389 gene locus_tag LOCUS_04260 413487 414389 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876994.1 protein_id gnl|my_center|LOCUS_04260 414541 415500 gene locus_tag LOCUS_04270 414541 415500 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_04270 415589 416326 gene locus_tag LOCUS_04280 415589 416326 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_04280 416388 417128 gene locus_tag LOCUS_04290 416388 417128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_04290 417438 417280 gene locus_tag LOCUS_04300 417438 417280 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295425.1 protein_id gnl|my_center|LOCUS_04300 418129 417677 gene locus_tag LOCUS_04310 418129 417677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 418931 418737 gene locus_tag LOCUS_04320 418931 418737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 419223 418972 gene locus_tag LOCUS_04330 419223 418972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 419403 419861 gene locus_tag LOCUS_04340 419403 419861 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876689.1 protein_id gnl|my_center|LOCUS_04340 419918 421654 gene locus_tag LOCUS_04350 419918 421654 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020243.1 protein_id gnl|my_center|LOCUS_04350 421936 422559 gene locus_tag LOCUS_04360 421936 422559 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876687.1 protein_id gnl|my_center|LOCUS_04360 423490 423278 gene locus_tag LOCUS_04370 423490 423278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 423867 425018 gene locus_tag LOCUS_04380 423867 425018 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022050.1 protein_id gnl|my_center|LOCUS_04380 426410 425043 gene locus_tag LOCUS_04390 426410 425043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 426487 426666 gene locus_tag LOCUS_04400 426487 426666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 427639 426755 gene locus_tag LOCUS_04410 427639 426755 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107264.1 protein_id gnl|my_center|LOCUS_04410 428288 427632 gene locus_tag LOCUS_04420 428288 427632 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990882.1 protein_id gnl|my_center|LOCUS_04420 428609 429052 gene locus_tag LOCUS_04430 428609 429052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 429893 429198 gene locus_tag LOCUS_04440 429893 429198 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022181.1 protein_id gnl|my_center|LOCUS_04440 430814 429948 gene locus_tag LOCUS_04450 430814 429948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 431355 431669 gene locus_tag LOCUS_04460 431355 431669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 432574 431720 gene locus_tag LOCUS_04470 432574 431720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 433000 433770 gene locus_tag LOCUS_04480 433000 433770 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404795.1 protein_id gnl|my_center|LOCUS_04480 433814 434704 gene locus_tag LOCUS_04490 gene ligD 433814 434704 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392997.1 protein_id gnl|my_center|LOCUS_04490 434739 435050 gene locus_tag LOCUS_04500 434739 435050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 435375 436856 gene locus_tag LOCUS_04510 435375 436856 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_04510 437252 437875 gene locus_tag LOCUS_04520 437252 437875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 438018 439256 gene locus_tag LOCUS_04530 438018 439256 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_04530 439409 439672 gene locus_tag LOCUS_04540 439409 439672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 440240 439743 gene locus_tag LOCUS_04550 440240 439743 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877509.1 protein_id gnl|my_center|LOCUS_04550 441287 440841 gene locus_tag LOCUS_04560 441287 440841 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485814.1 protein_id gnl|my_center|LOCUS_04560 441948 441499 gene locus_tag LOCUS_04570 441948 441499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 442866 441997 gene locus_tag LOCUS_04580 442866 441997 CDS product methanogen output domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876086.1 protein_id gnl|my_center|LOCUS_04580 443435 443133 gene locus_tag LOCUS_04590 443435 443133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 444147 443569 gene locus_tag LOCUS_04600 444147 443569 CDS product protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846965.1 protein_id gnl|my_center|LOCUS_04600 444694 445962 gene locus_tag LOCUS_04610 444694 445962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 446455 446826 gene locus_tag LOCUS_04620 446455 446826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 447458 447000 gene locus_tag LOCUS_04630 447458 447000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 448150 447593 gene locus_tag LOCUS_04640 448150 447593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 449226 448420 gene locus_tag LOCUS_04650 449226 448420 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_04650 449917 451329 gene locus_tag LOCUS_04660 449917 451329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 452054 451383 gene locus_tag LOCUS_04670 452054 451383 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_04670 453098 452109 gene locus_tag LOCUS_04680 453098 452109 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060741.1 protein_id gnl|my_center|LOCUS_04680 453241 460065 gene locus_tag LOCUS_04690 453241 460065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04690 460100 461143 gene locus_tag LOCUS_04700 460100 461143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04700 461160 461441 gene locus_tag LOCUS_04710 461160 461441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 461506 461799 gene locus_tag LOCUS_04720 461506 461799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 461817 463835 gene locus_tag LOCUS_04730 461817 463835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 463822 464556 gene locus_tag LOCUS_04740 463822 464556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04740 464526 464819 gene locus_tag LOCUS_04750 464526 464819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04750 464922 465236 gene locus_tag LOCUS_04760 464922 465236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 465411 466031 gene locus_tag LOCUS_04770 465411 466031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 466156 466323 gene locus_tag LOCUS_04780 466156 466323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 468098 466686 gene locus_tag LOCUS_04790 468098 466686 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061146.1 protein_id gnl|my_center|LOCUS_04790 468377 469129 gene locus_tag LOCUS_04800 gene nucS 468377 469129 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061145.1 protein_id gnl|my_center|LOCUS_04800 469369 469833 gene locus_tag LOCUS_04810 469369 469833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 470284 471798 gene locus_tag LOCUS_04820 470284 471798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 472263 471865 gene locus_tag LOCUS_04830 472263 471865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876177.1 protein_id gnl|my_center|LOCUS_04830 472360 472593 gene locus_tag LOCUS_04840 472360 472593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 473192 472626 gene locus_tag LOCUS_04850 473192 472626 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877408.1 protein_id gnl|my_center|LOCUS_04850 473472 474281 gene locus_tag LOCUS_04860 473472 474281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 474364 475176 gene locus_tag LOCUS_04870 474364 475176 CDS product AAC(3)-VI family aminoglycoside N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969832.1 protein_id gnl|my_center|LOCUS_04870 475202 475705 gene locus_tag LOCUS_04880 475202 475705 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799620.1 protein_id gnl|my_center|LOCUS_04880 475739 476233 gene locus_tag LOCUS_04890 475739 476233 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_04890 476240 476779 gene locus_tag LOCUS_04900 476240 476779 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 protein_id gnl|my_center|LOCUS_04900 476840 477316 gene locus_tag LOCUS_04910 476840 477316 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948144.1 protein_id gnl|my_center|LOCUS_04910 477372 477833 gene locus_tag LOCUS_04920 477372 477833 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206072.1 protein_id gnl|my_center|LOCUS_04920 477886 478308 gene locus_tag LOCUS_04930 477886 478308 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171561.1 protein_id gnl|my_center|LOCUS_04930 478382 478813 gene locus_tag LOCUS_04940 478382 478813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 479279 480259 gene locus_tag LOCUS_04950 479279 480259 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967612.1 protein_id gnl|my_center|LOCUS_04950 480278 480412 gene locus_tag LOCUS_04960 480278 480412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04960 480457 481131 gene locus_tag LOCUS_04970 480457 481131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04970 481464 482414 gene locus_tag LOCUS_04980 481464 482414 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060981.1 protein_id gnl|my_center|LOCUS_04980 482646 483401 gene locus_tag LOCUS_04990 482646 483401 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877405.1 protein_id gnl|my_center|LOCUS_04990 483495 486074 gene locus_tag LOCUS_05000 483495 486074 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877404.1 protein_id gnl|my_center|LOCUS_05000 486431 486117 gene locus_tag LOCUS_05010 486431 486117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 487125 486541 gene locus_tag LOCUS_05020 487125 486541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 488037 487243 gene locus_tag LOCUS_05030 488037 487243 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485751.1 protein_id gnl|my_center|LOCUS_05030 488932 488186 gene locus_tag LOCUS_05040 488932 488186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876244.1 protein_id gnl|my_center|LOCUS_05040 488926 489129 gene locus_tag LOCUS_05050 488926 489129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 490052 489081 gene locus_tag LOCUS_05060 490052 489081 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020082.1 protein_id gnl|my_center|LOCUS_05060 492288 490183 gene locus_tag LOCUS_05070 492288 490183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 492836 492453 gene locus_tag LOCUS_05080 492836 492453 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876242.1 protein_id gnl|my_center|LOCUS_05080 495001 492902 gene locus_tag LOCUS_05090 495001 492902 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_05090 495314 495123 gene locus_tag LOCUS_05100 495314 495123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 497158 496088 gene locus_tag LOCUS_05110 497158 496088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 498641 497541 gene locus_tag LOCUS_05120 498641 497541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 500461 499265 gene locus_tag LOCUS_05130 500461 499265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 501714 500992 gene locus_tag LOCUS_05140 501714 500992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876163.1 protein_id gnl|my_center|LOCUS_05140 502118 502426 gene locus_tag LOCUS_05150 502118 502426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 502430 502921 gene locus_tag LOCUS_05160 502430 502921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 503158 503406 gene locus_tag LOCUS_05170 503158 503406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 503393 503782 gene locus_tag LOCUS_05180 503393 503782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 505700 504243 gene locus_tag LOCUS_05190 505700 504243 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871161.1 protein_id gnl|my_center|LOCUS_05190 507147 505963 gene locus_tag LOCUS_05200 507147 505963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 507469 507726 gene locus_tag LOCUS_05210 507469 507726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 507723 508112 gene locus_tag LOCUS_05220 507723 508112 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904050.1 protein_id gnl|my_center|LOCUS_05220 508562 508380 gene locus_tag LOCUS_05230 508562 508380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 508866 508555 gene locus_tag LOCUS_05240 508866 508555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 509310 509032 gene locus_tag LOCUS_05250 509310 509032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05250 510186 510698 gene locus_tag LOCUS_05260 510186 510698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 510878 511753 gene locus_tag LOCUS_05270 510878 511753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 511842 512396 gene locus_tag LOCUS_05280 511842 512396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 512847 512656 gene locus_tag LOCUS_05290 512847 512656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 513407 513042 gene locus_tag LOCUS_05300 513407 513042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 513394 513672 gene locus_tag LOCUS_05310 513394 513672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 514874 514065 gene locus_tag LOCUS_05320 514874 514065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 515959 516819 gene locus_tag LOCUS_05330 515959 516819 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_05330 517136 518347 gene locus_tag LOCUS_05340 517136 518347 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837186.1 protein_id gnl|my_center|LOCUS_05340 518629 519483 gene locus_tag LOCUS_05350 518629 519483 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250673.1 protein_id gnl|my_center|LOCUS_05350 519662 520786 gene locus_tag LOCUS_05360 519662 520786 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023660.1 protein_id gnl|my_center|LOCUS_05360 520783 521976 gene locus_tag LOCUS_05370 520783 521976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 521997 523943 gene locus_tag LOCUS_05380 521997 523943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 525034 524033 gene locus_tag LOCUS_05390 525034 524033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 525969 525043 gene locus_tag LOCUS_05400 525969 525043 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112595.1 protein_id gnl|my_center|LOCUS_05400 526917 526069 gene locus_tag LOCUS_05410 526917 526069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 527620 527802 gene locus_tag LOCUS_05420 527620 527802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 528436 527924 gene locus_tag LOCUS_05430 528436 527924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 534668 529371 gene locus_tag LOCUS_05440 534668 529371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 535179 536612 gene locus_tag LOCUS_05450 535179 536612 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_05450 537136 538029 gene locus_tag LOCUS_05460 537136 538029 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_05460 538229 539179 gene locus_tag LOCUS_05470 538229 539179 CDS product DUF166 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061232.1 protein_id gnl|my_center|LOCUS_05470 540551 539226 gene locus_tag LOCUS_05480 540551 539226 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879940.1 protein_id gnl|my_center|LOCUS_05480 540952 541668 gene locus_tag LOCUS_05490 540952 541668 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875869.1 protein_id gnl|my_center|LOCUS_05490 542002 543759 gene locus_tag LOCUS_05500 542002 543759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 544139 543948 gene locus_tag LOCUS_05510 544139 543948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 544307 545464 gene locus_tag LOCUS_05520 544307 545464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 545475 549197 gene locus_tag LOCUS_05530 545475 549197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 549425 550222 gene locus_tag LOCUS_05540 549425 550222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_05540 550293 551471 gene locus_tag LOCUS_05550 550293 551471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 551475 552446 gene locus_tag LOCUS_05560 551475 552446 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_05560 554002 552494 gene locus_tag LOCUS_05570 554002 552494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 555277 554108 gene locus_tag LOCUS_05580 555277 554108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 556940 555537 gene locus_tag LOCUS_05590 556940 555537 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_05590 557315 559423 gene locus_tag LOCUS_05600 557315 559423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 560624 559440 gene locus_tag LOCUS_05610 560624 559440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 561839 560679 gene locus_tag LOCUS_05620 561839 560679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 562596 564581 gene locus_tag LOCUS_05630 562596 564581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 564655 566601 gene locus_tag LOCUS_05640 564655 566601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 567723 566704 gene locus_tag LOCUS_05650 567723 566704 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793191.1 protein_id gnl|my_center|LOCUS_05650 568129 567983 gene locus_tag LOCUS_05660 568129 567983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 569146 568349 gene locus_tag LOCUS_05670 569146 568349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 570551 569247 gene locus_tag LOCUS_05680 570551 569247 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 protein_id gnl|my_center|LOCUS_05680 572073 570556 gene locus_tag LOCUS_05690 572073 570556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 577094 572535 gene locus_tag LOCUS_05700 577094 572535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 578273 577161 gene locus_tag LOCUS_05710 gene glf 578273 577161 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_05710 579247 578366 gene locus_tag LOCUS_05720 579247 578366 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_05720 579478 579915 gene locus_tag LOCUS_05730 579478 579915 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060880.1 protein_id gnl|my_center|LOCUS_05730 579918 580880 gene locus_tag LOCUS_05740 579918 580880 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876331.1 protein_id gnl|my_center|LOCUS_05740 582497 580986 gene locus_tag LOCUS_05750 582497 580986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 582897 583655 gene locus_tag LOCUS_05760 gene cobM 582897 583655 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876241.1 protein_id gnl|my_center|LOCUS_05760 583681 584196 gene locus_tag LOCUS_05770 583681 584196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 584777 584274 gene locus_tag LOCUS_05780 584777 584274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875838.1 protein_id gnl|my_center|LOCUS_05780 585406 584777 gene locus_tag LOCUS_05790 585406 584777 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875839.1 protein_id gnl|my_center|LOCUS_05790 586014 585580 gene locus_tag LOCUS_05800 586014 585580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 586648 589521 gene locus_tag LOCUS_05810 586648 589521 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876312.1 protein_id gnl|my_center|LOCUS_05810 589862 589602 gene locus_tag LOCUS_05820 589862 589602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 589987 589802 gene locus_tag LOCUS_05830 589987 589802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 590300 589980 gene locus_tag LOCUS_05840 590300 589980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 590535 590606 gene locus_tag LOCUS_t00040 590535 590606 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 590844 590614 gene locus_tag LOCUS_05850 590844 590614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 591037 591405 gene locus_tag LOCUS_05860 591037 591405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 591684 591364 gene locus_tag LOCUS_05870 591684 591364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 592239 591847 gene locus_tag LOCUS_05880 592239 591847 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464385.1 protein_id gnl|my_center|LOCUS_05880 593814 592375 gene locus_tag LOCUS_05890 gene ectB 593814 592375 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 protein_id gnl|my_center|LOCUS_05890 594373 593816 gene locus_tag LOCUS_05900 gene ectA 594373 593816 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930801.1 protein_id gnl|my_center|LOCUS_05900 595520 594498 gene locus_tag LOCUS_05910 595520 594498 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876254.1 protein_id gnl|my_center|LOCUS_05910 596151 595795 gene locus_tag LOCUS_05920 596151 595795 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892103.1 protein_id gnl|my_center|LOCUS_05920 596211 596900 gene locus_tag LOCUS_05930 596211 596900 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876968.1 protein_id gnl|my_center|LOCUS_05930 597442 596897 gene locus_tag LOCUS_05940 597442 596897 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876447.1 protein_id gnl|my_center|LOCUS_05940 598079 597525 gene locus_tag LOCUS_05950 598079 597525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 598533 598150 gene locus_tag LOCUS_05960 598533 598150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 598926 598567 gene locus_tag LOCUS_05970 598926 598567 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956716.1 protein_id gnl|my_center|LOCUS_05970 599496 600200 gene locus_tag LOCUS_05980 599496 600200 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024122.1 protein_id gnl|my_center|LOCUS_05980 600234 600968 gene locus_tag LOCUS_05990 600234 600968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 601929 600976 gene locus_tag LOCUS_06000 601929 600976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 602767 603159 gene locus_tag LOCUS_06010 602767 603159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 603728 603483 gene locus_tag LOCUS_06020 603728 603483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 606350 603969 gene locus_tag LOCUS_06030 gene lon 606350 603969 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021863.1 protein_id gnl|my_center|LOCUS_06030 606810 606427 gene locus_tag LOCUS_06040 606810 606427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 608736 607057 gene locus_tag LOCUS_06050 gene gltX 608736 607057 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875691.1 protein_id gnl|my_center|LOCUS_06050 609798 608812 gene locus_tag LOCUS_06060 gene idsA 609798 608812 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_06060 611165 609816 gene locus_tag LOCUS_06070 611165 609816 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875689.1 protein_id gnl|my_center|LOCUS_06070 612220 611165 gene locus_tag LOCUS_06080 gene fni 612220 611165 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_06080 613106 612315 gene locus_tag LOCUS_06090 613106 612315 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_06090 614207 613215 gene locus_tag LOCUS_06100 gene mvk 614207 613215 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875686.1 protein_id gnl|my_center|LOCUS_06100 615157 614303 gene locus_tag LOCUS_06110 gene amrB 615157 614303 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_06110 615885 615289 gene locus_tag LOCUS_06120 gene rpsB 615885 615289 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875684.1 protein_id gnl|my_center|LOCUS_06120 616260 616069 gene locus_tag LOCUS_06130 616260 616069 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496418.1 protein_id gnl|my_center|LOCUS_06130 617598 616342 gene locus_tag LOCUS_06140 gene eno 617598 616342 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_06140 617915 617700 gene locus_tag LOCUS_06150 617915 617700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 618294 618127 gene locus_tag LOCUS_06160 618294 618127 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875681.1 protein_id gnl|my_center|LOCUS_06160 618833 618432 gene locus_tag LOCUS_06170 618833 618432 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_06170 619310 618888 gene locus_tag LOCUS_06180 gene rplM 619310 618888 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 protein_id gnl|my_center|LOCUS_06180 619704 619348 gene locus_tag LOCUS_06190 619704 619348 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_06190 620502 619705 gene locus_tag LOCUS_06200 620502 619705 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_06200 620895 620503 gene locus_tag LOCUS_06210 620895 620503 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875677.1 protein_id gnl|my_center|LOCUS_06210 621441 620914 gene locus_tag LOCUS_06220 gene rpsD 621441 620914 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875676.1 protein_id gnl|my_center|LOCUS_06220 621914 621462 gene locus_tag LOCUS_06230 621914 621462 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875675.1 protein_id gnl|my_center|LOCUS_06230 622147 622061 gene locus_tag LOCUS_t00050 622147 622061 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 623204 622242 gene locus_tag LOCUS_06240 623204 622242 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060731.1 protein_id gnl|my_center|LOCUS_06240 623502 623272 gene locus_tag LOCUS_06250 623502 623272 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875673.1 protein_id gnl|my_center|LOCUS_06250 624137 623619 gene locus_tag LOCUS_06260 624137 623619 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870161.1 protein_id gnl|my_center|LOCUS_06260 625101 624505 gene locus_tag LOCUS_06270 625101 624505 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875670.1 protein_id gnl|my_center|LOCUS_06270 625738 625181 gene locus_tag LOCUS_06280 625738 625181 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060730.1 protein_id gnl|my_center|LOCUS_06280 627150 625810 gene locus_tag LOCUS_06290 gene secY 627150 625810 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875668.1 protein_id gnl|my_center|LOCUS_06290 627673 627236 gene locus_tag LOCUS_06300 627673 627236 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875667.1 protein_id gnl|my_center|LOCUS_06300 628160 627705 gene locus_tag LOCUS_06310 gene rpmD 628160 627705 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875666.1 protein_id gnl|my_center|LOCUS_06310 628907 628215 gene locus_tag LOCUS_06320 gene rpsE 628907 628215 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192961070.1 protein_id gnl|my_center|LOCUS_06320 629485 628904 gene locus_tag LOCUS_06330 629485 628904 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875664.1 protein_id gnl|my_center|LOCUS_06330 629948 629502 gene locus_tag LOCUS_06340 629948 629502 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875663.1 protein_id gnl|my_center|LOCUS_06340 630412 630083 gene locus_tag LOCUS_06350 630412 630083 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875662.1 protein_id gnl|my_center|LOCUS_06350 630962 630429 gene locus_tag LOCUS_06360 630962 630429 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 protein_id gnl|my_center|LOCUS_06360 631366 630974 gene locus_tag LOCUS_06370 631366 630974 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060728.1 protein_id gnl|my_center|LOCUS_06370 632033 631524 gene locus_tag LOCUS_06380 632033 631524 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875658.1 protein_id gnl|my_center|LOCUS_06380 632764 632036 gene locus_tag LOCUS_06390 632764 632036 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_06390 633119 632766 gene locus_tag LOCUS_06400 gene rplX 633119 632766 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875656.1 protein_id gnl|my_center|LOCUS_06400 633584 633186 gene locus_tag LOCUS_06410 633584 633186 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875655.1 protein_id gnl|my_center|LOCUS_06410 633903 633586 gene locus_tag LOCUS_06420 633903 633586 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875654.1 protein_id gnl|my_center|LOCUS_06420 634248 633964 gene locus_tag LOCUS_06430 634248 633964 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875653.1 protein_id gnl|my_center|LOCUS_06430 634616 634275 gene locus_tag LOCUS_06440 gene yciH 634616 634275 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875652.1 protein_id gnl|my_center|LOCUS_06440 634829 634617 gene locus_tag LOCUS_06450 gene rpmC 634829 634617 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875651.1 protein_id gnl|my_center|LOCUS_06450 635967 634870 gene locus_tag LOCUS_06460 635967 634870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 636425 635967 gene locus_tag LOCUS_06470 gene rplV 636425 635967 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875649.1 protein_id gnl|my_center|LOCUS_06470 636848 636438 gene locus_tag LOCUS_06480 gene rpsS 636848 636438 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875648.1 protein_id gnl|my_center|LOCUS_06480 637662 636937 gene locus_tag LOCUS_06490 637662 636937 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_06490 637954 637694 gene locus_tag LOCUS_06500 637954 637694 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060727.1 protein_id gnl|my_center|LOCUS_06500 638757 637969 gene locus_tag LOCUS_06510 gene rpl4p 638757 637969 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 protein_id gnl|my_center|LOCUS_06510 639815 638805 gene locus_tag LOCUS_06520 gene rpl3p 639815 638805 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875644.1 protein_id gnl|my_center|LOCUS_06520 640681 639869 gene locus_tag LOCUS_06530 640681 639869 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875643.1 protein_id gnl|my_center|LOCUS_06530 641233 640931 gene locus_tag LOCUS_06540 641233 640931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 641833 641261 gene locus_tag LOCUS_06550 641833 641261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 641919 642278 gene locus_tag LOCUS_06560 641919 642278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 643033 642380 gene locus_tag LOCUS_06570 643033 642380 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892753.1 protein_id gnl|my_center|LOCUS_06570 643013 643228 gene locus_tag LOCUS_06580 643013 643228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 643275 644759 gene locus_tag LOCUS_06590 643275 644759 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877513.1 protein_id gnl|my_center|LOCUS_06590 644789 645652 gene locus_tag LOCUS_06600 644789 645652 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_06600 646872 645817 gene locus_tag LOCUS_06610 gene rtcA 646872 645817 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877511.1 protein_id gnl|my_center|LOCUS_06610 648068 646914 gene locus_tag LOCUS_06620 648068 646914 CDS product TIGR03576 family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877510.1 protein_id gnl|my_center|LOCUS_06620 648606 648100 gene locus_tag LOCUS_06630 648606 648100 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877509.1 protein_id gnl|my_center|LOCUS_06630 649388 649050 gene locus_tag LOCUS_06640 649388 649050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877508.1 protein_id gnl|my_center|LOCUS_06640 650402 649608 gene locus_tag LOCUS_06650 650402 649608 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 protein_id gnl|my_center|LOCUS_06650 650916 650371 gene locus_tag LOCUS_06660 650916 650371 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485798.1 protein_id gnl|my_center|LOCUS_06660 651129 652946 gene locus_tag LOCUS_06670 651129 652946 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877505.1 protein_id gnl|my_center|LOCUS_06670 653320 653042 gene locus_tag LOCUS_06680 653320 653042 CDS product DUF5379 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877504.1 protein_id gnl|my_center|LOCUS_06680 654184 653969 gene locus_tag LOCUS_06690 654184 653969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 654371 656359 gene locus_tag LOCUS_06700 gene rqcH 654371 656359 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061171.1 protein_id gnl|my_center|LOCUS_06700 656806 656375 gene locus_tag LOCUS_06710 656806 656375 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146813.1 protein_id gnl|my_center|LOCUS_06710 657080 656811 gene locus_tag LOCUS_06720 657080 656811 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879678.1 protein_id gnl|my_center|LOCUS_06720 657481 658029 gene locus_tag LOCUS_06730 657481 658029 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 protein_id gnl|my_center|LOCUS_06730 658095 659780 gene locus_tag LOCUS_06740 658095 659780 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_06740 660151 659816 gene locus_tag LOCUS_06750 660151 659816 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877501.1 protein_id gnl|my_center|LOCUS_06750 660563 660135 gene locus_tag LOCUS_06760 660563 660135 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877500.1 protein_id gnl|my_center|LOCUS_06760 661206 660571 gene locus_tag LOCUS_06770 661206 660571 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877499.1 protein_id gnl|my_center|LOCUS_06770 661963 661265 gene locus_tag LOCUS_06780 661963 661265 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877498.1 protein_id gnl|my_center|LOCUS_06780 663690 662185 gene locus_tag LOCUS_06790 663690 662185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877497.1 protein_id gnl|my_center|LOCUS_06790 663962 664138 gene locus_tag LOCUS_06800 663962 664138 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061337.1 protein_id gnl|my_center|LOCUS_06800 664772 664176 gene locus_tag LOCUS_06810 664772 664176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061169.1 protein_id gnl|my_center|LOCUS_06810 664971 665150 gene locus_tag LOCUS_06820 664971 665150 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061337.1 protein_id gnl|my_center|LOCUS_06820 665182 665355 gene locus_tag LOCUS_06830 665182 665355 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750464.1 protein_id gnl|my_center|LOCUS_06830 666379 665447 gene locus_tag LOCUS_06840 666379 665447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 667209 667853 gene locus_tag LOCUS_06850 667209 667853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 667943 668860 gene locus_tag LOCUS_06860 667943 668860 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_06860 668891 669808 gene locus_tag LOCUS_06870 668891 669808 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_06870 670855 669893 gene locus_tag LOCUS_06880 670855 669893 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965609.1 protein_id gnl|my_center|LOCUS_06880 671610 670876 gene locus_tag LOCUS_06890 671610 670876 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750438.1 protein_id gnl|my_center|LOCUS_06890 672294 671635 gene locus_tag LOCUS_06900 672294 671635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 673741 672317 gene locus_tag LOCUS_06910 673741 672317 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_06910 674931 673753 gene locus_tag LOCUS_06920 674931 673753 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_06920 675483 674974 gene locus_tag LOCUS_06930 675483 674974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 677085 676699 gene locus_tag LOCUS_06940 677085 676699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 678901 678464 gene locus_tag LOCUS_06950 678901 678464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 679617 679844 gene locus_tag LOCUS_06960 679617 679844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 680564 680040 gene locus_tag LOCUS_06970 gene yjjX 680564 680040 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061167.1 protein_id gnl|my_center|LOCUS_06970 681178 680714 gene locus_tag LOCUS_06980 681178 680714 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_06980 681233 682801 gene locus_tag LOCUS_06990 681233 682801 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877491.1 protein_id gnl|my_center|LOCUS_06990 684146 682788 gene locus_tag LOCUS_07000 684146 682788 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876185.1 protein_id gnl|my_center|LOCUS_07000 684280 685392 gene locus_tag LOCUS_07010 gene gntC 684280 685392 CDS product guanitoxin biosynthesis PLP-dependent (S)-gamma-hydroxy-L-arginine cyclodehydratase GntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061335.1 protein_id gnl|my_center|LOCUS_07010 685767 685402 gene locus_tag LOCUS_07020 685767 685402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 686128 685769 gene locus_tag LOCUS_07030 686128 685769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 686299 686811 gene locus_tag LOCUS_07040 686299 686811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07040 686820 687200 gene locus_tag LOCUS_07050 686820 687200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07050 687224 688051 gene locus_tag LOCUS_07060 687224 688051 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020389.1 protein_id gnl|my_center|LOCUS_07060 688096 689286 gene locus_tag LOCUS_07070 688096 689286 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939637.1 protein_id gnl|my_center|LOCUS_07070 689283 690269 gene locus_tag LOCUS_07080 689283 690269 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274470.1 protein_id gnl|my_center|LOCUS_07080 690822 690322 gene locus_tag LOCUS_07090 690822 690322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 691017 690930 gene locus_tag LOCUS_t00060 691017 690930 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 692384 691065 gene locus_tag LOCUS_07100 692384 691065 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_07100 692541 693617 gene locus_tag LOCUS_07110 692541 693617 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_07110 693649 693828 gene locus_tag LOCUS_07120 693649 693828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 694787 694137 gene locus_tag LOCUS_07130 694787 694137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 695418 694792 gene locus_tag LOCUS_07140 695418 694792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 695729 696703 gene locus_tag LOCUS_07150 695729 696703 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877487.1 protein_id gnl|my_center|LOCUS_07150 696827 698056 gene locus_tag LOCUS_07160 696827 698056 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060773.1 protein_id gnl|my_center|LOCUS_07160 698208 698621 gene locus_tag LOCUS_07170 698208 698621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875858.1 protein_id gnl|my_center|LOCUS_07170 698887 699825 gene locus_tag LOCUS_07180 698887 699825 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892361.1 protein_id gnl|my_center|LOCUS_07180 699897 700337 gene locus_tag LOCUS_07190 699897 700337 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_07190 700347 701498 gene locus_tag LOCUS_07200 700347 701498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 702081 701689 gene locus_tag LOCUS_07210 702081 701689 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877486.1 protein_id gnl|my_center|LOCUS_07210 703101 702202 gene locus_tag LOCUS_07220 703101 702202 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877485.1 protein_id gnl|my_center|LOCUS_07220 703879 703211 gene locus_tag LOCUS_07230 703879 703211 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_07230 704482 703946 gene locus_tag LOCUS_07240 704482 703946 CDS product DUF2096 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877483.1 protein_id gnl|my_center|LOCUS_07240 704941 705255 gene locus_tag LOCUS_07250 704941 705255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 705396 706190 gene locus_tag LOCUS_07260 705396 706190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 706388 707305 gene locus_tag LOCUS_07270 706388 707305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07270 707283 708275 gene locus_tag LOCUS_07280 707283 708275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07280 708814 713409 gene locus_tag LOCUS_07290 708814 713409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 715171 714020 gene locus_tag LOCUS_07300 715171 714020 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_07300 716248 715193 gene locus_tag LOCUS_07310 716248 715193 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_07310 716461 717069 gene locus_tag LOCUS_07320 716461 717069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 717448 717089 gene locus_tag LOCUS_07330 717448 717089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 718282 717530 gene locus_tag LOCUS_07340 718282 717530 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876497.1 protein_id gnl|my_center|LOCUS_07340 718447 718686 gene locus_tag LOCUS_07350 718447 718686 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060916.1 protein_id gnl|my_center|LOCUS_07350 719158 718754 gene locus_tag LOCUS_07360 719158 718754 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767551.1 protein_id gnl|my_center|LOCUS_07360 719665 719174 gene locus_tag LOCUS_07370 gene msrA 719665 719174 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_07370 721202 719775 gene locus_tag LOCUS_07380 721202 719775 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392258.1 protein_id gnl|my_center|LOCUS_07380 722231 721293 gene locus_tag LOCUS_07390 722231 721293 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876130.1 protein_id gnl|my_center|LOCUS_07390 722379 722930 gene locus_tag LOCUS_07400 722379 722930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 722969 723045 gene locus_tag LOCUS_t00070 722969 723045 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 723079 723408 gene locus_tag LOCUS_07410 723079 723408 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021618.1 protein_id gnl|my_center|LOCUS_07410 723820 723422 gene locus_tag LOCUS_07420 723820 723422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 724203 724886 gene locus_tag LOCUS_07430 724203 724886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876163.1 protein_id gnl|my_center|LOCUS_07430 725111 725410 gene locus_tag LOCUS_07440 725111 725410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 725407 725799 gene locus_tag LOCUS_07450 725407 725799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 726184 726450 gene locus_tag LOCUS_07460 726184 726450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 726447 726875 gene locus_tag LOCUS_07470 726447 726875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 727589 727395 gene locus_tag LOCUS_07480 727589 727395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 727765 727613 gene locus_tag LOCUS_07490 727765 727613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 728095 728397 gene locus_tag LOCUS_07500 728095 728397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 728385 728618 gene locus_tag LOCUS_07510 728385 728618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 728984 729241 gene locus_tag LOCUS_07520 728984 729241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 729238 729627 gene locus_tag LOCUS_07530 729238 729627 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904050.1 protein_id gnl|my_center|LOCUS_07530 730083 729742 gene locus_tag LOCUS_07540 730083 729742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 730481 730080 gene locus_tag LOCUS_07550 730481 730080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 730641 730919 gene locus_tag LOCUS_07560 730641 730919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 731893 731153 gene locus_tag LOCUS_07570 731893 731153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 732236 732910 gene locus_tag LOCUS_07580 732236 732910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 733167 734195 gene locus_tag LOCUS_07590 gene coxFIC1 733167 734195 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_07590 734671 734474 gene locus_tag LOCUS_07600 734671 734474 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_07600 736154 734700 gene locus_tag LOCUS_07610 736154 734700 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871161.1 protein_id gnl|my_center|LOCUS_07610 736337 736567 gene locus_tag LOCUS_07620 736337 736567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 736949 736692 gene locus_tag LOCUS_07630 736949 736692 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249742.1 protein_id gnl|my_center|LOCUS_07630 737112 736939 gene locus_tag LOCUS_07640 737112 736939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 737512 737721 gene locus_tag LOCUS_07650 737512 737721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 737742 737990 gene locus_tag LOCUS_07660 737742 737990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07660 738038 738658 gene locus_tag LOCUS_07670 738038 738658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07670 740905 738653 gene locus_tag LOCUS_07680 740905 738653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 741149 741295 gene locus_tag LOCUS_07690 741149 741295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 744262 741950 gene locus_tag LOCUS_07700 744262 741950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 744678 745256 gene locus_tag LOCUS_07710 744678 745256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 745375 746484 gene locus_tag LOCUS_07720 745375 746484 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_07720 746498 747331 gene locus_tag LOCUS_07730 746498 747331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021756.1 protein_id gnl|my_center|LOCUS_07730 749325 747514 gene locus_tag LOCUS_07740 749325 747514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 749571 752267 gene locus_tag LOCUS_07750 749571 752267 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331330.1 protein_id gnl|my_center|LOCUS_07750 752283 753827 gene locus_tag LOCUS_07760 752283 753827 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028663.1 protein_id gnl|my_center|LOCUS_07760 753834 754388 gene locus_tag LOCUS_07770 753834 754388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 754750 755070 gene locus_tag LOCUS_07780 754750 755070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 756112 755078 gene locus_tag LOCUS_07790 756112 755078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 757387 756266 gene locus_tag LOCUS_07800 757387 756266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 758764 757568 gene locus_tag LOCUS_07810 758764 757568 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072584.1 protein_id gnl|my_center|LOCUS_07810 759793 758861 gene locus_tag LOCUS_07820 759793 758861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 760881 759793 gene locus_tag LOCUS_07830 760881 759793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 761529 761140 gene locus_tag LOCUS_07840 761529 761140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 762114 761725 gene locus_tag LOCUS_07850 762114 761725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 762358 762119 gene locus_tag LOCUS_07860 762358 762119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 762893 762468 gene locus_tag LOCUS_07870 762893 762468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 763051 762890 gene locus_tag LOCUS_07880 763051 762890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 763337 763600 gene locus_tag LOCUS_07890 763337 763600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 763597 763980 gene locus_tag LOCUS_07900 763597 763980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 764453 764142 gene locus_tag LOCUS_07910 764453 764142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 765752 764562 gene locus_tag LOCUS_07920 765752 764562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 766855 766076 gene locus_tag LOCUS_07930 766855 766076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 767211 767357 gene locus_tag LOCUS_07940 767211 767357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 767354 767743 gene locus_tag LOCUS_07950 767354 767743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 768166 767882 gene locus_tag LOCUS_07960 768166 767882 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022202.1 protein_id gnl|my_center|LOCUS_07960 768953 768384 gene locus_tag LOCUS_07970 768953 768384 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940933.1 protein_id gnl|my_center|LOCUS_07970 769481 768972 gene locus_tag LOCUS_07980 769481 768972 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_07980 770265 769795 gene locus_tag LOCUS_07990 770265 769795 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459702.1 protein_id gnl|my_center|LOCUS_07990 771953 770427 gene locus_tag LOCUS_08000 771953 770427 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876381.1 protein_id gnl|my_center|LOCUS_08000 772929 772024 gene locus_tag LOCUS_08010 772929 772024 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876382.1 protein_id gnl|my_center|LOCUS_08010 773969 772986 gene locus_tag LOCUS_08020 gene hemB 773969 772986 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060891.1 protein_id gnl|my_center|LOCUS_08020 774143 773985 gene locus_tag LOCUS_08030 774143 773985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 774433 774140 gene locus_tag LOCUS_08040 774433 774140 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870729.1 protein_id gnl|my_center|LOCUS_08040 775228 774533 gene locus_tag LOCUS_08050 775228 774533 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022247.1 protein_id gnl|my_center|LOCUS_08050 775403 775870 gene locus_tag LOCUS_08060 775403 775870 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948359.1 protein_id gnl|my_center|LOCUS_08060 775907 776113 gene locus_tag LOCUS_08070 775907 776113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 776128 776517 gene locus_tag LOCUS_08080 776128 776517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 776531 776977 gene locus_tag LOCUS_08090 776531 776977 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 protein_id gnl|my_center|LOCUS_08090 777159 778265 gene locus_tag LOCUS_08100 gene aroC 777159 778265 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061243.1 protein_id gnl|my_center|LOCUS_08100 778307 778462 gene locus_tag LOCUS_08110 778307 778462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 778570 778497 gene locus_tag LOCUS_t00080 778570 778497 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 778985 778833 gene locus_tag LOCUS_08120 778985 778833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08120 779173 778982 gene locus_tag LOCUS_08130 779173 778982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 780117 779317 gene locus_tag LOCUS_08140 780117 779317 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876389.1 protein_id gnl|my_center|LOCUS_08140 781089 780160 gene locus_tag LOCUS_08150 781089 780160 CDS product DUF2121 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876390.1 protein_id gnl|my_center|LOCUS_08150 782168 781248 gene locus_tag LOCUS_08160 782168 781248 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879724.1 protein_id gnl|my_center|LOCUS_08160 785181 782278 gene locus_tag LOCUS_08170 gene uvrA 785181 782278 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_08170 787132 785174 gene locus_tag LOCUS_08180 gene uvrB 787132 785174 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330366.1 protein_id gnl|my_center|LOCUS_08180 787416 789251 gene locus_tag LOCUS_08190 gene uvrC 787416 789251 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876080.1 protein_id gnl|my_center|LOCUS_08190 789413 790675 gene locus_tag LOCUS_08200 789413 790675 CDS product methanogen output domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876079.1 protein_id gnl|my_center|LOCUS_08200 790748 791455 gene locus_tag LOCUS_08210 790748 791455 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876078.1 protein_id gnl|my_center|LOCUS_08210 791837 791508 gene locus_tag LOCUS_08220 791837 791508 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817039.1 protein_id gnl|my_center|LOCUS_08220 793410 791950 gene locus_tag LOCUS_08230 793410 791950 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871161.1 protein_id gnl|my_center|LOCUS_08230 794677 793649 gene locus_tag LOCUS_08240 794677 793649 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060820.1 protein_id gnl|my_center|LOCUS_08240 794969 794748 gene locus_tag LOCUS_08250 794969 794748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 795562 795095 gene locus_tag LOCUS_08260 795562 795095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 795737 796624 gene locus_tag LOCUS_08270 795737 796624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 796650 798824 gene locus_tag LOCUS_08280 796650 798824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485731.1 protein_id gnl|my_center|LOCUS_08280 798845 799909 gene locus_tag LOCUS_08290 798845 799909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485732.1 protein_id gnl|my_center|LOCUS_08290 799919 800338 gene locus_tag LOCUS_08300 799919 800338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876068.1 protein_id gnl|my_center|LOCUS_08300 800444 800842 gene locus_tag LOCUS_08310 800444 800842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876069.1 protein_id gnl|my_center|LOCUS_08310 800933 801748 gene locus_tag LOCUS_08320 800933 801748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060818.1 protein_id gnl|my_center|LOCUS_08320 801882 802520 gene locus_tag LOCUS_08330 801882 802520 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_08330 802970 802590 gene locus_tag LOCUS_08340 802970 802590 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876072.1 protein_id gnl|my_center|LOCUS_08340 803478 802960 gene locus_tag LOCUS_08350 803478 802960 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060819.1 protein_id gnl|my_center|LOCUS_08350 804354 803593 gene locus_tag LOCUS_08360 804354 803593 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876074.1 protein_id gnl|my_center|LOCUS_08360 805305 804415 gene locus_tag LOCUS_08370 805305 804415 CDS product DUF2101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876062.1 protein_id gnl|my_center|LOCUS_08370 806017 805565 gene locus_tag LOCUS_08380 806017 805565 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060817.1 protein_id gnl|my_center|LOCUS_08380 807248 806085 gene locus_tag LOCUS_08390 807248 806085 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876060.1 protein_id gnl|my_center|LOCUS_08390 809057 807447 gene locus_tag LOCUS_08400 gene pyrG 809057 807447 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876058.1 protein_id gnl|my_center|LOCUS_08400 810507 809287 gene locus_tag LOCUS_08410 810507 809287 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060815.1 protein_id gnl|my_center|LOCUS_08410 811635 810625 gene locus_tag LOCUS_08420 811635 810625 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876056.1 protein_id gnl|my_center|LOCUS_08420 812173 811685 gene locus_tag LOCUS_08430 812173 811685 CDS product allosteric regulator of homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060814.1 protein_id gnl|my_center|LOCUS_08430 812390 812175 gene locus_tag LOCUS_08440 gene gatC 812390 812175 CDS product Asp-tRNA(Asn) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876054.1 protein_id gnl|my_center|LOCUS_08440 813959 812427 gene locus_tag LOCUS_08450 gene asnB 813959 812427 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060813.1 protein_id gnl|my_center|LOCUS_08450 814296 814087 gene locus_tag LOCUS_08460 814296 814087 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876456.1 protein_id gnl|my_center|LOCUS_08460 814920 814540 gene locus_tag LOCUS_08470 814920 814540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 815744 815031 gene locus_tag LOCUS_08480 gene cysE 815744 815031 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_08480 816949 815963 gene locus_tag LOCUS_08490 gene cysK 816949 815963 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_08490 817878 817111 gene locus_tag LOCUS_08500 817878 817111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877379.1 protein_id gnl|my_center|LOCUS_08500 818982 818455 gene locus_tag LOCUS_08510 818982 818455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 819559 819783 gene locus_tag LOCUS_08520 819559 819783 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020854.1 protein_id gnl|my_center|LOCUS_08520 819801 820220 gene locus_tag LOCUS_08530 819801 820220 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020853.1 protein_id gnl|my_center|LOCUS_08530 820230 821390 gene locus_tag LOCUS_08540 820230 821390 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020852.1 protein_id gnl|my_center|LOCUS_08540 822235 821405 gene locus_tag LOCUS_08550 822235 821405 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_08550 822753 822259 gene locus_tag LOCUS_08560 822753 822259 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014038.1 protein_id gnl|my_center|LOCUS_08560 823493 822807 gene locus_tag LOCUS_08570 823493 822807 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877398.1 protein_id gnl|my_center|LOCUS_08570 824596 824327 gene locus_tag LOCUS_08580 824596 824327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 824944 824615 gene locus_tag LOCUS_08590 824944 824615 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022881.1 protein_id gnl|my_center|LOCUS_08590 826220 825024 gene locus_tag LOCUS_08600 826220 825024 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_08600 827273 826305 gene locus_tag LOCUS_08610 827273 826305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 827878 827483 gene locus_tag LOCUS_08620 827878 827483 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876052.1 protein_id gnl|my_center|LOCUS_08620 828023 828295 gene locus_tag LOCUS_08630 828023 828295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 828361 829257 gene locus_tag LOCUS_08640 828361 829257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 829402 830169 gene locus_tag LOCUS_08650 829402 830169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 833206 830519 gene locus_tag LOCUS_08660 833206 830519 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876312.1 protein_id gnl|my_center|LOCUS_08660 833726 834223 gene locus_tag LOCUS_08670 833726 834223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 834314 834937 gene locus_tag LOCUS_08680 834314 834937 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875839.1 protein_id gnl|my_center|LOCUS_08680 834951 835466 gene locus_tag LOCUS_08690 834951 835466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875838.1 protein_id gnl|my_center|LOCUS_08690 837958 835580 gene locus_tag LOCUS_08700 837958 835580 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065616.1 protein_id gnl|my_center|LOCUS_08700 838947 837994 gene locus_tag LOCUS_08710 838947 837994 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023064.1 protein_id gnl|my_center|LOCUS_08710 839571 838951 gene locus_tag LOCUS_08720 839571 838951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 840694 839684 gene locus_tag LOCUS_08730 840694 839684 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158098.1 protein_id gnl|my_center|LOCUS_08730 842261 840912 gene locus_tag LOCUS_08740 842261 840912 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_08740 843818 842439 gene locus_tag LOCUS_08750 gene cysS 843818 842439 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_08750 843964 843894 gene locus_tag LOCUS_t00090 843964 843894 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 844276 845583 gene locus_tag LOCUS_08760 844276 845583 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022675.1 protein_id gnl|my_center|LOCUS_08760 845705 847180 gene locus_tag LOCUS_08770 845705 847180 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990604.1 protein_id gnl|my_center|LOCUS_08770 847250 848080 gene locus_tag LOCUS_08780 847250 848080 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927080.1 protein_id gnl|my_center|LOCUS_08780 848077 849240 gene locus_tag LOCUS_08790 gene nifS 848077 849240 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_08790 849277 849657 gene locus_tag LOCUS_08800 gene nifU 849277 849657 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_08800 850367 849723 gene locus_tag LOCUS_08810 850367 849723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 850482 851639 gene locus_tag LOCUS_08820 850482 851639 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022050.1 protein_id gnl|my_center|LOCUS_08820 852567 851689 gene locus_tag LOCUS_08830 gene pdxS 852567 851689 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876304.1 protein_id gnl|my_center|LOCUS_08830 853087 852638 gene locus_tag LOCUS_08840 853087 852638 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943409.1 protein_id gnl|my_center|LOCUS_08840 854057 853230 gene locus_tag LOCUS_08850 854057 853230 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_08850 855283 854123 gene locus_tag LOCUS_08860 gene thiI 855283 854123 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 protein_id gnl|my_center|LOCUS_08860 856679 855516 gene locus_tag LOCUS_08870 856679 855516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 857860 856805 gene locus_tag LOCUS_08880 857860 856805 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958610.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08880 858746 858111 gene locus_tag LOCUS_08890 858746 858111 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876045.1 protein_id gnl|my_center|LOCUS_08890 859496 858747 gene locus_tag LOCUS_08900 859496 858747 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060810.1 protein_id gnl|my_center|LOCUS_08900 860471 859536 gene locus_tag LOCUS_08910 860471 859536 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876043.1 protein_id gnl|my_center|LOCUS_08910 861402 860503 gene locus_tag LOCUS_08920 861402 860503 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876042.1 protein_id gnl|my_center|LOCUS_08920 862429 861404 gene locus_tag LOCUS_08930 862429 861404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876041.1 protein_id gnl|my_center|LOCUS_08930 863894 862515 gene locus_tag LOCUS_08940 863894 862515 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061005.1 protein_id gnl|my_center|LOCUS_08940 864924 863887 gene locus_tag LOCUS_08950 864924 863887 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876038.1 protein_id gnl|my_center|LOCUS_08950 866137 864983 gene locus_tag LOCUS_08960 866137 864983 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876037.1 protein_id gnl|my_center|LOCUS_08960 866634 866134 gene locus_tag LOCUS_08970 866634 866134 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876036.1 protein_id gnl|my_center|LOCUS_08970 867476 866769 gene locus_tag LOCUS_08980 867476 866769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 867799 867473 gene locus_tag LOCUS_08990 867799 867473 CDS product DUF2104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876034.1 protein_id gnl|my_center|LOCUS_08990 868075 867812 gene locus_tag LOCUS_09000 868075 867812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 869021 868155 gene locus_tag LOCUS_09010 869021 868155 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876032.1 protein_id gnl|my_center|LOCUS_09010 869295 869080 gene locus_tag LOCUS_09020 869295 869080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060808.1 protein_id gnl|my_center|LOCUS_09020 870081 869398 gene locus_tag LOCUS_09030 870081 869398 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060807.1 protein_id gnl|my_center|LOCUS_09030 870773 870087 gene locus_tag LOCUS_09040 870773 870087 CDS product EhaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060806.1 protein_id gnl|my_center|LOCUS_09040 871255 870776 gene locus_tag LOCUS_09050 871255 870776 CDS product DUF2106 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261153.1 protein_id gnl|my_center|LOCUS_09050 871512 871252 gene locus_tag LOCUS_09060 871512 871252 CDS product EhaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060805.1 protein_id gnl|my_center|LOCUS_09060 871795 871505 gene locus_tag LOCUS_09070 871795 871505 CDS product DUF2108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892391.1 protein_id gnl|my_center|LOCUS_09070 872130 871879 gene locus_tag LOCUS_09080 872130 871879 CDS product DUF2109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060804.1 protein_id gnl|my_center|LOCUS_09080 872718 872215 gene locus_tag LOCUS_09090 872718 872215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061212.1 protein_id gnl|my_center|LOCUS_09090 873032 872715 gene locus_tag LOCUS_09100 gene ehaA 873032 872715 CDS product energy-converting NiFe hydrogenase A subunit EhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870032.1 protein_id gnl|my_center|LOCUS_09100 873323 873748 gene locus_tag LOCUS_09110 873323 873748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 873738 874751 gene locus_tag LOCUS_09120 873738 874751 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_09120 874900 876333 gene locus_tag LOCUS_09130 874900 876333 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_09130 877209 876361 gene locus_tag LOCUS_09140 877209 876361 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_09140 878401 877247 gene locus_tag LOCUS_09150 878401 877247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 878496 879575 gene locus_tag LOCUS_09160 878496 879575 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868306.1 protein_id gnl|my_center|LOCUS_09160 879580 880776 gene locus_tag LOCUS_09170 879580 880776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 880822 881841 gene locus_tag LOCUS_09180 880822 881841 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868306.1 protein_id gnl|my_center|LOCUS_09180 881862 882827 gene locus_tag LOCUS_09190 881862 882827 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868306.1 protein_id gnl|my_center|LOCUS_09190 883070 883312 gene locus_tag LOCUS_09200 883070 883312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 884536 883358 gene locus_tag LOCUS_09210 884536 883358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 886653 884530 gene locus_tag LOCUS_09220 886653 884530 CDS product DUF2206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875978.1 protein_id gnl|my_center|LOCUS_09220 887873 886740 gene locus_tag LOCUS_09230 887873 886740 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 protein_id gnl|my_center|LOCUS_09230 889039 887900 gene locus_tag LOCUS_09240 889039 887900 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060795.1 protein_id gnl|my_center|LOCUS_09240 890243 889116 gene locus_tag LOCUS_09250 890243 889116 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_09250 891298 890444 gene locus_tag LOCUS_09260 gene galU 891298 890444 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876273.1 protein_id gnl|my_center|LOCUS_09260 892482 891415 gene locus_tag LOCUS_09270 892482 891415 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868292.1 protein_id gnl|my_center|LOCUS_09270 893342 892479 gene locus_tag LOCUS_09280 gene rfbD 893342 892479 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_09280 893413 893880 gene locus_tag LOCUS_09290 893413 893880 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_09290 893920 894855 gene locus_tag LOCUS_09300 gene rfbB 893920 894855 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_09300 895188 894874 gene locus_tag LOCUS_09310 895188 894874 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060863.1 protein_id gnl|my_center|LOCUS_09310 895349 895432 gene locus_tag LOCUS_t00100 895349 895432 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 895876 895448 gene locus_tag LOCUS_09320 895876 895448 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061234.1 protein_id gnl|my_center|LOCUS_09320 896032 896517 gene locus_tag LOCUS_09330 896032 896517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 896519 896965 gene locus_tag LOCUS_09340 896519 896965 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_09340 897285 896998 gene locus_tag LOCUS_09350 897285 896998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226987603.1 protein_id gnl|my_center|LOCUS_09350 897494 897315 gene locus_tag LOCUS_09360 897494 897315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 898535 897693 gene locus_tag LOCUS_09370 gene cfbC 898535 897693 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876281.1 protein_id gnl|my_center|LOCUS_09370 899057 898578 gene locus_tag LOCUS_09380 899057 898578 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876282.1 protein_id gnl|my_center|LOCUS_09380 899426 899070 gene locus_tag LOCUS_09390 899426 899070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 900753 899551 gene locus_tag LOCUS_09400 900753 899551 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060867.1 protein_id gnl|my_center|LOCUS_09400 902259 900862 gene locus_tag LOCUS_09410 gene purF 902259 900862 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060868.1 protein_id gnl|my_center|LOCUS_09410 903349 902456 gene locus_tag LOCUS_09420 903349 902456 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876285.1 protein_id gnl|my_center|LOCUS_09420 903555 903370 gene locus_tag LOCUS_09430 903555 903370 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876286.1 protein_id gnl|my_center|LOCUS_09430 903847 903605 gene locus_tag LOCUS_09440 903847 903605 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_09440 904154 904675 gene locus_tag LOCUS_09450 904154 904675 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 protein_id gnl|my_center|LOCUS_09450 904766 905473 gene locus_tag LOCUS_09460 gene arfB 904766 905473 CDS product 2-amino-5-formylamino-6-ribosylaminopyrimidin-4(3H)-one 5'-monophosphate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876289.1 protein_id gnl|my_center|LOCUS_09460 905565 906131 gene locus_tag LOCUS_09470 905565 906131 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898080.1 protein_id gnl|my_center|LOCUS_09470 908706 906211 gene locus_tag LOCUS_09480 908706 906211 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060872.1 protein_id gnl|my_center|LOCUS_09480 909097 908765 gene locus_tag LOCUS_09490 909097 908765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 909527 909084 gene locus_tag LOCUS_09500 909527 909084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 909680 910009 gene locus_tag LOCUS_09510 909680 910009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 911676 910018 gene locus_tag LOCUS_09520 911676 910018 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876295.1 protein_id gnl|my_center|LOCUS_09520 912209 911781 gene locus_tag LOCUS_09530 912209 911781 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_09530 912834 912259 gene locus_tag LOCUS_09540 912834 912259 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021440.1 protein_id gnl|my_center|LOCUS_09540 913276 913001 gene locus_tag LOCUS_09550 913276 913001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 915172 913394 gene locus_tag LOCUS_09560 gene glmS 915172 913394 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875810.1 protein_id gnl|my_center|LOCUS_09560 915387 916142 gene locus_tag LOCUS_09570 915387 916142 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875809.1 protein_id gnl|my_center|LOCUS_09570 916253 916504 gene locus_tag LOCUS_09580 gene purS 916253 916504 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875808.1 protein_id gnl|my_center|LOCUS_09580 916506 917156 gene locus_tag LOCUS_09590 gene purQ 916506 917156 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875807.1 protein_id gnl|my_center|LOCUS_09590 917221 917928 gene locus_tag LOCUS_09600 gene cobA 917221 917928 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060761.1 protein_id gnl|my_center|LOCUS_09600 917959 918741 gene locus_tag LOCUS_09610 917959 918741 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875805.1 protein_id gnl|my_center|LOCUS_09610 918781 919053 gene locus_tag LOCUS_09620 918781 919053 CDS product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066074.1 protein_id gnl|my_center|LOCUS_09620 919252 920649 gene locus_tag LOCUS_09630 gene recJ 919252 920649 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875803.1 protein_id gnl|my_center|LOCUS_09630 921183 920659 gene locus_tag LOCUS_09640 921183 920659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 921394 922188 gene locus_tag LOCUS_09650 921394 922188 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875802.1 protein_id gnl|my_center|LOCUS_09650 923114 922233 gene locus_tag LOCUS_09660 923114 922233 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892274.1 protein_id gnl|my_center|LOCUS_09660 923218 923880 gene locus_tag LOCUS_09670 923218 923880 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060848.1 protein_id gnl|my_center|LOCUS_09670 923948 924106 gene locus_tag LOCUS_09680 923948 924106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 924799 924119 gene locus_tag LOCUS_09690 924799 924119 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875874.1 protein_id gnl|my_center|LOCUS_09690 924948 925325 gene locus_tag LOCUS_09700 924948 925325 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875873.1 protein_id gnl|my_center|LOCUS_09700 926449 925373 gene locus_tag LOCUS_09710 gene pgsA 926449 925373 CDS product capsular polyglutamate synthetase PgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243306.1 protein_id gnl|my_center|LOCUS_09710 927203 926454 gene locus_tag LOCUS_09720 927203 926454 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875872.1 protein_id gnl|my_center|LOCUS_09720 928158 927391 gene locus_tag LOCUS_09730 gene uppS 928158 927391 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875871.1 protein_id gnl|my_center|LOCUS_09730 929101 928406 gene locus_tag LOCUS_09740 gene mtxX 929101 928406 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875870.1 protein_id gnl|my_center|LOCUS_09740 929237 929815 gene locus_tag LOCUS_09750 929237 929815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875868.1 protein_id gnl|my_center|LOCUS_09750 931167 929914 gene locus_tag LOCUS_09760 gene hemL 931167 929914 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875867.1 protein_id gnl|my_center|LOCUS_09760 931925 931263 gene locus_tag LOCUS_09770 931925 931263 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060776.1 protein_id gnl|my_center|LOCUS_09770 932110 932373 gene locus_tag LOCUS_09780 932110 932373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 932370 932567 gene locus_tag LOCUS_09790 932370 932567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 933146 932568 gene locus_tag LOCUS_09800 933146 932568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 933502 933158 gene locus_tag LOCUS_09810 933502 933158 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877438.1 protein_id gnl|my_center|LOCUS_09810 934199 934417 gene locus_tag LOCUS_09820 934199 934417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 934874 934431 gene locus_tag LOCUS_09830 934874 934431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 935969 934959 gene locus_tag LOCUS_09840 gene hypE 935969 934959 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 protein_id gnl|my_center|LOCUS_09840 936293 936673 gene locus_tag LOCUS_09850 936293 936673 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_09850 936666 937325 gene locus_tag LOCUS_09860 gene polB2 936666 937325 CDS product DNA polymerase PolB subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875847.1 protein_id gnl|my_center|LOCUS_09860 937447 938127 gene locus_tag LOCUS_09870 937447 938127 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875848.1 protein_id gnl|my_center|LOCUS_09870 938312 939865 gene locus_tag LOCUS_09880 938312 939865 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875849.1 protein_id gnl|my_center|LOCUS_09880 940043 941011 gene locus_tag LOCUS_09890 940043 941011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 942238 941360 gene locus_tag LOCUS_09900 942238 941360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 942992 942306 gene locus_tag LOCUS_09910 942992 942306 CDS product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876307.1 protein_id gnl|my_center|LOCUS_09910 943325 943053 gene locus_tag LOCUS_09920 943325 943053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 943684 943322 gene locus_tag LOCUS_09930 943684 943322 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876316.1 protein_id gnl|my_center|LOCUS_09930 943998 943738 gene locus_tag LOCUS_09940 gene pcc1 943998 943738 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146522.1 protein_id gnl|my_center|LOCUS_09940 944571 943999 gene locus_tag LOCUS_09950 944571 943999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 945053 944784 gene locus_tag LOCUS_09960 gene rpl37A 945053 944784 CDS product 50S ribosomal protein L37Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876320.1 protein_id gnl|my_center|LOCUS_09960 945925 945119 gene locus_tag LOCUS_09970 gene rrp42 945925 945119 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876321.1 protein_id gnl|my_center|LOCUS_09970 946655 945927 gene locus_tag LOCUS_09980 gene rrp41 946655 945927 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876322.1 protein_id gnl|my_center|LOCUS_09980 947448 946684 gene locus_tag LOCUS_09990 947448 946684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 948263 947571 gene locus_tag LOCUS_10000 948263 947571 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876324.1 protein_id gnl|my_center|LOCUS_10000 949026 948268 gene locus_tag LOCUS_10010 gene psmA 949026 948268 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876325.1 protein_id gnl|my_center|LOCUS_10010 950363 949635 gene locus_tag LOCUS_10020 950363 949635 CDS product ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876327.1 protein_id gnl|my_center|LOCUS_10020 950779 950366 gene locus_tag LOCUS_10030 950779 950366 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061237.1 protein_id gnl|my_center|LOCUS_10030 951328 950783 gene locus_tag LOCUS_10040 951328 950783 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750468.1 protein_id gnl|my_center|LOCUS_10040 952978 951542 gene locus_tag LOCUS_10050 952978 951542 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_10050 953568 953248 gene locus_tag LOCUS_10060 953568 953248 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060879.1 protein_id gnl|my_center|LOCUS_10060 954118 953660 gene locus_tag LOCUS_10070 gene ribC 954118 953660 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061180.1 protein_id gnl|my_center|LOCUS_10070 955158 954196 gene locus_tag LOCUS_10080 gene mch 955158 954196 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876411.1 protein_id gnl|my_center|LOCUS_10080 956008 955346 gene locus_tag LOCUS_10090 956008 955346 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061245.1 protein_id gnl|my_center|LOCUS_10090 956973 955996 gene locus_tag LOCUS_10100 956973 955996 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876413.1 protein_id gnl|my_center|LOCUS_10100 957444 957136 gene locus_tag LOCUS_10110 957444 957136 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876414.1 protein_id gnl|my_center|LOCUS_10110 957908 957447 gene locus_tag LOCUS_10120 957908 957447 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876415.1 protein_id gnl|my_center|LOCUS_10120 959012 957930 gene locus_tag LOCUS_10130 959012 957930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060897.1 protein_id gnl|my_center|LOCUS_10130 959641 959126 gene locus_tag LOCUS_10140 959641 959126 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296330.1 protein_id gnl|my_center|LOCUS_10140 959724 959797 gene locus_tag LOCUS_t00110 959724 959797 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 960924 959899 gene locus_tag LOCUS_10150 960924 959899 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485760.1 protein_id gnl|my_center|LOCUS_10150 961735 961076 gene locus_tag LOCUS_10160 gene hypB 961735 961076 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_10160 962227 961856 gene locus_tag LOCUS_10170 gene hypA 962227 961856 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060898.1 protein_id gnl|my_center|LOCUS_10170 962847 962368 gene locus_tag LOCUS_10180 962847 962368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 963094 963243 gene locus_tag LOCUS_10190 963094 963243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 963305 964168 gene locus_tag LOCUS_10200 963305 964168 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876421.1 protein_id gnl|my_center|LOCUS_10200 964334 964702 gene locus_tag LOCUS_10210 964334 964702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 964915 965277 gene locus_tag LOCUS_10220 964915 965277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 965358 965678 gene locus_tag LOCUS_10230 965358 965678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 967321 965738 gene locus_tag LOCUS_10240 967321 965738 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_10240 969356 967449 gene locus_tag LOCUS_10250 gene lonB 969356 967449 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876422.1 protein_id gnl|my_center|LOCUS_10250 969661 971172 gene locus_tag LOCUS_10260 gene cobQ 969661 971172 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061247.1 protein_id gnl|my_center|LOCUS_10260 971937 971284 gene locus_tag LOCUS_10270 971937 971284 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061014.1 protein_id gnl|my_center|LOCUS_10270 972557 972111 gene locus_tag LOCUS_10280 972557 972111 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876689.1 protein_id gnl|my_center|LOCUS_10280 974021 972642 gene locus_tag LOCUS_10290 974021 972642 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876425.1 protein_id gnl|my_center|LOCUS_10290 974635 974204 gene locus_tag LOCUS_10300 974635 974204 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060980.1 protein_id gnl|my_center|LOCUS_10300 975641 974640 gene locus_tag LOCUS_10310 975641 974640 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060981.1 protein_id gnl|my_center|LOCUS_10310 975798 975874 gene locus_tag LOCUS_t00120 975798 975874 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 975875 975948 gene locus_tag LOCUS_t00130 975875 975948 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 976433 976029 gene locus_tag LOCUS_10320 976433 976029 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876379.1 protein_id gnl|my_center|LOCUS_10320 976741 977160 gene locus_tag LOCUS_10330 gene nikR 976741 977160 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876378.1 protein_id gnl|my_center|LOCUS_10330 977276 978049 gene locus_tag LOCUS_10340 977276 978049 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876377.1 protein_id gnl|my_center|LOCUS_10340 978054 978602 gene locus_tag LOCUS_10350 gene hycI 978054 978602 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485809.1 protein_id gnl|my_center|LOCUS_10350 979372 978671 gene locus_tag LOCUS_10360 979372 978671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876815.1 protein_id gnl|my_center|LOCUS_10360 979681 980814 gene locus_tag LOCUS_10370 979681 980814 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485757.1 protein_id gnl|my_center|LOCUS_10370 980837 981913 gene locus_tag LOCUS_10380 980837 981913 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876374.1 protein_id gnl|my_center|LOCUS_10380 981941 983359 gene locus_tag LOCUS_10390 981941 983359 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 protein_id gnl|my_center|LOCUS_10390 983532 984965 gene locus_tag LOCUS_10400 983532 984965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 984979 986574 gene locus_tag LOCUS_10410 984979 986574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 986870 987292 gene locus_tag LOCUS_10420 986870 987292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876372.1 protein_id gnl|my_center|LOCUS_10420 987289 988566 gene locus_tag LOCUS_10430 987289 988566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 988574 988945 gene locus_tag LOCUS_10440 988574 988945 CDS product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876369.1 protein_id gnl|my_center|LOCUS_10440 989414 988956 gene locus_tag LOCUS_10450 989414 988956 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 protein_id gnl|my_center|LOCUS_10450 989555 990787 gene locus_tag LOCUS_10460 989555 990787 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876367.1 protein_id gnl|my_center|LOCUS_10460 990991 991587 gene locus_tag LOCUS_10470 990991 991587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 991556 991723 gene locus_tag LOCUS_10480 991556 991723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 992002 992361 gene locus_tag LOCUS_10490 992002 992361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 992711 992430 gene locus_tag LOCUS_10500 992711 992430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 993621 992944 gene locus_tag LOCUS_10510 993621 992944 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_10510 993837 994625 gene locus_tag LOCUS_10520 993837 994625 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974484.1 protein_id gnl|my_center|LOCUS_10520 995520 994747 gene locus_tag LOCUS_10530 gene cobK 995520 994747 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876633.1 protein_id gnl|my_center|LOCUS_10530 998098 995573 gene locus_tag LOCUS_10540 998098 995573 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060943.1 protein_id gnl|my_center|LOCUS_10540 999049 998231 gene locus_tag LOCUS_10550 999049 998231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 999206 999556 gene locus_tag LOCUS_10560 999206 999556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 999995 999615 gene locus_tag LOCUS_10570 999995 999615 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876631.1 protein_id gnl|my_center|LOCUS_10570 1000018 1000473 gene locus_tag LOCUS_10580 gene rimI 1000018 1000473 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876630.1 protein_id gnl|my_center|LOCUS_10580 1000532 1001614 gene locus_tag LOCUS_10590 gene carA 1000532 1001614 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060942.1 protein_id gnl|my_center|LOCUS_10590 1001660 1004851 gene locus_tag LOCUS_10600 gene carB 1001660 1004851 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_10600 1004915 1006072 gene locus_tag LOCUS_10610 1004915 1006072 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876625.1 protein_id gnl|my_center|LOCUS_10610 1006225 1006674 gene locus_tag LOCUS_10620 1006225 1006674 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876624.1 protein_id gnl|my_center|LOCUS_10620 1006794 1007561 gene locus_tag LOCUS_10630 1006794 1007561 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060939.1 protein_id gnl|my_center|LOCUS_10630 1007563 1008108 gene locus_tag LOCUS_10640 1007563 1008108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1008170 1008970 gene locus_tag LOCUS_10650 1008170 1008970 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232400.1 protein_id gnl|my_center|LOCUS_10650 1010072 1009020 gene locus_tag LOCUS_10660 gene larE 1010072 1009020 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876621.1 protein_id gnl|my_center|LOCUS_10660 1010803 1010156 gene locus_tag LOCUS_10670 1010803 1010156 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_10670 1011391 1010915 gene locus_tag LOCUS_10680 1011391 1010915 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877275.1 protein_id gnl|my_center|LOCUS_10680 1011937 1011449 gene locus_tag LOCUS_10690 gene tfe 1011937 1011449 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877276.1 protein_id gnl|my_center|LOCUS_10690 1013116 1012265 gene locus_tag LOCUS_10700 1013116 1012265 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877277.1 protein_id gnl|my_center|LOCUS_10700 1013266 1014447 gene locus_tag LOCUS_10710 1013266 1014447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1015214 1014501 gene locus_tag LOCUS_10720 gene comA 1015214 1014501 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877281.1 protein_id gnl|my_center|LOCUS_10720 1015417 1015980 gene locus_tag LOCUS_10730 1015417 1015980 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877282.1 protein_id gnl|my_center|LOCUS_10730 1016206 1017354 gene locus_tag LOCUS_10740 gene ftsZ 1016206 1017354 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877283.1 protein_id gnl|my_center|LOCUS_10740 1017546 1017731 gene locus_tag LOCUS_10750 1017546 1017731 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877284.1 protein_id gnl|my_center|LOCUS_10750 1017921 1018364 gene locus_tag LOCUS_10760 1017921 1018364 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061118.1 protein_id gnl|my_center|LOCUS_10760 1018364 1018852 gene locus_tag LOCUS_10770 1018364 1018852 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877286.1 protein_id gnl|my_center|LOCUS_10770 1018989 1019627 gene locus_tag LOCUS_10780 1018989 1019627 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061119.1 protein_id gnl|my_center|LOCUS_10780 1019628 1020641 gene locus_tag LOCUS_10790 1019628 1020641 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877288.1 protein_id gnl|my_center|LOCUS_10790 1020788 1021108 gene locus_tag LOCUS_10800 1020788 1021108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1021496 1021308 gene locus_tag LOCUS_10810 1021496 1021308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1021818 1024517 gene locus_tag LOCUS_10820 gene alaS 1021818 1024517 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877290.1 protein_id gnl|my_center|LOCUS_10820 1024552 1024902 gene locus_tag LOCUS_10830 1024552 1024902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1024982 1026238 gene locus_tag LOCUS_10840 1024982 1026238 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877291.1 protein_id gnl|my_center|LOCUS_10840 1026689 1026267 gene locus_tag LOCUS_10850 1026689 1026267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1027248 1028384 gene locus_tag LOCUS_10860 1027248 1028384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1029513 1028479 gene locus_tag LOCUS_10870 1029513 1028479 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061273.1 protein_id gnl|my_center|LOCUS_10870 1030823 1029519 gene locus_tag LOCUS_10880 1030823 1029519 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876694.1 protein_id gnl|my_center|LOCUS_10880 1031529 1030852 gene locus_tag LOCUS_10890 1031529 1030852 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 protein_id gnl|my_center|LOCUS_10890 1032633 1031584 gene locus_tag LOCUS_10900 gene hypD 1032633 1031584 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876696.1 protein_id gnl|my_center|LOCUS_10900 1032866 1034098 gene locus_tag LOCUS_10910 1032866 1034098 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876171.1 protein_id gnl|my_center|LOCUS_10910 1034397 1035587 gene locus_tag LOCUS_10920 1034397 1035587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1035656 1036315 gene locus_tag LOCUS_10930 1035656 1036315 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060837.1 protein_id gnl|my_center|LOCUS_10930 1036414 1037244 gene locus_tag LOCUS_10940 1036414 1037244 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876485.1 protein_id gnl|my_center|LOCUS_10940 1038006 1037317 gene locus_tag LOCUS_10950 1038006 1037317 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876165.1 protein_id gnl|my_center|LOCUS_10950 1038175 1038840 gene locus_tag LOCUS_10960 1038175 1038840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1038851 1039681 gene locus_tag LOCUS_10970 1038851 1039681 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_10970 1039696 1039947 gene locus_tag LOCUS_10980 1039696 1039947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1040837 1040106 gene locus_tag LOCUS_10990 1040837 1040106 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060841.1 protein_id gnl|my_center|LOCUS_10990 1041047 1040901 gene locus_tag LOCUS_11000 1041047 1040901 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876192.1 protein_id gnl|my_center|LOCUS_11000 1041562 1041053 gene locus_tag LOCUS_11010 1041562 1041053 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060842.1 protein_id gnl|my_center|LOCUS_11010 1041682 1042299 gene locus_tag LOCUS_11020 1041682 1042299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1042890 1042306 gene locus_tag LOCUS_11030 1042890 1042306 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020386.1 protein_id gnl|my_center|LOCUS_11030 1044999 1043002 gene locus_tag LOCUS_11040 1044999 1043002 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_11040 1045190 1045345 gene locus_tag LOCUS_11050 1045190 1045345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1045360 1045785 gene locus_tag LOCUS_11060 1045360 1045785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 protein_id gnl|my_center|LOCUS_11060 1045940 1046644 gene locus_tag LOCUS_11070 1045940 1046644 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892283.1 protein_id gnl|my_center|LOCUS_11070 1046757 1047428 gene locus_tag LOCUS_11080 1046757 1047428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1047665 1047456 gene locus_tag LOCUS_11090 1047665 1047456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1047911 1047714 gene locus_tag LOCUS_11100 1047911 1047714 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 protein_id gnl|my_center|LOCUS_11100 1048297 1047926 gene locus_tag LOCUS_11110 1048297 1047926 CDS product DUF2178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319102.1 protein_id gnl|my_center|LOCUS_11110 1048777 1048310 gene locus_tag LOCUS_11120 1048777 1048310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1049126 1048752 gene locus_tag LOCUS_11130 1049126 1048752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1049320 1049976 gene locus_tag LOCUS_11140 gene rncS 1049320 1049976 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_11140 1050316 1050044 gene locus_tag LOCUS_11150 1050316 1050044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1050493 1050702 gene locus_tag LOCUS_11160 1050493 1050702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1050723 1050971 gene locus_tag LOCUS_11170 1050723 1050971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11170 1051019 1051561 gene locus_tag LOCUS_11180 1051019 1051561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11180 1051703 1052533 gene locus_tag LOCUS_11190 gene nudC 1051703 1052533 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_11190 1053337 1052564 gene locus_tag LOCUS_11200 1053337 1052564 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875742.1 protein_id gnl|my_center|LOCUS_11200 1053557 1053348 gene locus_tag LOCUS_11210 1053557 1053348 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064700.1 protein_id gnl|my_center|LOCUS_11210 1055093 1053594 gene locus_tag LOCUS_11220 1055093 1053594 CDS product DUF2193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875740.1 protein_id gnl|my_center|LOCUS_11220 1055571 1056650 gene locus_tag LOCUS_11230 1055571 1056650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1056708 1057274 gene locus_tag LOCUS_11240 1056708 1057274 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197538709.1 protein_id gnl|my_center|LOCUS_11240 1057284 1058021 gene locus_tag LOCUS_11250 1057284 1058021 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865221.1 protein_id gnl|my_center|LOCUS_11250 1058070 1058405 gene locus_tag LOCUS_11260 1058070 1058405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1058632 1058964 gene locus_tag LOCUS_11270 1058632 1058964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1059430 1060014 gene locus_tag LOCUS_11280 1059430 1060014 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877201.1 protein_id gnl|my_center|LOCUS_11280 1060058 1060741 gene locus_tag LOCUS_11290 1060058 1060741 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877200.1 protein_id gnl|my_center|LOCUS_11290 1060751 1061974 gene locus_tag LOCUS_11300 1060751 1061974 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877199.1 protein_id gnl|my_center|LOCUS_11300 1061981 1063333 gene locus_tag LOCUS_11310 gene glmM 1061981 1063333 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877198.1 protein_id gnl|my_center|LOCUS_11310 1063389 1064666 gene locus_tag LOCUS_11320 1063389 1064666 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 protein_id gnl|my_center|LOCUS_11320 1064751 1065218 gene locus_tag LOCUS_11330 1064751 1065218 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877196.1 protein_id gnl|my_center|LOCUS_11330 1065309 1066409 gene locus_tag LOCUS_11340 gene hisC 1065309 1066409 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877195.1 protein_id gnl|my_center|LOCUS_11340 1066443 1067144 gene locus_tag LOCUS_11350 1066443 1067144 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061096.1 protein_id gnl|my_center|LOCUS_11350 1067589 1068356 gene locus_tag LOCUS_11360 1067589 1068356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1068861 1068421 gene locus_tag LOCUS_11370 1068861 1068421 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061260.1 protein_id gnl|my_center|LOCUS_11370 1069477 1068821 gene locus_tag LOCUS_11380 1069477 1068821 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_11380 1070641 1069700 gene locus_tag LOCUS_11390 1070641 1069700 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_11390 1070986 1071708 gene locus_tag LOCUS_11400 gene cas6 1070986 1071708 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750454.1 protein_id gnl|my_center|LOCUS_11400 1071701 1073977 gene locus_tag LOCUS_11410 1071701 1073977 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877585.1 protein_id gnl|my_center|LOCUS_11410 1073955 1075022 gene locus_tag LOCUS_11420 1073955 1075022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590844.1 protein_id gnl|my_center|LOCUS_11420 1075009 1075353 gene locus_tag LOCUS_11430 1075009 1075353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877583.1 protein_id gnl|my_center|LOCUS_11430 1075370 1076356 gene locus_tag LOCUS_11440 1075370 1076356 CDS product DevR family CRISPR-associated autoregulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877582.1 protein_id gnl|my_center|LOCUS_11440 1076359 1077033 gene locus_tag LOCUS_11450 gene cas5 1076359 1077033 CDS product CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877581.1 protein_id gnl|my_center|LOCUS_11450 1077072 1077326 gene locus_tag LOCUS_11460 1077072 1077326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1077350 1077805 gene locus_tag LOCUS_11470 1077350 1077805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11470 1077751 1078437 gene locus_tag LOCUS_11480 1077751 1078437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11480 1078504 1078731 gene locus_tag LOCUS_11490 1078504 1078731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11490 1078725 1078997 gene locus_tag LOCUS_11500 gene cas2 1078725 1078997 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060963.1 protein_id gnl|my_center|LOCUS_11500 1079355 1082771 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctcaaatcagactattttaggattgaaat 1084343 1082832 gene locus_tag LOCUS_11510 1084343 1082832 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876525.1 protein_id gnl|my_center|LOCUS_11510 1085582 1084422 gene locus_tag LOCUS_11520 gene dnaG 1085582 1084422 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876524.1 protein_id gnl|my_center|LOCUS_11520 1086064 1085645 gene locus_tag LOCUS_11530 1086064 1085645 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876523.1 protein_id gnl|my_center|LOCUS_11530 1086403 1086699 gene locus_tag LOCUS_11540 1086403 1086699 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876522.1 protein_id gnl|my_center|LOCUS_11540 1086705 1087364 gene locus_tag LOCUS_11550 1086705 1087364 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876521.1 protein_id gnl|my_center|LOCUS_11550 1087497 1088564 gene locus_tag LOCUS_11560 1087497 1088564 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061258.1 protein_id gnl|my_center|LOCUS_11560 1088754 1088936 gene locus_tag LOCUS_11570 1088754 1088936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1088993 1089928 gene locus_tag LOCUS_11580 1088993 1089928 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 protein_id gnl|my_center|LOCUS_11580 1090142 1092472 gene locus_tag LOCUS_11590 1090142 1092472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1092787 1093209 gene locus_tag LOCUS_11600 1092787 1093209 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020395.1 protein_id gnl|my_center|LOCUS_11600 1093536 1093336 gene locus_tag LOCUS_11610 1093536 1093336 CDS product DUF2116 family Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876513.1 protein_id gnl|my_center|LOCUS_11610 1094303 1093629 gene locus_tag LOCUS_11620 gene pyrH 1094303 1093629 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876512.1 protein_id gnl|my_center|LOCUS_11620 1094504 1096702 gene locus_tag LOCUS_11630 1094504 1096702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1096912 1098141 gene locus_tag LOCUS_11640 gene prf1 1096912 1098141 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_11640 1098223 1100031 gene locus_tag LOCUS_11650 1098223 1100031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1100193 1100053 gene locus_tag LOCUS_11660 1100193 1100053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1100593 1101081 gene locus_tag LOCUS_11670 1100593 1101081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1101293 1101898 gene locus_tag LOCUS_11680 1101293 1101898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1102253 1102014 gene locus_tag LOCUS_11690 1102253 1102014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1103167 1102346 gene locus_tag LOCUS_11700 1103167 1102346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1103429 1103647 gene locus_tag LOCUS_11710 1103429 1103647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1104238 1103702 gene locus_tag LOCUS_11720 1104238 1103702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1104806 1104228 gene locus_tag LOCUS_11730 1104806 1104228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1104929 1105081 gene locus_tag LOCUS_11740 1104929 1105081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1105374 1105559 gene locus_tag LOCUS_11750 1105374 1105559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1106056 1105658 gene locus_tag LOCUS_11760 1106056 1105658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1106219 1107535 gene locus_tag LOCUS_11770 1106219 1107535 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875743.1 protein_id gnl|my_center|LOCUS_11770 1108893 1108297 gene locus_tag LOCUS_11780 1108893 1108297 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876509.1 protein_id gnl|my_center|LOCUS_11780 1109867 1108914 gene locus_tag LOCUS_11790 1109867 1108914 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 protein_id gnl|my_center|LOCUS_11790 1110736 1109867 gene locus_tag LOCUS_11800 gene hemC 1110736 1109867 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876507.1 protein_id gnl|my_center|LOCUS_11800 1112265 1110925 gene locus_tag LOCUS_11810 gene cfbE 1112265 1110925 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485764.1 protein_id gnl|my_center|LOCUS_11810 1113095 1112256 gene locus_tag LOCUS_11820 1113095 1112256 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_11820 1113927 1113097 gene locus_tag LOCUS_11830 1113927 1113097 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876504.1 protein_id gnl|my_center|LOCUS_11830 1114387 1113944 gene locus_tag LOCUS_11840 1114387 1113944 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060917.1 protein_id gnl|my_center|LOCUS_11840 1114539 1114928 gene locus_tag LOCUS_11850 gene eif5A 1114539 1114928 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 protein_id gnl|my_center|LOCUS_11850 1115007 1115867 gene locus_tag LOCUS_11860 gene speB 1115007 1115867 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876501.1 protein_id gnl|my_center|LOCUS_11860 1116370 1117587 gene locus_tag LOCUS_11870 1116370 1117587 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_11870 1118100 1117912 gene locus_tag LOCUS_11880 1118100 1117912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1118526 1118242 gene locus_tag LOCUS_11890 1118526 1118242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1121252 1119315 gene locus_tag LOCUS_11900 1121252 1119315 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_11900 1123740 1121581 gene locus_tag LOCUS_11910 1123740 1121581 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086363.1 protein_id gnl|my_center|LOCUS_11910 1124316 1123957 gene locus_tag LOCUS_11920 1124316 1123957 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_11920 1124741 1126426 gene locus_tag LOCUS_11930 1124741 1126426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1126839 1126513 gene locus_tag LOCUS_11940 1126839 1126513 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065092.1 protein_id gnl|my_center|LOCUS_11940 1127126 1127614 gene locus_tag LOCUS_11950 1127126 1127614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1127589 1128515 gene locus_tag LOCUS_11960 1127589 1128515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1128583 1129047 gene locus_tag LOCUS_11970 1128583 1129047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1129037 1129867 gene locus_tag LOCUS_11980 1129037 1129867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1132444 1130264 gene locus_tag LOCUS_11990 gene feoB 1132444 1130264 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943880.1 protein_id gnl|my_center|LOCUS_11990 1132669 1132448 gene locus_tag LOCUS_12000 1132669 1132448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1132899 1132669 gene locus_tag LOCUS_12010 1132899 1132669 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_12010 1133501 1133127 gene locus_tag LOCUS_12020 1133501 1133127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1133630 1133995 gene locus_tag LOCUS_12030 1133630 1133995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1134373 1134134 gene locus_tag LOCUS_12040 1134373 1134134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1134934 1134698 gene locus_tag LOCUS_12050 1134934 1134698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1135376 1136989 gene locus_tag LOCUS_12060 gene ade 1135376 1136989 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876499.1 protein_id gnl|my_center|LOCUS_12060 1137036 1137917 gene locus_tag LOCUS_12070 1137036 1137917 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250632.1 protein_id gnl|my_center|LOCUS_12070 1138336 1137941 gene locus_tag LOCUS_12080 gene tsaA 1138336 1137941 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877752.1 protein_id gnl|my_center|LOCUS_12080 1138840 1138370 gene locus_tag LOCUS_12090 1138840 1138370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1139515 1138895 gene locus_tag LOCUS_12100 1139515 1138895 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876496.1 protein_id gnl|my_center|LOCUS_12100 1139866 1140432 gene locus_tag LOCUS_12110 1139866 1140432 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060887.1 protein_id gnl|my_center|LOCUS_12110 1142030 1140474 gene locus_tag LOCUS_12120 1142030 1140474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1143697 1142093 gene locus_tag LOCUS_12130 1143697 1142093 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_12130 1144133 1143711 gene locus_tag LOCUS_12140 1144133 1143711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1145679 1144213 gene locus_tag LOCUS_12150 1145679 1144213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1145903 1146829 gene locus_tag LOCUS_12160 gene guaA 1145903 1146829 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060888.1 protein_id gnl|my_center|LOCUS_12160 1146966 1147397 gene locus_tag LOCUS_12170 1146966 1147397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1147454 1148179 gene locus_tag LOCUS_12180 1147454 1148179 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213557.1 protein_id gnl|my_center|LOCUS_12180 1148261 1148890 gene locus_tag LOCUS_12190 1148261 1148890 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860823.1 protein_id gnl|my_center|LOCUS_12190 1148909 1150180 gene locus_tag LOCUS_12200 1148909 1150180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1150205 1150660 gene locus_tag LOCUS_12210 gene msrB 1150205 1150660 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876350.1 protein_id gnl|my_center|LOCUS_12210 1151597 1150737 gene locus_tag LOCUS_12220 1151597 1150737 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_12220 1152480 1151800 gene locus_tag LOCUS_12230 gene npdG 1152480 1151800 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_12230 1153297 1152530 gene locus_tag LOCUS_12240 1153297 1152530 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_12240 1153687 1154298 gene locus_tag LOCUS_12250 1153687 1154298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1154447 1155616 gene locus_tag LOCUS_12260 1154447 1155616 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061240.1 protein_id gnl|my_center|LOCUS_12260 1156201 1155650 gene locus_tag LOCUS_12270 1156201 1155650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1157312 1156359 gene locus_tag LOCUS_12280 1157312 1156359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1157481 1157864 gene locus_tag LOCUS_12290 1157481 1157864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1157925 1158884 gene locus_tag LOCUS_12300 1157925 1158884 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876360.1 protein_id gnl|my_center|LOCUS_12300 1159383 1158886 gene locus_tag LOCUS_12310 gene cgi121 1159383 1158886 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876361.1 protein_id gnl|my_center|LOCUS_12310 1160924 1159422 gene locus_tag LOCUS_12320 1160924 1159422 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876362.1 protein_id gnl|my_center|LOCUS_12320 1162009 1160966 gene locus_tag LOCUS_12330 1162009 1160966 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876363.1 protein_id gnl|my_center|LOCUS_12330 1163209 1162028 gene locus_tag LOCUS_12340 1163209 1162028 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876364.1 protein_id gnl|my_center|LOCUS_12340 1164816 1163386 gene locus_tag LOCUS_12350 1164816 1163386 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061013.1 protein_id gnl|my_center|LOCUS_12350 1165483 1164881 gene locus_tag LOCUS_12360 1165483 1164881 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876365.1 protein_id gnl|my_center|LOCUS_12360 1165596 1166321 gene locus_tag LOCUS_12370 1165596 1166321 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060890.1 protein_id gnl|my_center|LOCUS_12370 1166696 1166295 gene locus_tag LOCUS_12380 1166696 1166295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1166868 1166680 gene locus_tag LOCUS_12390 1166868 1166680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1167110 1168231 gene locus_tag LOCUS_12400 1167110 1168231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1169288 1168908 gene locus_tag LOCUS_12410 1169288 1168908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1170782 1169697 gene locus_tag LOCUS_12420 1170782 1169697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1171162 1170815 gene locus_tag LOCUS_12430 1171162 1170815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1176040 1171217 gene locus_tag LOCUS_12440 1176040 1171217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1177814 1176576 gene locus_tag LOCUS_12450 1177814 1176576 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060944.1 protein_id gnl|my_center|LOCUS_12450 1178044 1178349 gene locus_tag LOCUS_12460 gene eif1A 1178044 1178349 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876635.1 protein_id gnl|my_center|LOCUS_12460 1178452 1179219 gene locus_tag LOCUS_12470 1178452 1179219 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 protein_id gnl|my_center|LOCUS_12470 1179317 1179898 gene locus_tag LOCUS_12480 1179317 1179898 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 protein_id gnl|my_center|LOCUS_12480 1179969 1181567 gene locus_tag LOCUS_12490 gene top6B 1179969 1181567 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876638.1 protein_id gnl|my_center|LOCUS_12490 1181557 1182630 gene locus_tag LOCUS_12500 1181557 1182630 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_12500 1182961 1183980 gene locus_tag LOCUS_12510 1182961 1183980 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876640.1 protein_id gnl|my_center|LOCUS_12510 1184090 1184728 gene locus_tag LOCUS_12520 1184090 1184728 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_12520 1184789 1185925 gene locus_tag LOCUS_12530 gene pscS 1184789 1185925 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876691.1 protein_id gnl|my_center|LOCUS_12530 1186446 1185979 gene locus_tag LOCUS_12540 1186446 1185979 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060861.1 protein_id gnl|my_center|LOCUS_12540 1186536 1187303 gene locus_tag LOCUS_12550 1186536 1187303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022686.1 protein_id gnl|my_center|LOCUS_12550 1187854 1187315 gene locus_tag LOCUS_12560 1187854 1187315 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762040.1 protein_id gnl|my_center|LOCUS_12560 1188034 1188312 gene locus_tag LOCUS_12570 1188034 1188312 CDS product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876119.1 protein_id gnl|my_center|LOCUS_12570 1188430 1189317 gene locus_tag LOCUS_12580 1188430 1189317 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879978.1 protein_id gnl|my_center|LOCUS_12580 1189581 1190165 gene locus_tag LOCUS_12590 1189581 1190165 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060893.1 protein_id gnl|my_center|LOCUS_12590 1190700 1190239 gene locus_tag LOCUS_12600 1190700 1190239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1193044 1190960 gene locus_tag LOCUS_12610 1193044 1190960 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_12610 1194206 1193319 gene locus_tag LOCUS_12620 1194206 1193319 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_12620 1195110 1194424 gene locus_tag LOCUS_12630 gene npdG 1195110 1194424 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_12630 1196228 1195158 gene locus_tag LOCUS_12640 1196228 1195158 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_12640 1196506 1197102 gene locus_tag LOCUS_12650 1196506 1197102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1197345 1197124 gene locus_tag LOCUS_12660 1197345 1197124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1197290 1197586 gene locus_tag LOCUS_12670 1197290 1197586 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860072.1 protein_id gnl|my_center|LOCUS_12670 1197713 1197627 gene locus_tag LOCUS_t00140 1197713 1197627 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1198112 1199512 gene locus_tag LOCUS_12680 1198112 1199512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1199760 1199542 gene locus_tag LOCUS_12690 1199760 1199542 CDS product TIGR04165 family Cys-rich peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875760.1 protein_id gnl|my_center|LOCUS_12690 1200000 1199782 gene locus_tag LOCUS_12700 1200000 1199782 CDS product TIGR04165 family Cys-rich peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875760.1 protein_id gnl|my_center|LOCUS_12700 1200459 1200184 gene locus_tag LOCUS_12710 1200459 1200184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1200344 1201600 gene locus_tag LOCUS_12720 1200344 1201600 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876425.1 protein_id gnl|my_center|LOCUS_12720 1201698 1202144 gene locus_tag LOCUS_12730 1201698 1202144 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_12730 1203276 1202170 gene locus_tag LOCUS_12740 1203276 1202170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1203456 1204274 gene locus_tag LOCUS_12750 1203456 1204274 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_12750 1205715 1204306 gene locus_tag LOCUS_12760 1205715 1204306 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_12760 1206232 1206792 gene locus_tag LOCUS_12770 1206232 1206792 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020425.1 protein_id gnl|my_center|LOCUS_12770 1206896 1208122 gene locus_tag LOCUS_12780 1206896 1208122 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022271.1 protein_id gnl|my_center|LOCUS_12780 1208127 1208798 gene locus_tag LOCUS_12790 1208127 1208798 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680333.1 protein_id gnl|my_center|LOCUS_12790 1209268 1208855 gene locus_tag LOCUS_12800 1209268 1208855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1209510 1209250 gene locus_tag LOCUS_12810 1209510 1209250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1210026 1211141 gene locus_tag LOCUS_12820 1210026 1211141 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_12820 1211528 1211217 gene locus_tag LOCUS_12830 1211528 1211217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12830 1212196 1211438 gene locus_tag LOCUS_12840 1212196 1211438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12840 1213955 1212249 gene locus_tag LOCUS_12850 1213955 1212249 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_12850 1215681 1214020 gene locus_tag LOCUS_12860 1215681 1214020 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015287949.1 protein_id gnl|my_center|LOCUS_12860 1215886 1216464 gene locus_tag LOCUS_12870 1215886 1216464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023807.1 protein_id gnl|my_center|LOCUS_12870 1216588 1217013 gene locus_tag LOCUS_12880 1216588 1217013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1219322 1217286 gene locus_tag LOCUS_12890 1219322 1217286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1220666 1219512 gene locus_tag LOCUS_12900 1220666 1219512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1221624 1220680 gene locus_tag LOCUS_12910 1221624 1220680 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_12910 1221827 1223038 gene locus_tag LOCUS_12920 1221827 1223038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1223128 1223044 gene locus_tag LOCUS_t00150 1223128 1223044 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1223538 1223230 gene locus_tag LOCUS_12930 gene rpsJ 1223538 1223230 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_12930 1224865 1223624 gene locus_tag LOCUS_12940 gene tuf 1224865 1223624 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876684.1 protein_id gnl|my_center|LOCUS_12940 1227195 1225003 gene locus_tag LOCUS_12950 1227195 1225003 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060960.1 protein_id gnl|my_center|LOCUS_12950 1227812 1227249 gene locus_tag LOCUS_12960 gene rpsG 1227812 1227249 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876682.1 protein_id gnl|my_center|LOCUS_12960 1228296 1227871 gene locus_tag LOCUS_12970 1228296 1227871 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_12970 1228846 1228415 gene locus_tag LOCUS_12980 1228846 1228415 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 protein_id gnl|my_center|LOCUS_12980 1229148 1228852 gene locus_tag LOCUS_12990 1229148 1228852 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876679.1 protein_id gnl|my_center|LOCUS_12990 1230315 1229161 gene locus_tag LOCUS_13000 gene rpoA2 1230315 1229161 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876678.1 protein_id gnl|my_center|LOCUS_13000 1232971 1230359 gene locus_tag LOCUS_13010 gene rpoA1 1232971 1230359 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876677.1 protein_id gnl|my_center|LOCUS_13010 1234930 1233077 gene locus_tag LOCUS_13020 gene rpoB 1234930 1233077 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876676.1 protein_id gnl|my_center|LOCUS_13020 1236438 1234948 gene locus_tag LOCUS_13030 1236438 1234948 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060959.1 protein_id gnl|my_center|LOCUS_13030 1236856 1236626 gene locus_tag LOCUS_13040 1236856 1236626 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876674.1 protein_id gnl|my_center|LOCUS_13040 1236958 1236885 gene locus_tag LOCUS_t00160 1236958 1236885 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1237035 1236962 gene locus_tag LOCUS_t00170 1237035 1236962 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1237272 1237197 gene locus_tag LOCUS_t00180 1237272 1237197 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1237355 1237281 gene locus_tag LOCUS_t00190 1237355 1237281 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1237466 1237392 gene locus_tag LOCUS_t00200 1237466 1237392 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1238819 1237593 gene locus_tag LOCUS_13050 gene pgk 1238819 1237593 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_13050 1239595 1238915 gene locus_tag LOCUS_13060 gene tpiA 1239595 1238915 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876672.1 protein_id gnl|my_center|LOCUS_13060 1240683 1239853 gene locus_tag LOCUS_13070 1240683 1239853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1241208 1242122 gene locus_tag LOCUS_13080 gene twy1 1241208 1242122 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061270.1 protein_id gnl|my_center|LOCUS_13080 1242417 1243280 gene locus_tag LOCUS_13090 1242417 1243280 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060958.1 protein_id gnl|my_center|LOCUS_13090 1244458 1243352 gene locus_tag LOCUS_13100 gene sucC 1244458 1243352 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876667.1 protein_id gnl|my_center|LOCUS_13100 1245055 1244507 gene locus_tag LOCUS_13110 1245055 1244507 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060957.1 protein_id gnl|my_center|LOCUS_13110 1245922 1245059 gene locus_tag LOCUS_13120 gene korB 1245922 1245059 CDS product 2-oxoglutarate synthase subunit KorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876665.1 protein_id gnl|my_center|LOCUS_13120 1247119 1245992 gene locus_tag LOCUS_13130 1247119 1245992 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_13130 1247324 1247112 gene locus_tag LOCUS_13140 1247324 1247112 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060956.1 protein_id gnl|my_center|LOCUS_13140 1247450 1247824 gene locus_tag LOCUS_13150 1247450 1247824 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875703.1 protein_id gnl|my_center|LOCUS_13150 1247946 1248437 gene locus_tag LOCUS_13160 1247946 1248437 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876457.1 protein_id gnl|my_center|LOCUS_13160 1248844 1248467 gene locus_tag LOCUS_13170 1248844 1248467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1249311 1248949 gene locus_tag LOCUS_13180 1249311 1248949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1249776 1249408 gene locus_tag LOCUS_13190 1249776 1249408 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060955.1 protein_id gnl|my_center|LOCUS_13190 1250558 1249833 gene locus_tag LOCUS_13200 1250558 1249833 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876661.1 protein_id gnl|my_center|LOCUS_13200 1251532 1250579 gene locus_tag LOCUS_13210 1251532 1250579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060954.1 protein_id gnl|my_center|LOCUS_13210 1253150 1251717 gene locus_tag LOCUS_13220 1253150 1251717 CDS product DUF515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876659.1 protein_id gnl|my_center|LOCUS_13220 1253862 1253140 gene locus_tag LOCUS_13230 1253862 1253140 CDS product archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060953.1 protein_id gnl|my_center|LOCUS_13230 1254185 1254817 gene locus_tag LOCUS_13240 1254185 1254817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876656.1 protein_id gnl|my_center|LOCUS_13240 1254822 1255895 gene locus_tag LOCUS_13250 1254822 1255895 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_13250 1256128 1256745 gene locus_tag LOCUS_13260 gene rnhB 1256128 1256745 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876654.1 protein_id gnl|my_center|LOCUS_13260 1256797 1257399 gene locus_tag LOCUS_13270 gene purO 1256797 1257399 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876651.1 protein_id gnl|my_center|LOCUS_13270 1257431 1258195 gene locus_tag LOCUS_13280 gene cofE 1257431 1258195 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_13280 1258294 1259196 gene locus_tag LOCUS_13290 gene cofD 1258294 1259196 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060952.1 protein_id gnl|my_center|LOCUS_13290 1259197 1259958 gene locus_tag LOCUS_13300 1259197 1259958 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876648.1 protein_id gnl|my_center|LOCUS_13300 1260068 1260823 gene locus_tag LOCUS_13310 1260068 1260823 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876647.1 protein_id gnl|my_center|LOCUS_13310 1260965 1262563 gene locus_tag LOCUS_13320 gene atwA 1260965 1262563 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060951.1 protein_id gnl|my_center|LOCUS_13320 1262568 1263044 gene locus_tag LOCUS_13330 1262568 1263044 CDS product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876645.1 protein_id gnl|my_center|LOCUS_13330 1263082 1263699 gene locus_tag LOCUS_13340 1263082 1263699 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060950.1 protein_id gnl|my_center|LOCUS_13340 1263756 1264949 gene locus_tag LOCUS_13350 gene hemA 1263756 1264949 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060949.1 protein_id gnl|my_center|LOCUS_13350 1265813 1265268 gene locus_tag LOCUS_13360 1265813 1265268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1266398 1265823 gene locus_tag LOCUS_13370 1266398 1265823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1267301 1266573 gene locus_tag LOCUS_13380 1267301 1266573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1268593 1267472 gene locus_tag LOCUS_13390 1268593 1267472 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060948.1 protein_id gnl|my_center|LOCUS_13390 1269577 1268735 gene locus_tag LOCUS_13400 1269577 1268735 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_13400 1270544 1269627 gene locus_tag LOCUS_13410 gene trxB 1270544 1269627 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060886.1 protein_id gnl|my_center|LOCUS_13410 1272453 1270570 gene locus_tag LOCUS_13420 gene gatE 1272453 1270570 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876346.1 protein_id gnl|my_center|LOCUS_13420 1273823 1272510 gene locus_tag LOCUS_13430 gene gatD 1273823 1272510 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876345.1 protein_id gnl|my_center|LOCUS_13430 1274717 1273911 gene locus_tag LOCUS_13440 gene xth 1274717 1273911 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_13440 1275068 1275538 gene locus_tag LOCUS_13450 1275068 1275538 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_13450 1277109 1275580 gene locus_tag LOCUS_13460 1277109 1275580 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_13460 1278176 1277106 gene locus_tag LOCUS_13470 gene vorB 1278176 1277106 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060884.1 protein_id gnl|my_center|LOCUS_13470 1278449 1278177 gene locus_tag LOCUS_13480 1278449 1278177 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022860.1 protein_id gnl|my_center|LOCUS_13480 1280238 1278556 gene locus_tag LOCUS_13490 1280238 1278556 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_13490 1280812 1280258 gene locus_tag LOCUS_13500 1280812 1280258 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 protein_id gnl|my_center|LOCUS_13500 1281023 1281511 gene locus_tag LOCUS_13510 1281023 1281511 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060883.1 protein_id gnl|my_center|LOCUS_13510 1281629 1281949 gene locus_tag LOCUS_13520 1281629 1281949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1282060 1282338 gene locus_tag LOCUS_13530 1282060 1282338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1283979 1282627 gene locus_tag LOCUS_13540 gene glmM 1283979 1282627 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877192.1 protein_id gnl|my_center|LOCUS_13540 1284183 1284740 gene locus_tag LOCUS_13550 gene afpA 1284183 1284740 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064401.1 protein_id gnl|my_center|LOCUS_13550 1284967 1284767 gene locus_tag LOCUS_13560 1284967 1284767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1284966 1286465 gene locus_tag LOCUS_13570 gene serS 1284966 1286465 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876746.1 protein_id gnl|my_center|LOCUS_13570 1287216 1287992 gene locus_tag LOCUS_13580 1287216 1287992 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_13580 1289874 1288285 gene locus_tag LOCUS_13590 1289874 1288285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1291218 1289899 gene locus_tag LOCUS_13600 1291218 1289899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877191.1 protein_id gnl|my_center|LOCUS_13600 1291770 1292381 gene locus_tag LOCUS_13610 1291770 1292381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1293120 1292485 gene locus_tag LOCUS_13620 1293120 1292485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1294024 1294707 gene locus_tag LOCUS_13630 1294024 1294707 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061211.1 protein_id gnl|my_center|LOCUS_13630 1294704 1295705 gene locus_tag LOCUS_13640 1294704 1295705 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876017.1 protein_id gnl|my_center|LOCUS_13640 1296131 1295739 gene locus_tag LOCUS_13650 1296131 1295739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1297927 1296230 gene locus_tag LOCUS_13660 1297927 1296230 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061094.1 protein_id gnl|my_center|LOCUS_13660 1298531 1298016 gene locus_tag LOCUS_13670 1298531 1298016 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065175.1 protein_id gnl|my_center|LOCUS_13670 1298806 1298528 gene locus_tag LOCUS_13680 1298806 1298528 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877185.1 protein_id gnl|my_center|LOCUS_13680 1300276 1298996 gene locus_tag LOCUS_13690 gene thiC 1300276 1298996 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877184.1 protein_id gnl|my_center|LOCUS_13690 1300593 1301456 gene locus_tag LOCUS_13700 1300593 1301456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1301598 1301975 gene locus_tag LOCUS_13710 1301598 1301975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1302120 1302482 gene locus_tag LOCUS_13720 1302120 1302482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1302472 1303302 gene locus_tag LOCUS_13730 1302472 1303302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1303618 1304793 gene locus_tag LOCUS_13740 1303618 1304793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1304899 1305537 gene locus_tag LOCUS_13750 1304899 1305537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1305562 1306092 gene locus_tag LOCUS_13760 1305562 1306092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1306341 1306889 gene locus_tag LOCUS_13770 1306341 1306889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1306784 1307386 gene locus_tag LOCUS_13780 1306784 1307386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1307429 1308076 gene locus_tag LOCUS_13790 1307429 1308076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1308228 1308626 gene locus_tag LOCUS_13800 1308228 1308626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1308649 1308927 gene locus_tag LOCUS_13810 1308649 1308927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1308960 1309493 gene locus_tag LOCUS_13820 1308960 1309493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1310047 1309709 gene locus_tag LOCUS_13830 1310047 1309709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1310918 1310058 gene locus_tag LOCUS_13840 1310918 1310058 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876176.1 protein_id gnl|my_center|LOCUS_13840 1312564 1310921 gene locus_tag LOCUS_13850 1312564 1310921 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892300.1 protein_id gnl|my_center|LOCUS_13850 1312902 1313285 gene locus_tag LOCUS_13860 1312902 1313285 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061093.1 protein_id gnl|my_center|LOCUS_13860 1314169 1313330 gene locus_tag LOCUS_13870 1314169 1313330 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061092.1 protein_id gnl|my_center|LOCUS_13870 1314607 1315650 gene locus_tag LOCUS_13880 gene cofH 1314607 1315650 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021503.1 protein_id gnl|my_center|LOCUS_13880 1316093 1315722 gene locus_tag LOCUS_13890 1316093 1315722 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870296.1 protein_id gnl|my_center|LOCUS_13890 1316376 1316095 gene locus_tag LOCUS_13900 1316376 1316095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1316667 1321775 gene locus_tag LOCUS_13910 1316667 1321775 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_13910 1321874 1323883 gene locus_tag LOCUS_13920 1321874 1323883 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223224.1 protein_id gnl|my_center|LOCUS_13920 1324054 1325379 gene locus_tag LOCUS_13930 gene glnA 1324054 1325379 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_13930 1325537 1327237 gene locus_tag LOCUS_13940 1325537 1327237 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061091.1 protein_id gnl|my_center|LOCUS_13940 1327795 1327304 gene locus_tag LOCUS_13950 gene tsaA 1327795 1327304 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_13950 1328346 1328555 gene locus_tag LOCUS_13960 1328346 1328555 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724678.1 protein_id gnl|my_center|LOCUS_13960 1328763 1328957 gene locus_tag LOCUS_13970 1328763 1328957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1328969 1329973 gene locus_tag LOCUS_13980 1328969 1329973 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061086.1 protein_id gnl|my_center|LOCUS_13980 1333116 1330192 gene locus_tag LOCUS_13990 1333116 1330192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1336626 1333708 gene locus_tag LOCUS_14000 1336626 1333708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1337771 1336827 gene locus_tag LOCUS_14010 1337771 1336827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1338355 1338203 gene locus_tag LOCUS_14020 1338355 1338203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1344215 1338474 gene locus_tag LOCUS_14030 1344215 1338474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1344420 1345034 gene locus_tag LOCUS_14040 1344420 1345034 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877478.1 protein_id gnl|my_center|LOCUS_14040 1345685 1345113 gene locus_tag LOCUS_14050 1345685 1345113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1346541 1345759 gene locus_tag LOCUS_14060 1346541 1345759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065064.1 protein_id gnl|my_center|LOCUS_14060 1347639 1346596 gene locus_tag LOCUS_14070 1347639 1346596 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_14070 1348806 1347682 gene locus_tag LOCUS_14080 1348806 1347682 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066011.1 protein_id gnl|my_center|LOCUS_14080 1349202 1348900 gene locus_tag LOCUS_14090 1349202 1348900 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060878.1 protein_id gnl|my_center|LOCUS_14090 1349837 1349178 gene locus_tag LOCUS_14100 1349837 1349178 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876309.1 protein_id gnl|my_center|LOCUS_14100 1350088 1349903 gene locus_tag LOCUS_14110 1350088 1349903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1350168 1350311 gene locus_tag LOCUS_14120 1350168 1350311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1351593 1351919 gene locus_tag LOCUS_14130 1351593 1351919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1352228 1352677 gene locus_tag LOCUS_14140 1352228 1352677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1352683 1353546 gene locus_tag LOCUS_14150 1352683 1353546 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392933.1 protein_id gnl|my_center|LOCUS_14150 1353836 1354843 gene locus_tag LOCUS_14160 1353836 1354843 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272343.1 protein_id gnl|my_center|LOCUS_14160 1354929 1355348 gene locus_tag LOCUS_14170 1354929 1355348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1355447 1356445 gene locus_tag LOCUS_14180 1355447 1356445 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020838.1 protein_id gnl|my_center|LOCUS_14180 1357279 1356536 gene locus_tag LOCUS_14190 1357279 1356536 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876558.1 protein_id gnl|my_center|LOCUS_14190 1357861 1357289 gene locus_tag LOCUS_14200 1357861 1357289 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761978.1 protein_id gnl|my_center|LOCUS_14200 1358169 1358867 gene locus_tag LOCUS_14210 1358169 1358867 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694515.1 protein_id gnl|my_center|LOCUS_14210 1358902 1359477 gene locus_tag LOCUS_14220 1358902 1359477 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990722.1 protein_id gnl|my_center|LOCUS_14220 1359577 1360182 gene locus_tag LOCUS_14230 1359577 1360182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1360552 1361637 gene locus_tag LOCUS_14240 1360552 1361637 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065059.1 protein_id gnl|my_center|LOCUS_14240 1361728 1362747 gene locus_tag LOCUS_14250 1361728 1362747 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_14250 1362744 1363517 gene locus_tag LOCUS_14260 1362744 1363517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065064.1 protein_id gnl|my_center|LOCUS_14260 1363551 1363703 gene locus_tag LOCUS_14270 1363551 1363703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1363972 1364232 gene locus_tag LOCUS_14280 1363972 1364232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1364572 1365318 gene locus_tag LOCUS_14290 gene modA 1364572 1365318 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876557.1 protein_id gnl|my_center|LOCUS_14290 1365389 1366177 gene locus_tag LOCUS_14300 1365389 1366177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020382.1 protein_id gnl|my_center|LOCUS_14300 1366182 1367255 gene locus_tag LOCUS_14310 1366182 1367255 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020381.1 protein_id gnl|my_center|LOCUS_14310 1367391 1368083 gene locus_tag LOCUS_14320 1367391 1368083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1368464 1368150 gene locus_tag LOCUS_14330 1368464 1368150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1368828 1368529 gene locus_tag LOCUS_14340 1368828 1368529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1369797 1368988 gene locus_tag LOCUS_14350 1369797 1368988 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870684.1 protein_id gnl|my_center|LOCUS_14350 1371521 1369809 gene locus_tag LOCUS_14360 1371521 1369809 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877166.1 protein_id gnl|my_center|LOCUS_14360 1372870 1371530 gene locus_tag LOCUS_14370 1372870 1371530 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_14370 1373414 1372872 gene locus_tag LOCUS_14380 1373414 1372872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1373657 1373424 gene locus_tag LOCUS_14390 1373657 1373424 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877164.1 protein_id gnl|my_center|LOCUS_14390 1374731 1373673 gene locus_tag LOCUS_14400 1374731 1373673 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061086.1 protein_id gnl|my_center|LOCUS_14400 1375182 1374721 gene locus_tag LOCUS_14410 1375182 1374721 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061085.1 protein_id gnl|my_center|LOCUS_14410 1375456 1376160 gene locus_tag LOCUS_14420 gene mobB 1375456 1376160 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877160.1 protein_id gnl|my_center|LOCUS_14420 1376147 1377190 gene locus_tag LOCUS_14430 gene moaA 1376147 1377190 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061083.1 protein_id gnl|my_center|LOCUS_14430 1377981 1377232 gene locus_tag LOCUS_14440 1377981 1377232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1378249 1378082 gene locus_tag LOCUS_14450 1378249 1378082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1378605 1378459 gene locus_tag LOCUS_14460 1378605 1378459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1378815 1378609 gene locus_tag LOCUS_14470 1378815 1378609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1380034 1379150 gene locus_tag LOCUS_14480 1380034 1379150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1385058 1380058 gene locus_tag LOCUS_14490 1385058 1380058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1385057 1385254 gene locus_tag LOCUS_14500 1385057 1385254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1385615 1385322 gene locus_tag LOCUS_14510 1385615 1385322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14510 1388020 1385612 gene locus_tag LOCUS_14520 gene fdhF 1388020 1385612 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061084.1 protein_id gnl|my_center|LOCUS_14520 1389249 1388176 gene locus_tag LOCUS_14530 1389249 1388176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14530 1390087 1389299 gene locus_tag LOCUS_14540 1390087 1389299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14540 1390303 1392393 gene locus_tag LOCUS_14550 1390303 1392393 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_14550 1392697 1393587 gene locus_tag LOCUS_14560 1392697 1393587 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060745.1 protein_id gnl|my_center|LOCUS_14560 1394169 1394858 gene locus_tag LOCUS_14570 1394169 1394858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1395038 1395367 gene locus_tag LOCUS_14580 1395038 1395367 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_14580 1395480 1396232 gene locus_tag LOCUS_14590 gene fdhD 1395480 1396232 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877156.1 protein_id gnl|my_center|LOCUS_14590 1396896 1396312 gene locus_tag LOCUS_14600 gene hxlB 1396896 1396312 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061311.1 protein_id gnl|my_center|LOCUS_14600 1397010 1397873 gene locus_tag LOCUS_14610 1397010 1397873 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061082.1 protein_id gnl|my_center|LOCUS_14610 1397946 1398863 gene locus_tag LOCUS_14620 1397946 1398863 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877153.1 protein_id gnl|my_center|LOCUS_14620 1400339 1398984 gene locus_tag LOCUS_14630 1400339 1398984 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_14630 1400836 1402134 gene locus_tag LOCUS_14640 gene thiC 1400836 1402134 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877152.1 protein_id gnl|my_center|LOCUS_14640 1402269 1403852 gene locus_tag LOCUS_14650 gene lysS 1402269 1403852 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 protein_id gnl|my_center|LOCUS_14650 1404071 1403868 gene locus_tag LOCUS_14660 1404071 1403868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1404293 1404144 gene locus_tag LOCUS_14670 1404293 1404144 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583928.1 protein_id gnl|my_center|LOCUS_14670 1406784 1404337 gene locus_tag LOCUS_14680 1406784 1404337 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877144.1 protein_id gnl|my_center|LOCUS_14680 1406986 1407327 gene locus_tag LOCUS_14690 1406986 1407327 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061015.1 protein_id gnl|my_center|LOCUS_14690 1408620 1407388 gene locus_tag LOCUS_14700 1408620 1407388 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457408.1 protein_id gnl|my_center|LOCUS_14700 1408815 1409192 gene locus_tag LOCUS_14710 1408815 1409192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1409318 1409734 gene locus_tag LOCUS_14720 1409318 1409734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1410188 1409781 gene locus_tag LOCUS_14730 1410188 1409781 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877139.1 protein_id gnl|my_center|LOCUS_14730 1411226 1410306 gene locus_tag LOCUS_14740 1411226 1410306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1412725 1411373 gene locus_tag LOCUS_14750 gene purB 1412725 1411373 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877146.1 protein_id gnl|my_center|LOCUS_14750 1412974 1412813 gene locus_tag LOCUS_14760 1412974 1412813 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013294958.1 protein_id gnl|my_center|LOCUS_14760 1413206 1416469 gene locus_tag LOCUS_14770 gene polC 1413206 1416469 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061308.1 protein_id gnl|my_center|LOCUS_14770 1416617 1418923 gene locus_tag LOCUS_14780 gene nrdD 1416617 1418923 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330373.1 protein_id gnl|my_center|LOCUS_14780 1419009 1419137 gene locus_tag LOCUS_14790 1419009 1419137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1419226 1419681 gene locus_tag LOCUS_14800 1419226 1419681 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071603.1 protein_id gnl|my_center|LOCUS_14800 1420875 1419685 gene locus_tag LOCUS_14810 1420875 1419685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_14810 1421395 1420886 gene locus_tag LOCUS_14820 1421395 1420886 CDS product UGSC family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877150.1 protein_id gnl|my_center|LOCUS_14820 1422680 1421427 gene locus_tag LOCUS_14830 gene truD 1422680 1421427 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877138.1 protein_id gnl|my_center|LOCUS_14830 1423006 1423629 gene locus_tag LOCUS_14840 1423006 1423629 CDS product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102258.1 protein_id gnl|my_center|LOCUS_14840 1423643 1424326 gene locus_tag LOCUS_14850 1423643 1424326 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400890.1 protein_id gnl|my_center|LOCUS_14850 1424359 1425288 gene locus_tag LOCUS_14860 1424359 1425288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_14860 1425290 1426048 gene locus_tag LOCUS_14870 1425290 1426048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1426791 1426102 gene locus_tag LOCUS_14880 1426791 1426102 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877395.1 protein_id gnl|my_center|LOCUS_14880 1428132 1426840 gene locus_tag LOCUS_14890 1428132 1426840 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_14890 1428233 1429735 gene locus_tag LOCUS_14900 1428233 1429735 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065911.1 protein_id gnl|my_center|LOCUS_14900 1429924 1430784 gene locus_tag LOCUS_14910 gene hisG 1429924 1430784 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877116.1 protein_id gnl|my_center|LOCUS_14910 1430819 1431598 gene locus_tag LOCUS_14920 1430819 1431598 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 protein_id gnl|my_center|LOCUS_14920 1432725 1431622 gene locus_tag LOCUS_14930 1432725 1431622 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094976.1 protein_id gnl|my_center|LOCUS_14930 1433237 1432950 gene locus_tag LOCUS_14940 1433237 1432950 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545162.1 protein_id gnl|my_center|LOCUS_14940 1436187 1433323 gene locus_tag LOCUS_14950 gene leuS 1436187 1433323 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061305.1 protein_id gnl|my_center|LOCUS_14950 1436621 1436310 gene locus_tag LOCUS_14960 1436621 1436310 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_14960 1437435 1436623 gene locus_tag LOCUS_14970 1437435 1436623 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061072.1 protein_id gnl|my_center|LOCUS_14970 1437724 1438731 gene locus_tag LOCUS_14980 1437724 1438731 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_14980 1439073 1438831 gene locus_tag LOCUS_14990 1439073 1438831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1440679 1439192 gene locus_tag LOCUS_15000 1440679 1439192 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061013.1 protein_id gnl|my_center|LOCUS_15000 1442740 1440935 gene locus_tag LOCUS_15010 1442740 1440935 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022623.1 protein_id gnl|my_center|LOCUS_15010 1443319 1442759 gene locus_tag LOCUS_15020 1443319 1442759 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_15020 1443404 1443775 gene locus_tag LOCUS_15030 1443404 1443775 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_15030 1444400 1443777 gene locus_tag LOCUS_15040 1444400 1443777 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877124.1 protein_id gnl|my_center|LOCUS_15040 1444494 1446227 gene locus_tag LOCUS_15050 1444494 1446227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1447203 1446232 gene locus_tag LOCUS_15060 1447203 1446232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1448521 1447364 gene locus_tag LOCUS_15070 1448521 1447364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15070 1449471 1448533 gene locus_tag LOCUS_15080 1449471 1448533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1449567 1449767 gene locus_tag LOCUS_15090 1449567 1449767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1450692 1449727 gene locus_tag LOCUS_15100 1450692 1449727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1451378 1450617 gene locus_tag LOCUS_15110 1451378 1450617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1451874 1451413 gene locus_tag LOCUS_15120 1451874 1451413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1453414 1451843 gene locus_tag LOCUS_15130 1453414 1451843 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950374.1 protein_id gnl|my_center|LOCUS_15130 1453570 1454757 gene locus_tag LOCUS_15140 1453570 1454757 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_15140 1456158 1454764 gene locus_tag LOCUS_15150 1456158 1454764 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250508.1 protein_id gnl|my_center|LOCUS_15150 1456270 1458993 gene locus_tag LOCUS_15160 1456270 1458993 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061075.1 protein_id gnl|my_center|LOCUS_15160 1459385 1458990 gene locus_tag LOCUS_15170 1459385 1458990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15170 1459741 1459394 gene locus_tag LOCUS_15180 1459741 1459394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15180 1459850 1460935 gene locus_tag LOCUS_15190 gene cfbD 1459850 1460935 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877132.1 protein_id gnl|my_center|LOCUS_15190 1460986 1461993 gene locus_tag LOCUS_15200 1460986 1461993 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877133.1 protein_id gnl|my_center|LOCUS_15200 1462071 1462682 gene locus_tag LOCUS_15210 gene hisH 1462071 1462682 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_15210 1462753 1464114 gene locus_tag LOCUS_15220 1462753 1464114 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061078.1 protein_id gnl|my_center|LOCUS_15220 1464142 1464585 gene locus_tag LOCUS_15230 1464142 1464585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1464656 1465207 gene locus_tag LOCUS_15240 1464656 1465207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1465345 1465947 gene locus_tag LOCUS_15250 1465345 1465947 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870116.1 protein_id gnl|my_center|LOCUS_15250 1466793 1466014 gene locus_tag LOCUS_15260 1466793 1466014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1467001 1468140 gene locus_tag LOCUS_15270 1467001 1468140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1468227 1468862 gene locus_tag LOCUS_15280 1468227 1468862 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022715.1 protein_id gnl|my_center|LOCUS_15280 1469010 1469177 gene locus_tag LOCUS_15290 1469010 1469177 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061197.1 protein_id gnl|my_center|LOCUS_15290 1469174 1470379 gene locus_tag LOCUS_15300 1469174 1470379 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061196.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence2 2151 1903 gene locus_tag LOCUS_15310 2151 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2542 2204 gene locus_tag LOCUS_15320 2542 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3082 2555 gene locus_tag LOCUS_15330 3082 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3760 3236 gene locus_tag LOCUS_15340 3760 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4445 3801 gene locus_tag LOCUS_15350 4445 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 5364 4519 gene locus_tag LOCUS_15360 5364 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 6212 5550 gene locus_tag LOCUS_15370 6212 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 9586 6242 gene locus_tag LOCUS_15380 9586 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 10612 9998 gene locus_tag LOCUS_15390 10612 9998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 12368 10707 gene locus_tag LOCUS_15400 12368 10707 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_15400 12501 14171 gene locus_tag LOCUS_15410 gene sepS 12501 14171 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877111.1 protein_id gnl|my_center|LOCUS_15410 14164 14841 gene locus_tag LOCUS_15420 gene nfi 14164 14841 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583138.1 protein_id gnl|my_center|LOCUS_15420 14843 15238 gene locus_tag LOCUS_15430 14843 15238 CDS product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877110.1 protein_id gnl|my_center|LOCUS_15430 15348 16028 gene locus_tag LOCUS_15440 gene ribB 15348 16028 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877109.1 protein_id gnl|my_center|LOCUS_15440 16144 16809 gene locus_tag LOCUS_15450 16144 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 18393 16882 gene locus_tag LOCUS_15460 18393 16882 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061066.1 protein_id gnl|my_center|LOCUS_15460 19822 18446 gene locus_tag LOCUS_15470 gene gatA 19822 18446 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061065.1 protein_id gnl|my_center|LOCUS_15470 20906 19983 gene locus_tag LOCUS_15480 20906 19983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 21871 20933 gene locus_tag LOCUS_15490 21871 20933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 22356 22523 gene locus_tag LOCUS_15500 22356 22523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 22869 23861 gene locus_tag LOCUS_15510 gene ala 22869 23861 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061064.1 protein_id gnl|my_center|LOCUS_15510 23964 24617 gene locus_tag LOCUS_15520 23964 24617 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877104.1 protein_id gnl|my_center|LOCUS_15520 24654 25451 gene locus_tag LOCUS_15530 24654 25451 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877103.1 protein_id gnl|my_center|LOCUS_15530 26191 25565 gene locus_tag LOCUS_15540 26191 25565 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485785.1 protein_id gnl|my_center|LOCUS_15540 27357 26251 gene locus_tag LOCUS_15550 27357 26251 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877428.1 protein_id gnl|my_center|LOCUS_15550 28117 27347 gene locus_tag LOCUS_15560 28117 27347 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877099.1 protein_id gnl|my_center|LOCUS_15560 28291 28776 gene locus_tag LOCUS_15570 28291 28776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 28803 29879 gene locus_tag LOCUS_15580 28803 29879 CDS product DrrA-related ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877097.1 protein_id gnl|my_center|LOCUS_15580 29882 31042 gene locus_tag LOCUS_15590 29882 31042 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877096.1 protein_id gnl|my_center|LOCUS_15590 31105 32343 gene locus_tag LOCUS_15600 31105 32343 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_15600 32821 32546 gene locus_tag LOCUS_15610 gene albA 32821 32546 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061063.1 protein_id gnl|my_center|LOCUS_15610 34194 32992 gene locus_tag LOCUS_15620 34194 32992 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877092.1 protein_id gnl|my_center|LOCUS_15620 34627 34235 gene locus_tag LOCUS_15630 34627 34235 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021483.1 protein_id gnl|my_center|LOCUS_15630 36215 34698 gene locus_tag LOCUS_15640 36215 34698 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877091.1 protein_id gnl|my_center|LOCUS_15640 37102 36299 gene locus_tag LOCUS_15650 37102 36299 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877090.1 protein_id gnl|my_center|LOCUS_15650 37896 37246 gene locus_tag LOCUS_15660 37896 37246 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_15660 38967 37942 gene locus_tag LOCUS_15670 38967 37942 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892670.1 protein_id gnl|my_center|LOCUS_15670 39116 40408 gene locus_tag LOCUS_15680 39116 40408 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877086.1 protein_id gnl|my_center|LOCUS_15680 40755 41129 gene locus_tag LOCUS_15690 40755 41129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 41126 42295 gene locus_tag LOCUS_15700 41126 42295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 42523 43764 gene locus_tag LOCUS_15710 42523 43764 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877084.1 protein_id gnl|my_center|LOCUS_15710 43866 44462 gene locus_tag LOCUS_15720 43866 44462 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879016.1 protein_id gnl|my_center|LOCUS_15720 44649 44876 gene locus_tag LOCUS_15730 44649 44876 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061061.1 protein_id gnl|my_center|LOCUS_15730 44842 45420 gene locus_tag LOCUS_15740 gene hisB 44842 45420 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061060.1 protein_id gnl|my_center|LOCUS_15740 45434 46063 gene locus_tag LOCUS_15750 45434 46063 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485785.1 protein_id gnl|my_center|LOCUS_15750 47008 46178 gene locus_tag LOCUS_15760 47008 46178 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877074.1 protein_id gnl|my_center|LOCUS_15760 48378 47200 gene locus_tag LOCUS_15770 48378 47200 CDS product oligosaccharide repeat unit polymerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877071.1 protein_id gnl|my_center|LOCUS_15770 49781 48432 gene locus_tag LOCUS_15780 gene cfbB 49781 48432 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877070.1 protein_id gnl|my_center|LOCUS_15780 50282 51058 gene locus_tag LOCUS_15790 50282 51058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 51584 51156 gene locus_tag LOCUS_15800 51584 51156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 52366 51581 gene locus_tag LOCUS_15810 52366 51581 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_15810 54365 52539 gene locus_tag LOCUS_15820 54365 52539 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877065.1 protein_id gnl|my_center|LOCUS_15820 54622 56277 gene locus_tag LOCUS_15830 gene ilvD 54622 56277 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061057.1 protein_id gnl|my_center|LOCUS_15830 56287 56724 gene locus_tag LOCUS_15840 56287 56724 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877058.1 protein_id gnl|my_center|LOCUS_15840 56799 58640 gene locus_tag LOCUS_15850 gene argS 56799 58640 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877057.1 protein_id gnl|my_center|LOCUS_15850 59670 58765 gene locus_tag LOCUS_15860 gene argF 59670 58765 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877056.1 protein_id gnl|my_center|LOCUS_15860 61053 59737 gene locus_tag LOCUS_15870 gene purD 61053 59737 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061056.1 protein_id gnl|my_center|LOCUS_15870 61252 62997 gene locus_tag LOCUS_15880 61252 62997 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_15880 62998 63495 gene locus_tag LOCUS_15890 gene ilvN 62998 63495 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061054.1 protein_id gnl|my_center|LOCUS_15890 63547 64527 gene locus_tag LOCUS_15900 gene ilvC 63547 64527 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061053.1 protein_id gnl|my_center|LOCUS_15900 64576 65568 gene locus_tag LOCUS_15910 64576 65568 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061052.1 protein_id gnl|my_center|LOCUS_15910 65882 65577 gene locus_tag LOCUS_15920 65882 65577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 66905 66105 gene locus_tag LOCUS_15930 gene surE 66905 66105 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878442.1 protein_id gnl|my_center|LOCUS_15930 67039 67818 gene locus_tag LOCUS_15940 67039 67818 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061050.1 protein_id gnl|my_center|LOCUS_15940 68013 67939 gene locus_tag LOCUS_t00210 68013 67939 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 68143 68072 gene locus_tag LOCUS_t00220 68143 68072 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 68350 69273 gene locus_tag LOCUS_15950 gene ilvE 68350 69273 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_15950 69324 70160 gene locus_tag LOCUS_15960 69324 70160 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546705.1 protein_id gnl|my_center|LOCUS_15960 70389 70192 gene locus_tag LOCUS_15970 70389 70192 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879289.1 protein_id gnl|my_center|LOCUS_15970 70824 70399 gene locus_tag LOCUS_15980 70824 70399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 72043 70973 gene locus_tag LOCUS_15990 72043 70973 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061048.1 protein_id gnl|my_center|LOCUS_15990 72186 73811 gene locus_tag LOCUS_16000 72186 73811 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877037.1 protein_id gnl|my_center|LOCUS_16000 74735 73845 gene locus_tag LOCUS_16010 74735 73845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 74917 75492 gene locus_tag LOCUS_16020 74917 75492 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877036.1 protein_id gnl|my_center|LOCUS_16020 75580 75981 gene locus_tag LOCUS_16030 75580 75981 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061047.1 protein_id gnl|my_center|LOCUS_16030 75947 77338 gene locus_tag LOCUS_16040 75947 77338 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330372.1 protein_id gnl|my_center|LOCUS_16040 77357 78547 gene locus_tag LOCUS_16050 77357 78547 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_16050 78756 79592 gene locus_tag LOCUS_16060 78756 79592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141459.1 protein_id gnl|my_center|LOCUS_16060 79594 79842 gene locus_tag LOCUS_16070 79594 79842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 79836 80105 gene locus_tag LOCUS_16080 79836 80105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 80432 82621 gene locus_tag LOCUS_16090 80432 82621 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877027.1 protein_id gnl|my_center|LOCUS_16090 82690 83418 gene locus_tag LOCUS_16100 82690 83418 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061045.1 protein_id gnl|my_center|LOCUS_16100 83600 84517 gene locus_tag LOCUS_16110 gene pyrB 83600 84517 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877025.1 protein_id gnl|my_center|LOCUS_16110 85852 84704 gene locus_tag LOCUS_16120 gene cdc6-1 85852 84704 CDS product ORC1-type DNA replication protein Cdc6-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877024.1 protein_id gnl|my_center|LOCUS_16120 85885 86064 gene locus_tag LOCUS_16130 85885 86064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 87011 86523 gene locus_tag LOCUS_16140 87011 86523 CDS product DUF2299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877022.1 protein_id gnl|my_center|LOCUS_16140 87208 88041 gene locus_tag LOCUS_16150 gene cbiB 87208 88041 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_16150 88247 89290 gene locus_tag LOCUS_16160 88247 89290 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877020.1 protein_id gnl|my_center|LOCUS_16160 89521 89781 gene locus_tag LOCUS_16170 89521 89781 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061044.1 protein_id gnl|my_center|LOCUS_16170 90410 89877 gene locus_tag LOCUS_16180 90410 89877 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892716.1 protein_id gnl|my_center|LOCUS_16180 92271 90607 gene locus_tag LOCUS_16190 92271 90607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 92414 92935 gene locus_tag LOCUS_16200 92414 92935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 92978 94042 gene locus_tag LOCUS_16210 gene cobJ 92978 94042 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877015.1 protein_id gnl|my_center|LOCUS_16210 94609 94121 gene locus_tag LOCUS_16220 94609 94121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 94735 95106 gene locus_tag LOCUS_16230 94735 95106 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_16230 96002 95130 gene locus_tag LOCUS_16240 gene dapF 96002 95130 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876947.1 protein_id gnl|my_center|LOCUS_16240 97322 96036 gene locus_tag LOCUS_16250 gene lysA 97322 96036 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_16250 98651 97473 gene locus_tag LOCUS_16260 98651 97473 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 protein_id gnl|my_center|LOCUS_16260 98790 99215 gene locus_tag LOCUS_16270 98790 99215 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_16270 99769 99254 gene locus_tag LOCUS_16280 99769 99254 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876952.1 protein_id gnl|my_center|LOCUS_16280 99905 100165 gene locus_tag LOCUS_16290 99905 100165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 100806 100147 gene locus_tag LOCUS_16300 100806 100147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 101807 100824 gene locus_tag LOCUS_16310 101807 100824 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876955.1 protein_id gnl|my_center|LOCUS_16310 103217 101820 gene locus_tag LOCUS_16320 103217 101820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 103497 103330 gene locus_tag LOCUS_16330 103497 103330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 103619 103972 gene locus_tag LOCUS_16340 103619 103972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 104455 104045 gene locus_tag LOCUS_16350 104455 104045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 105059 104496 gene locus_tag LOCUS_16360 105059 104496 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744266.1 protein_id gnl|my_center|LOCUS_16360 106717 105176 gene locus_tag LOCUS_16370 106717 105176 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947011.1 protein_id gnl|my_center|LOCUS_16370 107943 107401 gene locus_tag LOCUS_16380 107943 107401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16380 108239 107991 gene locus_tag LOCUS_16390 108239 107991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16390 108469 108260 gene locus_tag LOCUS_16400 108469 108260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 108583 108909 gene locus_tag LOCUS_16410 108583 108909 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_16410 109525 109034 gene locus_tag LOCUS_16420 109525 109034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 110539 109715 gene locus_tag LOCUS_16430 gene hisF 110539 109715 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061292.1 protein_id gnl|my_center|LOCUS_16430 110723 111448 gene locus_tag LOCUS_16440 110723 111448 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_16440 111451 112026 gene locus_tag LOCUS_16450 111451 112026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16450 112049 112231 gene locus_tag LOCUS_16460 112049 112231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 112409 113041 gene locus_tag LOCUS_16470 112409 113041 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876213.1 protein_id gnl|my_center|LOCUS_16470 113130 113906 gene locus_tag LOCUS_16480 113130 113906 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060846.1 protein_id gnl|my_center|LOCUS_16480 114045 114776 gene locus_tag LOCUS_16490 114045 114776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 114988 115066 gene locus_tag LOCUS_t00230 114988 115066 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 115375 115073 gene locus_tag LOCUS_16500 115375 115073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 120584 115395 gene locus_tag LOCUS_16510 120584 115395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 122442 120706 gene locus_tag LOCUS_16520 122442 120706 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876959.1 protein_id gnl|my_center|LOCUS_16520 122563 123261 gene locus_tag LOCUS_16530 gene cobI 122563 123261 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876960.1 protein_id gnl|my_center|LOCUS_16530 124152 123367 gene locus_tag LOCUS_16540 124152 123367 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876961.1 protein_id gnl|my_center|LOCUS_16540 124322 125545 gene locus_tag LOCUS_16550 124322 125545 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870253.1 protein_id gnl|my_center|LOCUS_16550 125618 126034 gene locus_tag LOCUS_16560 125618 126034 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870251.1 protein_id gnl|my_center|LOCUS_16560 126586 127149 gene locus_tag LOCUS_16570 126586 127149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16570 128882 127530 gene locus_tag LOCUS_16580 128882 127530 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876966.1 protein_id gnl|my_center|LOCUS_16580 129092 129565 gene locus_tag LOCUS_16590 129092 129565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 130761 129589 gene locus_tag LOCUS_16600 130761 129589 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061033.1 protein_id gnl|my_center|LOCUS_16600 132092 130878 gene locus_tag LOCUS_16610 132092 130878 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876981.1 protein_id gnl|my_center|LOCUS_16610 132405 132890 gene locus_tag LOCUS_16620 132405 132890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 132992 133837 gene locus_tag LOCUS_16630 132992 133837 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 protein_id gnl|my_center|LOCUS_16630 134197 133898 gene locus_tag LOCUS_16640 134197 133898 CDS product DUF2769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875739.1 protein_id gnl|my_center|LOCUS_16640 134345 135262 gene locus_tag LOCUS_16650 134345 135262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876982.1 protein_id gnl|my_center|LOCUS_16650 135330 136517 gene locus_tag LOCUS_16660 135330 136517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876983.1 protein_id gnl|my_center|LOCUS_16660 136608 137015 gene locus_tag LOCUS_16670 136608 137015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 137042 137254 gene locus_tag LOCUS_16680 137042 137254 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876941.1 protein_id gnl|my_center|LOCUS_16680 137329 138411 gene locus_tag LOCUS_16690 137329 138411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_16690 138404 139069 gene locus_tag LOCUS_16700 138404 139069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_16700 139094 140224 gene locus_tag LOCUS_16710 139094 140224 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876984.1 protein_id gnl|my_center|LOCUS_16710 140803 140294 gene locus_tag LOCUS_16720 140803 140294 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876985.1 protein_id gnl|my_center|LOCUS_16720 143067 140875 gene locus_tag LOCUS_16730 gene purL 143067 140875 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876986.1 protein_id gnl|my_center|LOCUS_16730 146301 143140 gene locus_tag LOCUS_16740 gene ileS 146301 143140 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876987.1 protein_id gnl|my_center|LOCUS_16740 147664 146459 gene locus_tag LOCUS_16750 147664 146459 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061035.1 protein_id gnl|my_center|LOCUS_16750 147908 148285 gene locus_tag LOCUS_16760 147908 148285 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876989.1 protein_id gnl|my_center|LOCUS_16760 148408 148701 gene locus_tag LOCUS_16770 148408 148701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892859.1 protein_id gnl|my_center|LOCUS_16770 149489 148782 gene locus_tag LOCUS_16780 149489 148782 CDS product dihydromethanopterin reductase (acceptor) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876991.1 protein_id gnl|my_center|LOCUS_16780 150831 149563 gene locus_tag LOCUS_16790 gene glyA 150831 149563 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_16790 153046 151061 gene locus_tag LOCUS_16800 gene hdrA 153046 151061 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_16800 154232 153297 gene locus_tag LOCUS_16810 gene radA 154232 153297 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876995.1 protein_id gnl|my_center|LOCUS_16810 156653 154275 gene locus_tag LOCUS_16820 156653 154275 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115891889.1 protein_id gnl|my_center|LOCUS_16820 157044 157463 gene locus_tag LOCUS_16830 157044 157463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 157500 158753 gene locus_tag LOCUS_16840 gene hacA 157500 158753 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_16840 158813 159319 gene locus_tag LOCUS_16850 158813 159319 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876999.1 protein_id gnl|my_center|LOCUS_16850 159391 160377 gene locus_tag LOCUS_16860 159391 160377 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061040.1 protein_id gnl|my_center|LOCUS_16860 160553 161752 gene locus_tag LOCUS_16870 160553 161752 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061297.1 protein_id gnl|my_center|LOCUS_16870 161959 162363 gene locus_tag LOCUS_16880 gene ribH 161959 162363 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877002.1 protein_id gnl|my_center|LOCUS_16880 162412 163344 gene locus_tag LOCUS_16890 162412 163344 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877003.1 protein_id gnl|my_center|LOCUS_16890 165101 163389 gene locus_tag LOCUS_16900 165101 163389 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877004.1 protein_id gnl|my_center|LOCUS_16900 165329 166333 gene locus_tag LOCUS_16910 gene purE 165329 166333 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061041.1 protein_id gnl|my_center|LOCUS_16910 166351 167658 gene locus_tag LOCUS_16920 166351 167658 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_16920 168468 167698 gene locus_tag LOCUS_16930 168468 167698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 170308 169301 gene locus_tag LOCUS_16940 gene amrS 170308 169301 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877007.1 protein_id gnl|my_center|LOCUS_16940 171398 170352 gene locus_tag LOCUS_16950 gene thiL 171398 170352 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877008.1 protein_id gnl|my_center|LOCUS_16950 171897 171385 gene locus_tag LOCUS_16960 gene cfbA 171897 171385 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061042.1 protein_id gnl|my_center|LOCUS_16960 172267 171869 gene locus_tag LOCUS_16970 172267 171869 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061298.1 protein_id gnl|my_center|LOCUS_16970 172496 173488 gene locus_tag LOCUS_16980 172496 173488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877011.1 protein_id gnl|my_center|LOCUS_16980 173505 174494 gene locus_tag LOCUS_16990 173505 174494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 174672 175439 gene locus_tag LOCUS_17000 174672 175439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 175650 176102 gene locus_tag LOCUS_17010 175650 176102 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_17010 176126 177364 gene locus_tag LOCUS_17020 176126 177364 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_17020 177382 178638 gene locus_tag LOCUS_17030 177382 178638 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_17030 179258 178662 gene locus_tag LOCUS_17040 179258 178662 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061290.1 protein_id gnl|my_center|LOCUS_17040 179629 179306 gene locus_tag LOCUS_17050 179629 179306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17050 179786 179646 gene locus_tag LOCUS_17060 179786 179646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 180090 179797 gene locus_tag LOCUS_17070 180090 179797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 180443 180120 gene locus_tag LOCUS_17080 180443 180120 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989541.1 protein_id gnl|my_center|LOCUS_17080 180583 181083 gene locus_tag LOCUS_17090 180583 181083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 181961 181134 gene locus_tag LOCUS_17100 gene rsmA 181961 181134 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876939.1 protein_id gnl|my_center|LOCUS_17100 182580 182002 gene locus_tag LOCUS_17110 182580 182002 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_17110 182988 182650 gene locus_tag LOCUS_17120 182988 182650 CDS product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061025.1 protein_id gnl|my_center|LOCUS_17120 183283 182993 gene locus_tag LOCUS_17130 183283 182993 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876936.1 protein_id gnl|my_center|LOCUS_17130 184871 183615 gene locus_tag LOCUS_17140 184871 183615 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876935.1 protein_id gnl|my_center|LOCUS_17140 186295 184961 gene locus_tag LOCUS_17150 186295 184961 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876934.1 protein_id gnl|my_center|LOCUS_17150 186527 187084 gene locus_tag LOCUS_17160 gene hpt 186527 187084 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061024.1 protein_id gnl|my_center|LOCUS_17160 187122 188117 gene locus_tag LOCUS_17170 gene dph2 187122 188117 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_17170 188272 189345 gene locus_tag LOCUS_17180 188272 189345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 189652 190221 gene locus_tag LOCUS_17190 189652 190221 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876931.1 protein_id gnl|my_center|LOCUS_17190 190223 190528 gene locus_tag LOCUS_17200 190223 190528 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876930.1 protein_id gnl|my_center|LOCUS_17200 190603 191211 gene locus_tag LOCUS_17210 190603 191211 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_17210 191259 191666 gene locus_tag LOCUS_17220 191259 191666 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876928.1 protein_id gnl|my_center|LOCUS_17220 191722 192039 gene locus_tag LOCUS_17230 191722 192039 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061022.1 protein_id gnl|my_center|LOCUS_17230 192127 192960 gene locus_tag LOCUS_17240 192127 192960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 193023 193757 gene locus_tag LOCUS_17250 gene pcn 193023 193757 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876925.1 protein_id gnl|my_center|LOCUS_17250 193760 194815 gene locus_tag LOCUS_17260 193760 194815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 195046 194843 gene locus_tag LOCUS_17270 195046 194843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 195458 195282 gene locus_tag LOCUS_17280 195458 195282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 196025 195465 gene locus_tag LOCUS_17290 196025 195465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 196327 196608 gene locus_tag LOCUS_17300 196327 196608 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876923.1 protein_id gnl|my_center|LOCUS_17300 196623 196808 gene locus_tag LOCUS_17310 196623 196808 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876922.1 protein_id gnl|my_center|LOCUS_17310 196848 197627 gene locus_tag LOCUS_17320 196848 197627 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061020.1 protein_id gnl|my_center|LOCUS_17320 197624 197803 gene locus_tag LOCUS_17330 197624 197803 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876920.1 protein_id gnl|my_center|LOCUS_17330 197804 198577 gene locus_tag LOCUS_17340 197804 198577 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496756.1 protein_id gnl|my_center|LOCUS_17340 198726 199943 gene locus_tag LOCUS_17350 198726 199943 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876918.1 protein_id gnl|my_center|LOCUS_17350 200095 200271 gene locus_tag LOCUS_17360 200095 200271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 200352 200277 gene locus_tag LOCUS_t00240 200352 200277 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 200473 200398 gene locus_tag LOCUS_t00250 200473 200398 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 201401 200682 gene locus_tag LOCUS_17370 201401 200682 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876917.1 protein_id gnl|my_center|LOCUS_17370 201671 202888 gene locus_tag LOCUS_17380 gene frhA 201671 202888 CDS product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061018.1 protein_id gnl|my_center|LOCUS_17380 202897 203367 gene locus_tag LOCUS_17390 gene frhD 202897 203367 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876914.1 protein_id gnl|my_center|LOCUS_17390 203371 204195 gene locus_tag LOCUS_17400 gene frhG 203371 204195 CDS product coenzyme F420 hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876913.1 protein_id gnl|my_center|LOCUS_17400 204208 205092 gene locus_tag LOCUS_17410 gene frhB 204208 205092 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876912.1 protein_id gnl|my_center|LOCUS_17410 206094 205162 gene locus_tag LOCUS_17420 gene map 206094 205162 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061017.1 protein_id gnl|my_center|LOCUS_17420 206333 206515 gene locus_tag LOCUS_17430 206333 206515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 206645 207109 gene locus_tag LOCUS_17440 206645 207109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876910.1 protein_id gnl|my_center|LOCUS_17440 207111 207689 gene locus_tag LOCUS_17450 207111 207689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876909.1 protein_id gnl|my_center|LOCUS_17450 207789 207863 gene locus_tag LOCUS_t00260 207789 207863 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 208291 208989 gene locus_tag LOCUS_17460 208291 208989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 208931 209089 gene locus_tag LOCUS_17470 208931 209089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 210294 209134 gene locus_tag LOCUS_17480 gene dnaJ 210294 209134 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876908.1 protein_id gnl|my_center|LOCUS_17480 212336 210462 gene locus_tag LOCUS_17490 gene dnaK 212336 210462 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_17490 212900 212343 gene locus_tag LOCUS_17500 212900 212343 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876906.1 protein_id gnl|my_center|LOCUS_17500 213145 213636 gene locus_tag LOCUS_17510 213145 213636 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876905.1 protein_id gnl|my_center|LOCUS_17510 215992 213692 gene locus_tag LOCUS_17520 gene hypF 215992 213692 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496588.1 protein_id gnl|my_center|LOCUS_17520 216363 217907 gene locus_tag LOCUS_17530 216363 217907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 217987 218745 gene locus_tag LOCUS_17540 gene larB 217987 218745 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061016.1 protein_id gnl|my_center|LOCUS_17540 219120 218806 gene locus_tag LOCUS_17550 219120 218806 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061015.1 protein_id gnl|my_center|LOCUS_17550 219480 219992 gene locus_tag LOCUS_17560 219480 219992 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_17560 220069 220518 gene locus_tag LOCUS_17570 220069 220518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 221243 220545 gene locus_tag LOCUS_17580 221243 220545 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879896.1 protein_id gnl|my_center|LOCUS_17580 221770 221261 gene locus_tag LOCUS_17590 221770 221261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 223601 221814 gene locus_tag LOCUS_17600 gene polB1 223601 221814 CDS product DNA polymerase PolB subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876832.1 protein_id gnl|my_center|LOCUS_17600 223635 224243 gene locus_tag LOCUS_17610 223635 224243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 224416 224757 gene locus_tag LOCUS_17620 224416 224757 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_17620 224750 225367 gene locus_tag LOCUS_17630 224750 225367 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831458.1 protein_id gnl|my_center|LOCUS_17630 225367 225714 gene locus_tag LOCUS_17640 225367 225714 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_17640 226108 227160 gene locus_tag LOCUS_17650 226108 227160 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_17650 227153 227809 gene locus_tag LOCUS_17660 227153 227809 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_17660 228868 227855 gene locus_tag LOCUS_17670 228868 227855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 229544 228861 gene locus_tag LOCUS_17680 229544 228861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 229960 229607 gene locus_tag LOCUS_17690 229960 229607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17690 230364 229909 gene locus_tag LOCUS_17700 230364 229909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17700 230847 230407 gene locus_tag LOCUS_17710 230847 230407 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963527.1 protein_id gnl|my_center|LOCUS_17710 231214 230918 gene locus_tag LOCUS_17720 231214 230918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 231339 231461 gene locus_tag LOCUS_17730 231339 231461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 231632 232375 gene locus_tag LOCUS_17740 231632 232375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 232388 233179 gene locus_tag LOCUS_17750 232388 233179 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461573.1 protein_id gnl|my_center|LOCUS_17750 233227 233805 gene locus_tag LOCUS_17760 233227 233805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 233891 234358 gene locus_tag LOCUS_17770 233891 234358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 234391 235209 gene locus_tag LOCUS_17780 234391 235209 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_17780 235306 235590 gene locus_tag LOCUS_17790 235306 235590 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_17790 235621 235953 gene locus_tag LOCUS_17800 235621 235953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 236184 237065 gene locus_tag LOCUS_17810 236184 237065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877147.1 protein_id gnl|my_center|LOCUS_17810 239688 237706 gene locus_tag LOCUS_17820 239688 237706 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485824.1 protein_id gnl|my_center|LOCUS_17820 240001 240525 gene locus_tag LOCUS_17830 240001 240525 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979839.1 protein_id gnl|my_center|LOCUS_17830 240624 241640 gene locus_tag LOCUS_17840 240624 241640 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 protein_id gnl|my_center|LOCUS_17840 241645 242829 gene locus_tag LOCUS_17850 241645 242829 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877096.1 protein_id gnl|my_center|LOCUS_17850 242944 243261 gene locus_tag LOCUS_17860 242944 243261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 243577 244041 gene locus_tag LOCUS_17870 243577 244041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 244079 244714 gene locus_tag LOCUS_17880 244079 244714 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 protein_id gnl|my_center|LOCUS_17880 244763 245335 gene locus_tag LOCUS_17890 244763 245335 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024490.1 protein_id gnl|my_center|LOCUS_17890 245879 245304 gene locus_tag LOCUS_17900 245879 245304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 246117 246860 gene locus_tag LOCUS_17910 246117 246860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 246870 247673 gene locus_tag LOCUS_17920 246870 247673 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065502.1 protein_id gnl|my_center|LOCUS_17920 247987 248376 gene locus_tag LOCUS_17930 247987 248376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 248483 248554 gene locus_tag LOCUS_t00270 248483 248554 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 248783 249400 gene locus_tag LOCUS_17940 248783 249400 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876891.1 protein_id gnl|my_center|LOCUS_17940 249558 251495 gene locus_tag LOCUS_17950 249558 251495 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_17950 252352 251564 gene locus_tag LOCUS_17960 252352 251564 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061142.1 protein_id gnl|my_center|LOCUS_17960 252673 253239 gene locus_tag LOCUS_17970 252673 253239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 253372 253842 gene locus_tag LOCUS_17980 253372 253842 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084126250.1 protein_id gnl|my_center|LOCUS_17980 254046 254429 gene locus_tag LOCUS_17990 254046 254429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 254618 255643 gene locus_tag LOCUS_18000 254618 255643 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_18000 255720 256115 gene locus_tag LOCUS_18010 255720 256115 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876052.1 protein_id gnl|my_center|LOCUS_18010 256133 257029 gene locus_tag LOCUS_18020 gene fhcD 256133 257029 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869816.1 protein_id gnl|my_center|LOCUS_18020 259008 257068 gene locus_tag LOCUS_18030 259008 257068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 259269 260741 gene locus_tag LOCUS_18040 259269 260741 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876880.1 protein_id gnl|my_center|LOCUS_18040 261228 260800 gene locus_tag LOCUS_18050 261228 260800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 261894 261499 gene locus_tag LOCUS_18060 261894 261499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 262463 262071 gene locus_tag LOCUS_18070 262463 262071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 263656 262517 gene locus_tag LOCUS_18080 263656 262517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 264468 263926 gene locus_tag LOCUS_18090 264468 263926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 265516 264791 gene locus_tag LOCUS_18100 265516 264791 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021837.1 protein_id gnl|my_center|LOCUS_18100 265987 265538 gene locus_tag LOCUS_18110 265987 265538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 267119 266088 gene locus_tag LOCUS_18120 267119 266088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 267868 267176 gene locus_tag LOCUS_18130 267868 267176 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065512.1 protein_id gnl|my_center|LOCUS_18130 269552 268371 gene locus_tag LOCUS_18140 269552 268371 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061009.1 protein_id gnl|my_center|LOCUS_18140 269808 270536 gene locus_tag LOCUS_18150 269808 270536 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061008.1 protein_id gnl|my_center|LOCUS_18150 271619 271930 gene locus_tag LOCUS_18160 271619 271930 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876875.1 protein_id gnl|my_center|LOCUS_18160 272028 272288 gene locus_tag LOCUS_18170 272028 272288 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876874.1 protein_id gnl|my_center|LOCUS_18170 272291 272578 gene locus_tag LOCUS_18180 272291 272578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 272575 272817 gene locus_tag LOCUS_18190 272575 272817 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869936.1 protein_id gnl|my_center|LOCUS_18190 272837 273208 gene locus_tag LOCUS_18200 272837 273208 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330371.1 protein_id gnl|my_center|LOCUS_18200 273261 274760 gene locus_tag LOCUS_18210 gene ehbF 273261 274760 CDS product energy conserving hydrogenase EhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876870.1 protein_id gnl|my_center|LOCUS_18210 274774 275112 gene locus_tag LOCUS_18220 274774 275112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876869.1 protein_id gnl|my_center|LOCUS_18220 275105 275383 gene locus_tag LOCUS_18230 275105 275383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061006.1 protein_id gnl|my_center|LOCUS_18230 275385 275873 gene locus_tag LOCUS_18240 275385 275873 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876867.1 protein_id gnl|my_center|LOCUS_18240 275870 276142 gene locus_tag LOCUS_18250 275870 276142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876866.1 protein_id gnl|my_center|LOCUS_18250 276117 276302 gene locus_tag LOCUS_18260 276117 276302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 276269 277630 gene locus_tag LOCUS_18270 276269 277630 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061005.1 protein_id gnl|my_center|LOCUS_18270 277627 278127 gene locus_tag LOCUS_18280 277627 278127 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061004.1 protein_id gnl|my_center|LOCUS_18280 278133 278579 gene locus_tag LOCUS_18290 278133 278579 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876863.1 protein_id gnl|my_center|LOCUS_18290 278656 279801 gene locus_tag LOCUS_18300 278656 279801 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061003.1 protein_id gnl|my_center|LOCUS_18300 279834 280832 gene locus_tag LOCUS_18310 279834 280832 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876861.1 protein_id gnl|my_center|LOCUS_18310 280884 281156 gene locus_tag LOCUS_18320 280884 281156 CDS product energy-converting hydrogenase B subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061002.1 protein_id gnl|my_center|LOCUS_18320 281814 281167 gene locus_tag LOCUS_18330 281814 281167 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021861.1 protein_id gnl|my_center|LOCUS_18330 282264 281818 gene locus_tag LOCUS_18340 282264 281818 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_18340 283639 282341 gene locus_tag LOCUS_18350 283639 282341 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_18350 284274 283672 gene locus_tag LOCUS_18360 284274 283672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 287130 284341 gene locus_tag LOCUS_18370 287130 284341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 288364 287120 gene locus_tag LOCUS_18380 288364 287120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 289206 288394 gene locus_tag LOCUS_18390 289206 288394 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878933.1 protein_id gnl|my_center|LOCUS_18390 289872 289225 gene locus_tag LOCUS_18400 289872 289225 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085042.1 protein_id gnl|my_center|LOCUS_18400 290235 291500 gene locus_tag LOCUS_18410 290235 291500 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021944.1 protein_id gnl|my_center|LOCUS_18410 291885 292202 gene locus_tag LOCUS_18420 291885 292202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18420 292345 293073 gene locus_tag LOCUS_18430 292345 293073 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_18430 293162 293818 gene locus_tag LOCUS_18440 293162 293818 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876859.1 protein_id gnl|my_center|LOCUS_18440 294144 293863 gene locus_tag LOCUS_18450 294144 293863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061001.1 protein_id gnl|my_center|LOCUS_18450 294314 294817 gene locus_tag LOCUS_18460 294314 294817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 294837 295160 gene locus_tag LOCUS_18470 294837 295160 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_18470 296524 295241 gene locus_tag LOCUS_18480 296524 295241 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876856.1 protein_id gnl|my_center|LOCUS_18480 297587 296607 gene locus_tag LOCUS_18490 297587 296607 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876855.1 protein_id gnl|my_center|LOCUS_18490 297888 298358 gene locus_tag LOCUS_18500 297888 298358 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061000.1 protein_id gnl|my_center|LOCUS_18500 298437 298928 gene locus_tag LOCUS_18510 298437 298928 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060999.1 protein_id gnl|my_center|LOCUS_18510 298937 299638 gene locus_tag LOCUS_18520 298937 299638 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060998.1 protein_id gnl|my_center|LOCUS_18520 299653 300204 gene locus_tag LOCUS_18530 299653 300204 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876850.1 protein_id gnl|my_center|LOCUS_18530 300214 301029 gene locus_tag LOCUS_18540 300214 301029 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876849.1 protein_id gnl|my_center|LOCUS_18540 301160 302059 gene locus_tag LOCUS_18550 301160 302059 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876848.1 protein_id gnl|my_center|LOCUS_18550 302125 302964 gene locus_tag LOCUS_18560 302125 302964 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060997.1 protein_id gnl|my_center|LOCUS_18560 303032 303853 gene locus_tag LOCUS_18570 303032 303853 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060996.1 protein_id gnl|my_center|LOCUS_18570 303965 305101 gene locus_tag LOCUS_18580 gene mthRnl 303965 305101 CDS product ATP-dependent RNA/DNA ligase MthRnl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060995.1 protein_id gnl|my_center|LOCUS_18580 305115 305936 gene locus_tag LOCUS_18590 gene pheA 305115 305936 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060994.1 protein_id gnl|my_center|LOCUS_18590 305929 306609 gene locus_tag LOCUS_18600 305929 306609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 306738 307274 gene locus_tag LOCUS_18610 306738 307274 CDS product PsbP-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876842.1 protein_id gnl|my_center|LOCUS_18610 307584 308081 gene locus_tag LOCUS_18620 307584 308081 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060993.1 protein_id gnl|my_center|LOCUS_18620 308146 309294 gene locus_tag LOCUS_18630 gene coaBC 308146 309294 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876840.1 protein_id gnl|my_center|LOCUS_18630 309460 310005 gene locus_tag LOCUS_18640 309460 310005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18640 310427 310735 gene locus_tag LOCUS_18650 310427 310735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 310653 311018 gene locus_tag LOCUS_18660 310653 311018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18660 311296 317034 gene locus_tag LOCUS_18670 311296 317034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 317161 324612 gene locus_tag LOCUS_18680 317161 324612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 324665 330199 gene locus_tag LOCUS_18690 324665 330199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 330352 330840 gene locus_tag LOCUS_18700 330352 330840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 331052 331657 gene locus_tag LOCUS_18710 331052 331657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 332444 331770 gene locus_tag LOCUS_18720 332444 331770 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876839.1 protein_id gnl|my_center|LOCUS_18720 333394 332528 gene locus_tag LOCUS_18730 333394 332528 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558806.1 protein_id gnl|my_center|LOCUS_18730 334692 333490 gene locus_tag LOCUS_18740 334692 333490 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876838.1 protein_id gnl|my_center|LOCUS_18740 334744 335649 gene locus_tag LOCUS_18750 334744 335649 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060992.1 protein_id gnl|my_center|LOCUS_18750 335693 336487 gene locus_tag LOCUS_18760 335693 336487 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061285.1 protein_id gnl|my_center|LOCUS_18760 336973 336563 gene locus_tag LOCUS_18770 gene hjc 336973 336563 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876892.1 protein_id gnl|my_center|LOCUS_18770 337354 337046 gene locus_tag LOCUS_18780 337354 337046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876893.1 protein_id gnl|my_center|LOCUS_18780 337603 337531 gene locus_tag LOCUS_t00280 337603 337531 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 337700 337613 gene locus_tag LOCUS_t00290 337700 337613 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 337847 337771 gene locus_tag LOCUS_t00300 337847 337771 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 337964 337890 gene locus_tag LOCUS_t00310 337964 337890 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 338042 337968 gene locus_tag LOCUS_t00320 338042 337968 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 338333 339328 gene locus_tag LOCUS_18790 338333 339328 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496555.1 protein_id gnl|my_center|LOCUS_18790 339368 339451 gene locus_tag LOCUS_t00330 339368 339451 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 340046 339498 gene locus_tag LOCUS_18800 340046 339498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 340720 340100 gene locus_tag LOCUS_18810 340720 340100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18810 341016 340768 gene locus_tag LOCUS_18820 341016 340768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18820 341246 341037 gene locus_tag LOCUS_18830 341246 341037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 341751 341410 gene locus_tag LOCUS_18840 341751 341410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 342067 343422 gene locus_tag LOCUS_18850 gene gatB 342067 343422 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876897.1 protein_id gnl|my_center|LOCUS_18850 343641 343877 gene locus_tag LOCUS_18860 343641 343877 CDS product DUF504 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876898.1 protein_id gnl|my_center|LOCUS_18860 343892 344689 gene locus_tag LOCUS_18870 343892 344689 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876899.1 protein_id gnl|my_center|LOCUS_18870 344686 344976 gene locus_tag LOCUS_18880 gene hisE 344686 344976 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876900.1 protein_id gnl|my_center|LOCUS_18880 345551 345012 gene locus_tag LOCUS_18890 gene comE 345551 345012 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_18890 346103 345612 gene locus_tag LOCUS_18900 gene comD 346103 345612 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 protein_id gnl|my_center|LOCUS_18900 346438 346241 gene locus_tag LOCUS_18910 346438 346241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 346371 348251 gene locus_tag LOCUS_18920 346371 348251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 349445 348354 gene locus_tag LOCUS_18930 349445 348354 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060989.1 protein_id gnl|my_center|LOCUS_18930 350239 349712 gene locus_tag LOCUS_18940 350239 349712 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941475.1 protein_id gnl|my_center|LOCUS_18940 351679 350480 gene locus_tag LOCUS_18950 351679 350480 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_18950 352113 351685 gene locus_tag LOCUS_18960 352113 351685 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_18960 353559 352345 gene locus_tag LOCUS_18970 353559 352345 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943325.1 protein_id gnl|my_center|LOCUS_18970 355610 353556 gene locus_tag LOCUS_18980 gene fdhF 355610 353556 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_18980 356644 355799 gene locus_tag LOCUS_18990 356644 355799 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_18990 357613 357272 gene locus_tag LOCUS_19000 357613 357272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 357937 358326 gene locus_tag LOCUS_19010 357937 358326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 359523 358498 gene locus_tag LOCUS_19020 gene comC 359523 358498 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876829.1 protein_id gnl|my_center|LOCUS_19020 360651 359623 gene locus_tag LOCUS_19030 gene purM 360651 359623 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 protein_id gnl|my_center|LOCUS_19030 362803 360899 gene locus_tag LOCUS_19040 362803 360899 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_19040 363536 362913 gene locus_tag LOCUS_19050 gene psmB 363536 362913 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_19050 364225 363776 gene locus_tag LOCUS_19060 gene nuoE 364225 363776 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877157.1 protein_id gnl|my_center|LOCUS_19060 364345 365079 gene locus_tag LOCUS_19070 364345 365079 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060988.1 protein_id gnl|my_center|LOCUS_19070 365181 366167 gene locus_tag LOCUS_19080 365181 366167 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876818.1 protein_id gnl|my_center|LOCUS_19080 366276 366956 gene locus_tag LOCUS_19090 366276 366956 CDS product DUF2100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876819.1 protein_id gnl|my_center|LOCUS_19090 367273 368235 gene locus_tag LOCUS_19100 gene mptA 367273 368235 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876820.1 protein_id gnl|my_center|LOCUS_19100 368252 368659 gene locus_tag LOCUS_19110 368252 368659 CDS product DUF2120 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061284.1 protein_id gnl|my_center|LOCUS_19110 368730 369818 gene locus_tag LOCUS_19120 gene cofG 368730 369818 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876822.1 protein_id gnl|my_center|LOCUS_19120 370330 369848 gene locus_tag LOCUS_19130 370330 369848 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060987.1 protein_id gnl|my_center|LOCUS_19130 370459 370677 gene locus_tag LOCUS_19140 370459 370677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060739.1 protein_id gnl|my_center|LOCUS_19140 371396 370848 gene locus_tag LOCUS_19150 371396 370848 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061179.1 protein_id gnl|my_center|LOCUS_19150 371598 372215 gene locus_tag LOCUS_19160 371598 372215 CDS product tributyrin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875745.1 protein_id gnl|my_center|LOCUS_19160 372212 374074 gene locus_tag LOCUS_19170 372212 374074 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060738.1 protein_id gnl|my_center|LOCUS_19170 374503 374135 gene locus_tag LOCUS_19180 374503 374135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 374484 374618 gene locus_tag LOCUS_19190 374484 374618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 374619 374894 gene locus_tag LOCUS_19200 374619 374894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 375667 374963 gene locus_tag LOCUS_19210 375667 374963 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_19210 376380 375730 gene locus_tag LOCUS_19220 376380 375730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 377650 376502 gene locus_tag LOCUS_19230 377650 376502 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_19230 377810 378904 gene locus_tag LOCUS_19240 377810 378904 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_19240 379227 378925 gene locus_tag LOCUS_19250 379227 378925 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876811.1 protein_id gnl|my_center|LOCUS_19250 379264 380115 gene locus_tag LOCUS_19260 379264 380115 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876810.1 protein_id gnl|my_center|LOCUS_19260 380187 380477 gene locus_tag LOCUS_19270 380187 380477 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_19270 380500 380865 gene locus_tag LOCUS_19280 380500 380865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 381515 380940 gene locus_tag LOCUS_19290 381515 380940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877047.1 protein_id gnl|my_center|LOCUS_19290 383730 382144 gene locus_tag LOCUS_19300 383730 382144 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876809.1 protein_id gnl|my_center|LOCUS_19300 383938 383816 gene locus_tag LOCUS_19310 383938 383816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 385373 384078 gene locus_tag LOCUS_19320 385373 384078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 386052 385384 gene locus_tag LOCUS_19330 gene comB 386052 385384 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876806.1 protein_id gnl|my_center|LOCUS_19330 386377 386168 gene locus_tag LOCUS_19340 386377 386168 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876887.1 protein_id gnl|my_center|LOCUS_19340 386645 387190 gene locus_tag LOCUS_19350 386645 387190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060984.1 protein_id gnl|my_center|LOCUS_19350 387775 387512 gene locus_tag LOCUS_19360 387775 387512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 388759 389670 gene locus_tag LOCUS_19370 388759 389670 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876804.1 protein_id gnl|my_center|LOCUS_19370 389719 390177 gene locus_tag LOCUS_19380 389719 390177 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876495.1 protein_id gnl|my_center|LOCUS_19380 390545 391297 gene locus_tag LOCUS_19390 390545 391297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 391333 391923 gene locus_tag LOCUS_19400 391333 391923 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876802.1 protein_id gnl|my_center|LOCUS_19400 391940 392710 gene locus_tag LOCUS_19410 391940 392710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19410 392710 393534 gene locus_tag LOCUS_19420 392710 393534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19420 393942 393583 gene locus_tag LOCUS_19430 393942 393583 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876799.1 protein_id gnl|my_center|LOCUS_19430 394563 394063 gene locus_tag LOCUS_19440 394563 394063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 396357 394579 gene locus_tag LOCUS_19450 396357 394579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020427.1 protein_id gnl|my_center|LOCUS_19450 397544 396495 gene locus_tag LOCUS_19460 397544 396495 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869578.1 protein_id gnl|my_center|LOCUS_19460 398455 397559 gene locus_tag LOCUS_19470 398455 397559 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868127.1 protein_id gnl|my_center|LOCUS_19470 399660 398902 gene locus_tag LOCUS_19480 399660 398902 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496386.1 protein_id gnl|my_center|LOCUS_19480 400721 399663 gene locus_tag LOCUS_19490 400721 399663 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869579.1 protein_id gnl|my_center|LOCUS_19490 401771 400722 gene locus_tag LOCUS_19500 401771 400722 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869578.1 protein_id gnl|my_center|LOCUS_19500 402926 401808 gene locus_tag LOCUS_19510 402926 401808 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869577.1 protein_id gnl|my_center|LOCUS_19510 404102 402978 gene locus_tag LOCUS_19520 404102 402978 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869577.1 protein_id gnl|my_center|LOCUS_19520 405504 404404 gene locus_tag LOCUS_19530 405504 404404 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868127.1 protein_id gnl|my_center|LOCUS_19530 406484 406002 gene locus_tag LOCUS_19540 406484 406002 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763041.1 protein_id gnl|my_center|LOCUS_19540 406860 407627 gene locus_tag LOCUS_19550 406860 407627 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022734.1 protein_id gnl|my_center|LOCUS_19550 407773 408384 gene locus_tag LOCUS_19560 407773 408384 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065519.1 protein_id gnl|my_center|LOCUS_19560 408371 408571 gene locus_tag LOCUS_19570 408371 408571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 409351 408779 gene locus_tag LOCUS_19580 409351 408779 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869954.1 protein_id gnl|my_center|LOCUS_19580 410151 409531 gene locus_tag LOCUS_19590 410151 409531 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024475.1 protein_id gnl|my_center|LOCUS_19590 410640 410783 gene locus_tag LOCUS_19600 410640 410783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 410918 411151 gene locus_tag LOCUS_19610 410918 411151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 411494 411784 gene locus_tag LOCUS_19620 411494 411784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 411818 411958 gene locus_tag LOCUS_19630 411818 411958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 412953 412030 gene locus_tag LOCUS_19640 412953 412030 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_19640 413201 413034 gene locus_tag LOCUS_19650 413201 413034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 413283 413684 gene locus_tag LOCUS_19660 413283 413684 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021357.1 protein_id gnl|my_center|LOCUS_19660 413901 413719 gene locus_tag LOCUS_19670 413901 413719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 414314 414514 gene locus_tag LOCUS_19680 414314 414514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 414534 414908 gene locus_tag LOCUS_19690 414534 414908 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876801.1 protein_id gnl|my_center|LOCUS_19690 414970 415821 gene locus_tag LOCUS_19700 414970 415821 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_19700 415818 416234 gene locus_tag LOCUS_19710 415818 416234 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876799.1 protein_id gnl|my_center|LOCUS_19710 416301 416492 gene locus_tag LOCUS_19720 416301 416492 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496418.1 protein_id gnl|my_center|LOCUS_19720 416625 417485 gene locus_tag LOCUS_19730 416625 417485 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876798.1 protein_id gnl|my_center|LOCUS_19730 417482 418387 gene locus_tag LOCUS_19740 417482 418387 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876797.1 protein_id gnl|my_center|LOCUS_19740 418452 419660 gene locus_tag LOCUS_19750 418452 419660 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876796.1 protein_id gnl|my_center|LOCUS_19750 419686 420339 gene locus_tag LOCUS_19760 419686 420339 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_19760 420406 420864 gene locus_tag LOCUS_19770 420406 420864 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010885248.1 protein_id gnl|my_center|LOCUS_19770 422281 420944 gene locus_tag LOCUS_19780 422281 420944 CDS product methyl-coenzyme M reductase glutamine C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876795.1 protein_id gnl|my_center|LOCUS_19780 423639 422392 gene locus_tag LOCUS_19790 gene mmp10 423639 422392 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876794.1 protein_id gnl|my_center|LOCUS_19790 423921 425249 gene locus_tag LOCUS_19800 gene mcrB 423921 425249 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061283.1 protein_id gnl|my_center|LOCUS_19800 425284 425724 gene locus_tag LOCUS_19810 gene mcrD 425284 425724 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876791.1 protein_id gnl|my_center|LOCUS_19810 425721 426317 gene locus_tag LOCUS_19820 gene mcrC 425721 426317 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876790.1 protein_id gnl|my_center|LOCUS_19820 426320 427069 gene locus_tag LOCUS_19830 gene mcrG 426320 427069 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060982.1 protein_id gnl|my_center|LOCUS_19830 427082 428734 gene locus_tag LOCUS_19840 gene mcrA 427082 428734 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876788.1 protein_id gnl|my_center|LOCUS_19840 428795 429703 gene locus_tag LOCUS_19850 gene mtrE 428795 429703 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870361.1 protein_id gnl|my_center|LOCUS_19850 429716 430444 gene locus_tag LOCUS_19860 gene mtrD 429716 430444 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 protein_id gnl|my_center|LOCUS_19860 430444 431253 gene locus_tag LOCUS_19870 gene mtrC 430444 431253 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876785.1 protein_id gnl|my_center|LOCUS_19870 431269 431580 gene locus_tag LOCUS_19880 431269 431580 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876784.1 protein_id gnl|my_center|LOCUS_19880 431593 432315 gene locus_tag LOCUS_19890 gene mtrA 431593 432315 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876783.1 protein_id gnl|my_center|LOCUS_19890 432328 432534 gene locus_tag LOCUS_19900 gene mtrF 432328 432534 CDS product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876782.1 protein_id gnl|my_center|LOCUS_19900 432539 432790 gene locus_tag LOCUS_19910 gene mtrG 432539 432790 CDS product tetrahydromethanopterin S-methyltransferase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876781.1 protein_id gnl|my_center|LOCUS_19910 432809 433762 gene locus_tag LOCUS_19920 gene mtrH 432809 433762 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_19920 433922 434905 gene locus_tag LOCUS_19930 433922 434905 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060981.1 protein_id gnl|my_center|LOCUS_19930 434918 435346 gene locus_tag LOCUS_19940 434918 435346 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060980.1 protein_id gnl|my_center|LOCUS_19940 435443 436930 gene locus_tag LOCUS_19950 435443 436930 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060979.1 protein_id gnl|my_center|LOCUS_19950 437224 437078 gene locus_tag LOCUS_19960 437224 437078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 437748 437350 gene locus_tag LOCUS_19970 437748 437350 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876052.1 protein_id gnl|my_center|LOCUS_19970 437981 438613 gene locus_tag LOCUS_19980 437981 438613 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457366.1 protein_id gnl|my_center|LOCUS_19980 438625 438894 gene locus_tag LOCUS_19990 438625 438894 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876775.1 protein_id gnl|my_center|LOCUS_19990 439516 439019 gene locus_tag LOCUS_20000 439516 439019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 440807 439581 gene locus_tag LOCUS_20010 440807 439581 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876774.1 protein_id gnl|my_center|LOCUS_20010 441544 440786 gene locus_tag LOCUS_20020 gene sufC 441544 440786 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_20020 441840 442316 gene locus_tag LOCUS_20030 441840 442316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 442509 442949 gene locus_tag LOCUS_20040 442509 442949 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_20040 442952 443881 gene locus_tag LOCUS_20050 gene mvhG 442952 443881 CDS product F420-non-reducing hydrogenase subunit MvhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876759.1 protein_id gnl|my_center|LOCUS_20050 443882 445294 gene locus_tag LOCUS_20060 gene mvhA 443882 445294 CDS product F420-non-reducing hydrogenase subunit MvhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876758.1 protein_id gnl|my_center|LOCUS_20060 445312 446508 gene locus_tag LOCUS_20070 gene mvhB 445312 446508 CDS product polyferredoxin protein MvhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876757.1 protein_id gnl|my_center|LOCUS_20070 446789 447028 gene locus_tag LOCUS_20080 446789 447028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 447291 447815 gene locus_tag LOCUS_20090 447291 447815 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876447.1 protein_id gnl|my_center|LOCUS_20090 448244 448411 gene locus_tag LOCUS_20100 448244 448411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 448887 448693 gene locus_tag LOCUS_20110 448887 448693 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876752.1 protein_id gnl|my_center|LOCUS_20110 449267 456853 gene locus_tag LOCUS_20120 449267 456853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 458245 456947 gene locus_tag LOCUS_20130 gene pyrC 458245 456947 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060972.1 protein_id gnl|my_center|LOCUS_20130 458820 458302 gene locus_tag LOCUS_20140 458820 458302 CDS product PsbP-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750442.1 protein_id gnl|my_center|LOCUS_20140 458930 460051 gene locus_tag LOCUS_20150 458930 460051 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876750.1 protein_id gnl|my_center|LOCUS_20150 460024 460905 gene locus_tag LOCUS_20160 460024 460905 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876749.1 protein_id gnl|my_center|LOCUS_20160 462645 461014 gene locus_tag LOCUS_20170 gene serS 462645 461014 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876746.1 protein_id gnl|my_center|LOCUS_20170 462937 462710 gene locus_tag LOCUS_20180 462937 462710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 463729 462941 gene locus_tag LOCUS_20190 463729 462941 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060971.1 protein_id gnl|my_center|LOCUS_20190 463901 464383 gene locus_tag LOCUS_20200 gene rplJ 463901 464383 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876743.1 protein_id gnl|my_center|LOCUS_20200 464445 466739 gene locus_tag LOCUS_20210 gene ppsA 464445 466739 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_20210 466826 467974 gene locus_tag LOCUS_20220 gene mfnA 466826 467974 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868331.1 protein_id gnl|my_center|LOCUS_20220 468062 468553 gene locus_tag LOCUS_20230 468062 468553 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_20230 469175 468609 gene locus_tag LOCUS_20240 469175 468609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 469584 469958 gene locus_tag LOCUS_20250 469584 469958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 469982 470494 gene locus_tag LOCUS_20260 469982 470494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 470575 471060 gene locus_tag LOCUS_20270 470575 471060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 471106 471603 gene locus_tag LOCUS_20280 471106 471603 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876403.1 protein_id gnl|my_center|LOCUS_20280 471621 471986 gene locus_tag LOCUS_20290 471621 471986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 471991 472368 gene locus_tag LOCUS_20300 471991 472368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 473100 472465 gene locus_tag LOCUS_20310 gene upp 473100 472465 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876738.1 protein_id gnl|my_center|LOCUS_20310 473260 474312 gene locus_tag LOCUS_20320 473260 474312 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_20320 474478 474329 gene locus_tag LOCUS_20330 474478 474329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 474766 474587 gene locus_tag LOCUS_20340 474766 474587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 475491 474928 gene locus_tag LOCUS_20350 475491 474928 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061280.1 protein_id gnl|my_center|LOCUS_20350 476333 475542 gene locus_tag LOCUS_20360 gene cobS 476333 475542 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876736.1 protein_id gnl|my_center|LOCUS_20360 477385 476336 gene locus_tag LOCUS_20370 477385 476336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 477464 477823 gene locus_tag LOCUS_20380 477464 477823 CDS product MJ1244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060970.1 protein_id gnl|my_center|LOCUS_20380 478011 479126 gene locus_tag LOCUS_20390 478011 479126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 479504 479304 gene locus_tag LOCUS_20400 479504 479304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 481077 479587 gene locus_tag LOCUS_20410 gene hcp 481077 479587 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750458.1 protein_id gnl|my_center|LOCUS_20410 481220 481972 gene locus_tag LOCUS_20420 481220 481972 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876961.1 protein_id gnl|my_center|LOCUS_20420 482057 483271 gene locus_tag LOCUS_20430 gene larC 482057 483271 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060969.1 protein_id gnl|my_center|LOCUS_20430 483329 484006 gene locus_tag LOCUS_20440 gene queC 483329 484006 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876732.1 protein_id gnl|my_center|LOCUS_20440 486589 484217 gene locus_tag LOCUS_20450 486589 484217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 489012 487294 gene locus_tag LOCUS_20460 gene oadA 489012 487294 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876731.1 protein_id gnl|my_center|LOCUS_20460 490806 489205 gene locus_tag LOCUS_20470 490806 489205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876291.1 protein_id gnl|my_center|LOCUS_20470 491223 492050 gene locus_tag LOCUS_20480 gene nifH 491223 492050 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061088.1 protein_id gnl|my_center|LOCUS_20480 492133 492450 gene locus_tag LOCUS_20490 492133 492450 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061089.1 protein_id gnl|my_center|LOCUS_20490 492455 492823 gene locus_tag LOCUS_20500 492455 492823 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877171.1 protein_id gnl|my_center|LOCUS_20500 492946 494406 gene locus_tag LOCUS_20510 492946 494406 CDS product nitrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877172.1 protein_id gnl|my_center|LOCUS_20510 494403 495788 gene locus_tag LOCUS_20520 494403 495788 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877173.1 protein_id gnl|my_center|LOCUS_20520 495876 497246 gene locus_tag LOCUS_20530 gene nifE 495876 497246 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877174.1 protein_id gnl|my_center|LOCUS_20530 497248 498666 gene locus_tag LOCUS_20540 497248 498666 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877175.1 protein_id gnl|my_center|LOCUS_20540 498667 498987 gene locus_tag LOCUS_20550 498667 498987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 499014 499259 gene locus_tag LOCUS_20560 499014 499259 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061279.1 protein_id gnl|my_center|LOCUS_20560 499361 501322 gene locus_tag LOCUS_20570 499361 501322 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877176.1 protein_id gnl|my_center|LOCUS_20570 501482 502294 gene locus_tag LOCUS_20580 501482 502294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 503453 502350 gene locus_tag LOCUS_20590 503453 502350 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_20590 504134 503694 gene locus_tag LOCUS_20600 504134 503694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 504579 504286 gene locus_tag LOCUS_20610 504579 504286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 505535 505248 gene locus_tag LOCUS_20620 505535 505248 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_20620 505976 505671 gene locus_tag LOCUS_20630 505976 505671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 506932 506018 gene locus_tag LOCUS_20640 506932 506018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 509049 507055 gene locus_tag LOCUS_20650 509049 507055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 509460 510755 gene locus_tag LOCUS_20660 gene fumC 509460 510755 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083118.1 protein_id gnl|my_center|LOCUS_20660 510816 512519 gene locus_tag LOCUS_20670 510816 512519 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933697.1 protein_id gnl|my_center|LOCUS_20670 512519 513295 gene locus_tag LOCUS_20680 512519 513295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 513362 514594 gene locus_tag LOCUS_20690 513362 514594 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546010.1 protein_id gnl|my_center|LOCUS_20690 515545 514706 gene locus_tag LOCUS_20700 515545 514706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 517709 515985 gene locus_tag LOCUS_20710 517709 515985 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065752.1 protein_id gnl|my_center|LOCUS_20710 517955 518500 gene locus_tag LOCUS_20720 517955 518500 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227754.1 protein_id gnl|my_center|LOCUS_20720 518580 519041 gene locus_tag LOCUS_20730 518580 519041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 519091 519483 gene locus_tag LOCUS_20740 519091 519483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 519523 519921 gene locus_tag LOCUS_20750 519523 519921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 519926 520261 gene locus_tag LOCUS_20760 519926 520261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 520282 520971 gene locus_tag LOCUS_20770 520282 520971 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969534.1 protein_id gnl|my_center|LOCUS_20770 521224 521033 gene locus_tag LOCUS_20780 521224 521033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 521794 521408 gene locus_tag LOCUS_20790 521794 521408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 522047 521811 gene locus_tag LOCUS_20800 522047 521811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 522273 522479 gene locus_tag LOCUS_20810 522273 522479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876238.1 protein_id gnl|my_center|LOCUS_20810 523273 522788 gene locus_tag LOCUS_20820 523273 522788 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_20820 523793 523305 gene locus_tag LOCUS_20830 523793 523305 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876721.1 protein_id gnl|my_center|LOCUS_20830 524369 524157 gene locus_tag LOCUS_20840 524369 524157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 524640 525863 gene locus_tag LOCUS_20850 524640 525863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 527262 525895 gene locus_tag LOCUS_20860 527262 525895 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_20860 527572 529038 gene locus_tag LOCUS_20870 527572 529038 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022384.1 protein_id gnl|my_center|LOCUS_20870 529285 530238 gene locus_tag LOCUS_20880 529285 530238 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876717.1 protein_id gnl|my_center|LOCUS_20880 530241 531005 gene locus_tag LOCUS_20890 530241 531005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061277.1 protein_id gnl|my_center|LOCUS_20890 531185 532324 gene locus_tag LOCUS_20900 531185 532324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 532779 532706 gene locus_tag LOCUS_t00340 532779 532706 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 532977 533318 gene locus_tag LOCUS_20910 532977 533318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 533281 533517 gene locus_tag LOCUS_20920 533281 533517 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_20920 533621 533548 gene locus_tag LOCUS_t00350 533621 533548 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 534730 534200 gene locus_tag LOCUS_20930 534730 534200 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249296.1 protein_id gnl|my_center|LOCUS_20930 534939 535142 gene locus_tag LOCUS_20940 534939 535142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 535296 535610 gene locus_tag LOCUS_20950 535296 535610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 535833 536402 gene locus_tag LOCUS_20960 535833 536402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 536535 537200 gene locus_tag LOCUS_20970 536535 537200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 537434 537510 gene locus_tag LOCUS_t00360 537434 537510 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 537529 538728 gene locus_tag LOCUS_20980 537529 538728 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296134.1 protein_id gnl|my_center|LOCUS_20980 538892 538737 gene locus_tag LOCUS_20990 538892 538737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 539308 538901 gene locus_tag LOCUS_21000 539308 538901 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876580.1 protein_id gnl|my_center|LOCUS_21000 539533 540333 gene locus_tag LOCUS_21010 539533 540333 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927097.1 protein_id gnl|my_center|LOCUS_21010 541866 540766 gene locus_tag LOCUS_21020 gene arsB 541866 540766 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 protein_id gnl|my_center|LOCUS_21020 542658 541900 gene locus_tag LOCUS_21030 gene arsM 542658 541900 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_21030 543317 542916 gene locus_tag LOCUS_21040 543317 542916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21040 543543 543992 gene locus_tag LOCUS_21050 543543 543992 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_21050 544506 544123 gene locus_tag LOCUS_21060 544506 544123 CDS product DUF22 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876583.1 protein_id gnl|my_center|LOCUS_21060 545153 544506 gene locus_tag LOCUS_21070 545153 544506 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876584.1 protein_id gnl|my_center|LOCUS_21070 546583 545183 gene locus_tag LOCUS_21080 546583 545183 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296141.1 protein_id gnl|my_center|LOCUS_21080 548340 546586 gene locus_tag LOCUS_21090 548340 546586 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_21090 548657 548337 gene locus_tag LOCUS_21100 548657 548337 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876587.1 protein_id gnl|my_center|LOCUS_21100 549811 548654 gene locus_tag LOCUS_21110 549811 548654 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876588.1 protein_id gnl|my_center|LOCUS_21110 550453 549830 gene locus_tag LOCUS_21120 550453 549830 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876589.1 protein_id gnl|my_center|LOCUS_21120 550942 550457 gene locus_tag LOCUS_21130 550942 550457 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876590.1 protein_id gnl|my_center|LOCUS_21130 552950 550944 gene locus_tag LOCUS_21140 552950 550944 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060932.1 protein_id gnl|my_center|LOCUS_21140 553274 552960 gene locus_tag LOCUS_21150 gene ahaH 553274 552960 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060933.1 protein_id gnl|my_center|LOCUS_21150 554687 553827 gene locus_tag LOCUS_21160 554687 553827 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876593.1 protein_id gnl|my_center|LOCUS_21160 555751 554879 gene locus_tag LOCUS_21170 555751 554879 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876594.1 protein_id gnl|my_center|LOCUS_21170 556777 555878 gene locus_tag LOCUS_21180 556777 555878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 protein_id gnl|my_center|LOCUS_21180 558257 556878 gene locus_tag LOCUS_21190 558257 556878 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876596.1 protein_id gnl|my_center|LOCUS_21190 559661 558270 gene locus_tag LOCUS_21200 559661 558270 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 protein_id gnl|my_center|LOCUS_21200 559982 559791 gene locus_tag LOCUS_21210 559982 559791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 560674 560108 gene locus_tag LOCUS_21220 560674 560108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 561733 562935 gene locus_tag LOCUS_21230 561733 562935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 563206 562892 gene locus_tag LOCUS_21240 563206 562892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 563768 563196 gene locus_tag LOCUS_21250 563768 563196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 564427 564068 gene locus_tag LOCUS_21260 564427 564068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 564828 564541 gene locus_tag LOCUS_21270 564828 564541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 565935 565366 gene locus_tag LOCUS_21280 565935 565366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 566525 566154 gene locus_tag LOCUS_21290 566525 566154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 567064 566594 gene locus_tag LOCUS_21300 567064 566594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 567531 567304 gene locus_tag LOCUS_21310 567531 567304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 567943 567506 gene locus_tag LOCUS_21320 567943 567506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21320 569126 568434 gene locus_tag LOCUS_21330 569126 568434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 569799 569170 gene locus_tag LOCUS_21340 569799 569170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 569891 569769 gene locus_tag LOCUS_21350 569891 569769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 570437 570222 gene locus_tag LOCUS_21360 570437 570222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 571104 570484 gene locus_tag LOCUS_21370 571104 570484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 572046 571312 gene locus_tag LOCUS_21380 572046 571312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 572526 572164 gene locus_tag LOCUS_21390 572526 572164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 579171 572611 gene locus_tag LOCUS_21400 579171 572611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 579556 580545 gene locus_tag LOCUS_21410 579556 580545 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876598.1 protein_id gnl|my_center|LOCUS_21410 581321 580572 gene locus_tag LOCUS_21420 581321 580572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061265.1 protein_id gnl|my_center|LOCUS_21420 581727 581386 gene locus_tag LOCUS_21430 581727 581386 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061225.1 protein_id gnl|my_center|LOCUS_21430 581905 583476 gene locus_tag LOCUS_21440 gene serA 581905 583476 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061266.1 protein_id gnl|my_center|LOCUS_21440 586190 583536 gene locus_tag LOCUS_21450 586190 583536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 586760 586320 gene locus_tag LOCUS_21460 586760 586320 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060934.1 protein_id gnl|my_center|LOCUS_21460 587623 586865 gene locus_tag LOCUS_21470 587623 586865 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_21470 588497 587733 gene locus_tag LOCUS_21480 588497 587733 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_21480 588845 588510 gene locus_tag LOCUS_21490 588845 588510 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060937.1 protein_id gnl|my_center|LOCUS_21490 589158 590456 gene locus_tag LOCUS_21500 589158 590456 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010923212.1 protein_id gnl|my_center|LOCUS_21500 590478 591419 gene locus_tag LOCUS_21510 gene arcC 590478 591419 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_21510 592537 591548 gene locus_tag LOCUS_21520 592537 591548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 593178 593423 gene locus_tag LOCUS_21530 593178 593423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 593571 594293 gene locus_tag LOCUS_21540 593571 594293 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477233.1 protein_id gnl|my_center|LOCUS_21540 595760 594360 gene locus_tag LOCUS_21550 595760 594360 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_21550 596053 595859 gene locus_tag LOCUS_21560 596053 595859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 596998 596066 gene locus_tag LOCUS_21570 596998 596066 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876611.1 protein_id gnl|my_center|LOCUS_21570 598114 597125 gene locus_tag LOCUS_21580 598114 597125 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485766.1 protein_id gnl|my_center|LOCUS_21580 598653 598201 gene locus_tag LOCUS_21590 598653 598201 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485767.1 protein_id gnl|my_center|LOCUS_21590 598900 599445 gene locus_tag LOCUS_21600 598900 599445 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_21600 599515 600705 gene locus_tag LOCUS_21610 599515 600705 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_21610 600861 601184 gene locus_tag LOCUS_21620 gene pth2 600861 601184 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877304.1 protein_id gnl|my_center|LOCUS_21620 601226 601876 gene locus_tag LOCUS_21630 601226 601876 CDS product delta 1-pyrroline-5-carboxylate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061123.1 protein_id gnl|my_center|LOCUS_21630 601878 602039 gene locus_tag LOCUS_21640 601878 602039 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877306.1 protein_id gnl|my_center|LOCUS_21640 602111 602380 gene locus_tag LOCUS_21650 602111 602380 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_21650 602527 603786 gene locus_tag LOCUS_21660 602527 603786 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892580.1 protein_id gnl|my_center|LOCUS_21660 604843 603863 gene locus_tag LOCUS_21670 604843 603863 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024418.1 protein_id gnl|my_center|LOCUS_21670 605004 606623 gene locus_tag LOCUS_21680 605004 606623 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750460.1 protein_id gnl|my_center|LOCUS_21680 606676 607866 gene locus_tag LOCUS_21690 606676 607866 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877311.1 protein_id gnl|my_center|LOCUS_21690 610171 607961 gene locus_tag LOCUS_21700 610171 607961 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_21700 611287 610319 gene locus_tag LOCUS_21710 611287 610319 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877312.1 protein_id gnl|my_center|LOCUS_21710 612175 611345 gene locus_tag LOCUS_21720 gene cbiQ 612175 611345 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877313.1 protein_id gnl|my_center|LOCUS_21720 612568 612269 gene locus_tag LOCUS_21730 612568 612269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 613239 612565 gene locus_tag LOCUS_21740 gene cbiM 613239 612565 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877315.1 protein_id gnl|my_center|LOCUS_21740 613985 613596 gene locus_tag LOCUS_21750 613985 613596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061238.1 protein_id gnl|my_center|LOCUS_21750 614357 615709 gene locus_tag LOCUS_21760 614357 615709 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875743.1 protein_id gnl|my_center|LOCUS_21760 616524 615811 gene locus_tag LOCUS_21770 616524 615811 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871156.1 protein_id gnl|my_center|LOCUS_21770 616729 617136 gene locus_tag LOCUS_21780 gene nikR 616729 617136 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 protein_id gnl|my_center|LOCUS_21780 617317 617958 gene locus_tag LOCUS_21790 617317 617958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 619724 618000 gene locus_tag LOCUS_21800 619724 618000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461147.1 protein_id gnl|my_center|LOCUS_21800 621459 619717 gene locus_tag LOCUS_21810 621459 619717 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814189.1 protein_id gnl|my_center|LOCUS_21810 623125 621446 gene locus_tag LOCUS_21820 623125 621446 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_21820 623909 623118 gene locus_tag LOCUS_21830 623909 623118 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020913.1 protein_id gnl|my_center|LOCUS_21830 624642 624088 gene locus_tag LOCUS_21840 624642 624088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 626498 624879 gene locus_tag LOCUS_21850 626498 624879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 627463 626495 gene locus_tag LOCUS_21860 627463 626495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 628540 627734 gene locus_tag LOCUS_21870 628540 627734 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020913.1 protein_id gnl|my_center|LOCUS_21870 629142 628591 gene locus_tag LOCUS_21880 629142 628591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 629688 629161 gene locus_tag LOCUS_21890 629688 629161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 630238 629708 gene locus_tag LOCUS_21900 630238 629708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 630719 630258 gene locus_tag LOCUS_21910 630719 630258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 631113 631796 gene locus_tag LOCUS_21920 gene cbiM 631113 631796 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877315.1 protein_id gnl|my_center|LOCUS_21920 632223 631813 gene locus_tag LOCUS_21930 gene nikR 632223 631813 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876378.1 protein_id gnl|my_center|LOCUS_21930 632457 632873 gene locus_tag LOCUS_21940 632457 632873 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974935.1 protein_id gnl|my_center|LOCUS_21940 633225 633698 gene locus_tag LOCUS_21950 633225 633698 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279177.1 protein_id gnl|my_center|LOCUS_21950 633909 634304 gene locus_tag LOCUS_21960 633909 634304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 634910 634479 gene locus_tag LOCUS_21970 gene cfbA 634910 634479 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061042.1 protein_id gnl|my_center|LOCUS_21970 635549 635788 gene locus_tag LOCUS_21980 635549 635788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 636705 635902 gene locus_tag LOCUS_21990 636705 635902 CDS product nicotianamine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876313.1 protein_id gnl|my_center|LOCUS_21990 637695 637030 gene locus_tag LOCUS_22000 637695 637030 CDS product FeGP cofactor biosynthesis protein HcgF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876772.1 protein_id gnl|my_center|LOCUS_22000 638357 637719 gene locus_tag LOCUS_22010 638357 637719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876771.1 protein_id gnl|my_center|LOCUS_22010 639502 638897 gene locus_tag LOCUS_22020 639502 638897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 640043 639714 gene locus_tag LOCUS_22030 640043 639714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 640979 640266 gene locus_tag LOCUS_22040 640979 640266 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876770.1 protein_id gnl|my_center|LOCUS_22040 641922 641071 gene locus_tag LOCUS_22050 641922 641071 CDS product SAM-dependent methyltransferase HcgC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876769.1 protein_id gnl|my_center|LOCUS_22050 642401 641919 gene locus_tag LOCUS_22060 642401 641919 CDS product DUF3236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876768.1 protein_id gnl|my_center|LOCUS_22060 643438 642443 gene locus_tag LOCUS_22070 gene hmdB 643438 642443 CDS product 5,10-methenyltetrahydromethanopterin hydrogenase cofactor biosynthesis protein HmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876767.1 protein_id gnl|my_center|LOCUS_22070 644595 643531 gene locus_tag LOCUS_22080 gene hmd 644595 643531 CDS product 5,10-methenyltetrahydromethanopterin hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060977.1 protein_id gnl|my_center|LOCUS_22080 645063 645443 gene locus_tag LOCUS_22090 645063 645443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 645533 646684 gene locus_tag LOCUS_22100 645533 646684 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869499.1 protein_id gnl|my_center|LOCUS_22100 646691 647839 gene locus_tag LOCUS_22110 646691 647839 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943325.1 protein_id gnl|my_center|LOCUS_22110 647902 648345 gene locus_tag LOCUS_22120 647902 648345 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_22120 648404 649429 gene locus_tag LOCUS_22130 648404 649429 CDS product H(2)-dependent methylenetetrahydromethanopterin dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061073.1 protein_id gnl|my_center|LOCUS_22130 649622 651127 gene locus_tag LOCUS_22140 gene hmdC 649622 651127 CDS product 5,10-methenyltetrahydromethanopterin hydrogenase cofactor biosynthesis protein HmdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876761.1 protein_id gnl|my_center|LOCUS_22140 651354 652685 gene locus_tag LOCUS_22150 gene mcrB 651354 652685 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060974.1 protein_id gnl|my_center|LOCUS_22150 652700 653188 gene locus_tag LOCUS_22160 gene mcrD 652700 653188 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869611.1 protein_id gnl|my_center|LOCUS_22160 653191 653991 gene locus_tag LOCUS_22170 gene mcrG 653191 653991 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876754.1 protein_id gnl|my_center|LOCUS_22170 653988 655643 gene locus_tag LOCUS_22180 gene mcrA 653988 655643 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869575.1 protein_id gnl|my_center|LOCUS_22180 655907 656599 gene locus_tag LOCUS_22190 655907 656599 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990882.1 protein_id gnl|my_center|LOCUS_22190 657722 656649 gene locus_tag LOCUS_22200 657722 656649 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876607.1 protein_id gnl|my_center|LOCUS_22200 657844 658353 gene locus_tag LOCUS_22210 657844 658353 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892518.1 protein_id gnl|my_center|LOCUS_22210 658625 658416 gene locus_tag LOCUS_22220 658625 658416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 658942 658658 gene locus_tag LOCUS_22230 658942 658658 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060878.1 protein_id gnl|my_center|LOCUS_22230 659627 658953 gene locus_tag LOCUS_22240 659627 658953 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876309.1 protein_id gnl|my_center|LOCUS_22240 660351 659647 gene locus_tag LOCUS_22250 660351 659647 CDS product DUF2162 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261160.1 protein_id gnl|my_center|LOCUS_22250 665167 660539 gene locus_tag LOCUS_22260 665167 660539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 669987 665371 gene locus_tag LOCUS_22270 669987 665371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 670426 671211 gene locus_tag LOCUS_22280 670426 671211 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875802.1 protein_id gnl|my_center|LOCUS_22280 673208 671307 gene locus_tag LOCUS_22290 673208 671307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence3 225 1922 gene locus_tag LOCUS_22300 gene kaiC 225 1922 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_22300 1932 2264 gene locus_tag LOCUS_22310 1932 2264 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390296.1 protein_id gnl|my_center|LOCUS_22310 2279 2626 gene locus_tag LOCUS_22320 gene kaiB 2279 2626 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125575.1 protein_id gnl|my_center|LOCUS_22320 2634 4409 gene locus_tag LOCUS_22330 2634 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 4759 4487 gene locus_tag LOCUS_22340 4759 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 5829 4921 gene locus_tag LOCUS_22350 gene hdrB 5829 4921 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877481.1 protein_id gnl|my_center|LOCUS_22350 6717 5839 gene locus_tag LOCUS_22360 6717 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 6906 7427 gene locus_tag LOCUS_22370 6906 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 7506 8237 gene locus_tag LOCUS_22380 7506 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877479.1 protein_id gnl|my_center|LOCUS_22380 8863 8282 gene locus_tag LOCUS_22390 8863 8282 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877478.1 protein_id gnl|my_center|LOCUS_22390 10141 8879 gene locus_tag LOCUS_22400 10141 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 11082 10162 gene locus_tag LOCUS_22410 11082 10162 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 protein_id gnl|my_center|LOCUS_22410 11252 11581 gene locus_tag LOCUS_22420 11252 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 12505 11600 gene locus_tag LOCUS_22430 12505 11600 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_22430 14275 12623 gene locus_tag LOCUS_22440 14275 12623 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886094.1 protein_id gnl|my_center|LOCUS_22440 15179 14388 gene locus_tag LOCUS_22450 gene dph5 15179 14388 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877476.1 protein_id gnl|my_center|LOCUS_22450 15334 16356 gene locus_tag LOCUS_22460 15334 16356 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877475.1 protein_id gnl|my_center|LOCUS_22460 16420 17349 gene locus_tag LOCUS_22470 16420 17349 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876813.1 protein_id gnl|my_center|LOCUS_22470 17374 17955 gene locus_tag LOCUS_22480 17374 17955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 18448 18014 gene locus_tag LOCUS_22490 18448 18014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 19529 18588 gene locus_tag LOCUS_22500 gene mtnA 19529 18588 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061163.1 protein_id gnl|my_center|LOCUS_22500 20448 19597 gene locus_tag LOCUS_22510 gene nifB 20448 19597 CDS product FeMo cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877473.1 protein_id gnl|my_center|LOCUS_22510 21198 20623 gene locus_tag LOCUS_22520 21198 20623 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877472.1 protein_id gnl|my_center|LOCUS_22520 22467 21232 gene locus_tag LOCUS_22530 22467 21232 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877471.1 protein_id gnl|my_center|LOCUS_22530 22906 22460 gene locus_tag LOCUS_22540 22906 22460 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877470.1 protein_id gnl|my_center|LOCUS_22540 23283 22903 gene locus_tag LOCUS_22550 23283 22903 CDS product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877469.1 protein_id gnl|my_center|LOCUS_22550 23918 23349 gene locus_tag LOCUS_22560 23918 23349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 25446 23896 gene locus_tag LOCUS_22570 25446 23896 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061161.1 protein_id gnl|my_center|LOCUS_22570 26599 25616 gene locus_tag LOCUS_22580 26599 25616 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 protein_id gnl|my_center|LOCUS_22580 27888 26716 gene locus_tag LOCUS_22590 27888 26716 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869557.1 protein_id gnl|my_center|LOCUS_22590 28515 27997 gene locus_tag LOCUS_22600 28515 27997 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877464.1 protein_id gnl|my_center|LOCUS_22600 29009 29524 gene locus_tag LOCUS_22610 29009 29524 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061158.1 protein_id gnl|my_center|LOCUS_22610 30279 29749 gene locus_tag LOCUS_22620 gene pyrE 30279 29749 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877462.1 protein_id gnl|my_center|LOCUS_22620 30601 30359 gene locus_tag LOCUS_22630 30601 30359 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877461.1 protein_id gnl|my_center|LOCUS_22630 32365 30764 gene locus_tag LOCUS_22640 32365 30764 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_22640 32638 32375 gene locus_tag LOCUS_22650 32638 32375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 32862 33311 gene locus_tag LOCUS_22660 32862 33311 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_22660 33425 34309 gene locus_tag LOCUS_22670 33425 34309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 34891 34385 gene locus_tag LOCUS_22680 34891 34385 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037531.1 protein_id gnl|my_center|LOCUS_22680 35184 34987 gene locus_tag LOCUS_22690 35184 34987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 35129 35548 gene locus_tag LOCUS_22700 35129 35548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 36053 37060 gene locus_tag LOCUS_22710 36053 37060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 37318 37524 gene locus_tag LOCUS_22720 37318 37524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 37727 38068 gene locus_tag LOCUS_22730 37727 38068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 39618 38092 gene locus_tag LOCUS_22740 39618 38092 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_22740 39888 40382 gene locus_tag LOCUS_22750 39888 40382 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485761.1 protein_id gnl|my_center|LOCUS_22750 40479 40805 gene locus_tag LOCUS_22760 40479 40805 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767610.1 protein_id gnl|my_center|LOCUS_22760 40830 41657 gene locus_tag LOCUS_22770 40830 41657 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892320.1 protein_id gnl|my_center|LOCUS_22770 41944 43191 gene locus_tag LOCUS_22780 41944 43191 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986386.1 protein_id gnl|my_center|LOCUS_22780 44071 43202 gene locus_tag LOCUS_22790 44071 43202 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941492.1 protein_id gnl|my_center|LOCUS_22790 46005 44332 gene locus_tag LOCUS_22800 46005 44332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 46703 46011 gene locus_tag LOCUS_22810 46703 46011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 47513 46734 gene locus_tag LOCUS_22820 47513 46734 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023938.1 protein_id gnl|my_center|LOCUS_22820 48566 47799 gene locus_tag LOCUS_22830 48566 47799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 48959 49732 gene locus_tag LOCUS_22840 48959 49732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 49778 49963 gene locus_tag LOCUS_22850 49778 49963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 50159 50797 gene locus_tag LOCUS_22860 50159 50797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 51517 51299 gene locus_tag LOCUS_22870 51517 51299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 51657 52022 gene locus_tag LOCUS_22880 51657 52022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 52080 53432 gene locus_tag LOCUS_22890 52080 53432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 54350 53508 gene locus_tag LOCUS_22900 54350 53508 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087810.1 protein_id gnl|my_center|LOCUS_22900 55975 54362 gene locus_tag LOCUS_22910 55975 54362 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_22910 56178 57125 gene locus_tag LOCUS_22920 56178 57125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 57169 58470 gene locus_tag LOCUS_22930 57169 58470 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060759.1 protein_id gnl|my_center|LOCUS_22930 58556 58987 gene locus_tag LOCUS_22940 58556 58987 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875801.1 protein_id gnl|my_center|LOCUS_22940 59791 59117 gene locus_tag LOCUS_22950 59791 59117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 protein_id gnl|my_center|LOCUS_22950 60961 59810 gene locus_tag LOCUS_22960 60961 59810 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_22960 61370 61047 gene locus_tag LOCUS_22970 61370 61047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 61683 61399 gene locus_tag LOCUS_22980 61683 61399 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_22980 62350 61757 gene locus_tag LOCUS_22990 gene iorB 62350 61757 CDS product indolepyruvate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877455.1 protein_id gnl|my_center|LOCUS_22990 64311 62449 gene locus_tag LOCUS_23000 gene iorA 64311 62449 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877454.1 protein_id gnl|my_center|LOCUS_23000 64542 65117 gene locus_tag LOCUS_23010 64542 65117 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876572.1 protein_id gnl|my_center|LOCUS_23010 65853 65086 gene locus_tag LOCUS_23020 65853 65086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 66047 67591 gene locus_tag LOCUS_23030 66047 67591 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061157.1 protein_id gnl|my_center|LOCUS_23030 67643 68353 gene locus_tag LOCUS_23040 67643 68353 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877451.1 protein_id gnl|my_center|LOCUS_23040 68366 69523 gene locus_tag LOCUS_23050 68366 69523 CDS product DUF1512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877450.1 protein_id gnl|my_center|LOCUS_23050 69511 70125 gene locus_tag LOCUS_23060 gene dcd 69511 70125 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061156.1 protein_id gnl|my_center|LOCUS_23060 70226 71947 gene locus_tag LOCUS_23070 gene glyS 70226 71947 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061155.1 protein_id gnl|my_center|LOCUS_23070 72202 72050 gene locus_tag LOCUS_23080 72202 72050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 72413 72763 gene locus_tag LOCUS_23090 72413 72763 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876396.1 protein_id gnl|my_center|LOCUS_23090 72919 73674 gene locus_tag LOCUS_23100 72919 73674 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061154.1 protein_id gnl|my_center|LOCUS_23100 74598 73708 gene locus_tag LOCUS_23110 74598 73708 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061153.1 protein_id gnl|my_center|LOCUS_23110 75470 74676 gene locus_tag LOCUS_23120 75470 74676 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_23120 76283 75504 gene locus_tag LOCUS_23130 76283 75504 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_23130 77557 76301 gene locus_tag LOCUS_23140 77557 76301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 78047 77694 gene locus_tag LOCUS_23150 gene sepF 78047 77694 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877440.1 protein_id gnl|my_center|LOCUS_23150 79102 78050 gene locus_tag LOCUS_23160 79102 78050 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877439.1 protein_id gnl|my_center|LOCUS_23160 79248 79595 gene locus_tag LOCUS_23170 79248 79595 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877438.1 protein_id gnl|my_center|LOCUS_23170 79828 80793 gene locus_tag LOCUS_23180 79828 80793 CDS product 3H domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877437.1 protein_id gnl|my_center|LOCUS_23180 80911 81471 gene locus_tag LOCUS_23190 80911 81471 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877436.1 protein_id gnl|my_center|LOCUS_23190 82035 81568 gene locus_tag LOCUS_23200 82035 81568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 83173 82334 gene locus_tag LOCUS_23210 gene nadC 83173 82334 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877434.1 protein_id gnl|my_center|LOCUS_23210 83466 84368 gene locus_tag LOCUS_23220 gene rnz 83466 84368 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061333.1 protein_id gnl|my_center|LOCUS_23220 84365 85126 gene locus_tag LOCUS_23230 84365 85126 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877432.1 protein_id gnl|my_center|LOCUS_23230 85128 85733 gene locus_tag LOCUS_23240 85128 85733 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877431.1 protein_id gnl|my_center|LOCUS_23240 86102 86353 gene locus_tag LOCUS_23250 86102 86353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 86366 86920 gene locus_tag LOCUS_23260 86366 86920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 86920 87840 gene locus_tag LOCUS_23270 86920 87840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 87837 89288 gene locus_tag LOCUS_23280 gene mvhA 87837 89288 CDS product F420-non-reducing hydrogenase subunit MvhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876758.1 protein_id gnl|my_center|LOCUS_23280 89519 90796 gene locus_tag LOCUS_23290 89519 90796 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877430.1 protein_id gnl|my_center|LOCUS_23290 90990 91955 gene locus_tag LOCUS_23300 90990 91955 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060778.1 protein_id gnl|my_center|LOCUS_23300 92019 93524 gene locus_tag LOCUS_23310 92019 93524 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875879.1 protein_id gnl|my_center|LOCUS_23310 94633 93962 gene locus_tag LOCUS_23320 94633 93962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892482.1 protein_id gnl|my_center|LOCUS_23320 94757 95977 gene locus_tag LOCUS_23330 94757 95977 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023306.1 protein_id gnl|my_center|LOCUS_23330 96096 97031 gene locus_tag LOCUS_23340 96096 97031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875877.1 protein_id gnl|my_center|LOCUS_23340 97919 97053 gene locus_tag LOCUS_23350 97919 97053 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330368.1 protein_id gnl|my_center|LOCUS_23350 98031 98639 gene locus_tag LOCUS_23360 98031 98639 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_23360 99728 98697 gene locus_tag LOCUS_23370 99728 98697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 99831 100790 gene locus_tag LOCUS_23380 gene htpX 99831 100790 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392235.1 protein_id gnl|my_center|LOCUS_23380 101543 100932 gene locus_tag LOCUS_23390 101543 100932 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060845.1 protein_id gnl|my_center|LOCUS_23390 102214 101540 gene locus_tag LOCUS_23400 gene aroD 102214 101540 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876205.1 protein_id gnl|my_center|LOCUS_23400 103082 102366 gene locus_tag LOCUS_23410 103082 102366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 104002 103079 gene locus_tag LOCUS_23420 104002 103079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_23420 104213 104938 gene locus_tag LOCUS_23430 104213 104938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060844.1 protein_id gnl|my_center|LOCUS_23430 105089 105949 gene locus_tag LOCUS_23440 gene sucD 105089 105949 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750467.1 protein_id gnl|my_center|LOCUS_23440 106070 107290 gene locus_tag LOCUS_23450 gene hmgA 106070 107290 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876201.1 protein_id gnl|my_center|LOCUS_23450 107340 107918 gene locus_tag LOCUS_23460 107340 107918 CDS product TIGR00267 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876200.1 protein_id gnl|my_center|LOCUS_23460 108777 107998 gene locus_tag LOCUS_23470 108777 107998 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_23470 108941 109327 gene locus_tag LOCUS_23480 108941 109327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 110266 109421 gene locus_tag LOCUS_23490 110266 109421 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876199.1 protein_id gnl|my_center|LOCUS_23490 111233 110382 gene locus_tag LOCUS_23500 111233 110382 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_23500 111734 111348 gene locus_tag LOCUS_23510 111734 111348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 112442 113011 gene locus_tag LOCUS_23520 112442 113011 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875882.1 protein_id gnl|my_center|LOCUS_23520 113131 114426 gene locus_tag LOCUS_23530 gene hisS 113131 114426 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 protein_id gnl|my_center|LOCUS_23530 114448 114852 gene locus_tag LOCUS_23540 gene hisI 114448 114852 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_23540 114854 116680 gene locus_tag LOCUS_23550 114854 116680 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875885.1 protein_id gnl|my_center|LOCUS_23550 116701 117483 gene locus_tag LOCUS_23560 116701 117483 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485719.1 protein_id gnl|my_center|LOCUS_23560 117521 118162 gene locus_tag LOCUS_23570 117521 118162 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876433.1 protein_id gnl|my_center|LOCUS_23570 118742 119410 gene locus_tag LOCUS_23580 gene npdG 118742 119410 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_23580 119488 120072 gene locus_tag LOCUS_23590 gene hxlB 119488 120072 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061192.1 protein_id gnl|my_center|LOCUS_23590 120211 120714 gene locus_tag LOCUS_23600 gene endA 120211 120714 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060780.1 protein_id gnl|my_center|LOCUS_23600 120819 121910 gene locus_tag LOCUS_23610 120819 121910 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875890.1 protein_id gnl|my_center|LOCUS_23610 122090 122629 gene locus_tag LOCUS_23620 122090 122629 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892541.1 protein_id gnl|my_center|LOCUS_23620 122812 124008 gene locus_tag LOCUS_23630 gene thrC 122812 124008 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061193.1 protein_id gnl|my_center|LOCUS_23630 124269 124475 gene locus_tag LOCUS_23640 124269 124475 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_23640 124682 125134 gene locus_tag LOCUS_23650 124682 125134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 125348 125148 gene locus_tag LOCUS_23660 125348 125148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 125444 125815 gene locus_tag LOCUS_23670 gene rpl7ae 125444 125815 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061194.1 protein_id gnl|my_center|LOCUS_23670 125879 126085 gene locus_tag LOCUS_23680 125879 126085 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875895.1 protein_id gnl|my_center|LOCUS_23680 126104 126265 gene locus_tag LOCUS_23690 126104 126265 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875896.1 protein_id gnl|my_center|LOCUS_23690 126278 126736 gene locus_tag LOCUS_23700 gene ndk 126278 126736 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875897.1 protein_id gnl|my_center|LOCUS_23700 126870 128648 gene locus_tag LOCUS_23710 gene infB 126870 128648 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875898.1 protein_id gnl|my_center|LOCUS_23710 128764 129144 gene locus_tag LOCUS_23720 128764 129144 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_23720 129161 130387 gene locus_tag LOCUS_23730 gene eif2g 129161 130387 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875900.1 protein_id gnl|my_center|LOCUS_23730 130412 130765 gene locus_tag LOCUS_23740 130412 130765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875901.1 protein_id gnl|my_center|LOCUS_23740 130861 131514 gene locus_tag LOCUS_23750 130861 131514 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_23750 131572 132174 gene locus_tag LOCUS_23760 gene rpoE 131572 132174 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875903.1 protein_id gnl|my_center|LOCUS_23760 132177 132359 gene locus_tag LOCUS_23770 132177 132359 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875904.1 protein_id gnl|my_center|LOCUS_23770 132359 132892 gene locus_tag LOCUS_23780 132359 132892 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875905.1 protein_id gnl|my_center|LOCUS_23780 132877 133230 gene locus_tag LOCUS_23790 132877 133230 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875906.1 protein_id gnl|my_center|LOCUS_23790 133286 133450 gene locus_tag LOCUS_23800 133286 133450 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875907.1 protein_id gnl|my_center|LOCUS_23800 133503 134930 gene locus_tag LOCUS_23810 gene argH 133503 134930 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875908.1 protein_id gnl|my_center|LOCUS_23810 134977 135171 gene locus_tag LOCUS_23820 134977 135171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 135376 135191 gene locus_tag LOCUS_23830 135376 135191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 135431 135586 gene locus_tag LOCUS_23840 135431 135586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 136700 135669 gene locus_tag LOCUS_23850 136700 135669 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892473.1 protein_id gnl|my_center|LOCUS_23850 138417 136753 gene locus_tag LOCUS_23860 138417 136753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 138661 139116 gene locus_tag LOCUS_23870 138661 139116 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461316.1 protein_id gnl|my_center|LOCUS_23870 139603 139484 gene locus_tag LOCUS_23880 139603 139484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 139802 140095 gene locus_tag LOCUS_23890 139802 140095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23890 140297 140076 gene locus_tag LOCUS_23900 140297 140076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 140446 140706 gene locus_tag LOCUS_23910 140446 140706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 140949 141215 gene locus_tag LOCUS_23920 140949 141215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 141746 141288 gene locus_tag LOCUS_23930 141746 141288 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_23930 141908 143683 gene locus_tag LOCUS_23940 141908 143683 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061122.1 protein_id gnl|my_center|LOCUS_23940 144444 143686 gene locus_tag LOCUS_23950 144444 143686 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090885.1 protein_id gnl|my_center|LOCUS_23950 145708 144554 gene locus_tag LOCUS_23960 145708 144554 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877301.1 protein_id gnl|my_center|LOCUS_23960 146542 145838 gene locus_tag LOCUS_23970 gene radB 146542 145838 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877300.1 protein_id gnl|my_center|LOCUS_23970 146668 147321 gene locus_tag LOCUS_23980 146668 147321 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877389.1 protein_id gnl|my_center|LOCUS_23980 147379 148920 gene locus_tag LOCUS_23990 147379 148920 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_23990 148943 150385 gene locus_tag LOCUS_24000 148943 150385 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_24000 151599 150409 gene locus_tag LOCUS_24010 151599 150409 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065939.1 protein_id gnl|my_center|LOCUS_24010 152240 151662 gene locus_tag LOCUS_24020 152240 151662 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877299.1 protein_id gnl|my_center|LOCUS_24020 152312 152896 gene locus_tag LOCUS_24030 gene pgsA 152312 152896 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061121.1 protein_id gnl|my_center|LOCUS_24030 152952 153185 gene locus_tag LOCUS_24040 152952 153185 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877297.1 protein_id gnl|my_center|LOCUS_24040 153221 153877 gene locus_tag LOCUS_24050 153221 153877 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877296.1 protein_id gnl|my_center|LOCUS_24050 153881 154561 gene locus_tag LOCUS_24060 153881 154561 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023187.1 protein_id gnl|my_center|LOCUS_24060 155767 154667 gene locus_tag LOCUS_24070 gene fbp 155767 154667 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877293.1 protein_id gnl|my_center|LOCUS_24070 156985 155996 gene locus_tag LOCUS_24080 gene aksF 156985 155996 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875823.1 protein_id gnl|my_center|LOCUS_24080 157121 157693 gene locus_tag LOCUS_24090 157121 157693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 157910 158854 gene locus_tag LOCUS_24100 157910 158854 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875827.1 protein_id gnl|my_center|LOCUS_24100 159253 159831 gene locus_tag LOCUS_24110 gene pdxT 159253 159831 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875829.1 protein_id gnl|my_center|LOCUS_24110 159819 160736 gene locus_tag LOCUS_24120 159819 160736 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_24120 160777 161466 gene locus_tag LOCUS_24130 160777 161466 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875831.1 protein_id gnl|my_center|LOCUS_24130 161481 162569 gene locus_tag LOCUS_24140 161481 162569 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875832.1 protein_id gnl|my_center|LOCUS_24140 162583 164085 gene locus_tag LOCUS_24150 162583 164085 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875833.1 protein_id gnl|my_center|LOCUS_24150 164387 165616 gene locus_tag LOCUS_24160 164387 165616 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060874.1 protein_id gnl|my_center|LOCUS_24160 165702 166040 gene locus_tag LOCUS_24170 165702 166040 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_24170 166199 166056 gene locus_tag LOCUS_24180 166199 166056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 166613 167842 gene locus_tag LOCUS_24190 166613 167842 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060874.1 protein_id gnl|my_center|LOCUS_24190 167864 168205 gene locus_tag LOCUS_24200 167864 168205 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_24200 168439 169044 gene locus_tag LOCUS_24210 168439 169044 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064452.1 protein_id gnl|my_center|LOCUS_24210 169079 169600 gene locus_tag LOCUS_24220 169079 169600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 169630 170481 gene locus_tag LOCUS_24230 169630 170481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 170590 171369 gene locus_tag LOCUS_24240 170590 171369 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403240.1 protein_id gnl|my_center|LOCUS_24240 171538 172566 gene locus_tag LOCUS_24250 171538 172566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 173476 172898 gene locus_tag LOCUS_24260 173476 172898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 174886 173675 gene locus_tag LOCUS_24270 174886 173675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 175166 176308 gene locus_tag LOCUS_24280 175166 176308 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546088.1 protein_id gnl|my_center|LOCUS_24280 176383 177162 gene locus_tag LOCUS_24290 176383 177162 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876400.1 protein_id gnl|my_center|LOCUS_24290 177194 178471 gene locus_tag LOCUS_24300 gene eno 177194 178471 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_24300 178528 179079 gene locus_tag LOCUS_24310 178528 179079 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_24310 179277 179552 gene locus_tag LOCUS_24320 179277 179552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 179582 180106 gene locus_tag LOCUS_24330 179582 180106 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_24330 181212 180118 gene locus_tag LOCUS_24340 181212 180118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 181423 181283 gene locus_tag LOCUS_24350 181423 181283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 181609 182187 gene locus_tag LOCUS_24360 181609 182187 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461687.1 protein_id gnl|my_center|LOCUS_24360 182232 183341 gene locus_tag LOCUS_24370 182232 183341 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_24370 183352 184185 gene locus_tag LOCUS_24380 183352 184185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021756.1 protein_id gnl|my_center|LOCUS_24380 184925 184455 gene locus_tag LOCUS_24390 184925 184455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 185282 185076 gene locus_tag LOCUS_24400 185282 185076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 186102 185479 gene locus_tag LOCUS_24410 186102 185479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 187248 186121 gene locus_tag LOCUS_24420 187248 186121 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_24420 189079 187325 gene locus_tag LOCUS_24430 189079 187325 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876517.1 protein_id gnl|my_center|LOCUS_24430 190212 189214 gene locus_tag LOCUS_24440 190212 189214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876516.1 protein_id gnl|my_center|LOCUS_24440 191153 190239 gene locus_tag LOCUS_24450 gene nadA 191153 190239 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877429.1 protein_id gnl|my_center|LOCUS_24450 192013 191222 gene locus_tag LOCUS_24460 gene mtnP 192013 191222 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877204.1 protein_id gnl|my_center|LOCUS_24460 193545 192097 gene locus_tag LOCUS_24470 193545 192097 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061099.1 protein_id gnl|my_center|LOCUS_24470 194164 193712 gene locus_tag LOCUS_24480 194164 193712 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877206.1 protein_id gnl|my_center|LOCUS_24480 194317 194499 gene locus_tag LOCUS_24490 194317 194499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 195701 194580 gene locus_tag LOCUS_24500 gene cdc6-2 195701 194580 CDS product ORC1-type DNA replication protein Cdc6-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877207.1 protein_id gnl|my_center|LOCUS_24500 196552 195809 gene locus_tag LOCUS_24510 196552 195809 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877208.1 protein_id gnl|my_center|LOCUS_24510 196619 197767 gene locus_tag LOCUS_24520 196619 197767 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 protein_id gnl|my_center|LOCUS_24520 197839 198528 gene locus_tag LOCUS_24530 197839 198528 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_24530 199917 198565 gene locus_tag LOCUS_24540 199917 198565 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_24540 201690 200053 gene locus_tag LOCUS_24550 201690 200053 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877210.1 protein_id gnl|my_center|LOCUS_24550 202149 201694 gene locus_tag LOCUS_24560 202149 201694 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061315.1 protein_id gnl|my_center|LOCUS_24560 202951 202232 gene locus_tag LOCUS_24570 202951 202232 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022642.1 protein_id gnl|my_center|LOCUS_24570 203551 203048 gene locus_tag LOCUS_24580 203551 203048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022230.1 protein_id gnl|my_center|LOCUS_24580 204758 203790 gene locus_tag LOCUS_24590 204758 203790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 205388 205035 gene locus_tag LOCUS_24600 205388 205035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 209974 205457 gene locus_tag LOCUS_24610 209974 205457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 210270 210953 gene locus_tag LOCUS_24620 210270 210953 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_24620 212197 210983 gene locus_tag LOCUS_24630 gene ftsY 212197 210983 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877216.1 protein_id gnl|my_center|LOCUS_24630 212728 212294 gene locus_tag LOCUS_24640 gene pfdA 212728 212294 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877217.1 protein_id gnl|my_center|LOCUS_24640 212964 212734 gene locus_tag LOCUS_24650 gene rpl18a 212964 212734 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061100.1 protein_id gnl|my_center|LOCUS_24650 213635 212961 gene locus_tag LOCUS_24660 213635 212961 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877219.1 protein_id gnl|my_center|LOCUS_24660 213890 213645 gene locus_tag LOCUS_24670 213890 213645 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877220.1 protein_id gnl|my_center|LOCUS_24670 214073 213918 gene locus_tag LOCUS_24680 214073 213918 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868637.1 protein_id gnl|my_center|LOCUS_24680 214663 214070 gene locus_tag LOCUS_24690 214663 214070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877222.1 protein_id gnl|my_center|LOCUS_24690 215038 214691 gene locus_tag LOCUS_24700 215038 214691 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877223.1 protein_id gnl|my_center|LOCUS_24700 215490 215053 gene locus_tag LOCUS_24710 215490 215053 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877224.1 protein_id gnl|my_center|LOCUS_24710 215829 215566 gene locus_tag LOCUS_24720 215829 215566 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061101.1 protein_id gnl|my_center|LOCUS_24720 216136 215792 gene locus_tag LOCUS_24730 216136 215792 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877226.1 protein_id gnl|my_center|LOCUS_24730 216919 216383 gene locus_tag LOCUS_24740 216919 216383 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877227.1 protein_id gnl|my_center|LOCUS_24740 217757 216981 gene locus_tag LOCUS_24750 217757 216981 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_24750 217932 218141 gene locus_tag LOCUS_24760 217932 218141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 218161 218313 gene locus_tag LOCUS_24770 218161 218313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 219423 218329 gene locus_tag LOCUS_24780 219423 218329 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 protein_id gnl|my_center|LOCUS_24780 222075 219577 gene locus_tag LOCUS_24790 222075 219577 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877231.1 protein_id gnl|my_center|LOCUS_24790 224470 222350 gene locus_tag LOCUS_24800 gene topA 224470 222350 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061102.1 protein_id gnl|my_center|LOCUS_24800 224644 225177 gene locus_tag LOCUS_24810 224644 225177 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877376.1 protein_id gnl|my_center|LOCUS_24810 225170 225769 gene locus_tag LOCUS_24820 gene rrmJ 225170 225769 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877375.1 protein_id gnl|my_center|LOCUS_24820 226947 225817 gene locus_tag LOCUS_24830 226947 225817 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007652481.1 protein_id gnl|my_center|LOCUS_24830 227449 227081 gene locus_tag LOCUS_24840 227449 227081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 227718 229736 gene locus_tag LOCUS_24850 227718 229736 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877372.1 protein_id gnl|my_center|LOCUS_24850 229964 231085 gene locus_tag LOCUS_24860 229964 231085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 231295 231702 gene locus_tag LOCUS_24870 231295 231702 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877371.1 protein_id gnl|my_center|LOCUS_24870 231789 232844 gene locus_tag LOCUS_24880 231789 232844 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877370.1 protein_id gnl|my_center|LOCUS_24880 232898 233860 gene locus_tag LOCUS_24890 232898 233860 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877369.1 protein_id gnl|my_center|LOCUS_24890 233918 234130 gene locus_tag LOCUS_24900 233918 234130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 234628 234212 gene locus_tag LOCUS_24910 234628 234212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 235382 234807 gene locus_tag LOCUS_24920 gene tmk 235382 234807 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877367.1 protein_id gnl|my_center|LOCUS_24920 236294 235419 gene locus_tag LOCUS_24930 236294 235419 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_24930 236992 236312 gene locus_tag LOCUS_24940 236992 236312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 237749 237030 gene locus_tag LOCUS_24950 237749 237030 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990768.1 protein_id gnl|my_center|LOCUS_24950 237850 237777 gene locus_tag LOCUS_t00370 237850 237777 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 238103 238792 gene locus_tag LOCUS_24960 238103 238792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24960 238867 239628 gene locus_tag LOCUS_24970 238867 239628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 239673 240212 gene locus_tag LOCUS_24980 239673 240212 CDS product protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846965.1 protein_id gnl|my_center|LOCUS_24980 241083 240244 gene locus_tag LOCUS_24990 241083 240244 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876722.1 protein_id gnl|my_center|LOCUS_24990 241313 241693 gene locus_tag LOCUS_25000 241313 241693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 241739 244372 gene locus_tag LOCUS_25010 241739 244372 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877365.1 protein_id gnl|my_center|LOCUS_25010 244495 246411 gene locus_tag LOCUS_25020 244495 246411 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061138.1 protein_id gnl|my_center|LOCUS_25020 246434 246817 gene locus_tag LOCUS_25030 246434 246817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 247599 247054 gene locus_tag LOCUS_25040 247599 247054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 247717 248715 gene locus_tag LOCUS_25050 247717 248715 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485753.1 protein_id gnl|my_center|LOCUS_25050 248716 249276 gene locus_tag LOCUS_25060 248716 249276 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876823.1 protein_id gnl|my_center|LOCUS_25060 249370 249930 gene locus_tag LOCUS_25070 249370 249930 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_25070 249930 251081 gene locus_tag LOCUS_25080 gene htpX 249930 251081 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583272.1 protein_id gnl|my_center|LOCUS_25080 251272 251682 gene locus_tag LOCUS_25090 251272 251682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 252367 251975 gene locus_tag LOCUS_25100 252367 251975 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240343.1 protein_id gnl|my_center|LOCUS_25100 252572 254734 gene locus_tag LOCUS_25110 gene katG 252572 254734 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021009.1 protein_id gnl|my_center|LOCUS_25110 256806 254893 gene locus_tag LOCUS_25120 256806 254893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 257727 257503 gene locus_tag LOCUS_25130 257727 257503 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_25130 258466 257807 gene locus_tag LOCUS_25140 258466 257807 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023143.1 protein_id gnl|my_center|LOCUS_25140 258800 259033 gene locus_tag LOCUS_25150 258800 259033 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876887.1 protein_id gnl|my_center|LOCUS_25150 259164 259439 gene locus_tag LOCUS_25160 gene albA 259164 259439 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061063.1 protein_id gnl|my_center|LOCUS_25160 259542 259877 gene locus_tag LOCUS_25170 259542 259877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 260233 259955 gene locus_tag LOCUS_25180 260233 259955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 260317 261093 gene locus_tag LOCUS_25190 260317 261093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 261713 261288 gene locus_tag LOCUS_25200 261713 261288 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879679.1 protein_id gnl|my_center|LOCUS_25200 261936 261700 gene locus_tag LOCUS_25210 261936 261700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 262382 262164 gene locus_tag LOCUS_25220 262382 262164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 262611 262375 gene locus_tag LOCUS_25230 262611 262375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 262972 263625 gene locus_tag LOCUS_25240 262972 263625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 263622 264065 gene locus_tag LOCUS_25250 263622 264065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 264452 264649 gene locus_tag LOCUS_25260 264452 264649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 265258 265049 gene locus_tag LOCUS_25270 265258 265049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 265500 265261 gene locus_tag LOCUS_25280 265500 265261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 267824 266340 gene locus_tag LOCUS_25290 267824 266340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 268519 268758 gene locus_tag LOCUS_25300 268519 268758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 268713 268859 gene locus_tag LOCUS_25310 268713 268859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 268873 269286 gene locus_tag LOCUS_25320 268873 269286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 269587 270639 gene locus_tag LOCUS_25330 269587 270639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25330 270939 271478 gene locus_tag LOCUS_25340 270939 271478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 271711 271959 gene locus_tag LOCUS_25350 271711 271959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 272027 273316 gene locus_tag LOCUS_25360 272027 273316 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964746.1 protein_id gnl|my_center|LOCUS_25360 273321 274535 gene locus_tag LOCUS_25370 273321 274535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963673.1 protein_id gnl|my_center|LOCUS_25370 275191 275076 gene locus_tag LOCUS_r00010 275191 275076 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence4 6032 3444 gene locus_tag LOCUS_25380 6032 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 8832 6229 gene locus_tag LOCUS_25390 8832 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 11940 9079 gene locus_tag LOCUS_25400 11940 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 12119 12904 gene locus_tag LOCUS_25410 12119 12904 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875802.1 protein_id gnl|my_center|LOCUS_25410 17175 12994 gene locus_tag LOCUS_25420 17175 12994 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990725.1 protein_id gnl|my_center|LOCUS_25420 17359 18231 gene locus_tag LOCUS_25430 17359 18231 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_25430 18222 19991 gene locus_tag LOCUS_25440 18222 19991 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225543.1 protein_id gnl|my_center|LOCUS_25440 20042 20683 gene locus_tag LOCUS_25450 20042 20683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905797.1 protein_id gnl|my_center|LOCUS_25450 20763 21887 gene locus_tag LOCUS_25460 20763 21887 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_25460 25505 21903 gene locus_tag LOCUS_25470 25505 21903 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750440.1 protein_id gnl|my_center|LOCUS_25470 27042 25522 gene locus_tag LOCUS_25480 27042 25522 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876093.1 protein_id gnl|my_center|LOCUS_25480 27828 27064 gene locus_tag LOCUS_25490 27828 27064 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060821.1 protein_id gnl|my_center|LOCUS_25490 28433 27825 gene locus_tag LOCUS_25500 28433 27825 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261154.1 protein_id gnl|my_center|LOCUS_25500 30251 28455 gene locus_tag LOCUS_25510 30251 28455 CDS product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876090.1 protein_id gnl|my_center|LOCUS_25510 30919 30323 gene locus_tag LOCUS_25520 gene mtrA 30919 30323 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876783.1 protein_id gnl|my_center|LOCUS_25520 37803 31555 gene locus_tag LOCUS_25530 37803 31555 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876353.1 protein_id gnl|my_center|LOCUS_25530 43368 38167 gene locus_tag LOCUS_25540 43368 38167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 44237 44461 gene locus_tag LOCUS_25550 44237 44461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 44617 44829 gene locus_tag LOCUS_25560 44617 44829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 44992 45198 gene locus_tag LOCUS_25570 44992 45198 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_25570 45198 45419 gene locus_tag LOCUS_25580 45198 45419 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545805.1 protein_id gnl|my_center|LOCUS_25580 46001 46288 gene locus_tag LOCUS_25590 46001 46288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 46285 46446 gene locus_tag LOCUS_25600 46285 46446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 47029 46658 gene locus_tag LOCUS_25610 47029 46658 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250024.1 protein_id gnl|my_center|LOCUS_25610 54571 47207 gene locus_tag LOCUS_25620 54571 47207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 55163 55366 gene locus_tag LOCUS_25630 55163 55366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 55366 55524 gene locus_tag LOCUS_25640 55366 55524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 55922 56194 gene locus_tag LOCUS_25650 55922 56194 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249168.1 protein_id gnl|my_center|LOCUS_25650 56191 56670 gene locus_tag LOCUS_25660 56191 56670 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence5 1363 2823 gene locus_tag LOCUS_25670 1363 2823 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_25670 <3777 2794 gene locus_tag LOCUS_25680 <3777 2794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435274.1:SIR2 family protein >Feature sequence6 2064 517 gene locus_tag LOCUS_25690 2064 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 2922 2521 gene locus_tag LOCUS_25700 2922 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 3217 2927 gene locus_tag LOCUS_25710 3217 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710