>Feature sequence001 1169 660 gene locus_tag LOCUS_00010 1169 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2680 1166 gene locus_tag LOCUS_00020 gene accC 2680 1166 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_00020 3786 3595 gene locus_tag LOCUS_00030 3786 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4221 4445 gene locus_tag LOCUS_00040 4221 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6235 4694 gene locus_tag LOCUS_00050 6235 4694 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_00050 7081 6428 gene locus_tag LOCUS_00060 gene fsa 7081 6428 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_00060 8503 7325 gene locus_tag LOCUS_00070 8503 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9912 8530 gene locus_tag LOCUS_00080 gene hslU 9912 8530 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_00080 10394 9918 gene locus_tag LOCUS_00090 gene hslV 10394 9918 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_00090 10982 10764 gene locus_tag LOCUS_00100 10982 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11092 11655 gene locus_tag LOCUS_00110 11092 11655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11725 12117 gene locus_tag LOCUS_00120 11725 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13508 12081 gene locus_tag LOCUS_00130 13508 12081 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_00130 14016 13522 gene locus_tag LOCUS_00140 14016 13522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14807 14040 gene locus_tag LOCUS_00150 14807 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15592 14807 gene locus_tag LOCUS_00160 15592 14807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16220 15636 gene locus_tag LOCUS_00170 16220 15636 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_00170 16350 17570 gene locus_tag LOCUS_00180 16350 17570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17596 18186 gene locus_tag LOCUS_00190 17596 18186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18183 20279 gene locus_tag LOCUS_00200 18183 20279 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_00200 20589 21722 gene locus_tag LOCUS_00210 gene gnfL 20589 21722 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_00210 21815 23239 gene locus_tag LOCUS_00220 21815 23239 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_00220 24240 23302 gene locus_tag LOCUS_00230 gene xerC 24240 23302 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392542.1 protein_id gnl|my_center|LOCUS_00230 25753 24212 gene locus_tag LOCUS_00240 gene trmFO 25753 24212 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262867.1 protein_id gnl|my_center|LOCUS_00240 28062 25714 gene locus_tag LOCUS_00250 gene topA 28062 25714 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_00250 29268 28171 gene locus_tag LOCUS_00260 gene dprA 29268 28171 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262883.1 protein_id gnl|my_center|LOCUS_00260 29567 29920 gene locus_tag LOCUS_00270 29567 29920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29889 30728 gene locus_tag LOCUS_00280 29889 30728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30979 31293 gene locus_tag LOCUS_00290 gene rplU 30979 31293 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271409.1 protein_id gnl|my_center|LOCUS_00290 31332 31592 gene locus_tag LOCUS_00300 gene rpmA 31332 31592 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419086.1 protein_id gnl|my_center|LOCUS_00300 31679 32749 gene locus_tag LOCUS_00310 gene obgE 31679 32749 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_00310 32746 33450 gene locus_tag LOCUS_00320 gene nadD 32746 33450 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_00320 33437 34015 gene locus_tag LOCUS_00330 33437 34015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 34688 34404 gene locus_tag LOCUS_00340 34688 34404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35319 34726 gene locus_tag LOCUS_00350 gene tmk 35319 34726 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_00350 36600 35320 gene locus_tag LOCUS_00360 gene lysA 36600 35320 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401767.1 protein_id gnl|my_center|LOCUS_00360 36647 37297 gene locus_tag LOCUS_00370 36647 37297 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_00370 37294 37635 gene locus_tag LOCUS_00380 37294 37635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 37640 37924 gene locus_tag LOCUS_00390 37640 37924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 37987 39348 gene locus_tag LOCUS_00400 37987 39348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 39484 39702 gene locus_tag LOCUS_00410 39484 39702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40704 39784 gene locus_tag LOCUS_00420 gene lpxC 40704 39784 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_00420 43798 40943 gene locus_tag LOCUS_00430 gene uvrA 43798 40943 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_00430 45366 43888 gene locus_tag LOCUS_00440 45366 43888 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_00440 46388 45363 gene locus_tag LOCUS_00450 46388 45363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 46973 46437 gene locus_tag LOCUS_00460 46973 46437 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_00460 47160 47543 gene locus_tag LOCUS_00470 47160 47543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 48485 47673 gene locus_tag LOCUS_00480 48485 47673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 49487 48624 gene locus_tag LOCUS_00490 49487 48624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 >Feature sequence002 289 1302 gene locus_tag LOCUS_00500 289 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 1299 2540 gene locus_tag LOCUS_00510 1299 2540 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_00510 3618 2518 gene locus_tag LOCUS_00520 3618 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 3736 5271 gene locus_tag LOCUS_00530 gene guaA 3736 5271 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_00530 5414 8893 gene locus_tag LOCUS_00540 gene dnaE 5414 8893 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_00540 8910 9896 gene locus_tag LOCUS_00550 8910 9896 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_00550 9893 11611 gene locus_tag LOCUS_00560 9893 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 11611 13776 gene locus_tag LOCUS_00570 11611 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 13776 14501 gene locus_tag LOCUS_00580 13776 14501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 14535 15962 gene locus_tag LOCUS_00590 gene rpoN 14535 15962 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_00590 16076 16618 gene locus_tag LOCUS_00600 gene raiA 16076 16618 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546709.1 protein_id gnl|my_center|LOCUS_00600 16672 17649 gene locus_tag LOCUS_00610 gene hprK 16672 17649 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_00610 17649 18563 gene locus_tag LOCUS_00620 gene rapZ 17649 18563 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_00620 18624 19058 gene locus_tag LOCUS_00630 18624 19058 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_00630 19055 19333 gene locus_tag LOCUS_00640 19055 19333 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400240.1 protein_id gnl|my_center|LOCUS_00640 19324 21057 gene locus_tag LOCUS_00650 gene ptsP 19324 21057 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_00650 21089 21439 gene locus_tag LOCUS_00660 21089 21439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 21591 22031 gene locus_tag LOCUS_00670 21591 22031 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_00670 22935 22108 gene locus_tag LOCUS_00680 22935 22108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 23562 22990 gene locus_tag LOCUS_00690 23562 22990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 25009 23633 gene locus_tag LOCUS_00700 gene tolB 25009 23633 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_00700 25794 25009 gene locus_tag LOCUS_00710 25794 25009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 26269 25811 gene locus_tag LOCUS_00720 gene tolR 26269 25811 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_00720 27113 26349 gene locus_tag LOCUS_00730 gene tolQ 27113 26349 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_00730 27272 28921 gene locus_tag LOCUS_00740 gene recN 27272 28921 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_00740 28948 30288 gene locus_tag LOCUS_00750 gene miaB 28948 30288 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167929.1 protein_id gnl|my_center|LOCUS_00750 30291 30776 gene locus_tag LOCUS_00760 30291 30776 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_00760 30845 31600 gene locus_tag LOCUS_00770 30845 31600 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 protein_id gnl|my_center|LOCUS_00770 31593 32414 gene locus_tag LOCUS_00780 31593 32414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 33579 35987 gene locus_tag LOCUS_00790 33579 35987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 36065 36457 gene locus_tag LOCUS_00800 36065 36457 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547604.1 protein_id gnl|my_center|LOCUS_00800 >Feature sequence003 57 830 gene locus_tag LOCUS_00810 57 830 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941673.1 protein_id gnl|my_center|LOCUS_00810 858 1160 gene locus_tag LOCUS_00820 858 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 1880 1185 gene locus_tag LOCUS_00830 1880 1185 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528277.1 protein_id gnl|my_center|LOCUS_00830 3974 1932 gene locus_tag LOCUS_00840 3974 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 5682 3979 gene locus_tag LOCUS_00850 5682 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 7177 5873 gene locus_tag LOCUS_00860 gene zraR 7177 5873 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 protein_id gnl|my_center|LOCUS_00860 7626 7174 gene locus_tag LOCUS_00870 7626 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 7777 8934 gene locus_tag LOCUS_00880 gene speY 7777 8934 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_00880 8997 9413 gene locus_tag LOCUS_00890 8997 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 9444 10595 gene locus_tag LOCUS_00900 gene nagA 9444 10595 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195336.1 protein_id gnl|my_center|LOCUS_00900 10656 11543 gene locus_tag LOCUS_00910 10656 11543 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976449.1 protein_id gnl|my_center|LOCUS_00910 12211 11540 gene locus_tag LOCUS_00920 12211 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 12263 12682 gene locus_tag LOCUS_00930 gene queD 12263 12682 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264135.1 protein_id gnl|my_center|LOCUS_00930 14258 12759 gene locus_tag LOCUS_00940 14258 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 14346 15398 gene locus_tag LOCUS_00950 14346 15398 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577656.1 protein_id gnl|my_center|LOCUS_00950 15388 16614 gene locus_tag LOCUS_00960 15388 16614 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398440.1 protein_id gnl|my_center|LOCUS_00960 16611 17015 gene locus_tag LOCUS_00970 16611 17015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 17012 17779 gene locus_tag LOCUS_00980 gene ubiE 17012 17779 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392794.1 protein_id gnl|my_center|LOCUS_00980 17809 18246 gene locus_tag LOCUS_00990 17809 18246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 19450 18260 gene locus_tag LOCUS_01000 19450 18260 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_01000 20433 19447 gene locus_tag LOCUS_01010 20433 19447 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402005.1 protein_id gnl|my_center|LOCUS_01010 21555 20434 gene locus_tag LOCUS_01020 21555 20434 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027527.1 protein_id gnl|my_center|LOCUS_01020 21868 22458 gene locus_tag LOCUS_01030 21868 22458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 23788 22451 gene locus_tag LOCUS_01040 23788 22451 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137617.1 protein_id gnl|my_center|LOCUS_01040 23846 25009 gene locus_tag LOCUS_01050 gene moeB 23846 25009 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404770.1 protein_id gnl|my_center|LOCUS_01050 25224 25550 gene locus_tag LOCUS_01060 25224 25550 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_01060 25689 27134 gene locus_tag LOCUS_01070 gene sufB 25689 27134 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_01070 27149 27910 gene locus_tag LOCUS_01080 gene sufC 27149 27910 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_01080 27916 29241 gene locus_tag LOCUS_01090 gene sufD 27916 29241 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_01090 29238 30521 gene locus_tag LOCUS_01100 29238 30521 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_01100 30518 30964 gene locus_tag LOCUS_01110 30518 30964 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_01110 30998 31393 gene locus_tag LOCUS_01120 30998 31393 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213210.1 protein_id gnl|my_center|LOCUS_01120 31530 31958 gene locus_tag LOCUS_01130 31530 31958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 >Feature sequence004 2499 418 gene locus_tag LOCUS_01140 gene fusA 2499 418 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_01140 2909 2538 gene locus_tag LOCUS_01150 2909 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 4287 3019 gene locus_tag LOCUS_01160 4287 3019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_01160 5534 4311 gene locus_tag LOCUS_01170 5534 4311 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_01170 6979 5633 gene locus_tag LOCUS_01180 6979 5633 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933016.1 protein_id gnl|my_center|LOCUS_01180 7665 6985 gene locus_tag LOCUS_01190 7665 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 7827 8867 gene locus_tag LOCUS_01200 7827 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 8985 10757 gene locus_tag LOCUS_01210 gene pilB 8985 10757 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_01210 10842 11966 gene locus_tag LOCUS_01220 10842 11966 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_01220 11982 13199 gene locus_tag LOCUS_01230 11982 13199 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_01230 13207 14889 gene locus_tag LOCUS_01240 13207 14889 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_01240 14886 16328 gene locus_tag LOCUS_01250 14886 16328 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_01250 16585 17112 gene locus_tag LOCUS_01260 16585 17112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 17242 17778 gene locus_tag LOCUS_01270 17242 17778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 17809 19002 gene locus_tag LOCUS_01280 17809 19002 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071432.1 protein_id gnl|my_center|LOCUS_01280 19262 20242 gene locus_tag LOCUS_01290 19262 20242 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144194.1 protein_id gnl|my_center|LOCUS_01290 20229 21035 gene locus_tag LOCUS_01300 20229 21035 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_01300 21032 21910 gene locus_tag LOCUS_01310 21032 21910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 21907 22677 gene locus_tag LOCUS_01320 21907 22677 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_01320 22677 23939 gene locus_tag LOCUS_01330 22677 23939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 24108 24653 gene locus_tag LOCUS_01340 24108 24653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 24625 25203 gene locus_tag LOCUS_01350 24625 25203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 25200 26300 gene locus_tag LOCUS_01360 25200 26300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 26300 27121 gene locus_tag LOCUS_01370 26300 27121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 >Feature sequence005 2522 285 gene locus_tag LOCUS_01380 2522 285 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615857.1 protein_id gnl|my_center|LOCUS_01380 2755 4044 gene locus_tag LOCUS_01390 2755 4044 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_01390 6059 4212 gene locus_tag LOCUS_01400 6059 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 6235 7650 gene locus_tag LOCUS_01410 6235 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 9685 7694 gene locus_tag LOCUS_01420 9685 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 10044 9730 gene locus_tag LOCUS_01430 10044 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 11098 10142 gene locus_tag LOCUS_01440 11098 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 11355 11104 gene locus_tag LOCUS_01450 11355 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 11532 13520 gene locus_tag LOCUS_01460 11532 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 13517 14461 gene locus_tag LOCUS_01470 13517 14461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 14882 14655 gene locus_tag LOCUS_01480 14882 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 14853 16652 gene locus_tag LOCUS_01490 14853 16652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 16706 17971 gene locus_tag LOCUS_01500 16706 17971 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_01500 18017 19237 gene locus_tag LOCUS_01510 18017 19237 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_01510 19251 20498 gene locus_tag LOCUS_01520 19251 20498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 20495 21583 gene locus_tag LOCUS_01530 gene serC 20495 21583 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_01530 21558 22406 gene locus_tag LOCUS_01540 21558 22406 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 protein_id gnl|my_center|LOCUS_01540 22509 23393 gene locus_tag LOCUS_01550 22509 23393 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 protein_id gnl|my_center|LOCUS_01550 23506 24438 gene locus_tag LOCUS_01560 23506 24438 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_01560 24435 25148 gene locus_tag LOCUS_01570 24435 25148 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_01570 25148 27061 gene locus_tag LOCUS_01580 25148 27061 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_01580 28480 27122 gene locus_tag LOCUS_01590 gene pcnB 28480 27122 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943862.1 protein_id gnl|my_center|LOCUS_01590 28546 29382 gene locus_tag LOCUS_01600 28546 29382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 >Feature sequence006 1703 201 gene locus_tag LOCUS_01610 1703 201 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_01610 1790 2551 gene locus_tag LOCUS_01620 gene larB 1790 2551 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392116.1 protein_id gnl|my_center|LOCUS_01620 2621 5038 gene locus_tag LOCUS_01630 2621 5038 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542519.1 protein_id gnl|my_center|LOCUS_01630 5038 6825 gene locus_tag LOCUS_01640 gene dnaG 5038 6825 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_01640 6851 8569 gene locus_tag LOCUS_01650 gene rpoD 6851 8569 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_01650 8671 8743 gene locus_tag LOCUS_t00010 8671 8743 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9443 8787 gene locus_tag LOCUS_01660 9443 8787 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206063.1 protein_id gnl|my_center|LOCUS_01660 9611 9970 gene locus_tag LOCUS_01670 9611 9970 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035303.1 protein_id gnl|my_center|LOCUS_01670 9967 11721 gene locus_tag LOCUS_01680 9967 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 12427 11732 gene locus_tag LOCUS_01690 12427 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 12611 13345 gene locus_tag LOCUS_01700 12611 13345 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_01700 13276 13797 gene locus_tag LOCUS_01710 13276 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01710 14727 13963 gene locus_tag LOCUS_01720 14727 13963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 14726 15121 gene locus_tag LOCUS_01730 gene acpS 14726 15121 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707403.1 protein_id gnl|my_center|LOCUS_01730 15321 15632 gene locus_tag LOCUS_01740 15321 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 17501 15756 gene locus_tag LOCUS_01750 17501 15756 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_01750 18974 17715 gene locus_tag LOCUS_01760 gene ftsZ 18974 17715 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_01760 20270 19035 gene locus_tag LOCUS_01770 gene ftsA 20270 19035 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_01770 21137 20283 gene locus_tag LOCUS_01780 21137 20283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 22531 21134 gene locus_tag LOCUS_01790 gene murC 22531 21134 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_01790 23618 22536 gene locus_tag LOCUS_01800 gene murG 23618 22536 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_01800 24745 23615 gene locus_tag LOCUS_01810 gene ftsW 24745 23615 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_01810 26376 24994 gene locus_tag LOCUS_01820 gene murD 26376 24994 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_01820 27464 26373 gene locus_tag LOCUS_01830 gene mraY 27464 26373 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_01830 <28188 27464 gene locus_tag LOCUS_01840 <28188 27464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256654.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence007 1408 761 gene locus_tag LOCUS_01850 1408 761 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_01850 1895 2812 gene locus_tag LOCUS_01860 1895 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 4992 2845 gene locus_tag LOCUS_01870 4992 2845 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_01870 5893 5030 gene locus_tag LOCUS_01880 5893 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 6357 5890 gene locus_tag LOCUS_01890 6357 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 7537 6668 gene locus_tag LOCUS_01900 7537 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 7635 8864 gene locus_tag LOCUS_01910 7635 8864 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_01910 9733 8852 gene locus_tag LOCUS_01920 9733 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 9786 9941 gene locus_tag LOCUS_01930 9786 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 12349 9965 gene locus_tag LOCUS_01940 gene rnr 12349 9965 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391084.1 protein_id gnl|my_center|LOCUS_01940 12385 13023 gene locus_tag LOCUS_01950 gene rpoE 12385 13023 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_01950 13016 13576 gene locus_tag LOCUS_01960 13016 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 13587 14108 gene locus_tag LOCUS_01970 13587 14108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 14532 14125 gene locus_tag LOCUS_01980 14532 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 15659 14529 gene locus_tag LOCUS_01990 15659 14529 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244121.1 protein_id gnl|my_center|LOCUS_01990 15720 15911 gene locus_tag LOCUS_02000 15720 15911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 16114 15830 gene locus_tag LOCUS_02010 16114 15830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 17073 16183 gene locus_tag LOCUS_02020 17073 16183 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479855.1 protein_id gnl|my_center|LOCUS_02020 17749 17090 gene locus_tag LOCUS_02030 gene ftsE 17749 17090 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_02030 19208 17769 gene locus_tag LOCUS_02040 gene gatB 19208 17769 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_02040 20877 19276 gene locus_tag LOCUS_02050 gene pckA 20877 19276 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_02050 21979 21011 gene locus_tag LOCUS_02060 21979 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 22680 22021 gene locus_tag LOCUS_02070 22680 22021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 22789 23433 gene locus_tag LOCUS_02080 gene rpoE 22789 23433 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_02080 23435 24055 gene locus_tag LOCUS_02090 23435 24055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 24078 25286 gene locus_tag LOCUS_02100 24078 25286 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143289.1 protein_id gnl|my_center|LOCUS_02100 25561 26064 gene locus_tag LOCUS_02110 25561 26064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 >Feature sequence008 113 712 gene locus_tag LOCUS_02120 113 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02120 1553 2008 gene locus_tag LOCUS_02130 1553 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 3152 2136 gene locus_tag LOCUS_02140 gene hemB 3152 2136 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_02140 4740 3211 gene locus_tag LOCUS_02150 gene cobA 4740 3211 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 protein_id gnl|my_center|LOCUS_02150 5657 4737 gene locus_tag LOCUS_02160 gene hemC 5657 4737 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057483.1 protein_id gnl|my_center|LOCUS_02160 6973 5654 gene locus_tag LOCUS_02170 gene hemA 6973 5654 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_02170 7788 6970 gene locus_tag LOCUS_02180 gene ccsB 7788 6970 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944563.1 protein_id gnl|my_center|LOCUS_02180 8725 7790 gene locus_tag LOCUS_02190 8725 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 9619 8729 gene locus_tag LOCUS_02200 9619 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 9619 9885 gene locus_tag LOCUS_02210 9619 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 9886 10272 gene locus_tag LOCUS_02220 9886 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 10310 11122 gene locus_tag LOCUS_02230 10310 11122 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_02230 11183 11539 gene locus_tag LOCUS_02240 11183 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 11622 12566 gene locus_tag LOCUS_02250 11622 12566 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242776.1 protein_id gnl|my_center|LOCUS_02250 12668 13678 gene locus_tag LOCUS_02260 12668 13678 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090585.1 protein_id gnl|my_center|LOCUS_02260 13728 15464 gene locus_tag LOCUS_02270 13728 15464 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_02270 15818 15552 gene locus_tag LOCUS_02280 15818 15552 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089416.1 protein_id gnl|my_center|LOCUS_02280 17300 15828 gene locus_tag LOCUS_02290 17300 15828 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270301.1 protein_id gnl|my_center|LOCUS_02290 17357 20203 gene locus_tag LOCUS_02300 17357 20203 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_02300 21658 20255 gene locus_tag LOCUS_02310 gene hydA 21658 20255 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_02310 21960 21667 gene locus_tag LOCUS_02320 21960 21667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 23536 21968 gene locus_tag LOCUS_02330 23536 21968 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257638.1 protein_id gnl|my_center|LOCUS_02330 23549 24706 gene locus_tag LOCUS_02340 23549 24706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 >Feature sequence009 1667 879 gene locus_tag LOCUS_02350 gene tmk 1667 879 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_02350 2331 1630 gene locus_tag LOCUS_02360 gene tmk 2331 1630 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_02360 3886 2219 gene locus_tag LOCUS_02370 3886 2219 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140513.1 protein_id gnl|my_center|LOCUS_02370 4246 4022 gene locus_tag LOCUS_02380 4246 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 4133 4945 gene locus_tag LOCUS_02390 4133 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 4948 5448 gene locus_tag LOCUS_02400 gene sixA 4948 5448 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057106.1 protein_id gnl|my_center|LOCUS_02400 6025 5492 gene locus_tag LOCUS_02410 6025 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 7511 6255 gene locus_tag LOCUS_02420 7511 6255 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_02420 7614 7859 gene locus_tag LOCUS_02430 7614 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 8533 7841 gene locus_tag LOCUS_02440 8533 7841 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_02440 9068 8688 gene locus_tag LOCUS_02450 9068 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 9140 10003 gene locus_tag LOCUS_02460 9140 10003 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_02460 9981 10481 gene locus_tag LOCUS_02470 9981 10481 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_02470 11437 10559 gene locus_tag LOCUS_02480 gene pstA 11437 10559 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_02480 12324 11434 gene locus_tag LOCUS_02490 gene pstC 12324 11434 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140013.1 protein_id gnl|my_center|LOCUS_02490 13335 12337 gene locus_tag LOCUS_02500 13335 12337 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_02500 14500 13433 gene locus_tag LOCUS_02510 14500 13433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 16536 14809 gene locus_tag LOCUS_02520 16536 14809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 18417 16621 gene locus_tag LOCUS_02530 18417 16621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 18647 19267 gene locus_tag LOCUS_02540 18647 19267 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_02540 19273 20274 gene locus_tag LOCUS_02550 19273 20274 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086819.1 protein_id gnl|my_center|LOCUS_02550 22030 20282 gene locus_tag LOCUS_02560 gene phoR 22030 20282 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_02560 22867 22196 gene locus_tag LOCUS_02570 22867 22196 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_02570 23017 23607 gene locus_tag LOCUS_02580 23017 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 23675 23989 gene locus_tag LOCUS_02590 23675 23989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 >Feature sequence010 141 839 gene locus_tag LOCUS_02600 141 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 898 1416 gene locus_tag LOCUS_02610 898 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 1413 2984 gene locus_tag LOCUS_02620 1413 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 2993 3406 gene locus_tag LOCUS_02630 2993 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 3406 3789 gene locus_tag LOCUS_02640 3406 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 3929 4912 gene locus_tag LOCUS_02650 3929 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 5018 6541 gene locus_tag LOCUS_02660 gene zwf 5018 6541 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_02660 6538 7362 gene locus_tag LOCUS_02670 6538 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 7359 8768 gene locus_tag LOCUS_02680 gene gndA 7359 8768 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056424.1 protein_id gnl|my_center|LOCUS_02680 8815 9255 gene locus_tag LOCUS_02690 8815 9255 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976090.1 protein_id gnl|my_center|LOCUS_02690 9349 9678 gene locus_tag LOCUS_02700 9349 9678 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972473.1 protein_id gnl|my_center|LOCUS_02700 9714 10079 gene locus_tag LOCUS_02710 9714 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 10092 12212 gene locus_tag LOCUS_02720 10092 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 12209 12661 gene locus_tag LOCUS_02730 12209 12661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 12682 13617 gene locus_tag LOCUS_02740 gene gvpL 12682 13617 CDS product gas vesicle protein GvpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890528.1 protein_id gnl|my_center|LOCUS_02740 13647 13958 gene locus_tag LOCUS_02750 13647 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 14062 15924 gene locus_tag LOCUS_02760 gene arsA 14062 15924 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890458.1 protein_id gnl|my_center|LOCUS_02760 15921 16700 gene locus_tag LOCUS_02770 15921 16700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 16697 17047 gene locus_tag LOCUS_02780 16697 17047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 17048 17677 gene locus_tag LOCUS_02790 17048 17677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 17746 18066 gene locus_tag LOCUS_02800 17746 18066 CDS product gas vesicle protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730759.1 protein_id gnl|my_center|LOCUS_02800 18063 19004 gene locus_tag LOCUS_02810 18063 19004 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_02810 20073 18991 gene locus_tag LOCUS_02820 20073 18991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 22284 20140 gene locus_tag LOCUS_02830 22284 20140 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_02830 22404 22805 gene locus_tag LOCUS_02840 22404 22805 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525114.1 protein_id gnl|my_center|LOCUS_02840 22806 23597 gene locus_tag LOCUS_02850 22806 23597 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339313.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence011 172 432 gene locus_tag LOCUS_02860 172 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 529 2031 gene locus_tag LOCUS_02870 529 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02870 2028 2384 gene locus_tag LOCUS_02880 2028 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 2844 2407 gene locus_tag LOCUS_02890 2844 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 3146 2841 gene locus_tag LOCUS_02900 3146 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 3484 3269 gene locus_tag LOCUS_02910 3484 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 4942 3563 gene locus_tag LOCUS_02920 4942 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 6331 5063 gene locus_tag LOCUS_02930 6331 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 6508 6705 gene locus_tag LOCUS_02940 6508 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 6702 6884 gene locus_tag LOCUS_02950 6702 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 8145 7000 gene locus_tag LOCUS_02960 8145 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 10344 8341 gene locus_tag LOCUS_02970 10344 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 12807 10399 gene locus_tag LOCUS_02980 12807 10399 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965347.1 protein_id gnl|my_center|LOCUS_02980 13914 13108 gene locus_tag LOCUS_02990 13914 13108 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720501.1 protein_id gnl|my_center|LOCUS_02990 14486 14034 gene locus_tag LOCUS_03000 14486 14034 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113661.1 protein_id gnl|my_center|LOCUS_03000 15429 14650 gene locus_tag LOCUS_03010 15429 14650 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530891.1 protein_id gnl|my_center|LOCUS_03010 15619 15933 gene locus_tag LOCUS_03020 15619 15933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 16293 16472 gene locus_tag LOCUS_03030 16293 16472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 16812 18374 gene locus_tag LOCUS_03040 16812 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 20925 19054 gene locus_tag LOCUS_03050 20925 19054 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_03050 21601 21080 gene locus_tag LOCUS_03060 21601 21080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 22395 21607 gene locus_tag LOCUS_03070 22395 21607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 >Feature sequence012 <1 1614 gene locus_tag LOCUS_03080 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944075.1:membrane protein insertase YidC 1614 2069 gene locus_tag LOCUS_03090 1614 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 2163 3524 gene locus_tag LOCUS_03100 gene mnmE 2163 3524 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_03100 3530 5356 gene locus_tag LOCUS_03110 gene mnmG 3530 5356 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_03110 5402 6091 gene locus_tag LOCUS_03120 5402 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 6269 7075 gene locus_tag LOCUS_03130 6269 7075 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921580.1 protein_id gnl|my_center|LOCUS_03130 7068 7919 gene locus_tag LOCUS_03140 7068 7919 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_03140 8060 9004 gene locus_tag LOCUS_03150 gene selD 8060 9004 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_03150 9219 9644 gene locus_tag LOCUS_03160 9219 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 9644 10318 gene locus_tag LOCUS_03170 9644 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 10315 10872 gene locus_tag LOCUS_03180 gene atpH 10315 10872 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938079.1 protein_id gnl|my_center|LOCUS_03180 10936 12465 gene locus_tag LOCUS_03190 gene atpA 10936 12465 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_03190 12560 13435 gene locus_tag LOCUS_03200 12560 13435 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_03200 13626 15086 gene locus_tag LOCUS_03210 gene atpD 13626 15086 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_03210 15182 15643 gene locus_tag LOCUS_03220 15182 15643 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_03220 15654 16436 gene locus_tag LOCUS_03230 15654 16436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 16426 17244 gene locus_tag LOCUS_03240 16426 17244 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_03240 17241 18590 gene locus_tag LOCUS_03250 17241 18590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021201.1 protein_id gnl|my_center|LOCUS_03250 18574 19068 gene locus_tag LOCUS_03260 18574 19068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 >Feature sequence013 1365 742 gene locus_tag LOCUS_03270 1365 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03270 1692 1369 gene locus_tag LOCUS_03280 1692 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 1832 3247 gene locus_tag LOCUS_03290 1832 3247 CDS product deoxyribodipyrimidine photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_03290 4384 3257 gene locus_tag LOCUS_03300 4384 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 4406 4726 gene locus_tag LOCUS_03310 4406 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 4914 5294 gene locus_tag LOCUS_03320 4914 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 5317 6048 gene locus_tag LOCUS_03330 5317 6048 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530111.1 protein_id gnl|my_center|LOCUS_03330 7107 6109 gene locus_tag LOCUS_03340 7107 6109 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123665.1 protein_id gnl|my_center|LOCUS_03340 7333 7584 gene locus_tag LOCUS_03350 7333 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 7745 8155 gene locus_tag LOCUS_03360 7745 8155 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_03360 8981 8172 gene locus_tag LOCUS_03370 8981 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 12283 8993 gene locus_tag LOCUS_03380 12283 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 14293 12290 gene locus_tag LOCUS_03390 14293 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 15969 14293 gene locus_tag LOCUS_03400 15969 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 16932 16057 gene locus_tag LOCUS_03410 16932 16057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 17026 17703 gene locus_tag LOCUS_03420 17026 17703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 17731 18471 gene locus_tag LOCUS_03430 17731 18471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 18468 19991 gene locus_tag LOCUS_03440 18468 19991 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986277.1 protein_id gnl|my_center|LOCUS_03440 20438 19974 gene locus_tag LOCUS_03450 20438 19974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 21245 20547 gene locus_tag LOCUS_03460 21245 20547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 >Feature sequence014 1735 713 gene locus_tag LOCUS_03470 1735 713 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545634.1 protein_id gnl|my_center|LOCUS_03470 2400 1780 gene locus_tag LOCUS_03480 2400 1780 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938961.1 protein_id gnl|my_center|LOCUS_03480 4170 2506 gene locus_tag LOCUS_03490 4170 2506 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035873.1 protein_id gnl|my_center|LOCUS_03490 5191 4232 gene locus_tag LOCUS_03500 gene etfA 5191 4232 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 protein_id gnl|my_center|LOCUS_03500 5952 5188 gene locus_tag LOCUS_03510 5952 5188 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460372.1 protein_id gnl|my_center|LOCUS_03510 7336 6113 gene locus_tag LOCUS_03520 gene fabF 7336 6113 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_03520 7679 7440 gene locus_tag LOCUS_03530 gene acpP 7679 7440 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_03530 8429 7689 gene locus_tag LOCUS_03540 gene fabG 8429 7689 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097120.1 protein_id gnl|my_center|LOCUS_03540 9431 8490 gene locus_tag LOCUS_03550 gene fabD 9431 8490 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_03550 10531 9503 gene locus_tag LOCUS_03560 gene plsX 10531 9503 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_03560 10801 10619 gene locus_tag LOCUS_03570 gene rpmF 10801 10619 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888992.1 protein_id gnl|my_center|LOCUS_03570 11338 10805 gene locus_tag LOCUS_03580 11338 10805 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_03580 12744 11695 gene locus_tag LOCUS_03590 12744 11695 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_03590 13934 12744 gene locus_tag LOCUS_03600 13934 12744 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_03600 14207 13935 gene locus_tag LOCUS_03610 14207 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 15126 14191 gene locus_tag LOCUS_03620 gene miaA 15126 14191 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_03620 16199 15237 gene locus_tag LOCUS_03630 16199 15237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 17020 16277 gene locus_tag LOCUS_03640 gene ubiE 17020 16277 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_03640 17646 17035 gene locus_tag LOCUS_03650 17646 17035 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140532.1 protein_id gnl|my_center|LOCUS_03650 18502 17636 gene locus_tag LOCUS_03660 18502 17636 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_03660 19738 18557 gene locus_tag LOCUS_03670 19738 18557 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_03670 20982 19765 gene locus_tag LOCUS_03680 gene mqnC 20982 19765 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_03680 >Feature sequence015 1058 507 gene locus_tag LOCUS_03690 gene folE 1058 507 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390685.1 protein_id gnl|my_center|LOCUS_03690 1045 1770 gene locus_tag LOCUS_03700 1045 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 2634 1786 gene locus_tag LOCUS_03710 2634 1786 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_03710 3840 2659 gene locus_tag LOCUS_03720 3840 2659 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390637.1 protein_id gnl|my_center|LOCUS_03720 5048 3990 gene locus_tag LOCUS_03730 5048 3990 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 protein_id gnl|my_center|LOCUS_03730 6279 5089 gene locus_tag LOCUS_03740 6279 5089 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460999.1 protein_id gnl|my_center|LOCUS_03740 7891 6377 gene locus_tag LOCUS_03750 7891 6377 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257638.1 protein_id gnl|my_center|LOCUS_03750 8298 7939 gene locus_tag LOCUS_03760 8298 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 9691 8291 gene locus_tag LOCUS_03770 9691 8291 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_03770 10121 9699 gene locus_tag LOCUS_03780 10121 9699 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_03780 11121 10183 gene locus_tag LOCUS_03790 11121 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 12129 11263 gene locus_tag LOCUS_03800 12129 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 13213 12281 gene locus_tag LOCUS_03810 13213 12281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_03810 14052 13210 gene locus_tag LOCUS_03820 14052 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 15119 14148 gene locus_tag LOCUS_03830 15119 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 15751 15182 gene locus_tag LOCUS_03840 15751 15182 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_03840 16298 15876 gene locus_tag LOCUS_03850 16298 15876 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870191.1 protein_id gnl|my_center|LOCUS_03850 17457 16372 gene locus_tag LOCUS_03860 gene tsaD 17457 16372 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_03860 18524 17463 gene locus_tag LOCUS_03870 gene mtnA 18524 17463 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_03870 19044 18529 gene locus_tag LOCUS_03880 19044 18529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 19870 19031 gene locus_tag LOCUS_03890 19870 19031 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_03890 <21121 19867 gene locus_tag LOCUS_03900 <21121 19867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036001.1:nucleoside transporter >Feature sequence016 205 44 gene locus_tag LOCUS_03910 205 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 480 785 gene locus_tag LOCUS_03920 480 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 782 973 gene locus_tag LOCUS_03930 782 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 970 1335 gene locus_tag LOCUS_03940 970 1335 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_03940 1978 2280 gene locus_tag LOCUS_03950 1978 2280 CDS product DUF3303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532573.1 protein_id gnl|my_center|LOCUS_03950 4220 2331 gene locus_tag LOCUS_03960 4220 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 4479 4979 gene locus_tag LOCUS_03970 4479 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 5032 5991 gene locus_tag LOCUS_03980 5032 5991 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_03980 5972 6130 gene locus_tag LOCUS_03990 5972 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 6127 6447 gene locus_tag LOCUS_04000 6127 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 7324 6530 gene locus_tag LOCUS_04010 7324 6530 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_04010 7557 7784 gene locus_tag LOCUS_04020 7557 7784 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_04020 7781 8173 gene locus_tag LOCUS_04030 7781 8173 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_04030 8365 8883 gene locus_tag LOCUS_04040 8365 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 9057 9785 gene locus_tag LOCUS_04050 9057 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 12243 9814 gene locus_tag LOCUS_04060 12243 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 13147 12275 gene locus_tag LOCUS_04070 13147 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 13572 13201 gene locus_tag LOCUS_04080 13572 13201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 15494 13824 gene locus_tag LOCUS_04090 15494 13824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 16006 15563 gene locus_tag LOCUS_04100 16006 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 16224 16925 gene locus_tag LOCUS_04110 16224 16925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 17287 17039 gene locus_tag LOCUS_04120 17287 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 17470 17916 gene locus_tag LOCUS_04130 17470 17916 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729173.1 protein_id gnl|my_center|LOCUS_04130 17913 18962 gene locus_tag LOCUS_04140 gene rsmH 17913 18962 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_04140 >Feature sequence017 604 1146 gene locus_tag LOCUS_04150 604 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 1143 1802 gene locus_tag LOCUS_04160 1143 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 1817 3211 gene locus_tag LOCUS_04170 1817 3211 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928471.1 protein_id gnl|my_center|LOCUS_04170 3825 3316 gene locus_tag LOCUS_04180 3825 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 5501 3822 gene locus_tag LOCUS_04190 5501 3822 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973724.1 protein_id gnl|my_center|LOCUS_04190 7834 5438 gene locus_tag LOCUS_04200 7834 5438 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_04200 7971 11354 gene locus_tag LOCUS_04210 7971 11354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 12365 11361 gene locus_tag LOCUS_04220 12365 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 12457 12873 gene locus_tag LOCUS_04230 12457 12873 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095512524.1 protein_id gnl|my_center|LOCUS_04230 12879 13340 gene locus_tag LOCUS_04240 12879 13340 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141212.1 protein_id gnl|my_center|LOCUS_04240 13403 14551 gene locus_tag LOCUS_04250 13403 14551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 17765 14553 gene locus_tag LOCUS_04260 17765 14553 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037299.1 protein_id gnl|my_center|LOCUS_04260 17905 19236 gene locus_tag LOCUS_04270 17905 19236 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976101.1 protein_id gnl|my_center|LOCUS_04270 19378 20103 gene locus_tag LOCUS_04280 19378 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 20303 20482 gene locus_tag LOCUS_04290 20303 20482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence018 296 1249 gene locus_tag LOCUS_04300 296 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 1885 1337 gene locus_tag LOCUS_04310 1885 1337 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927118.1 protein_id gnl|my_center|LOCUS_04310 3052 1982 gene locus_tag LOCUS_04320 gene queG 3052 1982 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037446.1 protein_id gnl|my_center|LOCUS_04320 5809 3056 gene locus_tag LOCUS_04330 gene acnA 5809 3056 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_04330 5907 6194 gene locus_tag LOCUS_04340 5907 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 6191 6454 gene locus_tag LOCUS_04350 6191 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 6458 7321 gene locus_tag LOCUS_04360 6458 7321 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933259.1 protein_id gnl|my_center|LOCUS_04360 7993 7301 gene locus_tag LOCUS_04370 7993 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 9211 8213 gene locus_tag LOCUS_04380 9211 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 9759 9208 gene locus_tag LOCUS_04390 9759 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 10987 9836 gene locus_tag LOCUS_04400 gene lpxB 10987 9836 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_04400 13340 11112 gene locus_tag LOCUS_04410 13340 11112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 14704 13337 gene locus_tag LOCUS_04420 14704 13337 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_04420 15805 14783 gene locus_tag LOCUS_04430 gene lpxD 15805 14783 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142707.1 protein_id gnl|my_center|LOCUS_04430 16546 15836 gene locus_tag LOCUS_04440 16546 15836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 17591 16707 gene locus_tag LOCUS_04450 17591 16707 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_04450 18140 17595 gene locus_tag LOCUS_04460 18140 17595 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_04460 18975 18130 gene locus_tag LOCUS_04470 gene amrB 18975 18130 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_04470 19051 19347 gene locus_tag LOCUS_04480 gene gatC 19051 19347 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938110.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence019 <1 589 gene locus_tag LOCUS_04490 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014876812.1:DNA polymerase domain-containing protein 1646 534 gene locus_tag LOCUS_04500 1646 534 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742235.1 protein_id gnl|my_center|LOCUS_04500 1733 2836 gene locus_tag LOCUS_04510 gene ychF 1733 2836 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057426.1 protein_id gnl|my_center|LOCUS_04510 3880 2876 gene locus_tag LOCUS_04520 3880 2876 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_04520 4210 3959 gene locus_tag LOCUS_04530 4210 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4370 5734 gene locus_tag LOCUS_04540 4370 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 5731 8568 gene locus_tag LOCUS_04550 5731 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 8561 11884 gene locus_tag LOCUS_04560 8561 11884 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090811.1 protein_id gnl|my_center|LOCUS_04560 11877 12401 gene locus_tag LOCUS_04570 11877 12401 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_04570 12589 12837 gene locus_tag LOCUS_04580 12589 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 13033 13254 gene locus_tag LOCUS_04590 13033 13254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 13559 14161 gene locus_tag LOCUS_04600 13559 14161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 14180 14557 gene locus_tag LOCUS_04610 14180 14557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 14595 14924 gene locus_tag LOCUS_04620 14595 14924 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_04620 14993 16090 gene locus_tag LOCUS_04630 14993 16090 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_04630 17249 16083 gene locus_tag LOCUS_04640 17249 16083 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258908.1 protein_id gnl|my_center|LOCUS_04640 17291 19096 gene locus_tag LOCUS_04650 17291 19096 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039194.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence020 422 87 gene locus_tag LOCUS_04660 422 87 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941967.1 protein_id gnl|my_center|LOCUS_04660 718 419 gene locus_tag LOCUS_04670 718 419 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061280.1 protein_id gnl|my_center|LOCUS_04670 1107 2312 gene locus_tag LOCUS_04680 1107 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 2390 2884 gene locus_tag LOCUS_04690 2390 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 3088 3603 gene locus_tag LOCUS_04700 3088 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 3604 4371 gene locus_tag LOCUS_04710 3604 4371 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083337.1 protein_id gnl|my_center|LOCUS_04710 4485 4994 gene locus_tag LOCUS_04720 gene msrB 4485 4994 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327110.1 protein_id gnl|my_center|LOCUS_04720 4997 5617 gene locus_tag LOCUS_04730 gene msrA 4997 5617 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_04730 5743 7239 gene locus_tag LOCUS_04740 5743 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 7297 7983 gene locus_tag LOCUS_04750 7297 7983 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_04750 8833 8039 gene locus_tag LOCUS_04760 8833 8039 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947815.1 protein_id gnl|my_center|LOCUS_04760 9690 8863 gene locus_tag LOCUS_04770 9690 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 10280 9687 gene locus_tag LOCUS_04780 10280 9687 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 protein_id gnl|my_center|LOCUS_04780 10484 11290 gene locus_tag LOCUS_04790 10484 11290 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393976.1 protein_id gnl|my_center|LOCUS_04790 11294 11734 gene locus_tag LOCUS_04800 11294 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 11674 13284 gene locus_tag LOCUS_04810 11674 13284 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_04810 13333 14016 gene locus_tag LOCUS_04820 13333 14016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 14013 14426 gene locus_tag LOCUS_04830 14013 14426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04830 14339 14587 gene locus_tag LOCUS_04840 14339 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04840 14690 14839 gene locus_tag LOCUS_04850 14690 14839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 17174 14886 gene locus_tag LOCUS_04860 17174 14886 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_04860 17555 17785 gene locus_tag LOCUS_04870 17555 17785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 17782 18177 gene locus_tag LOCUS_04880 17782 18177 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409273.1 protein_id gnl|my_center|LOCUS_04880 19003 18209 gene locus_tag LOCUS_04890 19003 18209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 19821 19000 gene locus_tag LOCUS_04900 19821 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence021 1499 1284 gene locus_tag LOCUS_04910 1499 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 1729 2904 gene locus_tag LOCUS_04920 1729 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 3303 3671 gene locus_tag LOCUS_04930 3303 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 3782 4123 gene locus_tag LOCUS_04940 3782 4123 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356630.1 protein_id gnl|my_center|LOCUS_04940 4123 6801 gene locus_tag LOCUS_04950 4123 6801 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_04950 7150 6950 gene locus_tag LOCUS_04960 7150 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 7789 7451 gene locus_tag LOCUS_04970 7789 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 8205 9395 gene locus_tag LOCUS_04980 8205 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 10635 9706 gene locus_tag LOCUS_04990 10635 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 11291 12358 gene locus_tag LOCUS_05000 11291 12358 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113490.1 protein_id gnl|my_center|LOCUS_05000 12714 12935 gene locus_tag LOCUS_05010 12714 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 13604 13269 gene locus_tag LOCUS_05020 13604 13269 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891546.1 protein_id gnl|my_center|LOCUS_05020 13900 15333 gene locus_tag LOCUS_05030 13900 15333 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_05030 15522 15761 gene locus_tag LOCUS_05040 15522 15761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 15846 17435 gene locus_tag LOCUS_05050 15846 17435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 17432 18271 gene locus_tag LOCUS_05060 17432 18271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 18268 19212 gene locus_tag LOCUS_05070 18268 19212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223951.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence022 2331 433 gene locus_tag LOCUS_05080 2331 433 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_05080 2612 2364 gene locus_tag LOCUS_05090 2612 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05090 2830 2609 gene locus_tag LOCUS_05100 2830 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 3567 2827 gene locus_tag LOCUS_05110 3567 2827 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971646.1 protein_id gnl|my_center|LOCUS_05110 5497 3644 gene locus_tag LOCUS_05120 5497 3644 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538194.1 protein_id gnl|my_center|LOCUS_05120 9351 5503 gene locus_tag LOCUS_05130 9351 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 10374 9379 gene locus_tag LOCUS_05140 10374 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 11859 10405 gene locus_tag LOCUS_05150 gene putP 11859 10405 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 protein_id gnl|my_center|LOCUS_05150 12068 11856 gene locus_tag LOCUS_05160 12068 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 12670 11978 gene locus_tag LOCUS_05170 12670 11978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 14084 13062 gene locus_tag LOCUS_05180 14084 13062 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402990.1 protein_id gnl|my_center|LOCUS_05180 14348 14755 gene locus_tag LOCUS_05190 14348 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 16041 14860 gene locus_tag LOCUS_05200 16041 14860 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_05200 16668 16063 gene locus_tag LOCUS_05210 16668 16063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 18521 16665 gene locus_tag LOCUS_05220 18521 16665 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533438.1 protein_id gnl|my_center|LOCUS_05220 19456 18521 gene locus_tag LOCUS_05230 19456 18521 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_05230 >Feature sequence023 2297 726 gene locus_tag LOCUS_05240 2297 726 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_05240 2284 2544 gene locus_tag LOCUS_05250 2284 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2547 3071 gene locus_tag LOCUS_05260 2547 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 4172 3126 gene locus_tag LOCUS_05270 4172 3126 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672294.1 protein_id gnl|my_center|LOCUS_05270 4171 4440 gene locus_tag LOCUS_05280 4171 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 4434 4622 gene locus_tag LOCUS_05290 4434 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 4978 5244 gene locus_tag LOCUS_05300 4978 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05300 5216 5545 gene locus_tag LOCUS_05310 5216 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 7253 5634 gene locus_tag LOCUS_05320 7253 5634 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036483.1 protein_id gnl|my_center|LOCUS_05320 8370 7369 gene locus_tag LOCUS_05330 8370 7369 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036484.1 protein_id gnl|my_center|LOCUS_05330 8821 10653 gene locus_tag LOCUS_05340 gene recQ 8821 10653 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921919.1 protein_id gnl|my_center|LOCUS_05340 10682 10990 gene locus_tag LOCUS_05350 10682 10990 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_05350 11000 11566 gene locus_tag LOCUS_05360 11000 11566 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615894.1 protein_id gnl|my_center|LOCUS_05360 11684 12079 gene locus_tag LOCUS_05370 11684 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 12127 12579 gene locus_tag LOCUS_05380 12127 12579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 12637 14574 gene locus_tag LOCUS_05390 12637 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 15261 14659 gene locus_tag LOCUS_05400 15261 14659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 17855 15261 gene locus_tag LOCUS_05410 17855 15261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 19564 17852 gene locus_tag LOCUS_05420 19564 17852 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence024 387 1472 gene locus_tag LOCUS_05430 387 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 1531 3477 gene locus_tag LOCUS_05440 1531 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3947 6718 gene locus_tag LOCUS_05450 3947 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 6721 8238 gene locus_tag LOCUS_05460 6721 8238 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_05460 9516 8260 gene locus_tag LOCUS_05470 9516 8260 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_05470 10581 9517 gene locus_tag LOCUS_05480 10581 9517 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_05480 11804 10578 gene locus_tag LOCUS_05490 11804 10578 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_05490 13090 11801 gene locus_tag LOCUS_05500 13090 11801 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_05500 14028 13087 gene locus_tag LOCUS_05510 14028 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 15326 14037 gene locus_tag LOCUS_05520 15326 14037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 16266 15319 gene locus_tag LOCUS_05530 16266 15319 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393491.1 protein_id gnl|my_center|LOCUS_05530 16629 16288 gene locus_tag LOCUS_05540 16629 16288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 <19313 17095 gene locus_tag LOCUS_05550 <19313 17095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143976.1:efflux RND transporter permease subunit >Feature sequence025 2820 625 gene locus_tag LOCUS_05560 2820 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05560 4367 2820 gene locus_tag LOCUS_05570 4367 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05570 6023 4437 gene locus_tag LOCUS_05580 6023 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05580 6792 7292 gene locus_tag LOCUS_05590 6792 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05590 7419 7619 gene locus_tag LOCUS_05600 7419 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 7781 8203 gene locus_tag LOCUS_05610 7781 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 8325 11642 gene locus_tag LOCUS_05620 8325 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 11653 15321 gene locus_tag LOCUS_05630 11653 15321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence026 381 539 gene locus_tag LOCUS_05640 381 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1035 730 gene locus_tag LOCUS_05650 1035 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 1246 1037 gene locus_tag LOCUS_05660 1246 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 1822 2421 gene locus_tag LOCUS_05670 1822 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 3144 2521 gene locus_tag LOCUS_05680 3144 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 4056 3460 gene locus_tag LOCUS_05690 4056 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 4504 4767 gene locus_tag LOCUS_05700 4504 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 6671 6231 gene locus_tag LOCUS_05710 6671 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05710 7535 6840 gene locus_tag LOCUS_05720 7535 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05720 7534 7869 gene locus_tag LOCUS_05730 7534 7869 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 protein_id gnl|my_center|LOCUS_05730 7946 8140 gene locus_tag LOCUS_05740 7946 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 8367 8194 gene locus_tag LOCUS_05750 8367 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 8712 9560 gene locus_tag LOCUS_05760 8712 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05760 10335 10745 gene locus_tag LOCUS_05770 10335 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 11019 12194 gene locus_tag LOCUS_05780 11019 12194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 12307 13062 gene locus_tag LOCUS_05790 12307 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 13172 14908 gene locus_tag LOCUS_05800 gene sppA 13172 14908 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929471.1 protein_id gnl|my_center|LOCUS_05800 16939 15020 gene locus_tag LOCUS_05810 gene ppiD 16939 15020 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071919.1 protein_id gnl|my_center|LOCUS_05810 17141 18187 gene locus_tag LOCUS_05820 17141 18187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence027 <1 879 gene locus_tag LOCUS_05830 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776792.1:galactokinase family protein 1654 866 gene locus_tag LOCUS_05840 1654 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 1786 3138 gene locus_tag LOCUS_05850 1786 3138 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640554.1 protein_id gnl|my_center|LOCUS_05850 3230 4030 gene locus_tag LOCUS_05860 3230 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_05860 4064 5872 gene locus_tag LOCUS_05870 4064 5872 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030061.1 protein_id gnl|my_center|LOCUS_05870 5928 6668 gene locus_tag LOCUS_05880 5928 6668 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_05880 6687 7190 gene locus_tag LOCUS_05890 6687 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 7238 8428 gene locus_tag LOCUS_05900 7238 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 8443 9213 gene locus_tag LOCUS_05910 8443 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 11706 9406 gene locus_tag LOCUS_05920 11706 9406 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_05920 11775 12719 gene locus_tag LOCUS_05930 11775 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 12755 14251 gene locus_tag LOCUS_05940 12755 14251 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_05940 14372 15148 gene locus_tag LOCUS_05950 14372 15148 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208554.1 protein_id gnl|my_center|LOCUS_05950 15291 17516 gene locus_tag LOCUS_05960 15291 17516 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869185.1 protein_id gnl|my_center|LOCUS_05960 17509 17988 gene locus_tag LOCUS_05970 17509 17988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05970 17985 18863 gene locus_tag LOCUS_05980 17985 18863 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223811.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence028 533 1729 gene locus_tag LOCUS_05990 533 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2021 1821 gene locus_tag LOCUS_06000 2021 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2502 2191 gene locus_tag LOCUS_06010 2502 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 2907 3875 gene locus_tag LOCUS_06020 2907 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4517 5206 gene locus_tag LOCUS_06030 4517 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06030 5445 5311 gene locus_tag LOCUS_06040 5445 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 5865 5485 gene locus_tag LOCUS_06050 5865 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 6920 5862 gene locus_tag LOCUS_06060 6920 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7490 7143 gene locus_tag LOCUS_06070 7490 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 9801 8509 gene locus_tag LOCUS_06080 9801 8509 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168631.1 protein_id gnl|my_center|LOCUS_06080 11743 9812 gene locus_tag LOCUS_06090 11743 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 12211 11747 gene locus_tag LOCUS_06100 12211 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06100 12884 12153 gene locus_tag LOCUS_06110 12884 12153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06110 14363 14866 gene locus_tag LOCUS_06120 14363 14866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 15358 16308 gene locus_tag LOCUS_06130 15358 16308 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_06130 16840 16412 gene locus_tag LOCUS_06140 16840 16412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 17459 17247 gene locus_tag LOCUS_06150 17459 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06150 18103 17456 gene locus_tag LOCUS_06160 18103 17456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06160 >Feature sequence029 38 1351 gene locus_tag LOCUS_06170 38 1351 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_06170 1348 2355 gene locus_tag LOCUS_06180 gene galE 1348 2355 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_06180 2355 3065 gene locus_tag LOCUS_06190 2355 3065 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_06190 3062 4828 gene locus_tag LOCUS_06200 gene msbA 3062 4828 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_06200 4825 5712 gene locus_tag LOCUS_06210 4825 5712 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_06210 5702 6364 gene locus_tag LOCUS_06220 gene gmk 5702 6364 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_06220 6473 7678 gene locus_tag LOCUS_06230 gene coaBC 6473 7678 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_06230 7678 8388 gene locus_tag LOCUS_06240 7678 8388 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_06240 8393 10792 gene locus_tag LOCUS_06250 gene priA 8393 10792 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666732.1 protein_id gnl|my_center|LOCUS_06250 11765 10800 gene locus_tag LOCUS_06260 11765 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 12038 11766 gene locus_tag LOCUS_06270 12038 11766 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720260.1 protein_id gnl|my_center|LOCUS_06270 12121 13482 gene locus_tag LOCUS_06280 gene der 12121 13482 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_06280 14781 13582 gene locus_tag LOCUS_06290 14781 13582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06290 15395 14784 gene locus_tag LOCUS_06300 15395 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 16749 15535 gene locus_tag LOCUS_06310 16749 15535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 17991 16759 gene locus_tag LOCUS_06320 17991 16759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence030 1782 823 gene locus_tag LOCUS_06330 1782 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3117 1783 gene locus_tag LOCUS_06340 3117 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3958 3140 gene locus_tag LOCUS_06350 3958 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5290 3959 gene locus_tag LOCUS_06360 5290 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6980 5292 gene locus_tag LOCUS_06370 6980 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 7102 8397 gene locus_tag LOCUS_06380 7102 8397 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 protein_id gnl|my_center|LOCUS_06380 8466 9935 gene locus_tag LOCUS_06390 8466 9935 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062280311.1 protein_id gnl|my_center|LOCUS_06390 9949 12177 gene locus_tag LOCUS_06400 9949 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 12259 13566 gene locus_tag LOCUS_06410 12259 13566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 13573 14544 gene locus_tag LOCUS_06420 13573 14544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 14735 17845 gene locus_tag LOCUS_06430 14735 17845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence031 385 1002 gene locus_tag LOCUS_06440 385 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 906 1175 gene locus_tag LOCUS_06450 906 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 1260 1412 gene locus_tag LOCUS_06460 1260 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 3038 1464 gene locus_tag LOCUS_06470 3038 1464 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_06470 4756 3035 gene locus_tag LOCUS_06480 4756 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 5314 4907 gene locus_tag LOCUS_06490 5314 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 5630 5911 gene locus_tag LOCUS_06500 5630 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 5904 6929 gene locus_tag LOCUS_06510 5904 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 9164 7299 gene locus_tag LOCUS_06520 9164 7299 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143991.1 protein_id gnl|my_center|LOCUS_06520 9912 9148 gene locus_tag LOCUS_06530 9912 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 9992 10822 gene locus_tag LOCUS_06540 9992 10822 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383856.1 protein_id gnl|my_center|LOCUS_06540 10949 11365 gene locus_tag LOCUS_06550 10949 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 12345 11653 gene locus_tag LOCUS_06560 12345 11653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 12527 13255 gene locus_tag LOCUS_06570 12527 13255 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259732.1 protein_id gnl|my_center|LOCUS_06570 14160 13300 gene locus_tag LOCUS_06580 14160 13300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 14194 14370 gene locus_tag LOCUS_06590 14194 14370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 15763 14417 gene locus_tag LOCUS_06600 15763 14417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255956.1 protein_id gnl|my_center|LOCUS_06600 16821 15763 gene locus_tag LOCUS_06610 16821 15763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_06610 17936 16818 gene locus_tag LOCUS_06620 17936 16818 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence032 942 1358 gene locus_tag LOCUS_06630 942 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 2792 1452 gene locus_tag LOCUS_06640 2792 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 3496 2792 gene locus_tag LOCUS_06650 3496 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 6274 3638 gene locus_tag LOCUS_06660 gene bamA 6274 3638 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240970.1 protein_id gnl|my_center|LOCUS_06660 9089 6654 gene locus_tag LOCUS_06670 gene clpC 9089 6654 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_06670 9283 9957 gene locus_tag LOCUS_06680 9283 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 10784 10110 gene locus_tag LOCUS_06690 10784 10110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_06690 12138 10900 gene locus_tag LOCUS_06700 12138 10900 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_06700 13776 12268 gene locus_tag LOCUS_06710 gene lysS 13776 12268 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_06710 14271 13834 gene locus_tag LOCUS_06720 gene nusB 14271 13834 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 protein_id gnl|my_center|LOCUS_06720 14801 14268 gene locus_tag LOCUS_06730 gene ribE 14801 14268 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545200.1 protein_id gnl|my_center|LOCUS_06730 15602 14805 gene locus_tag LOCUS_06740 15602 14805 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_06740 15858 15634 gene locus_tag LOCUS_06750 15858 15634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 16318 16145 gene locus_tag LOCUS_06760 16318 16145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 16638 16315 gene locus_tag LOCUS_06770 16638 16315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 17170 16679 gene locus_tag LOCUS_06780 17170 16679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence033 627 2561 gene locus_tag LOCUS_06790 627 2561 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_06790 2817 2638 gene locus_tag LOCUS_06800 2817 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 3880 2903 gene locus_tag LOCUS_06810 3880 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061227.1 protein_id gnl|my_center|LOCUS_06810 6119 3906 gene locus_tag LOCUS_06820 6119 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 9556 6119 gene locus_tag LOCUS_06830 9556 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 11394 9562 gene locus_tag LOCUS_06840 11394 9562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 12419 11508 gene locus_tag LOCUS_06850 12419 11508 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_06850 13429 12422 gene locus_tag LOCUS_06860 13429 12422 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 protein_id gnl|my_center|LOCUS_06860 14272 13466 gene locus_tag LOCUS_06870 14272 13466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 16812 14269 gene locus_tag LOCUS_06880 16812 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence034 3363 2347 gene locus_tag LOCUS_06890 3363 2347 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507354.1 protein_id gnl|my_center|LOCUS_06890 3462 4010 gene locus_tag LOCUS_06900 3462 4010 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_06900 4049 4675 gene locus_tag LOCUS_06910 4049 4675 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_06910 5361 4573 gene locus_tag LOCUS_06920 5361 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06920 5339 5863 gene locus_tag LOCUS_06930 5339 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 6603 7319 gene locus_tag LOCUS_06940 6603 7319 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927146.1 protein_id gnl|my_center|LOCUS_06940 7338 9179 gene locus_tag LOCUS_06950 gene pepF 7338 9179 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903691.1 protein_id gnl|my_center|LOCUS_06950 10719 9535 gene locus_tag LOCUS_06960 10719 9535 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055994.1 protein_id gnl|my_center|LOCUS_06960 11472 10822 gene locus_tag LOCUS_06970 11472 10822 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941558.1 protein_id gnl|my_center|LOCUS_06970 11680 12024 gene locus_tag LOCUS_06980 11680 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 12123 15047 gene locus_tag LOCUS_06990 12123 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 17145 15409 gene locus_tag LOCUS_07000 17145 15409 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence035 <1 943 gene locus_tag LOCUS_07010 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546515.1:glycosyltransferase family 4 protein 952 2886 gene locus_tag LOCUS_07020 952 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4382 2871 gene locus_tag LOCUS_07030 4382 2871 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_07030 4493 6532 gene locus_tag LOCUS_07040 4493 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 6552 7589 gene locus_tag LOCUS_07050 6552 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 7601 8428 gene locus_tag LOCUS_07060 gene ttcA 7601 8428 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940803.1 protein_id gnl|my_center|LOCUS_07060 8486 9331 gene locus_tag LOCUS_07070 8486 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 9336 10190 gene locus_tag LOCUS_07080 gene dapF 9336 10190 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_07080 10200 11720 gene locus_tag LOCUS_07090 10200 11720 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_07090 12446 11775 gene locus_tag LOCUS_07100 12446 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 12518 13183 gene locus_tag LOCUS_07110 gene radC 12518 13183 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_07110 13187 14482 gene locus_tag LOCUS_07120 gene larC 13187 14482 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_07120 14487 16490 gene locus_tag LOCUS_07130 gene metG 14487 16490 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence036 600 800 gene locus_tag LOCUS_07140 600 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1703 1383 gene locus_tag LOCUS_07150 1703 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07150 3477 1834 gene locus_tag LOCUS_07160 gene flhA 3477 1834 CDS product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098476.1 protein_id gnl|my_center|LOCUS_07160 3690 4031 gene locus_tag LOCUS_07170 3690 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4034 5452 gene locus_tag LOCUS_07180 4034 5452 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526921.1 protein_id gnl|my_center|LOCUS_07180 5530 6657 gene locus_tag LOCUS_07190 5530 6657 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_07190 6700 9786 gene locus_tag LOCUS_07200 6700 9786 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_07200 10774 9827 gene locus_tag LOCUS_07210 10774 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 11369 10776 gene locus_tag LOCUS_07220 11369 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 13484 11415 gene locus_tag LOCUS_07230 13484 11415 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048538435.1 protein_id gnl|my_center|LOCUS_07230 <16447 14283 gene locus_tag LOCUS_07240 <16447 14283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200284324.1:NACHT domain-containing protein >Feature sequence037 380 1435 gene locus_tag LOCUS_07250 380 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 2469 1624 gene locus_tag LOCUS_07260 2469 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5321 2598 gene locus_tag LOCUS_07270 5321 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5983 7959 gene locus_tag LOCUS_07280 5983 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 7968 10373 gene locus_tag LOCUS_07290 7968 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 10784 12268 gene locus_tag LOCUS_07300 gene glgA 10784 12268 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_07300 12314 12643 gene locus_tag LOCUS_07310 gene trxA 12314 12643 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416871.1 protein_id gnl|my_center|LOCUS_07310 12633 13586 gene locus_tag LOCUS_07320 gene trxB 12633 13586 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_07320 14675 13614 gene locus_tag LOCUS_07330 gene mnmA 14675 13614 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_07330 15929 14772 gene locus_tag LOCUS_07340 gene nifS 15929 14772 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence038 1926 247 gene locus_tag LOCUS_07350 1926 247 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328020.1 protein_id gnl|my_center|LOCUS_07350 2992 2054 gene locus_tag LOCUS_07360 2992 2054 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619235.1 protein_id gnl|my_center|LOCUS_07360 3193 6855 gene locus_tag LOCUS_07370 3193 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 6905 9079 gene locus_tag LOCUS_07380 6905 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 9131 10315 gene locus_tag LOCUS_07390 9131 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 12116 10662 gene locus_tag LOCUS_07400 12116 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 14755 12116 gene locus_tag LOCUS_07410 14755 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 14919 14752 gene locus_tag LOCUS_07420 14919 14752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 15661 15119 gene locus_tag LOCUS_07430 15661 15119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence039 <1 755 gene locus_tag LOCUS_07440 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405200.1:response regulator transcription factor 748 2169 gene locus_tag LOCUS_07450 748 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2515 2754 gene locus_tag LOCUS_07460 2515 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07460 2812 3597 gene locus_tag LOCUS_07470 2812 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07470 5065 4805 gene locus_tag LOCUS_07480 5065 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 6253 5075 gene locus_tag LOCUS_07490 6253 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6523 7734 gene locus_tag LOCUS_07500 6523 7734 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965724.1 protein_id gnl|my_center|LOCUS_07500 10308 7765 gene locus_tag LOCUS_07510 10308 7765 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_07510 11800 10301 gene locus_tag LOCUS_07520 11800 10301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 12706 12020 gene locus_tag LOCUS_07530 12706 12020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 13863 12790 gene locus_tag LOCUS_07540 13863 12790 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141167.1 protein_id gnl|my_center|LOCUS_07540 14788 13982 gene locus_tag LOCUS_07550 14788 13982 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_07550 <15655 15108 gene locus_tag LOCUS_07560 <15655 15108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141271.1:ABC transporter permease >Feature sequence040 675 145 gene locus_tag LOCUS_07570 gene rfbC 675 145 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257099.1 protein_id gnl|my_center|LOCUS_07570 1917 679 gene locus_tag LOCUS_07580 1917 679 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_07580 3990 2140 gene locus_tag LOCUS_07590 3990 2140 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582947.1 protein_id gnl|my_center|LOCUS_07590 4132 5325 gene locus_tag LOCUS_07600 4132 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 5322 6572 gene locus_tag LOCUS_07610 5322 6572 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704930.1 protein_id gnl|my_center|LOCUS_07610 7471 6548 gene locus_tag LOCUS_07620 7471 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 8961 7468 gene locus_tag LOCUS_07630 8961 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 9752 8958 gene locus_tag LOCUS_07640 9752 8958 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_07640 10062 9742 gene locus_tag LOCUS_07650 10062 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 11456 10059 gene locus_tag LOCUS_07660 11456 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 11632 11997 gene locus_tag LOCUS_07670 gene ndhC 11632 11997 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258748.1 protein_id gnl|my_center|LOCUS_07670 12040 12504 gene locus_tag LOCUS_07680 12040 12504 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888144.1 protein_id gnl|my_center|LOCUS_07680 12730 13281 gene locus_tag LOCUS_07690 12730 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 13319 13894 gene locus_tag LOCUS_07700 13319 13894 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546496.1 protein_id gnl|my_center|LOCUS_07700 13913 15100 gene locus_tag LOCUS_07710 gene nuoD 13913 15100 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence041 2958 2785 gene locus_tag LOCUS_07720 2958 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 3931 4539 gene locus_tag LOCUS_07730 3931 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 4536 5531 gene locus_tag LOCUS_07740 4536 5531 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839879.1 protein_id gnl|my_center|LOCUS_07740 5528 6562 gene locus_tag LOCUS_07750 5528 6562 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_07750 6576 7460 gene locus_tag LOCUS_07760 6576 7460 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_07760 7457 8530 gene locus_tag LOCUS_07770 7457 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 8527 9534 gene locus_tag LOCUS_07780 8527 9534 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839880.1 protein_id gnl|my_center|LOCUS_07780 11695 9527 gene locus_tag LOCUS_07790 11695 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 12880 11843 gene locus_tag LOCUS_07800 12880 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 13960 12887 gene locus_tag LOCUS_07810 13960 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 15452 14106 gene locus_tag LOCUS_07820 15452 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence042 2934 2221 gene locus_tag LOCUS_07830 2934 2221 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_07830 3356 3063 gene locus_tag LOCUS_07840 3356 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 5120 3663 gene locus_tag LOCUS_07850 gene gltX 5120 3663 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583633.1 protein_id gnl|my_center|LOCUS_07850 5407 6699 gene locus_tag LOCUS_07860 5407 6699 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227678.1 protein_id gnl|my_center|LOCUS_07860 6696 7073 gene locus_tag LOCUS_07870 6696 7073 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631113.1 protein_id gnl|my_center|LOCUS_07870 8380 7109 gene locus_tag LOCUS_07880 8380 7109 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275477.1 protein_id gnl|my_center|LOCUS_07880 8524 9087 gene locus_tag LOCUS_07890 8524 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 9039 10361 gene locus_tag LOCUS_07900 9039 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07900 10747 10358 gene locus_tag LOCUS_07910 10747 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 11103 10744 gene locus_tag LOCUS_07920 11103 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 12731 11490 gene locus_tag LOCUS_07930 12731 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 13075 12728 gene locus_tag LOCUS_07940 13075 12728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 13692 13165 gene locus_tag LOCUS_07950 13692 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 14974 13754 gene locus_tag LOCUS_07960 14974 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 15143 15049 gene locus_tag LOCUS_t00020 15143 15049 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence043 2217 1453 gene locus_tag LOCUS_07970 2217 1453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_07970 2241 2885 gene locus_tag LOCUS_07980 2241 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2891 3319 gene locus_tag LOCUS_07990 2891 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 3761 3309 gene locus_tag LOCUS_08000 3761 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 3836 6256 gene locus_tag LOCUS_08010 3836 6256 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_08010 6356 7138 gene locus_tag LOCUS_08020 6356 7138 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338637.1 protein_id gnl|my_center|LOCUS_08020 7146 7682 gene locus_tag LOCUS_08030 7146 7682 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_08030 10294 7703 gene locus_tag LOCUS_08040 10294 7703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_08040 10653 10294 gene locus_tag LOCUS_08050 10653 10294 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142423.1 protein_id gnl|my_center|LOCUS_08050 11869 10742 gene locus_tag LOCUS_08060 11869 10742 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073563.1 protein_id gnl|my_center|LOCUS_08060 12438 11866 gene locus_tag LOCUS_08070 12438 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 12899 13351 gene locus_tag LOCUS_08080 12899 13351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 13364 13957 gene locus_tag LOCUS_08090 13364 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 13960 14745 gene locus_tag LOCUS_08100 13960 14745 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230200.1 protein_id gnl|my_center|LOCUS_08100 15180 14692 gene locus_tag LOCUS_08110 15180 14692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence044 2389 4146 gene locus_tag LOCUS_08120 2389 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 4965 7418 gene locus_tag LOCUS_08130 4965 7418 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_08130 8596 7604 gene locus_tag LOCUS_08140 8596 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 10212 8581 gene locus_tag LOCUS_08150 10212 8581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 10485 10709 gene locus_tag LOCUS_08160 10485 10709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 12089 10899 gene locus_tag LOCUS_08170 12089 10899 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130602656.1 protein_id gnl|my_center|LOCUS_08170 13054 12197 gene locus_tag LOCUS_08180 13054 12197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 13592 13101 gene locus_tag LOCUS_08190 13592 13101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 14070 13597 gene locus_tag LOCUS_08200 14070 13597 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_08200 14884 14204 gene locus_tag LOCUS_08210 14884 14204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence045 38 289 gene locus_tag LOCUS_08220 38 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 617 757 gene locus_tag LOCUS_08230 617 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1074 1355 gene locus_tag LOCUS_08240 1074 1355 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393693.1 protein_id gnl|my_center|LOCUS_08240 1352 1780 gene locus_tag LOCUS_08250 1352 1780 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393694.1 protein_id gnl|my_center|LOCUS_08250 1834 2127 gene locus_tag LOCUS_08260 1834 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_08260 5245 2495 gene locus_tag LOCUS_08270 5245 2495 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_08270 5610 5242 gene locus_tag LOCUS_08280 5610 5242 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827865.1 protein_id gnl|my_center|LOCUS_08280 6284 5877 gene locus_tag LOCUS_08290 6284 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 6469 6813 gene locus_tag LOCUS_08300 6469 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 6810 9527 gene locus_tag LOCUS_08310 6810 9527 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_08310 10121 9537 gene locus_tag LOCUS_08320 10121 9537 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967875.1 protein_id gnl|my_center|LOCUS_08320 10863 10243 gene locus_tag LOCUS_08330 10863 10243 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027536.1 protein_id gnl|my_center|LOCUS_08330 11501 10908 gene locus_tag LOCUS_08340 11501 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 12494 11571 gene locus_tag LOCUS_08350 12494 11571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 13111 13278 gene locus_tag LOCUS_08360 13111 13278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence046 2205 574 gene locus_tag LOCUS_08370 2205 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2257 2643 gene locus_tag LOCUS_08380 2257 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 2649 3482 gene locus_tag LOCUS_08390 2649 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 3557 5233 gene locus_tag LOCUS_08400 3557 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5305 6363 gene locus_tag LOCUS_08410 5305 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 7822 6311 gene locus_tag LOCUS_08420 gene proS 7822 6311 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_08420 9387 7837 gene locus_tag LOCUS_08430 gene nadB 9387 7837 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_08430 9443 10573 gene locus_tag LOCUS_08440 gene aroB 9443 10573 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706965.1 protein_id gnl|my_center|LOCUS_08440 11994 10603 gene locus_tag LOCUS_08450 11994 10603 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_08450 12530 12006 gene locus_tag LOCUS_08460 12530 12006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 13239 12568 gene locus_tag LOCUS_08470 13239 12568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 14175 13243 gene locus_tag LOCUS_08480 14175 13243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence047 250 38 gene locus_tag LOCUS_08490 250 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1102 947 gene locus_tag LOCUS_08500 1102 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 2004 1180 gene locus_tag LOCUS_08510 2004 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 3501 2173 gene locus_tag LOCUS_08520 3501 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4009 3587 gene locus_tag LOCUS_08530 4009 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 5206 4772 gene locus_tag LOCUS_08540 5206 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 6100 5267 gene locus_tag LOCUS_08550 6100 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 6498 6256 gene locus_tag LOCUS_08560 6498 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 6912 6523 gene locus_tag LOCUS_08570 6912 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 7358 7164 gene locus_tag LOCUS_08580 7358 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 7272 8255 gene locus_tag LOCUS_08590 7272 8255 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083076.1 protein_id gnl|my_center|LOCUS_08590 8245 9522 gene locus_tag LOCUS_08600 8245 9522 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704479.1 protein_id gnl|my_center|LOCUS_08600 10171 9581 gene locus_tag LOCUS_08610 10171 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 10568 10227 gene locus_tag LOCUS_08620 10568 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 11097 12026 gene locus_tag LOCUS_08630 11097 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 12052 13401 gene locus_tag LOCUS_08640 12052 13401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence048 <1 1078 gene locus_tag LOCUS_08650 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383836.1:MFS transporter 1149 4421 gene locus_tag LOCUS_08660 1149 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 4569 5390 gene locus_tag LOCUS_08670 gene iolB 4569 5390 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640197.1 protein_id gnl|my_center|LOCUS_08670 5398 6786 gene locus_tag LOCUS_08680 5398 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 6779 8104 gene locus_tag LOCUS_08690 6779 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 8101 8631 gene locus_tag LOCUS_08700 8101 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 8672 10543 gene locus_tag LOCUS_08710 gene iolD 8672 10543 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_08710 10621 13287 gene locus_tag LOCUS_08720 10621 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 13430 13723 gene locus_tag LOCUS_08730 13430 13723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08730 >Feature sequence049 1810 23 gene locus_tag LOCUS_08740 gene pabB 1810 23 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_08740 3062 1926 gene locus_tag LOCUS_08750 3062 1926 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218080540.1 protein_id gnl|my_center|LOCUS_08750 2943 4319 gene locus_tag LOCUS_08760 2943 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 4324 6516 gene locus_tag LOCUS_08770 4324 6516 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_08770 6610 7077 gene locus_tag LOCUS_08780 6610 7077 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993958.1 protein_id gnl|my_center|LOCUS_08780 7950 7186 gene locus_tag LOCUS_08790 7950 7186 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256259.1 protein_id gnl|my_center|LOCUS_08790 7941 8957 gene locus_tag LOCUS_08800 7941 8957 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056901.1 protein_id gnl|my_center|LOCUS_08800 10305 8929 gene locus_tag LOCUS_08810 10305 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 11252 10302 gene locus_tag LOCUS_08820 11252 10302 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798653.1 protein_id gnl|my_center|LOCUS_08820 12467 11295 gene locus_tag LOCUS_08830 12467 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 13432 12449 gene locus_tag LOCUS_08840 13432 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence050 273 58 gene locus_tag LOCUS_08850 273 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 706 299 gene locus_tag LOCUS_08860 706 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1150 725 gene locus_tag LOCUS_08870 1150 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1402 1157 gene locus_tag LOCUS_08880 1402 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2817 1474 gene locus_tag LOCUS_08890 2817 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3629 2838 gene locus_tag LOCUS_08900 3629 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4429 3626 gene locus_tag LOCUS_08910 4429 3626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596488.1 protein_id gnl|my_center|LOCUS_08910 5875 4472 gene locus_tag LOCUS_08920 5875 4472 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_08920 7545 9152 gene locus_tag LOCUS_08930 7545 9152 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_08930 9211 9984 gene locus_tag LOCUS_08940 9211 9984 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257438.1 protein_id gnl|my_center|LOCUS_08940 9981 11480 gene locus_tag LOCUS_08950 9981 11480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08950 11480 11896 gene locus_tag LOCUS_08960 11480 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08960 13882 12698 gene locus_tag LOCUS_08970 13882 12698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence051 872 465 gene locus_tag LOCUS_08980 872 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1075 1383 gene locus_tag LOCUS_08990 1075 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1376 3604 gene locus_tag LOCUS_09000 1376 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 4185 3682 gene locus_tag LOCUS_09010 4185 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 4320 12812 gene locus_tag LOCUS_09020 4320 12812 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_09020 13349 13729 gene locus_tag LOCUS_09030 13349 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence052 1716 1504 gene locus_tag LOCUS_09040 1716 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1607 3349 gene locus_tag LOCUS_09050 1607 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 4544 3414 gene locus_tag LOCUS_09060 4544 3414 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839930.1 protein_id gnl|my_center|LOCUS_09060 4659 5633 gene locus_tag LOCUS_09070 gene ilvA 4659 5633 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_09070 5730 7856 gene locus_tag LOCUS_09080 gene glgP 5730 7856 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_09080 7897 8355 gene locus_tag LOCUS_09090 7897 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 8500 8922 gene locus_tag LOCUS_09100 8500 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 8980 9504 gene locus_tag LOCUS_09110 gene bstA 8980 9504 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999070.1 protein_id gnl|my_center|LOCUS_09110 9896 9501 gene locus_tag LOCUS_09120 9896 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 11968 9902 gene locus_tag LOCUS_09130 11968 9902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 12051 13229 gene locus_tag LOCUS_09140 12051 13229 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence053 1 966 gene locus_tag LOCUS_09150 1 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1072 1467 gene locus_tag LOCUS_09160 1072 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 2736 1594 gene locus_tag LOCUS_09170 2736 1594 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_09170 2852 4213 gene locus_tag LOCUS_09180 2852 4213 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123371.1 protein_id gnl|my_center|LOCUS_09180 5573 4245 gene locus_tag LOCUS_09190 5573 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_09190 6208 6348 gene locus_tag LOCUS_09200 6208 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 6475 7563 gene locus_tag LOCUS_09210 6475 7563 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243654.1 protein_id gnl|my_center|LOCUS_09210 7646 8152 gene locus_tag LOCUS_09220 7646 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09220 8845 8171 gene locus_tag LOCUS_09230 8845 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 9561 8845 gene locus_tag LOCUS_09240 9561 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 9998 9618 gene locus_tag LOCUS_09250 9998 9618 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614659.1 protein_id gnl|my_center|LOCUS_09250 11125 9995 gene locus_tag LOCUS_09260 11125 9995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 12598 11231 gene locus_tag LOCUS_09270 12598 11231 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_09270 <13989 12600 gene locus_tag LOCUS_09280 <13989 12600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121439.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence054 399 776 gene locus_tag LOCUS_09290 399 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1524 823 gene locus_tag LOCUS_09300 1524 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1949 1653 gene locus_tag LOCUS_09310 1949 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2544 2122 gene locus_tag LOCUS_09320 2544 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09320 2716 3909 gene locus_tag LOCUS_09330 2716 3909 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729341.1 protein_id gnl|my_center|LOCUS_09330 4307 4035 gene locus_tag LOCUS_09340 4307 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 4686 5174 gene locus_tag LOCUS_09350 4686 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 6678 5332 gene locus_tag LOCUS_09360 6678 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 7758 6730 gene locus_tag LOCUS_09370 7758 6730 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903356.1 protein_id gnl|my_center|LOCUS_09370 8939 7755 gene locus_tag LOCUS_09380 8939 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 9908 8952 gene locus_tag LOCUS_09390 9908 8952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192260.1 protein_id gnl|my_center|LOCUS_09390 10852 9905 gene locus_tag LOCUS_09400 10852 9905 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210221.1 protein_id gnl|my_center|LOCUS_09400 12405 10849 gene locus_tag LOCUS_09410 12405 10849 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970036.1 protein_id gnl|my_center|LOCUS_09410 13529 12405 gene locus_tag LOCUS_09420 13529 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence055 1348 458 gene locus_tag LOCUS_09430 1348 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1604 1371 gene locus_tag LOCUS_09440 1604 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1669 1995 gene locus_tag LOCUS_09450 1669 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 4906 2255 gene locus_tag LOCUS_09460 4906 2255 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928775.1 protein_id gnl|my_center|LOCUS_09460 5237 4911 gene locus_tag LOCUS_09470 5237 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 5343 6509 gene locus_tag LOCUS_09480 5343 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 7476 6481 gene locus_tag LOCUS_09490 7476 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 9904 7523 gene locus_tag LOCUS_09500 9904 7523 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_09500 10182 9925 gene locus_tag LOCUS_09510 10182 9925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 10230 11885 gene locus_tag LOCUS_09520 10230 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 <13553 11979 gene locus_tag LOCUS_09530 <13553 11979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928597.1:M14 family metallopeptidase >Feature sequence056 248 1135 gene locus_tag LOCUS_09540 gene ansZ 248 1135 CDS product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 protein_id gnl|my_center|LOCUS_09540 1850 1140 gene locus_tag LOCUS_09550 1850 1140 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258401.1 protein_id gnl|my_center|LOCUS_09550 1932 2801 gene locus_tag LOCUS_09560 gene lipA 1932 2801 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_09560 3842 2973 gene locus_tag LOCUS_09570 3842 2973 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_09570 5272 3839 gene locus_tag LOCUS_09580 gene lpdA 5272 3839 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_09580 6843 5320 gene locus_tag LOCUS_09590 gene aceF 6843 5320 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193075.1 protein_id gnl|my_center|LOCUS_09590 9566 6894 gene locus_tag LOCUS_09600 gene aceE 9566 6894 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_09600 10284 9781 gene locus_tag LOCUS_09610 10284 9781 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439348.1 protein_id gnl|my_center|LOCUS_09610 11667 10633 gene locus_tag LOCUS_09620 11667 10633 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224311.1 protein_id gnl|my_center|LOCUS_09620 12775 11963 gene locus_tag LOCUS_09630 12775 11963 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_09630 13328 12777 gene locus_tag LOCUS_09640 13328 12777 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence057 623 39 gene locus_tag LOCUS_09650 623 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1191 613 gene locus_tag LOCUS_09660 1191 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1808 1188 gene locus_tag LOCUS_09670 1808 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2794 1808 gene locus_tag LOCUS_09680 2794 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 4455 2791 gene locus_tag LOCUS_09690 4455 2791 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_09690 5663 4455 gene locus_tag LOCUS_09700 5663 4455 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_09700 6572 5895 gene locus_tag LOCUS_09710 6572 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 7516 6695 gene locus_tag LOCUS_09720 7516 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7633 7905 gene locus_tag LOCUS_09730 gene eutM 7633 7905 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358305.1 protein_id gnl|my_center|LOCUS_09730 7921 9690 gene locus_tag LOCUS_09740 7921 9690 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462296.1 protein_id gnl|my_center|LOCUS_09740 9908 11626 gene locus_tag LOCUS_09750 9908 11626 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941675.1 protein_id gnl|my_center|LOCUS_09750 11770 13278 gene locus_tag LOCUS_09760 11770 13278 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140479.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence058 400 3486 gene locus_tag LOCUS_09770 400 3486 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839612.1 protein_id gnl|my_center|LOCUS_09770 4299 3487 gene locus_tag LOCUS_09780 4299 3487 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226808.1 protein_id gnl|my_center|LOCUS_09780 4413 4805 gene locus_tag LOCUS_09790 4413 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5016 5390 gene locus_tag LOCUS_09800 5016 5390 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 protein_id gnl|my_center|LOCUS_09800 5387 5983 gene locus_tag LOCUS_09810 5387 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 6180 5980 gene locus_tag LOCUS_09820 6180 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 8189 6177 gene locus_tag LOCUS_09830 8189 6177 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326708.1 protein_id gnl|my_center|LOCUS_09830 8439 8191 gene locus_tag LOCUS_09840 8439 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 9124 8618 gene locus_tag LOCUS_09850 9124 8618 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141436.1 protein_id gnl|my_center|LOCUS_09850 9458 9099 gene locus_tag LOCUS_09860 9458 9099 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_09860 9790 10494 gene locus_tag LOCUS_09870 9790 10494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 10491 11927 gene locus_tag LOCUS_09880 10491 11927 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077027088.1 protein_id gnl|my_center|LOCUS_09880 12361 13491 gene locus_tag LOCUS_09890 12361 13491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence059 3179 252 gene locus_tag LOCUS_09900 3179 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 3333 4925 gene locus_tag LOCUS_09910 3333 4925 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994202.1 protein_id gnl|my_center|LOCUS_09910 6702 4954 gene locus_tag LOCUS_09920 6702 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 8658 6745 gene locus_tag LOCUS_09930 8658 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 9562 8849 gene locus_tag LOCUS_09940 9562 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 9725 11530 gene locus_tag LOCUS_09950 gene ftsH 9725 11530 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_09950 11584 13377 gene locus_tag LOCUS_09960 11584 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence060 355 1440 gene locus_tag LOCUS_09970 355 1440 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_09970 1985 1653 gene locus_tag LOCUS_09980 1985 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1984 2496 gene locus_tag LOCUS_09990 1984 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 4326 2536 gene locus_tag LOCUS_10000 4326 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403737.1 protein_id gnl|my_center|LOCUS_10000 5598 4417 gene locus_tag LOCUS_10010 5598 4417 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838519.1 protein_id gnl|my_center|LOCUS_10010 6514 5672 gene locus_tag LOCUS_10020 gene nikC 6514 5672 CDS product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023387.1 protein_id gnl|my_center|LOCUS_10020 7493 6549 gene locus_tag LOCUS_10030 7493 6549 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023386.1 protein_id gnl|my_center|LOCUS_10030 9096 7507 gene locus_tag LOCUS_10040 9096 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 10385 9282 gene locus_tag LOCUS_10050 10385 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 10324 10641 gene locus_tag LOCUS_10060 10324 10641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 10684 11631 gene locus_tag LOCUS_10070 gene cysK 10684 11631 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941203.1 protein_id gnl|my_center|LOCUS_10070 12659 12093 gene locus_tag LOCUS_10080 12659 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 12797 13396 gene locus_tag LOCUS_10090 12797 13396 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507867.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence061 3 1058 gene locus_tag LOCUS_10100 3 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1826 1077 gene locus_tag LOCUS_10110 1826 1077 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_10110 3860 1947 gene locus_tag LOCUS_10120 3860 1947 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_10120 4534 3866 gene locus_tag LOCUS_10130 4534 3866 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225081.1 protein_id gnl|my_center|LOCUS_10130 4771 5940 gene locus_tag LOCUS_10140 gene sucC 4771 5940 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_10140 5991 6857 gene locus_tag LOCUS_10150 gene sucD 5991 6857 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_10150 6873 8729 gene locus_tag LOCUS_10160 6873 8729 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_10160 8759 9802 gene locus_tag LOCUS_10170 8759 9802 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_10170 9837 11870 gene locus_tag LOCUS_10180 9837 11870 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444445.1 protein_id gnl|my_center|LOCUS_10180 12217 11990 gene locus_tag LOCUS_10190 12217 11990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 12205 12621 gene locus_tag LOCUS_10200 gene ndk 12205 12621 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941771.1 protein_id gnl|my_center|LOCUS_10200 12711 13265 gene locus_tag LOCUS_10210 gene dcd 12711 13265 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence062 <1 3103 gene locus_tag LOCUS_10220 <1 3103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039201.1:TonB-dependent receptor 5485 3158 gene locus_tag LOCUS_10230 5485 3158 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_10230 5516 6061 gene locus_tag LOCUS_10240 5516 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 6340 6810 gene locus_tag LOCUS_10250 6340 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 6803 7045 gene locus_tag LOCUS_10260 6803 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 7144 7371 gene locus_tag LOCUS_10270 7144 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 8714 7410 gene locus_tag LOCUS_10280 8714 7410 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876185.1 protein_id gnl|my_center|LOCUS_10280 8960 9163 gene locus_tag LOCUS_10290 8960 9163 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_10290 9591 10832 gene locus_tag LOCUS_10300 9591 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 10851 11684 gene locus_tag LOCUS_10310 10851 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 11702 13285 gene locus_tag LOCUS_10320 11702 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence063 <1 598 gene locus_tag LOCUS_10330 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942239.1:pitrilysin family protein 622 1896 gene locus_tag LOCUS_10340 gene purB 622 1896 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_10340 1904 2143 gene locus_tag LOCUS_10350 gene purS 1904 2143 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393546.1 protein_id gnl|my_center|LOCUS_10350 2248 2958 gene locus_tag LOCUS_10360 gene purQ 2248 2958 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403297.1 protein_id gnl|my_center|LOCUS_10360 2987 5215 gene locus_tag LOCUS_10370 gene purL 2987 5215 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_10370 5236 6642 gene locus_tag LOCUS_10380 gene purF 5236 6642 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_10380 6648 7832 gene locus_tag LOCUS_10390 6648 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 7924 8955 gene locus_tag LOCUS_10400 gene purM 7924 8955 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_10400 8975 9589 gene locus_tag LOCUS_10410 gene purN 8975 9589 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_10410 10250 9606 gene locus_tag LOCUS_10420 10250 9606 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088543.1 protein_id gnl|my_center|LOCUS_10420 11159 10314 gene locus_tag LOCUS_10430 11159 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 11217 12431 gene locus_tag LOCUS_10440 gene tyrS 11217 12431 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938252.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence064 368 526 gene locus_tag LOCUS_10450 368 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1497 670 gene locus_tag LOCUS_10460 1497 670 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 protein_id gnl|my_center|LOCUS_10460 1632 4061 gene locus_tag LOCUS_10470 1632 4061 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119377.1 protein_id gnl|my_center|LOCUS_10470 4312 5709 gene locus_tag LOCUS_10480 4312 5709 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921346.1 protein_id gnl|my_center|LOCUS_10480 5758 6126 gene locus_tag LOCUS_10490 5758 6126 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140688.1 protein_id gnl|my_center|LOCUS_10490 6123 8816 gene locus_tag LOCUS_10500 6123 8816 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_10500 9931 9053 gene locus_tag LOCUS_10510 9931 9053 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803873.1 protein_id gnl|my_center|LOCUS_10510 9951 12770 gene locus_tag LOCUS_10520 9951 12770 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259558.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence065 2891 1878 gene locus_tag LOCUS_10530 gene mltG 2891 1878 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_10530 3352 2888 gene locus_tag LOCUS_10540 gene ruvX 3352 2888 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_10540 3430 5487 gene locus_tag LOCUS_10550 3430 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5521 6699 gene locus_tag LOCUS_10560 5521 6699 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_10560 6726 7925 gene locus_tag LOCUS_10570 6726 7925 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_10570 8077 8153 gene locus_tag LOCUS_t00030 8077 8153 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8234 10189 gene locus_tag LOCUS_10580 gene thrS 8234 10189 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393260.1 protein_id gnl|my_center|LOCUS_10580 10312 10836 gene locus_tag LOCUS_10590 gene infC 10312 10836 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_10590 10932 11126 gene locus_tag LOCUS_10600 gene rpmI 10932 11126 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_10600 11299 11736 gene locus_tag LOCUS_10610 11299 11736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 11915 12997 gene locus_tag LOCUS_10620 gene pheS 11915 12997 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939804.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence066 1761 613 gene locus_tag LOCUS_10630 1761 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 2018 1782 gene locus_tag LOCUS_10640 2018 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3198 2071 gene locus_tag LOCUS_10650 3198 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4426 3206 gene locus_tag LOCUS_10660 4426 3206 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125903.1 protein_id gnl|my_center|LOCUS_10660 4609 5817 gene locus_tag LOCUS_10670 4609 5817 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_10670 5814 6902 gene locus_tag LOCUS_10680 5814 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 7764 6958 gene locus_tag LOCUS_10690 7764 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 7993 8760 gene locus_tag LOCUS_10700 7993 8760 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_10700 8838 9158 gene locus_tag LOCUS_10710 8838 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 9172 9696 gene locus_tag LOCUS_10720 9172 9696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 9693 9992 gene locus_tag LOCUS_10730 9693 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 10116 11324 gene locus_tag LOCUS_10740 10116 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 12377 11334 gene locus_tag LOCUS_10750 12377 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 12568 12960 gene locus_tag LOCUS_10760 12568 12960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence067 254 523 gene locus_tag LOCUS_10770 254 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 436 2583 gene locus_tag LOCUS_10780 436 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2622 2831 gene locus_tag LOCUS_10790 2622 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 2828 3160 gene locus_tag LOCUS_10800 2828 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4172 3444 gene locus_tag LOCUS_10810 4172 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 5998 4199 gene locus_tag LOCUS_10820 5998 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 7094 6237 gene locus_tag LOCUS_10830 7094 6237 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339510.1 protein_id gnl|my_center|LOCUS_10830 9986 7119 gene locus_tag LOCUS_10840 gene ppdK 9986 7119 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_10840 12186 9997 gene locus_tag LOCUS_10850 gene glyS 12186 9997 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_10850 <12999 12325 gene locus_tag LOCUS_10860 <12999 12325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903526.1:glycine--tRNA ligase subunit alpha >Feature sequence068 1496 1101 gene locus_tag LOCUS_10870 1496 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 2206 1526 gene locus_tag LOCUS_10880 2206 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2325 5303 gene locus_tag LOCUS_10890 gene uvrA 2325 5303 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408092.1 protein_id gnl|my_center|LOCUS_10890 5322 6533 gene locus_tag LOCUS_10900 5322 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 6530 7207 gene locus_tag LOCUS_10910 6530 7207 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966252.1 protein_id gnl|my_center|LOCUS_10910 8294 7122 gene locus_tag LOCUS_10920 8294 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 8686 8291 gene locus_tag LOCUS_10930 8686 8291 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_10930 8750 9289 gene locus_tag LOCUS_10940 gene efp 8750 9289 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564662.1 protein_id gnl|my_center|LOCUS_10940 10125 9733 gene locus_tag LOCUS_10950 10125 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 10192 10743 gene locus_tag LOCUS_10960 10192 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 10935 10702 gene locus_tag LOCUS_10970 10935 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 11534 10932 gene locus_tag LOCUS_10980 11534 10932 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064451.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence069 1349 84 gene locus_tag LOCUS_10990 1349 84 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 protein_id gnl|my_center|LOCUS_10990 1917 1432 gene locus_tag LOCUS_11000 1917 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 4663 2207 gene locus_tag LOCUS_11010 4663 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 5246 4650 gene locus_tag LOCUS_11020 5246 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 5443 8355 gene locus_tag LOCUS_11030 5443 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 8471 8839 gene locus_tag LOCUS_11040 8471 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 8875 9558 gene locus_tag LOCUS_11050 8875 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 9840 9499 gene locus_tag LOCUS_11060 9840 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 10477 10286 gene locus_tag LOCUS_11070 10477 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 10727 11104 gene locus_tag LOCUS_11080 10727 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 11101 11505 gene locus_tag LOCUS_11090 11101 11505 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143863.1 protein_id gnl|my_center|LOCUS_11090 12151 11618 gene locus_tag LOCUS_11100 12151 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 12579 12151 gene locus_tag LOCUS_11110 12579 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence070 1259 336 gene locus_tag LOCUS_11120 gene ftsY 1259 336 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_11120 2264 1263 gene locus_tag LOCUS_11130 2264 1263 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_11130 2839 2261 gene locus_tag LOCUS_11140 gene plsY 2839 2261 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256563.1 protein_id gnl|my_center|LOCUS_11140 3414 2839 gene locus_tag LOCUS_11150 gene thpR 3414 2839 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256208.1 protein_id gnl|my_center|LOCUS_11150 4685 3414 gene locus_tag LOCUS_11160 4685 3414 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_11160 5149 4682 gene locus_tag LOCUS_11170 5149 4682 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940818.1 protein_id gnl|my_center|LOCUS_11170 5610 5146 gene locus_tag LOCUS_11180 5610 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6863 6033 gene locus_tag LOCUS_11190 6863 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 6908 7798 gene locus_tag LOCUS_11200 gene ftcD 6908 7798 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_11200 9206 7818 gene locus_tag LOCUS_11210 9206 7818 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_11210 11751 9448 gene locus_tag LOCUS_11220 11751 9448 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_11220 12280 11816 gene locus_tag LOCUS_11230 gene nrdR 12280 11816 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_11230 12867 12277 gene locus_tag LOCUS_11240 12867 12277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence071 367 2034 gene locus_tag LOCUS_11250 367 2034 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869035.1 protein_id gnl|my_center|LOCUS_11250 3043 2087 gene locus_tag LOCUS_11260 3043 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 4268 3054 gene locus_tag LOCUS_11270 4268 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 5362 4256 gene locus_tag LOCUS_11280 gene waaF 5362 4256 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_11280 5611 5441 gene locus_tag LOCUS_11290 5611 5441 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942897.1 protein_id gnl|my_center|LOCUS_11290 5756 7285 gene locus_tag LOCUS_11300 5756 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 7285 8067 gene locus_tag LOCUS_11310 7285 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 8070 8999 gene locus_tag LOCUS_11320 gene ispE 8070 8999 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_11320 9107 9181 gene locus_tag LOCUS_t00040 9107 9181 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9303 10250 gene locus_tag LOCUS_11330 9303 10250 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_11330 10348 11013 gene locus_tag LOCUS_11340 10348 11013 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546254.1 protein_id gnl|my_center|LOCUS_11340 11128 11703 gene locus_tag LOCUS_11350 gene pth 11128 11703 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_11350 11827 12276 gene locus_tag LOCUS_11360 11827 12276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 12273 12575 gene locus_tag LOCUS_11370 12273 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence072 184 1113 gene locus_tag LOCUS_11380 184 1113 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048169.1 protein_id gnl|my_center|LOCUS_11380 1106 2116 gene locus_tag LOCUS_11390 1106 2116 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031134.1 protein_id gnl|my_center|LOCUS_11390 3528 2302 gene locus_tag LOCUS_11400 3528 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3576 4976 gene locus_tag LOCUS_11410 3576 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 6444 5005 gene locus_tag LOCUS_11420 6444 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 7886 6444 gene locus_tag LOCUS_11430 7886 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11430 11508 7915 gene locus_tag LOCUS_11440 11508 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence073 1950 529 gene locus_tag LOCUS_11450 1950 529 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107494.1 protein_id gnl|my_center|LOCUS_11450 4374 1969 gene locus_tag LOCUS_11460 4374 1969 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_11460 5216 4470 gene locus_tag LOCUS_11470 5216 4470 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_11470 6552 5293 gene locus_tag LOCUS_11480 6552 5293 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928727.1 protein_id gnl|my_center|LOCUS_11480 6869 7609 gene locus_tag LOCUS_11490 6869 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 7678 9228 gene locus_tag LOCUS_11500 7678 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 9232 11106 gene locus_tag LOCUS_11510 gene treZ 9232 11106 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389950.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence074 2 502 gene locus_tag LOCUS_11520 2 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 514 681 gene locus_tag LOCUS_11530 514 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 683 1477 gene locus_tag LOCUS_11540 683 1477 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_11540 1520 2653 gene locus_tag LOCUS_11550 gene amrS 1520 2653 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 protein_id gnl|my_center|LOCUS_11550 2650 3036 gene locus_tag LOCUS_11560 2650 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 3066 3875 gene locus_tag LOCUS_11570 3066 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 5837 3960 gene locus_tag LOCUS_11580 gene ftsH 5837 3960 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_11580 8456 5838 gene locus_tag LOCUS_11590 gene clpB 8456 5838 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_11590 9464 8460 gene locus_tag LOCUS_11600 9464 8460 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256215.1 protein_id gnl|my_center|LOCUS_11600 9799 9464 gene locus_tag LOCUS_11610 9799 9464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 9898 10635 gene locus_tag LOCUS_11620 9898 10635 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140629.1 protein_id gnl|my_center|LOCUS_11620 12553 10739 gene locus_tag LOCUS_11630 12553 10739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence075 <1 2156 gene locus_tag LOCUS_11640 <1 2156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943758.1:isoleucine--tRNA ligase 2153 2734 gene locus_tag LOCUS_11650 gene lspA 2153 2734 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_11650 2715 3524 gene locus_tag LOCUS_11660 gene lgt 2715 3524 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_11660 3527 4480 gene locus_tag LOCUS_11670 3527 4480 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_11670 4477 5001 gene locus_tag LOCUS_11680 4477 5001 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869771.1 protein_id gnl|my_center|LOCUS_11680 7538 5094 gene locus_tag LOCUS_11690 gene lon 7538 5094 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_11690 8160 7705 gene locus_tag LOCUS_11700 gene dksA 8160 7705 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_11700 8517 8726 gene locus_tag LOCUS_11710 gene rpmB 8517 8726 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_11710 8729 9109 gene locus_tag LOCUS_11720 8729 9109 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_11720 11274 9124 gene locus_tag LOCUS_11730 11274 9124 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_11730 11440 12390 gene locus_tag LOCUS_11740 11440 12390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence076 699 208 gene locus_tag LOCUS_11750 699 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1569 700 gene locus_tag LOCUS_11760 1569 700 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909297.1 protein_id gnl|my_center|LOCUS_11760 2123 1566 gene locus_tag LOCUS_11770 2123 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4023 2128 gene locus_tag LOCUS_11780 4023 2128 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894103.1 protein_id gnl|my_center|LOCUS_11780 4368 4108 gene locus_tag LOCUS_11790 4368 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 4685 4377 gene locus_tag LOCUS_11800 4685 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4981 4682 gene locus_tag LOCUS_11810 4981 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 5301 4978 gene locus_tag LOCUS_11820 5301 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 5591 5298 gene locus_tag LOCUS_11830 5591 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 6922 5591 gene locus_tag LOCUS_11840 6922 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 8014 6932 gene locus_tag LOCUS_11850 gene hypE 8014 6932 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_11850 9125 8004 gene locus_tag LOCUS_11860 gene hypD 9125 8004 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_11860 9403 9122 gene locus_tag LOCUS_11870 9403 9122 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_11870 11752 9437 gene locus_tag LOCUS_11880 gene hypF 11752 9437 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_11880 12313 11810 gene locus_tag LOCUS_11890 12313 11810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 12429 12719 gene locus_tag LOCUS_11900 12429 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence077 259 1341 gene locus_tag LOCUS_11910 259 1341 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731184.1 protein_id gnl|my_center|LOCUS_11910 1338 2735 gene locus_tag LOCUS_11920 gene pyk 1338 2735 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_11920 2732 3895 gene locus_tag LOCUS_11930 2732 3895 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811106.1 protein_id gnl|my_center|LOCUS_11930 3916 5031 gene locus_tag LOCUS_11940 3916 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5506 5066 gene locus_tag LOCUS_11950 5506 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 5545 6402 gene locus_tag LOCUS_11960 5545 6402 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139985.1 protein_id gnl|my_center|LOCUS_11960 6407 6886 gene locus_tag LOCUS_11970 6407 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 8096 6903 gene locus_tag LOCUS_11980 8096 6903 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_11980 8592 8104 gene locus_tag LOCUS_11990 8592 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 9954 8743 gene locus_tag LOCUS_12000 9954 8743 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_12000 10325 10855 gene locus_tag LOCUS_12010 10325 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence078 859 2265 gene locus_tag LOCUS_12020 859 2265 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537499.1 protein_id gnl|my_center|LOCUS_12020 2262 4004 gene locus_tag LOCUS_12030 2262 4004 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810002.1 protein_id gnl|my_center|LOCUS_12030 4195 4428 gene locus_tag LOCUS_12040 4195 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4812 4513 gene locus_tag LOCUS_12050 4812 4513 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_12050 5065 5415 gene locus_tag LOCUS_12060 gene queF 5065 5415 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_12060 5399 5686 gene locus_tag LOCUS_12070 5399 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 6560 5892 gene locus_tag LOCUS_12080 6560 5892 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206353.1 protein_id gnl|my_center|LOCUS_12080 7888 6557 gene locus_tag LOCUS_12090 7888 6557 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_12090 8895 7975 gene locus_tag LOCUS_12100 8895 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 9871 8897 gene locus_tag LOCUS_12110 9871 8897 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939400.1 protein_id gnl|my_center|LOCUS_12110 11214 9871 gene locus_tag LOCUS_12120 11214 9871 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537977.1 protein_id gnl|my_center|LOCUS_12120 12405 11230 gene locus_tag LOCUS_12130 12405 11230 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926861.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence079 364 89 gene locus_tag LOCUS_12140 364 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 471 1031 gene locus_tag LOCUS_12150 471 1031 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_12150 1086 1499 gene locus_tag LOCUS_12160 1086 1499 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_12160 1503 3974 gene locus_tag LOCUS_12170 1503 3974 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_12170 3952 4596 gene locus_tag LOCUS_12180 3952 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 4593 5801 gene locus_tag LOCUS_12190 4593 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 5816 6514 gene locus_tag LOCUS_12200 5816 6514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_12200 6511 7191 gene locus_tag LOCUS_12210 6511 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 7195 7851 gene locus_tag LOCUS_12220 gene ccsA 7195 7851 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_12220 7884 8156 gene locus_tag LOCUS_12230 7884 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 8153 8308 gene locus_tag LOCUS_12240 8153 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 9061 8315 gene locus_tag LOCUS_12250 9061 8315 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_12250 9585 9049 gene locus_tag LOCUS_12260 9585 9049 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056726.1 protein_id gnl|my_center|LOCUS_12260 10935 9625 gene locus_tag LOCUS_12270 gene aroA 10935 9625 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664630.1 protein_id gnl|my_center|LOCUS_12270 10832 11071 gene locus_tag LOCUS_12280 10832 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 11071 11508 gene locus_tag LOCUS_12290 11071 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 11501 12331 gene locus_tag LOCUS_12300 11501 12331 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence080 1477 974 gene locus_tag LOCUS_12310 gene coaD 1477 974 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_12310 2009 1470 gene locus_tag LOCUS_12320 gene rsmD 2009 1470 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910569.1 protein_id gnl|my_center|LOCUS_12320 4190 2031 gene locus_tag LOCUS_12330 gene recG 4190 2031 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_12330 4855 4256 gene locus_tag LOCUS_12340 4855 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 5407 4868 gene locus_tag LOCUS_12350 5407 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 6062 5418 gene locus_tag LOCUS_12360 6062 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 6627 6046 gene locus_tag LOCUS_12370 gene rpoE 6627 6046 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_12370 6729 7331 gene locus_tag LOCUS_12380 gene lexA 6729 7331 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_12380 7335 7646 gene locus_tag LOCUS_12390 7335 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 7684 8229 gene locus_tag LOCUS_12400 7684 8229 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256305.1 protein_id gnl|my_center|LOCUS_12400 8226 8558 gene locus_tag LOCUS_12410 8226 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 8555 9370 gene locus_tag LOCUS_12420 8555 9370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 9476 10453 gene locus_tag LOCUS_12430 9476 10453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 10450 10848 gene locus_tag LOCUS_12440 10450 10848 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_12440 10880 11431 gene locus_tag LOCUS_12450 10880 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12450 11428 11667 gene locus_tag LOCUS_12460 11428 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence081 1603 779 gene locus_tag LOCUS_12470 gene panB 1603 779 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_12470 2867 1635 gene locus_tag LOCUS_12480 2867 1635 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061914.1 protein_id gnl|my_center|LOCUS_12480 3370 2864 gene locus_tag LOCUS_12490 3370 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 4664 3378 gene locus_tag LOCUS_12500 4664 3378 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083760.1 protein_id gnl|my_center|LOCUS_12500 4775 5092 gene locus_tag LOCUS_12510 4775 5092 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209968.1 protein_id gnl|my_center|LOCUS_12510 5766 5095 gene locus_tag LOCUS_12520 5766 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 6869 5757 gene locus_tag LOCUS_12530 6869 5757 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086624.1 protein_id gnl|my_center|LOCUS_12530 7934 6897 gene locus_tag LOCUS_12540 7934 6897 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_12540 8013 9008 gene locus_tag LOCUS_12550 8013 9008 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038796.1 protein_id gnl|my_center|LOCUS_12550 9333 8998 gene locus_tag LOCUS_12560 9333 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 10198 9338 gene locus_tag LOCUS_12570 gene yfaU 10198 9338 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992981.1 protein_id gnl|my_center|LOCUS_12570 <12483 10232 gene locus_tag LOCUS_12580 <12483 10232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072714630.1:carbohydrate-binding family 9-like protein >Feature sequence082 1050 379 gene locus_tag LOCUS_12590 1050 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2867 1209 gene locus_tag LOCUS_12600 2867 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 4648 2861 gene locus_tag LOCUS_12610 4648 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5863 4661 gene locus_tag LOCUS_12620 gene solA 5863 4661 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_12620 6332 6024 gene locus_tag LOCUS_12630 6332 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 8335 6335 gene locus_tag LOCUS_12640 8335 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12640 8935 8420 gene locus_tag LOCUS_12650 8935 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12650 9660 8932 gene locus_tag LOCUS_12660 9660 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 10384 9779 gene locus_tag LOCUS_12670 10384 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 10776 10516 gene locus_tag LOCUS_12680 10776 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 11374 12390 gene locus_tag LOCUS_12690 11374 12390 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence083 2948 1377 gene locus_tag LOCUS_12700 2948 1377 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_12700 5585 2949 gene locus_tag LOCUS_12710 gene mutS 5585 2949 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_12710 5666 6370 gene locus_tag LOCUS_12720 gene tsaB 5666 6370 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_12720 6367 6831 gene locus_tag LOCUS_12730 gene rimI 6367 6831 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367190.1 protein_id gnl|my_center|LOCUS_12730 6933 7184 gene locus_tag LOCUS_12740 6933 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 7289 7927 gene locus_tag LOCUS_12750 7289 7927 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532543.1 protein_id gnl|my_center|LOCUS_12750 7917 8699 gene locus_tag LOCUS_12760 gene pssA 7917 8699 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770492.1 protein_id gnl|my_center|LOCUS_12760 <12373 8716 gene locus_tag LOCUS_12770 <12373 8716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838293.1:ATP-binding protein >Feature sequence084 355 606 gene locus_tag LOCUS_12780 355 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 599 2017 gene locus_tag LOCUS_12790 gene lpdA 599 2017 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258694.1 protein_id gnl|my_center|LOCUS_12790 2057 3175 gene locus_tag LOCUS_12800 2057 3175 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_12800 3294 4268 gene locus_tag LOCUS_12810 3294 4268 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_12810 4429 5790 gene locus_tag LOCUS_12820 4429 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 5813 6451 gene locus_tag LOCUS_12830 gene lipB 5813 6451 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_12830 6604 7218 gene locus_tag LOCUS_12840 6604 7218 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532428.1 protein_id gnl|my_center|LOCUS_12840 8054 7224 gene locus_tag LOCUS_12850 gene mdh 8054 7224 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461218.1 protein_id gnl|my_center|LOCUS_12850 8229 8065 gene locus_tag LOCUS_12860 8229 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 8183 8779 gene locus_tag LOCUS_12870 8183 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 9358 8792 gene locus_tag LOCUS_12880 9358 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 9682 9873 gene locus_tag LOCUS_12890 9682 9873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence085 521 6 gene locus_tag LOCUS_12900 521 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 433 630 gene locus_tag LOCUS_12910 433 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2239 1085 gene locus_tag LOCUS_12920 2239 1085 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_12920 2739 2236 gene locus_tag LOCUS_12930 2739 2236 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_12930 5331 2761 gene locus_tag LOCUS_12940 5331 2761 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_12940 6480 5374 gene locus_tag LOCUS_12950 6480 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 8141 6510 gene locus_tag LOCUS_12960 8141 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403737.1 protein_id gnl|my_center|LOCUS_12960 9555 8146 gene locus_tag LOCUS_12970 9555 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 9494 11968 gene locus_tag LOCUS_12980 9494 11968 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839420.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence086 1489 113 gene locus_tag LOCUS_12990 gene lysC 1489 113 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_12990 2544 1486 gene locus_tag LOCUS_13000 gene asd 2544 1486 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_13000 4953 2878 gene locus_tag LOCUS_13010 4953 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 5032 6198 gene locus_tag LOCUS_13020 5032 6198 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_13020 6762 6238 gene locus_tag LOCUS_13030 6762 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 7980 6841 gene locus_tag LOCUS_13040 7980 6841 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_13040 8632 8147 gene locus_tag LOCUS_13050 8632 8147 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256622.1 protein_id gnl|my_center|LOCUS_13050 9071 8712 gene locus_tag LOCUS_13060 9071 8712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 10995 9205 gene locus_tag LOCUS_13070 10995 9205 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_13070 11196 11483 gene locus_tag LOCUS_13080 11196 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence087 1088 132 gene locus_tag LOCUS_13090 1088 132 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_13090 1233 1868 gene locus_tag LOCUS_13100 1233 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2277 1852 gene locus_tag LOCUS_13110 2277 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 2739 2551 gene locus_tag LOCUS_13120 2739 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 3336 2827 gene locus_tag LOCUS_13130 3336 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 3780 3436 gene locus_tag LOCUS_13140 3780 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4422 4742 gene locus_tag LOCUS_13150 4422 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 4800 7043 gene locus_tag LOCUS_13160 4800 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 7286 8062 gene locus_tag LOCUS_13170 7286 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 8376 9086 gene locus_tag LOCUS_13180 8376 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 9098 9226 gene locus_tag LOCUS_13190 9098 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 11868 9223 gene locus_tag LOCUS_13200 11868 9223 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890690.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence088 3565 548 gene locus_tag LOCUS_13210 3565 548 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144060.1 protein_id gnl|my_center|LOCUS_13210 3680 4006 gene locus_tag LOCUS_13220 3680 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4495 4037 gene locus_tag LOCUS_13230 4495 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 5022 4603 gene locus_tag LOCUS_13240 5022 4603 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944109.1 protein_id gnl|my_center|LOCUS_13240 5560 5120 gene locus_tag LOCUS_13250 5560 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 5945 5616 gene locus_tag LOCUS_13260 5945 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 6703 5942 gene locus_tag LOCUS_13270 6703 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 7887 6784 gene locus_tag LOCUS_13280 7887 6784 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 protein_id gnl|my_center|LOCUS_13280 8144 7884 gene locus_tag LOCUS_13290 8144 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 8695 8141 gene locus_tag LOCUS_13300 8695 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 9404 8682 gene locus_tag LOCUS_13310 9404 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 10263 9394 gene locus_tag LOCUS_13320 10263 9394 CDS product amino acid--[acyl-carrier-protein] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083778.1 protein_id gnl|my_center|LOCUS_13320 10480 10226 gene locus_tag LOCUS_13330 10480 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 11574 10477 gene locus_tag LOCUS_13340 11574 10477 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036621.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence089 1483 620 gene locus_tag LOCUS_13350 1483 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 2598 1480 gene locus_tag LOCUS_13360 2598 1480 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_13360 4935 2674 gene locus_tag LOCUS_13370 gene vpsO 4935 2674 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_13370 5748 4945 gene locus_tag LOCUS_13380 5748 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 6941 5778 gene locus_tag LOCUS_13390 6941 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 7545 7096 gene locus_tag LOCUS_13400 7545 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 9054 7669 gene locus_tag LOCUS_13410 9054 7669 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531496.1 protein_id gnl|my_center|LOCUS_13410 9614 9051 gene locus_tag LOCUS_13420 9614 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 9972 11393 gene locus_tag LOCUS_13430 9972 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 11718 11422 gene locus_tag LOCUS_13440 11718 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence090 307 969 gene locus_tag LOCUS_13450 307 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1000 1614 gene locus_tag LOCUS_13460 1000 1614 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975842.1 protein_id gnl|my_center|LOCUS_13460 1611 3704 gene locus_tag LOCUS_13470 1611 3704 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258859.1 protein_id gnl|my_center|LOCUS_13470 3701 4687 gene locus_tag LOCUS_13480 3701 4687 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268938.1 protein_id gnl|my_center|LOCUS_13480 4700 4984 gene locus_tag LOCUS_13490 4700 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 5061 6287 gene locus_tag LOCUS_13500 5061 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 6338 9388 gene locus_tag LOCUS_13510 6338 9388 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_13510 10249 9434 gene locus_tag LOCUS_13520 10249 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 11641 10250 gene locus_tag LOCUS_13530 11641 10250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence091 3373 734 gene locus_tag LOCUS_13540 gene valS 3373 734 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_13540 4313 3393 gene locus_tag LOCUS_13550 4313 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4355 6268 gene locus_tag LOCUS_13560 4355 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 6677 6270 gene locus_tag LOCUS_13570 6677 6270 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_13570 8360 6693 gene locus_tag LOCUS_13580 8360 6693 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_13580 10172 8412 gene locus_tag LOCUS_13590 10172 8412 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_13590 10334 11626 gene locus_tag LOCUS_13600 gene gdhA 10334 11626 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence092 369 1592 gene locus_tag LOCUS_13610 369 1592 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_13610 1802 2071 gene locus_tag LOCUS_13620 1802 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 3560 2541 gene locus_tag LOCUS_13630 3560 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 4219 3620 gene locus_tag LOCUS_13640 4219 3620 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295401.1 protein_id gnl|my_center|LOCUS_13640 4856 4323 gene locus_tag LOCUS_13650 4856 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 5371 4829 gene locus_tag LOCUS_13660 5371 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 6613 5453 gene locus_tag LOCUS_13670 gene nadA 6613 5453 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804025.1 protein_id gnl|my_center|LOCUS_13670 7843 6680 gene locus_tag LOCUS_13680 gene mqnE 7843 6680 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_13680 8340 7840 gene locus_tag LOCUS_13690 8340 7840 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876409.1 protein_id gnl|my_center|LOCUS_13690 8694 10919 gene locus_tag LOCUS_13700 8694 10919 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence093 2325 586 gene locus_tag LOCUS_13710 2325 586 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 protein_id gnl|my_center|LOCUS_13710 2646 4292 gene locus_tag LOCUS_13720 2646 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 4326 5009 gene locus_tag LOCUS_13730 4326 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 5032 6198 gene locus_tag LOCUS_13740 5032 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 6198 7253 gene locus_tag LOCUS_13750 6198 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 7281 8486 gene locus_tag LOCUS_13760 7281 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 8508 9761 gene locus_tag LOCUS_13770 8508 9761 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_13770 9999 9805 gene locus_tag LOCUS_13780 9999 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 10733 9939 gene locus_tag LOCUS_13790 10733 9939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13790 >Feature sequence094 68 937 gene locus_tag LOCUS_13800 68 937 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_13800 942 1115 gene locus_tag LOCUS_13810 942 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1385 1164 gene locus_tag LOCUS_13820 1385 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1953 1402 gene locus_tag LOCUS_13830 1953 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 2491 1964 gene locus_tag LOCUS_13840 2491 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 3309 2764 gene locus_tag LOCUS_13850 3309 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 3642 6779 gene locus_tag LOCUS_13860 3642 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 6828 7088 gene locus_tag LOCUS_13870 6828 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 7190 7699 gene locus_tag LOCUS_13880 7190 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 8051 7791 gene locus_tag LOCUS_13890 8051 7791 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_13890 8457 8104 gene locus_tag LOCUS_13900 8457 8104 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440098.1 protein_id gnl|my_center|LOCUS_13900 8504 9745 gene locus_tag LOCUS_13910 8504 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 9770 10618 gene locus_tag LOCUS_13920 9770 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 10612 10953 gene locus_tag LOCUS_13930 10612 10953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence095 <1 1116 gene locus_tag LOCUS_13940 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_123042767.1:M1 family metallopeptidase 1172 2143 gene locus_tag LOCUS_13950 1172 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2166 3200 gene locus_tag LOCUS_13960 2166 3200 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337813.1 protein_id gnl|my_center|LOCUS_13960 3228 3995 gene locus_tag LOCUS_13970 gene nadE 3228 3995 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808614.1 protein_id gnl|my_center|LOCUS_13970 6571 4019 gene locus_tag LOCUS_13980 6571 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 6621 10364 gene locus_tag LOCUS_13990 6621 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 <11659 10384 gene locus_tag LOCUS_14000 <11659 10384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016769.1:gamma-glutamyltransferase >Feature sequence096 319 1431 gene locus_tag LOCUS_14010 319 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1428 2213 gene locus_tag LOCUS_14020 1428 2213 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14020 4296 2311 gene locus_tag LOCUS_14030 4296 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4682 4293 gene locus_tag LOCUS_14040 4682 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 5922 4771 gene locus_tag LOCUS_14050 5922 4771 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226295.1 protein_id gnl|my_center|LOCUS_14050 6693 5938 gene locus_tag LOCUS_14060 6693 5938 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_14060 7787 6681 gene locus_tag LOCUS_14070 7787 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 10424 7971 gene locus_tag LOCUS_14080 10424 7971 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928775.1 protein_id gnl|my_center|LOCUS_14080 10810 10412 gene locus_tag LOCUS_14090 10810 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 10854 11222 gene locus_tag LOCUS_14100 10854 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence097 120 302 gene locus_tag LOCUS_14110 120 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 777 274 gene locus_tag LOCUS_14120 777 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14120 1127 735 gene locus_tag LOCUS_14130 1127 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14130 1777 1346 gene locus_tag LOCUS_14140 1777 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2691 1936 gene locus_tag LOCUS_14150 2691 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3039 5111 gene locus_tag LOCUS_14160 3039 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 5255 5596 gene locus_tag LOCUS_14170 5255 5596 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_14170 5617 8280 gene locus_tag LOCUS_14180 5617 8280 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_14180 8381 9178 gene locus_tag LOCUS_14190 gene mutM 8381 9178 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083585.1 protein_id gnl|my_center|LOCUS_14190 10052 9270 gene locus_tag LOCUS_14200 10052 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084123.1 protein_id gnl|my_center|LOCUS_14200 10636 10100 gene locus_tag LOCUS_14210 10636 10100 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_14210 11153 10659 gene locus_tag LOCUS_14220 11153 10659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence098 1194 2528 gene locus_tag LOCUS_14230 gene glpT 1194 2528 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705541.1 protein_id gnl|my_center|LOCUS_14230 2566 3339 gene locus_tag LOCUS_14240 2566 3339 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062236.1 protein_id gnl|my_center|LOCUS_14240 3355 3831 gene locus_tag LOCUS_14250 3355 3831 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888279.1 protein_id gnl|my_center|LOCUS_14250 3798 6488 gene locus_tag LOCUS_14260 3798 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 8484 6670 gene locus_tag LOCUS_14270 8484 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14270 9183 9887 gene locus_tag LOCUS_14280 9183 9887 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_14280 10915 9935 gene locus_tag LOCUS_14290 10915 9935 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence099 2772 2431 gene locus_tag LOCUS_14300 2772 2431 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356630.1 protein_id gnl|my_center|LOCUS_14300 2879 3307 gene locus_tag LOCUS_14310 2879 3307 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923583.1 protein_id gnl|my_center|LOCUS_14310 3974 3471 gene locus_tag LOCUS_14320 3974 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 4069 6567 gene locus_tag LOCUS_14330 4069 6567 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_14330 6640 7902 gene locus_tag LOCUS_14340 6640 7902 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530809.1 protein_id gnl|my_center|LOCUS_14340 7896 8330 gene locus_tag LOCUS_14350 7896 8330 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530810.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence100 <1 1512 gene locus_tag LOCUS_14360 <1 1512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938893.1:ATP-dependent Clp protease ATP-binding subunit ClpA 1750 2334 gene locus_tag LOCUS_14370 1750 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 3319 2363 gene locus_tag LOCUS_14380 3319 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14380 4881 3274 gene locus_tag LOCUS_14390 4881 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14390 5382 5044 gene locus_tag LOCUS_14400 5382 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 6075 5479 gene locus_tag LOCUS_14410 6075 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 9491 6216 gene locus_tag LOCUS_14420 9491 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 9606 10964 gene locus_tag LOCUS_14430 9606 10964 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence101 610 1404 gene locus_tag LOCUS_14440 610 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1417 1770 gene locus_tag LOCUS_14450 1417 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1864 3183 gene locus_tag LOCUS_14460 1864 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 4750 3113 gene locus_tag LOCUS_14470 4750 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 6474 4747 gene locus_tag LOCUS_14480 6474 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 7253 6471 gene locus_tag LOCUS_14490 7253 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 7912 7250 gene locus_tag LOCUS_14500 7912 7250 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_14500 7923 8279 gene locus_tag LOCUS_14510 7923 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 8269 9870 gene locus_tag LOCUS_14520 gene glpD 8269 9870 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_14520 <11038 9824 gene locus_tag LOCUS_14530 <11038 9824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532773.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence102 3266 1578 gene locus_tag LOCUS_14540 3266 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 4791 3253 gene locus_tag LOCUS_14550 4791 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 5863 4802 gene locus_tag LOCUS_14560 5863 4802 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141179.1 protein_id gnl|my_center|LOCUS_14560 6052 6672 gene locus_tag LOCUS_14570 6052 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 6920 7714 gene locus_tag LOCUS_14580 6920 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 8553 7858 gene locus_tag LOCUS_14590 8553 7858 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897698.1 protein_id gnl|my_center|LOCUS_14590 10378 8597 gene locus_tag LOCUS_14600 10378 8597 CDS product peroxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094611.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence103 <1 1827 gene locus_tag LOCUS_14610 <1 1827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256905.1:molybdopterin oxidoreductase family protein note possible pseudo, frameshifted 1832 2092 gene locus_tag LOCUS_14620 1832 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 2606 2394 gene locus_tag LOCUS_14630 2606 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 3635 2865 gene locus_tag LOCUS_14640 3635 2865 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013490.1 protein_id gnl|my_center|LOCUS_14640 3638 4372 gene locus_tag LOCUS_14650 3638 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 4533 5348 gene locus_tag LOCUS_14660 4533 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 5372 5740 gene locus_tag LOCUS_14670 5372 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 5730 6875 gene locus_tag LOCUS_14680 5730 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 6921 7346 gene locus_tag LOCUS_14690 6921 7346 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844771.1 protein_id gnl|my_center|LOCUS_14690 7684 9129 gene locus_tag LOCUS_14700 7684 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 9300 9779 gene locus_tag LOCUS_14710 9300 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 9882 10805 gene locus_tag LOCUS_14720 9882 10805 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence104 1977 1681 gene locus_tag LOCUS_14730 1977 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4432 1988 gene locus_tag LOCUS_14740 4432 1988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_14740 5984 5376 gene locus_tag LOCUS_14750 5984 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 6810 6343 gene locus_tag LOCUS_14760 6810 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 7001 6807 gene locus_tag LOCUS_14770 7001 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 7306 7653 gene locus_tag LOCUS_14780 7306 7653 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_14780 8268 8618 gene locus_tag LOCUS_14790 8268 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 9141 10034 gene locus_tag LOCUS_14800 9141 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 <10774 9965 gene locus_tag LOCUS_14810 <10774 9965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527044.1:tetratricopeptide repeat protein >Feature sequence105 201 1163 gene locus_tag LOCUS_14820 201 1163 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_14820 1156 2640 gene locus_tag LOCUS_14830 1156 2640 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444159.1 protein_id gnl|my_center|LOCUS_14830 2645 4564 gene locus_tag LOCUS_14840 2645 4564 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_14840 4571 6748 gene locus_tag LOCUS_14850 4571 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 7585 7950 gene locus_tag LOCUS_14860 7585 7950 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140688.1 protein_id gnl|my_center|LOCUS_14860 7947 10682 gene locus_tag LOCUS_14870 7947 10682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928775.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence106 26 313 gene locus_tag LOCUS_14880 26 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 473 862 gene locus_tag LOCUS_14890 473 862 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815599.1 protein_id gnl|my_center|LOCUS_14890 887 1984 gene locus_tag LOCUS_14900 887 1984 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_14900 1974 3530 gene locus_tag LOCUS_14910 1974 3530 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809014.1 protein_id gnl|my_center|LOCUS_14910 4402 3527 gene locus_tag LOCUS_14920 4402 3527 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902823.1 protein_id gnl|my_center|LOCUS_14920 4590 4399 gene locus_tag LOCUS_14930 4590 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 5990 4596 gene locus_tag LOCUS_14940 5990 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 6697 5987 gene locus_tag LOCUS_14950 6697 5987 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_14950 6846 8063 gene locus_tag LOCUS_14960 6846 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 8065 10116 gene locus_tag LOCUS_14970 8065 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 10201 10437 gene locus_tag LOCUS_14980 10201 10437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence107 298 657 gene locus_tag LOCUS_14990 298 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 632 901 gene locus_tag LOCUS_15000 632 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1962 1024 gene locus_tag LOCUS_15010 1962 1024 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_15010 3602 2028 gene locus_tag LOCUS_15020 gene iolD 3602 2028 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15020 3940 3596 gene locus_tag LOCUS_15030 3940 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15030 4089 7313 gene locus_tag LOCUS_15040 4089 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 7442 10720 gene locus_tag LOCUS_15050 7442 10720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence108 2854 536 gene locus_tag LOCUS_15060 2854 536 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838717.1 protein_id gnl|my_center|LOCUS_15060 2853 3035 gene locus_tag LOCUS_15070 2853 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3199 4839 gene locus_tag LOCUS_15080 3199 4839 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_15080 4904 5665 gene locus_tag LOCUS_15090 4904 5665 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_15090 5665 6765 gene locus_tag LOCUS_15100 5665 6765 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_15100 7328 6801 gene locus_tag LOCUS_15110 7328 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 8131 7259 gene locus_tag LOCUS_15120 8131 7259 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_15120 8790 8173 gene locus_tag LOCUS_15130 gene pyrE 8790 8173 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228883.1 protein_id gnl|my_center|LOCUS_15130 10161 8857 gene locus_tag LOCUS_15140 10161 8857 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_15140 <10696 10163 gene locus_tag LOCUS_15150 <10696 10163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087859.1:aspartate carbamoyltransferase catalytic subunit >Feature sequence109 561 1874 gene locus_tag LOCUS_15160 561 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1871 3142 gene locus_tag LOCUS_15170 1871 3142 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967298.1 protein_id gnl|my_center|LOCUS_15170 3160 3987 gene locus_tag LOCUS_15180 3160 3987 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042382595.1 protein_id gnl|my_center|LOCUS_15180 4393 4049 gene locus_tag LOCUS_15190 4393 4049 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942071.1 protein_id gnl|my_center|LOCUS_15190 5287 4430 gene locus_tag LOCUS_15200 gene prmC 5287 4430 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_15200 6363 5287 gene locus_tag LOCUS_15210 gene prfA 6363 5287 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_15210 6669 6424 gene locus_tag LOCUS_15220 gene moaD 6669 6424 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257741.1 protein_id gnl|my_center|LOCUS_15220 7154 6660 gene locus_tag LOCUS_15230 gene moaE 7154 6660 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531878.1 protein_id gnl|my_center|LOCUS_15230 7948 7160 gene locus_tag LOCUS_15240 gene thiD 7948 7160 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_15240 7968 8579 gene locus_tag LOCUS_15250 7968 8579 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_15250 10589 8640 gene locus_tag LOCUS_15260 10589 8640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence110 657 568 gene locus_tag LOCUS_t00050 657 568 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 948 1283 gene locus_tag LOCUS_15270 948 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1681 1385 gene locus_tag LOCUS_15280 1681 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3048 2113 gene locus_tag LOCUS_15290 3048 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3500 3264 gene locus_tag LOCUS_15300 3500 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4328 3780 gene locus_tag LOCUS_15310 4328 3780 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528603.1 protein_id gnl|my_center|LOCUS_15310 5736 4426 gene locus_tag LOCUS_15320 gene serS 5736 4426 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937547.1 protein_id gnl|my_center|LOCUS_15320 5786 6706 gene locus_tag LOCUS_15330 gene galU 5786 6706 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_15330 7165 6725 gene locus_tag LOCUS_15340 7165 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 8827 7169 gene locus_tag LOCUS_15350 8827 7169 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_15350 8826 9698 gene locus_tag LOCUS_15360 gene rsmI 8826 9698 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_15360 9802 10602 gene locus_tag LOCUS_15370 9802 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence111 <1 2585 gene locus_tag LOCUS_15380 <1 2585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015445472.1:AAA family ATPase 2582 5794 gene locus_tag LOCUS_15390 2582 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 5803 6624 gene locus_tag LOCUS_15400 5803 6624 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088098.1 protein_id gnl|my_center|LOCUS_15400 6707 7828 gene locus_tag LOCUS_15410 6707 7828 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484633.1 protein_id gnl|my_center|LOCUS_15410 7828 9141 gene locus_tag LOCUS_15420 7828 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 9138 9542 gene locus_tag LOCUS_15430 9138 9542 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265752.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence112 2255 486 gene locus_tag LOCUS_15440 2255 486 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_15440 4325 2355 gene locus_tag LOCUS_15450 4325 2355 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920498.1 protein_id gnl|my_center|LOCUS_15450 4755 4360 gene locus_tag LOCUS_15460 4755 4360 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_15460 5703 4828 gene locus_tag LOCUS_15470 5703 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 7304 5715 gene locus_tag LOCUS_15480 7304 5715 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_15480 7508 7840 gene locus_tag LOCUS_15490 7508 7840 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403946.1 protein_id gnl|my_center|LOCUS_15490 7837 8280 gene locus_tag LOCUS_15500 7837 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 8502 8257 gene locus_tag LOCUS_15510 8502 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 8685 8978 gene locus_tag LOCUS_15520 8685 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15520 9530 9009 gene locus_tag LOCUS_15530 9530 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence113 2497 1838 gene locus_tag LOCUS_15540 2497 1838 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_15540 2706 3605 gene locus_tag LOCUS_15550 2706 3605 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_15550 3607 4893 gene locus_tag LOCUS_15560 3607 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 4897 5835 gene locus_tag LOCUS_15570 gene speB 4897 5835 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_15570 5926 7794 gene locus_tag LOCUS_15580 5926 7794 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_15580 8152 10512 gene locus_tag LOCUS_15590 8152 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence114 2931 67 gene locus_tag LOCUS_15600 2931 67 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_15600 3234 6314 gene locus_tag LOCUS_15610 3234 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 6406 7347 gene locus_tag LOCUS_15620 6406 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919009.1 protein_id gnl|my_center|LOCUS_15620 7366 8970 gene locus_tag LOCUS_15630 7366 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 8967 9869 gene locus_tag LOCUS_15640 8967 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15640 >Feature sequence115 1197 478 gene locus_tag LOCUS_15650 1197 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2919 1207 gene locus_tag LOCUS_15660 2919 1207 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258022.1 protein_id gnl|my_center|LOCUS_15660 3448 3696 gene locus_tag LOCUS_15670 3448 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4641 3958 gene locus_tag LOCUS_15680 4641 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 4873 5157 gene locus_tag LOCUS_15690 4873 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 5154 5417 gene locus_tag LOCUS_15700 5154 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5616 6194 gene locus_tag LOCUS_15710 5616 6194 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971313.1 protein_id gnl|my_center|LOCUS_15710 6208 7482 gene locus_tag LOCUS_15720 6208 7482 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143163.1 protein_id gnl|my_center|LOCUS_15720 7914 7537 gene locus_tag LOCUS_15730 7914 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 8253 8071 gene locus_tag LOCUS_15740 8253 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 8412 8756 gene locus_tag LOCUS_15750 8412 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 10109 8664 gene locus_tag LOCUS_15760 10109 8664 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192100.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence116 <1 1003 gene locus_tag LOCUS_15770 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259290.1:N-acetyl-gamma-glutamyl-phosphate reductase 1033 1830 gene locus_tag LOCUS_15780 gene argB 1033 1830 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090823.1 protein_id gnl|my_center|LOCUS_15780 1805 3022 gene locus_tag LOCUS_15790 1805 3022 CDS product acetylornithine/succinylornithine family transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877594.1 protein_id gnl|my_center|LOCUS_15790 3019 3591 gene locus_tag LOCUS_15800 3019 3591 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938878.1 protein_id gnl|my_center|LOCUS_15800 3591 4805 gene locus_tag LOCUS_15810 gene argJ 3591 4805 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057748.1 protein_id gnl|my_center|LOCUS_15810 4966 5931 gene locus_tag LOCUS_15820 gene argF 4966 5931 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257452.1 protein_id gnl|my_center|LOCUS_15820 6027 7043 gene locus_tag LOCUS_15830 6027 7043 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_15830 9431 7080 gene locus_tag LOCUS_15840 9431 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence117 <1 894 gene locus_tag LOCUS_15850 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942207.1:PBP1A family penicillin-binding protein 1277 891 gene locus_tag LOCUS_15860 1277 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2098 1274 gene locus_tag LOCUS_15870 2098 1274 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_15870 6719 2091 gene locus_tag LOCUS_15880 6719 2091 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742098.1 protein_id gnl|my_center|LOCUS_15880 6763 7107 gene locus_tag LOCUS_15890 6763 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 9802 7232 gene locus_tag LOCUS_15900 9802 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence118 2589 664 gene locus_tag LOCUS_15910 gene dnaK 2589 664 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_15910 2899 4908 gene locus_tag LOCUS_15920 2899 4908 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943164.1 protein_id gnl|my_center|LOCUS_15920 4938 7193 gene locus_tag LOCUS_15930 4938 7193 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_15930 8405 7308 gene locus_tag LOCUS_15940 gene prfB 8405 7308 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_15940 9804 8488 gene locus_tag LOCUS_15950 gene lnt 9804 8488 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence119 2094 208 gene locus_tag LOCUS_15960 2094 208 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_15960 2311 3993 gene locus_tag LOCUS_15970 2311 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 4676 4101 gene locus_tag LOCUS_15980 gene efp 4676 4101 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545338.1 protein_id gnl|my_center|LOCUS_15980 5872 4796 gene locus_tag LOCUS_15990 5872 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15990 6288 5866 gene locus_tag LOCUS_16000 6288 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 6478 8937 gene locus_tag LOCUS_16010 6478 8937 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141271.1 protein_id gnl|my_center|LOCUS_16010 9942 8941 gene locus_tag LOCUS_16020 9942 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 <10456 9939 gene locus_tag LOCUS_16030 <10456 9939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006311298.1:response regulator transcription factor >Feature sequence120 527 1252 gene locus_tag LOCUS_16040 527 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2249 1842 gene locus_tag LOCUS_16050 2249 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3641 2265 gene locus_tag LOCUS_16060 3641 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 4666 4337 gene locus_tag LOCUS_16070 4666 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 5209 4763 gene locus_tag LOCUS_16080 5209 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 7462 5219 gene locus_tag LOCUS_16090 7462 5219 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_16090 7941 7459 gene locus_tag LOCUS_16100 7941 7459 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_16100 8319 9575 gene locus_tag LOCUS_16110 8319 9575 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence121 165 581 gene locus_tag LOCUS_16120 165 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 751 1251 gene locus_tag LOCUS_16130 751 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16130 1310 1672 gene locus_tag LOCUS_16140 1310 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16140 1923 1612 gene locus_tag LOCUS_16150 1923 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2328 2936 gene locus_tag LOCUS_16160 2328 2936 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395469.1 protein_id gnl|my_center|LOCUS_16160 3199 3486 gene locus_tag LOCUS_16170 3199 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3560 4108 gene locus_tag LOCUS_16180 3560 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 4674 4895 gene locus_tag LOCUS_16190 4674 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 4989 5300 gene locus_tag LOCUS_16200 4989 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 5333 5998 gene locus_tag LOCUS_16210 5333 5998 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_16210 6140 8014 gene locus_tag LOCUS_16220 6140 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 8055 9380 gene locus_tag LOCUS_16230 8055 9380 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103018905.1 protein_id gnl|my_center|LOCUS_16230 9471 9983 gene locus_tag LOCUS_16240 9471 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence122 955 65 gene locus_tag LOCUS_16250 gene mak 955 65 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704548.1 protein_id gnl|my_center|LOCUS_16250 3822 967 gene locus_tag LOCUS_16260 3822 967 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_16260 3932 6805 gene locus_tag LOCUS_16270 3932 6805 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840190.1 protein_id gnl|my_center|LOCUS_16270 6939 7325 gene locus_tag LOCUS_16280 6939 7325 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812348.1 protein_id gnl|my_center|LOCUS_16280 7351 7980 gene locus_tag LOCUS_16290 7351 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 8100 9053 gene locus_tag LOCUS_16300 gene eutC 8100 9053 CDS product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877122.1 protein_id gnl|my_center|LOCUS_16300 9362 10159 gene locus_tag LOCUS_16310 gene truA 9362 10159 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403435.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence123 765 3998 gene locus_tag LOCUS_16320 765 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3998 7936 gene locus_tag LOCUS_16330 3998 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 8433 8005 gene locus_tag LOCUS_16340 8433 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 8546 10099 gene locus_tag LOCUS_16350 8546 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence124 271 1884 gene locus_tag LOCUS_16360 271 1884 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_16360 2753 1947 gene locus_tag LOCUS_16370 2753 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 3667 2750 gene locus_tag LOCUS_16380 3667 2750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_16380 4927 3809 gene locus_tag LOCUS_16390 4927 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5426 4887 gene locus_tag LOCUS_16400 5426 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 5580 5807 gene locus_tag LOCUS_16410 5580 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 5804 6163 gene locus_tag LOCUS_16420 5804 6163 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388817.1 protein_id gnl|my_center|LOCUS_16420 6212 9385 gene locus_tag LOCUS_16430 6212 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_16430 <10326 9535 gene locus_tag LOCUS_16440 <10326 9535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943453.1:ABC transporter permease >Feature sequence125 29 994 gene locus_tag LOCUS_16450 29 994 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_16450 994 1854 gene locus_tag LOCUS_16460 994 1854 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_16460 1861 3108 gene locus_tag LOCUS_16470 1861 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3105 3809 gene locus_tag LOCUS_16480 3105 3809 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_16480 3806 5041 gene locus_tag LOCUS_16490 3806 5041 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_16490 5097 6065 gene locus_tag LOCUS_16500 5097 6065 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_16500 6062 7141 gene locus_tag LOCUS_16510 6062 7141 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017302733.1 protein_id gnl|my_center|LOCUS_16510 7145 9655 gene locus_tag LOCUS_16520 7145 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence126 335 1630 gene locus_tag LOCUS_16530 335 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 3605 1668 gene locus_tag LOCUS_16540 3605 1668 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928481.1 protein_id gnl|my_center|LOCUS_16540 3684 4619 gene locus_tag LOCUS_16550 3684 4619 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931825.1 protein_id gnl|my_center|LOCUS_16550 5969 4704 gene locus_tag LOCUS_16560 5969 4704 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_16560 7481 5979 gene locus_tag LOCUS_16570 7481 5979 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537701.1 protein_id gnl|my_center|LOCUS_16570 8804 7587 gene locus_tag LOCUS_16580 8804 7587 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037302.1 protein_id gnl|my_center|LOCUS_16580 8880 10031 gene locus_tag LOCUS_16590 8880 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence127 666 1454 gene locus_tag LOCUS_16600 666 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1712 3586 gene locus_tag LOCUS_16610 1712 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3597 5675 gene locus_tag LOCUS_16620 3597 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 6641 5739 gene locus_tag LOCUS_16630 6641 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 9737 6840 gene locus_tag LOCUS_16640 9737 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence128 1534 578 gene locus_tag LOCUS_16650 1534 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1642 2499 gene locus_tag LOCUS_16660 gene iolB 1642 2499 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640197.1 protein_id gnl|my_center|LOCUS_16660 3467 2532 gene locus_tag LOCUS_16670 3467 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 3536 4933 gene locus_tag LOCUS_16680 3536 4933 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_16680 4930 7230 gene locus_tag LOCUS_16690 4930 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 7227 8063 gene locus_tag LOCUS_16700 7227 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence129 493 161 gene locus_tag LOCUS_16710 493 161 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_16710 1870 611 gene locus_tag LOCUS_16720 1870 611 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143936.1 protein_id gnl|my_center|LOCUS_16720 2093 4561 gene locus_tag LOCUS_16730 2093 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 4698 5000 gene locus_tag LOCUS_16740 4698 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 5372 7822 gene locus_tag LOCUS_16750 5372 7822 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_16750 7895 8320 gene locus_tag LOCUS_16760 7895 8320 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143935.1 protein_id gnl|my_center|LOCUS_16760 9125 8388 gene locus_tag LOCUS_16770 9125 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 <10161 9167 gene locus_tag LOCUS_16780 <10161 9167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034349876.1:excinuclease ABC subunit UvrA >Feature sequence130 1562 618 gene locus_tag LOCUS_16790 gene mdh 1562 618 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_16790 2826 1591 gene locus_tag LOCUS_16800 gene icd 2826 1591 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_16800 3052 4641 gene locus_tag LOCUS_16810 gene serA 3052 4641 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_16810 5157 4669 gene locus_tag LOCUS_16820 5157 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 5120 6043 gene locus_tag LOCUS_16830 gene kdsB 5120 6043 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_16830 6085 7761 gene locus_tag LOCUS_16840 6085 7761 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_16840 7764 8591 gene locus_tag LOCUS_16850 gene kdsA 7764 8591 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938915.1 protein_id gnl|my_center|LOCUS_16850 8588 9559 gene locus_tag LOCUS_16860 8588 9559 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence131 2105 1275 gene locus_tag LOCUS_16870 gene cpaB 2105 1275 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 protein_id gnl|my_center|LOCUS_16870 2652 2188 gene locus_tag LOCUS_16880 2652 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3170 2658 gene locus_tag LOCUS_16890 3170 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3413 3207 gene locus_tag LOCUS_16900 3413 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3758 3594 gene locus_tag LOCUS_16910 3758 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 4155 3991 gene locus_tag LOCUS_16920 4155 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 4428 4264 gene locus_tag LOCUS_16930 4428 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 5006 4647 gene locus_tag LOCUS_16940 5006 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 5299 5003 gene locus_tag LOCUS_16950 5299 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 6125 5730 gene locus_tag LOCUS_16960 6125 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 6268 6456 gene locus_tag LOCUS_16970 6268 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 6721 7881 gene locus_tag LOCUS_16980 6721 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 9353 8025 gene locus_tag LOCUS_16990 9353 8025 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_16990 9964 9353 gene locus_tag LOCUS_17000 9964 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence132 1971 1546 gene locus_tag LOCUS_17010 1971 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 3088 2114 gene locus_tag LOCUS_17020 3088 2114 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_17020 4197 3073 gene locus_tag LOCUS_17030 4197 3073 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_17030 4841 4254 gene locus_tag LOCUS_17040 4841 4254 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839853.1 protein_id gnl|my_center|LOCUS_17040 6529 4841 gene locus_tag LOCUS_17050 6529 4841 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_17050 6619 8157 gene locus_tag LOCUS_17060 6619 8157 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_17060 8158 9117 gene locus_tag LOCUS_17070 8158 9117 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_17070 9149 9796 gene locus_tag LOCUS_17080 9149 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence133 <1 823 gene locus_tag LOCUS_17090 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460373.1:enoyl-CoA hydratase 955 2409 gene locus_tag LOCUS_17100 gene dhaS 955 2409 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080281.1 protein_id gnl|my_center|LOCUS_17100 2449 3294 gene locus_tag LOCUS_17110 2449 3294 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979652.1 protein_id gnl|my_center|LOCUS_17110 3305 4459 gene locus_tag LOCUS_17120 gene kynU 3305 4459 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818477.1 protein_id gnl|my_center|LOCUS_17120 4506 5354 gene locus_tag LOCUS_17130 4506 5354 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272323.1 protein_id gnl|my_center|LOCUS_17130 5448 6221 gene locus_tag LOCUS_17140 5448 6221 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_17140 8886 6256 gene locus_tag LOCUS_17150 8886 6256 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111069335.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence134 1923 628 gene locus_tag LOCUS_17160 gene nusA 1923 628 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_17160 2516 2007 gene locus_tag LOCUS_17170 gene rimP 2516 2007 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082324.1 protein_id gnl|my_center|LOCUS_17170 4155 2632 gene locus_tag LOCUS_17180 gene rimO 4155 2632 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057404.1 protein_id gnl|my_center|LOCUS_17180 5463 4171 gene locus_tag LOCUS_17190 gene asnS 5463 4171 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_17190 6296 5463 gene locus_tag LOCUS_17200 6296 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 7439 6408 gene locus_tag LOCUS_17210 7439 6408 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933710.1 protein_id gnl|my_center|LOCUS_17210 8409 7450 gene locus_tag LOCUS_17220 8409 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 8972 8406 gene locus_tag LOCUS_17230 8972 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 <9905 9130 gene locus_tag LOCUS_17240 <9905 9130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339151.1:DegQ family serine endoprotease >Feature sequence135 2543 246 gene locus_tag LOCUS_17250 2543 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 3471 2869 gene locus_tag LOCUS_17260 3471 2869 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530428.1 protein_id gnl|my_center|LOCUS_17260 3647 4348 gene locus_tag LOCUS_17270 3647 4348 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_17270 4360 5034 gene locus_tag LOCUS_17280 4360 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6759 5254 gene locus_tag LOCUS_17290 6759 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 8969 6894 gene locus_tag LOCUS_17300 8969 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17300 9491 9402 gene locus_tag LOCUS_t00060 9491 9402 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence136 <1 1488 gene locus_tag LOCUS_17310 <1 1488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001089349.1:aminomethyl-transferring glycine dehydrogenase 2567 1671 gene locus_tag LOCUS_17320 gene ilvE 2567 1671 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_17320 2644 4221 gene locus_tag LOCUS_17330 2644 4221 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_17330 4218 4649 gene locus_tag LOCUS_17340 4218 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 5386 4787 gene locus_tag LOCUS_17350 5386 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 5979 5383 gene locus_tag LOCUS_17360 5979 5383 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_17360 7056 6022 gene locus_tag LOCUS_17370 7056 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 7565 7053 gene locus_tag LOCUS_17380 7565 7053 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892804.1 protein_id gnl|my_center|LOCUS_17380 9326 7800 gene locus_tag LOCUS_17390 gene guaB 9326 7800 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence137 2065 4284 gene locus_tag LOCUS_17400 2065 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 4294 5454 gene locus_tag LOCUS_17410 4294 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 6564 5551 gene locus_tag LOCUS_17420 6564 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 7584 6829 gene locus_tag LOCUS_17430 7584 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 8351 7581 gene locus_tag LOCUS_17440 8351 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 8438 8857 gene locus_tag LOCUS_17450 8438 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 9269 8850 gene locus_tag LOCUS_17460 9269 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence138 3674 621 gene locus_tag LOCUS_17470 3674 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 3768 5969 gene locus_tag LOCUS_17480 3768 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 5969 7342 gene locus_tag LOCUS_17490 5969 7342 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940959.1 protein_id gnl|my_center|LOCUS_17490 7383 7838 gene locus_tag LOCUS_17500 7383 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 7835 9457 gene locus_tag LOCUS_17510 7835 9457 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946763.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence139 310 645 gene locus_tag LOCUS_17520 310 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1660 662 gene locus_tag LOCUS_17530 gene recA 1660 662 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_17530 2102 2638 gene locus_tag LOCUS_17540 2102 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3425 2574 gene locus_tag LOCUS_17550 3425 2574 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_17550 3581 3910 gene locus_tag LOCUS_17560 3581 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3903 4310 gene locus_tag LOCUS_17570 3903 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 8117 4248 gene locus_tag LOCUS_17580 8117 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 <9532 8316 gene locus_tag LOCUS_17590 <9532 8316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887715.1:acetyl-CoA C-acetyltransferase >Feature sequence140 201 956 gene locus_tag LOCUS_17600 gene larE 201 956 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_17600 960 3167 gene locus_tag LOCUS_17610 960 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 3819 3160 gene locus_tag LOCUS_17620 3819 3160 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256806.1 protein_id gnl|my_center|LOCUS_17620 4038 4607 gene locus_tag LOCUS_17630 4038 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 5419 4697 gene locus_tag LOCUS_17640 gene pyrF 5419 4697 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072377.1 protein_id gnl|my_center|LOCUS_17640 6342 5404 gene locus_tag LOCUS_17650 6342 5404 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_17650 7169 6345 gene locus_tag LOCUS_17660 7169 6345 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_17660 7194 8936 gene locus_tag LOCUS_17670 7194 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 9401 9012 gene locus_tag LOCUS_17680 9401 9012 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence141 355 1497 gene locus_tag LOCUS_17690 355 1497 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120536.1 protein_id gnl|my_center|LOCUS_17690 2401 1454 gene locus_tag LOCUS_17700 2401 1454 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173642.1 protein_id gnl|my_center|LOCUS_17700 3035 2409 gene locus_tag LOCUS_17710 3035 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 3059 4885 gene locus_tag LOCUS_17720 3059 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 4999 6774 gene locus_tag LOCUS_17730 4999 6774 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964054.1 protein_id gnl|my_center|LOCUS_17730 6771 9419 gene locus_tag LOCUS_17740 gene ppc 6771 9419 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113850.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence142 3546 6461 gene locus_tag LOCUS_17750 3546 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 6546 7163 gene locus_tag LOCUS_17760 6546 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 9199 7175 gene locus_tag LOCUS_17770 9199 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence143 283 2022 gene locus_tag LOCUS_17780 gene ggt 283 2022 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703698.1 protein_id gnl|my_center|LOCUS_17780 2187 2492 gene locus_tag LOCUS_17790 2187 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2539 3432 gene locus_tag LOCUS_17800 gene hisG 2539 3432 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_17800 3456 4694 gene locus_tag LOCUS_17810 gene hisD 3456 4694 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970966.1 protein_id gnl|my_center|LOCUS_17810 4691 5740 gene locus_tag LOCUS_17820 gene hisC 4691 5740 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868985.1 protein_id gnl|my_center|LOCUS_17820 5725 6312 gene locus_tag LOCUS_17830 gene hisB 5725 6312 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257804.1 protein_id gnl|my_center|LOCUS_17830 6313 6918 gene locus_tag LOCUS_17840 gene hisH 6313 6918 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023176026.1 protein_id gnl|my_center|LOCUS_17840 6920 7678 gene locus_tag LOCUS_17850 gene hisF 6920 7678 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_17850 7682 8368 gene locus_tag LOCUS_17860 gene hisA 7682 8368 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871056.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence144 516 2780 gene locus_tag LOCUS_17870 516 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5300 2877 gene locus_tag LOCUS_17880 5300 2877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_17880 5631 8018 gene locus_tag LOCUS_17890 5631 8018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928775.1 protein_id gnl|my_center|LOCUS_17890 <9443 8068 gene locus_tag LOCUS_17900 <9443 8068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928775.1:ABC transporter permease >Feature sequence145 79 1428 gene locus_tag LOCUS_17910 79 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1491 2141 gene locus_tag LOCUS_17920 1491 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 3547 2159 gene locus_tag LOCUS_17930 3547 2159 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_17930 3840 3544 gene locus_tag LOCUS_17940 3840 3544 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_17940 3957 4352 gene locus_tag LOCUS_17950 3957 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4387 5307 gene locus_tag LOCUS_17960 4387 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 6465 5353 gene locus_tag LOCUS_17970 6465 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 6398 7099 gene locus_tag LOCUS_17980 6398 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 8213 7074 gene locus_tag LOCUS_17990 8213 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 8273 9235 gene locus_tag LOCUS_18000 8273 9235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence146 244 71 gene locus_tag LOCUS_18010 244 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 237 1418 gene locus_tag LOCUS_18020 237 1418 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_18020 1702 2592 gene locus_tag LOCUS_18030 1702 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2713 5298 gene locus_tag LOCUS_18040 2713 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 5345 7135 gene locus_tag LOCUS_18050 5345 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 7163 7888 gene locus_tag LOCUS_18060 7163 7888 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_18060 8835 7954 gene locus_tag LOCUS_18070 8835 7954 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence147 1500 568 gene locus_tag LOCUS_18080 gene folD 1500 568 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922068.1 protein_id gnl|my_center|LOCUS_18080 3309 1600 gene locus_tag LOCUS_18090 3309 1600 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809373.1 protein_id gnl|my_center|LOCUS_18090 4041 3412 gene locus_tag LOCUS_18100 gene thiE 4041 3412 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 protein_id gnl|my_center|LOCUS_18100 5432 4053 gene locus_tag LOCUS_18110 gene accC 5432 4053 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546633.1 protein_id gnl|my_center|LOCUS_18110 5907 5437 gene locus_tag LOCUS_18120 5907 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 7051 5948 gene locus_tag LOCUS_18130 7051 5948 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942664.1 protein_id gnl|my_center|LOCUS_18130 8164 7142 gene locus_tag LOCUS_18140 8164 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 8736 8164 gene locus_tag LOCUS_18150 8736 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 <9359 8741 gene locus_tag LOCUS_18160 <9359 8741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114575.1:type 4a pilus secretin PilQ >Feature sequence148 <1 725 gene locus_tag LOCUS_18170 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140123.1:S41 family peptidase 908 1558 gene locus_tag LOCUS_18180 908 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18180 1642 4011 gene locus_tag LOCUS_18190 1642 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 5138 4218 gene locus_tag LOCUS_18200 5138 4218 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_18200 5994 5203 gene locus_tag LOCUS_18210 5994 5203 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727458.1 protein_id gnl|my_center|LOCUS_18210 6905 6006 gene locus_tag LOCUS_18220 6905 6006 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339327.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence149 1454 690 gene locus_tag LOCUS_18230 1454 690 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928847.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18230 1902 1519 gene locus_tag LOCUS_18240 1902 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18240 3203 1890 gene locus_tag LOCUS_18250 3203 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18250 3518 4120 gene locus_tag LOCUS_18260 3518 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 5029 4217 gene locus_tag LOCUS_18270 5029 4217 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_18270 5199 5074 gene locus_tag LOCUS_18280 5199 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 5356 6861 gene locus_tag LOCUS_18290 5356 6861 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889218.1 protein_id gnl|my_center|LOCUS_18290 6980 8218 gene locus_tag LOCUS_18300 6980 8218 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889017.1 protein_id gnl|my_center|LOCUS_18300 8393 9022 gene locus_tag LOCUS_18310 8393 9022 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917998.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence150 176 967 gene locus_tag LOCUS_18320 176 967 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_18320 972 2432 gene locus_tag LOCUS_18330 972 2432 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153932.1 protein_id gnl|my_center|LOCUS_18330 2429 3181 gene locus_tag LOCUS_18340 2429 3181 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_18340 3206 5200 gene locus_tag LOCUS_18350 3206 5200 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869877.1 protein_id gnl|my_center|LOCUS_18350 5275 5913 gene locus_tag LOCUS_18360 5275 5913 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081985.1 protein_id gnl|my_center|LOCUS_18360 5917 7599 gene locus_tag LOCUS_18370 5917 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 7596 9047 gene locus_tag LOCUS_18380 7596 9047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence151 218 529 gene locus_tag LOCUS_18390 218 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18390 831 1046 gene locus_tag LOCUS_18400 831 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1043 2239 gene locus_tag LOCUS_18410 1043 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18410 2163 2507 gene locus_tag LOCUS_18420 2163 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18420 2477 2659 gene locus_tag LOCUS_18430 2477 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18430 3708 2758 gene locus_tag LOCUS_18440 3708 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3695 5563 gene locus_tag LOCUS_18450 3695 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 5943 8888 gene locus_tag LOCUS_18460 5943 8888 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037353.1 protein_id gnl|my_center|LOCUS_18460 9077 8769 gene locus_tag LOCUS_18470 9077 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence152 1 471 gene locus_tag LOCUS_18480 1 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 707 1060 gene locus_tag LOCUS_18490 707 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1155 4091 gene locus_tag LOCUS_18500 1155 4091 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839612.1 protein_id gnl|my_center|LOCUS_18500 5589 4207 gene locus_tag LOCUS_18510 5589 4207 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356408.1 protein_id gnl|my_center|LOCUS_18510 5827 7233 gene locus_tag LOCUS_18520 5827 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence153 1733 717 gene locus_tag LOCUS_18530 gene rfbB 1733 717 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_18530 2211 1726 gene locus_tag LOCUS_18540 2211 1726 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021906.1 protein_id gnl|my_center|LOCUS_18540 4505 2208 gene locus_tag LOCUS_18550 gene lptD 4505 2208 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_18550 5744 4527 gene locus_tag LOCUS_18560 5744 4527 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_18560 6667 5747 gene locus_tag LOCUS_18570 gene accD 6667 5747 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_18570 7319 6684 gene locus_tag LOCUS_18580 7319 6684 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_18580 7346 8473 gene locus_tag LOCUS_18590 gene menC 7346 8473 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence154 383 3361 gene locus_tag LOCUS_18600 383 3361 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918809.1 protein_id gnl|my_center|LOCUS_18600 3432 4868 gene locus_tag LOCUS_18610 3432 4868 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928471.1 protein_id gnl|my_center|LOCUS_18610 4826 5893 gene locus_tag LOCUS_18620 4826 5893 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_18620 5936 7330 gene locus_tag LOCUS_18630 5936 7330 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_18630 7335 8189 gene locus_tag LOCUS_18640 7335 8189 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence155 <1 1213 gene locus_tag LOCUS_18650 <1 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545101.1:adenylate/guanylate cyclase domain-containing protein 1210 2340 gene locus_tag LOCUS_18660 1210 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2346 3794 gene locus_tag LOCUS_18670 2346 3794 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 protein_id gnl|my_center|LOCUS_18670 4633 3971 gene locus_tag LOCUS_18680 4633 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 5267 4764 gene locus_tag LOCUS_18690 5267 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 6516 5257 gene locus_tag LOCUS_18700 6516 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 6636 6914 gene locus_tag LOCUS_18710 6636 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 7924 6944 gene locus_tag LOCUS_18720 gene ala 7924 6944 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061064.1 protein_id gnl|my_center|LOCUS_18720 7953 8957 gene locus_tag LOCUS_18730 7953 8957 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868740.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence156 2738 2496 gene locus_tag LOCUS_18740 2738 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18740 3319 2729 gene locus_tag LOCUS_18750 3319 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 3318 4508 gene locus_tag LOCUS_18760 3318 4508 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027385545.1 protein_id gnl|my_center|LOCUS_18760 4958 4641 gene locus_tag LOCUS_18770 4958 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 5485 4943 gene locus_tag LOCUS_18780 5485 4943 CDS product DUF2585 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528354.1 protein_id gnl|my_center|LOCUS_18780 5469 5711 gene locus_tag LOCUS_18790 5469 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 5704 6366 gene locus_tag LOCUS_18800 5704 6366 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086853930.1 protein_id gnl|my_center|LOCUS_18800 <8929 6449 gene locus_tag LOCUS_18810 <8929 6449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840190.1:prolyl oligopeptidase family serine peptidase >Feature sequence157 381 776 gene locus_tag LOCUS_18820 381 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 767 1132 gene locus_tag LOCUS_18830 767 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1774 2007 gene locus_tag LOCUS_18840 1774 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2146 3765 gene locus_tag LOCUS_18850 2146 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 5590 3821 gene locus_tag LOCUS_18860 5590 3821 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640131.1 protein_id gnl|my_center|LOCUS_18860 5715 6338 gene locus_tag LOCUS_18870 5715 6338 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528738.1 protein_id gnl|my_center|LOCUS_18870 7142 6357 gene locus_tag LOCUS_18880 7142 6357 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532424.1 protein_id gnl|my_center|LOCUS_18880 <8910 7178 gene locus_tag LOCUS_18890 <8910 7178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838556.1:methyltransferase domain-containing protein >Feature sequence158 2217 2867 gene locus_tag LOCUS_18900 2217 2867 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_18900 2864 4705 gene locus_tag LOCUS_18910 2864 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 6269 4662 gene locus_tag LOCUS_18920 6269 4662 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349984.1 protein_id gnl|my_center|LOCUS_18920 6891 6298 gene locus_tag LOCUS_18930 6891 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 7283 7825 gene locus_tag LOCUS_18940 7283 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 7827 8903 gene locus_tag LOCUS_18950 7827 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence159 1076 4744 gene locus_tag LOCUS_18960 1076 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 4748 6181 gene locus_tag LOCUS_18970 4748 6181 CDS product putative oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_18970 6261 7571 gene locus_tag LOCUS_18980 6261 7571 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_18980 7625 8464 gene locus_tag LOCUS_18990 7625 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence160 <1 634 gene locus_tag LOCUS_19000 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161963454.1:DEAD/DEAH box helicase 634 1953 gene locus_tag LOCUS_19010 gene mrfB 634 1953 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_19010 2579 1977 gene locus_tag LOCUS_19020 2579 1977 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919034.1 protein_id gnl|my_center|LOCUS_19020 3415 2576 gene locus_tag LOCUS_19030 3415 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19030 3819 3412 gene locus_tag LOCUS_19040 3819 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3912 4205 gene locus_tag LOCUS_19050 3912 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 4847 4332 gene locus_tag LOCUS_19060 4847 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 5261 4992 gene locus_tag LOCUS_19070 5261 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 5324 6811 gene locus_tag LOCUS_19080 5324 6811 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089309.1 protein_id gnl|my_center|LOCUS_19080 6868 7206 gene locus_tag LOCUS_19090 6868 7206 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227376.1 protein_id gnl|my_center|LOCUS_19090 7207 7719 gene locus_tag LOCUS_19100 7207 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 8134 8643 gene locus_tag LOCUS_19110 8134 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence161 1557 400 gene locus_tag LOCUS_19120 1557 400 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812582.1 protein_id gnl|my_center|LOCUS_19120 1582 2073 gene locus_tag LOCUS_19130 1582 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2073 2855 gene locus_tag LOCUS_19140 2073 2855 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967716.1 protein_id gnl|my_center|LOCUS_19140 3772 2852 gene locus_tag LOCUS_19150 3772 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3887 6310 gene locus_tag LOCUS_19160 3887 6310 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_19160 6501 7466 gene locus_tag LOCUS_19170 6501 7466 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027374.1 protein_id gnl|my_center|LOCUS_19170 7526 8671 gene locus_tag LOCUS_19180 7526 8671 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475604.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence162 1481 2536 gene locus_tag LOCUS_19190 1481 2536 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124130.1 protein_id gnl|my_center|LOCUS_19190 2621 3205 gene locus_tag LOCUS_19200 2621 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3144 3659 gene locus_tag LOCUS_19210 3144 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 4413 3895 gene locus_tag LOCUS_19220 4413 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 4505 5866 gene locus_tag LOCUS_19230 4505 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 5915 6112 gene locus_tag LOCUS_19240 5915 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 6100 7290 gene locus_tag LOCUS_19250 6100 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19250 7411 8100 gene locus_tag LOCUS_19260 7411 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence163 1075 350 gene locus_tag LOCUS_19270 1075 350 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_19270 1076 2272 gene locus_tag LOCUS_19280 1076 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 3018 2428 gene locus_tag LOCUS_19290 3018 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 3744 3022 gene locus_tag LOCUS_19300 3744 3022 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_19300 4519 3941 gene locus_tag LOCUS_19310 4519 3941 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_19310 4739 5260 gene locus_tag LOCUS_19320 4739 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 6394 5375 gene locus_tag LOCUS_19330 6394 5375 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_19330 6580 7047 gene locus_tag LOCUS_19340 6580 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 7115 7203 gene locus_tag LOCUS_t00070 7115 7203 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7709 8032 gene locus_tag LOCUS_19350 7709 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 8075 8308 gene locus_tag LOCUS_19360 8075 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 8302 8589 gene locus_tag LOCUS_19370 8302 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence164 961 1974 gene locus_tag LOCUS_19380 961 1974 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227080.1 protein_id gnl|my_center|LOCUS_19380 1974 4616 gene locus_tag LOCUS_19390 1974 4616 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928427.1 protein_id gnl|my_center|LOCUS_19390 4795 5163 gene locus_tag LOCUS_19400 4795 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 7319 5064 gene locus_tag LOCUS_19410 7319 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 8425 7316 gene locus_tag LOCUS_19420 8425 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence165 <1 1748 gene locus_tag LOCUS_19430 <1 1748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405539.1:ABC transporter transmembrane domain-containing protein 1846 3519 gene locus_tag LOCUS_19440 gene ettA 1846 3519 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_19440 3641 4597 gene locus_tag LOCUS_19450 3641 4597 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224055.1 protein_id gnl|my_center|LOCUS_19450 4762 6663 gene locus_tag LOCUS_19460 4762 6663 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892409.1 protein_id gnl|my_center|LOCUS_19460 7055 7303 gene locus_tag LOCUS_19470 7055 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence166 <1 1029 gene locus_tag LOCUS_19480 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027774.1:MFS transporter 1165 2301 gene locus_tag LOCUS_19490 1165 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2626 4842 gene locus_tag LOCUS_19500 2626 4842 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403520.1 protein_id gnl|my_center|LOCUS_19500 5170 4808 gene locus_tag LOCUS_19510 5170 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 5057 6379 gene locus_tag LOCUS_19520 5057 6379 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_19520 6838 6923 gene locus_tag LOCUS_t00080 6838 6923 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7152 6922 gene locus_tag LOCUS_19530 7152 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 7195 7995 gene locus_tag LOCUS_19540 7195 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence167 1273 338 gene locus_tag LOCUS_19550 1273 338 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331308.1 protein_id gnl|my_center|LOCUS_19550 2706 1273 gene locus_tag LOCUS_19560 2706 1273 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_19560 3614 2715 gene locus_tag LOCUS_19570 3614 2715 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_19570 4855 3602 gene locus_tag LOCUS_19580 4855 3602 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_19580 8207 4911 gene locus_tag LOCUS_19590 8207 4911 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265500.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence168 1600 194 gene locus_tag LOCUS_19600 1600 194 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 protein_id gnl|my_center|LOCUS_19600 2966 1602 gene locus_tag LOCUS_19610 2966 1602 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_19610 3580 3044 gene locus_tag LOCUS_19620 3580 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 3607 5271 gene locus_tag LOCUS_19630 3607 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 5613 5401 gene locus_tag LOCUS_19640 5613 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 5838 5617 gene locus_tag LOCUS_19650 5838 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 6281 6700 gene locus_tag LOCUS_19660 6281 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 6700 7743 gene locus_tag LOCUS_19670 6700 7743 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence169 360 1124 gene locus_tag LOCUS_19680 gene truA 360 1124 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_19680 1125 1910 gene locus_tag LOCUS_19690 1125 1910 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_19690 1910 2698 gene locus_tag LOCUS_19700 1910 2698 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460414.1 protein_id gnl|my_center|LOCUS_19700 2698 3882 gene locus_tag LOCUS_19710 2698 3882 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_19710 4020 5339 gene locus_tag LOCUS_19720 gene rseP 4020 5339 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_19720 5351 6106 gene locus_tag LOCUS_19730 5351 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 6267 7178 gene locus_tag LOCUS_19740 6267 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 7723 7193 gene locus_tag LOCUS_19750 7723 7193 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872152.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence170 2346 1540 gene locus_tag LOCUS_19760 2346 1540 CDS product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236716.1 protein_id gnl|my_center|LOCUS_19760 2832 2365 gene locus_tag LOCUS_19770 2832 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 3004 2840 gene locus_tag LOCUS_19780 3004 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 3334 4026 gene locus_tag LOCUS_19790 3334 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4653 4240 gene locus_tag LOCUS_19800 4653 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 5382 4906 gene locus_tag LOCUS_19810 5382 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence171 2461 1124 gene locus_tag LOCUS_19820 2461 1124 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_19820 3239 2472 gene locus_tag LOCUS_19830 3239 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 4754 3342 gene locus_tag LOCUS_19840 4754 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 4828 5940 gene locus_tag LOCUS_19850 4828 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 5952 7382 gene locus_tag LOCUS_19860 5952 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 7379 8578 gene locus_tag LOCUS_19870 7379 8578 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858471.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence172 559 1701 gene locus_tag LOCUS_19880 gene hemW 559 1701 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_19880 1792 2307 gene locus_tag LOCUS_19890 1792 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2891 2388 gene locus_tag LOCUS_19900 2891 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2966 4108 gene locus_tag LOCUS_19910 gene acdA 2966 4108 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_19910 4105 5049 gene locus_tag LOCUS_19920 gene meaB 4105 5049 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_19920 5171 5623 gene locus_tag LOCUS_19930 gene mce 5171 5623 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_19930 5620 6474 gene locus_tag LOCUS_19940 5620 6474 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_19940 6475 7386 gene locus_tag LOCUS_19950 6475 7386 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142419.1 protein_id gnl|my_center|LOCUS_19950 7426 8373 gene locus_tag LOCUS_19960 7426 8373 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074905.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence173 2365 1712 gene locus_tag LOCUS_19970 2365 1712 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943685.1 protein_id gnl|my_center|LOCUS_19970 2596 2886 gene locus_tag LOCUS_19980 2596 2886 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074197.1 protein_id gnl|my_center|LOCUS_19980 3187 2897 gene locus_tag LOCUS_19990 gene pduA 3187 2897 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_19990 4329 3202 gene locus_tag LOCUS_20000 4329 3202 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173644.1 protein_id gnl|my_center|LOCUS_20000 5584 4349 gene locus_tag LOCUS_20010 5584 4349 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_20010 7202 5589 gene locus_tag LOCUS_20020 7202 5589 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_20020 7298 8260 gene locus_tag LOCUS_20030 7298 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence174 279 1535 gene locus_tag LOCUS_20040 279 1535 CDS product ISNCY-like element ISTde1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679811.1 protein_id gnl|my_center|LOCUS_20040 2404 2628 gene locus_tag LOCUS_20050 2404 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2612 2932 gene locus_tag LOCUS_20060 2612 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3194 4051 gene locus_tag LOCUS_20070 3194 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 5516 4038 gene locus_tag LOCUS_20080 5516 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 6538 5552 gene locus_tag LOCUS_20090 6538 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 7011 7991 gene locus_tag LOCUS_20100 7011 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 7882 8487 gene locus_tag LOCUS_20110 7882 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence175 80 2050 gene locus_tag LOCUS_20120 gene speA 80 2050 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119511.1 protein_id gnl|my_center|LOCUS_20120 3762 2062 gene locus_tag LOCUS_20130 3762 2062 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_20130 4358 3852 gene locus_tag LOCUS_20140 4358 3852 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259748.1 protein_id gnl|my_center|LOCUS_20140 4476 5846 gene locus_tag LOCUS_20150 4476 5846 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_20150 6543 5926 gene locus_tag LOCUS_20160 6543 5926 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_20160 6965 8500 gene locus_tag LOCUS_20170 gene guaB 6965 8500 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227931.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence176 1851 1459 gene locus_tag LOCUS_20180 1851 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2504 2229 gene locus_tag LOCUS_20190 2504 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 3257 2637 gene locus_tag LOCUS_20200 3257 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3355 5979 gene locus_tag LOCUS_20210 3355 5979 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141097.1 protein_id gnl|my_center|LOCUS_20210 5976 6578 gene locus_tag LOCUS_20220 5976 6578 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_20220 6653 8014 gene locus_tag LOCUS_20230 6653 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence177 23 430 gene locus_tag LOCUS_20240 23 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 427 1137 gene locus_tag LOCUS_20250 427 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20250 1183 1269 gene locus_tag LOCUS_t00090 1183 1269 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2404 1280 gene locus_tag LOCUS_20260 2404 1280 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_20260 2801 2439 gene locus_tag LOCUS_20270 2801 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 4213 3386 gene locus_tag LOCUS_20280 4213 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 5381 4746 gene locus_tag LOCUS_20290 5381 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 6819 5407 gene locus_tag LOCUS_20300 6819 5407 CDS product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566295.1 protein_id gnl|my_center|LOCUS_20300 8224 6830 gene locus_tag LOCUS_20310 8224 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence178 <1 1216 gene locus_tag LOCUS_20320 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933145.1:UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase 1219 1902 gene locus_tag LOCUS_20330 gene pxpB 1219 1902 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869461.1 protein_id gnl|my_center|LOCUS_20330 1899 2828 gene locus_tag LOCUS_20340 1899 2828 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064866.1 protein_id gnl|my_center|LOCUS_20340 2825 3790 gene locus_tag LOCUS_20350 gene murB 2825 3790 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_20350 3771 5030 gene locus_tag LOCUS_20360 gene murA 3771 5030 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083644.1 protein_id gnl|my_center|LOCUS_20360 6963 5098 gene locus_tag LOCUS_20370 6963 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 7609 6932 gene locus_tag LOCUS_20380 gene lolA 7609 6932 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938957.1 protein_id gnl|my_center|LOCUS_20380 <8479 7749 gene locus_tag LOCUS_20390 <8479 7749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393249.1:PHP domain-containing protein >Feature sequence179 1336 62 gene locus_tag LOCUS_20400 1336 62 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_20400 1806 1333 gene locus_tag LOCUS_20410 gene rpiB 1806 1333 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_20410 1863 3023 gene locus_tag LOCUS_20420 1863 3023 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_20420 3579 2968 gene locus_tag LOCUS_20430 3579 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 3630 4082 gene locus_tag LOCUS_20440 3630 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 4203 5798 gene locus_tag LOCUS_20450 gene thiC 4203 5798 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230295.1 protein_id gnl|my_center|LOCUS_20450 6207 5857 gene locus_tag LOCUS_20460 6207 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 6438 7586 gene locus_tag LOCUS_20470 6438 7586 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_20470 7596 8423 gene locus_tag LOCUS_20480 gene htpX 7596 8423 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence180 518 102 gene locus_tag LOCUS_20490 518 102 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027906.1 protein_id gnl|my_center|LOCUS_20490 641 1846 gene locus_tag LOCUS_20500 641 1846 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230328.1 protein_id gnl|my_center|LOCUS_20500 2075 2776 gene locus_tag LOCUS_20510 2075 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2773 3681 gene locus_tag LOCUS_20520 2773 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 4232 3981 gene locus_tag LOCUS_20530 4232 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 6181 4229 gene locus_tag LOCUS_20540 6181 4229 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_20540 6689 8278 gene locus_tag LOCUS_20550 gene ggt 6689 8278 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133817160.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence181 3052 869 gene locus_tag LOCUS_20560 3052 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 5169 3052 gene locus_tag LOCUS_20570 5169 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 5781 5362 gene locus_tag LOCUS_20580 5781 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 6674 5784 gene locus_tag LOCUS_20590 6674 5784 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142163.1 protein_id gnl|my_center|LOCUS_20590 8214 6841 gene locus_tag LOCUS_20600 8214 6841 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence182 781 2562 gene locus_tag LOCUS_20610 781 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2594 4807 gene locus_tag LOCUS_20620 2594 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 5676 4912 gene locus_tag LOCUS_20630 5676 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 5915 5673 gene locus_tag LOCUS_20640 5915 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 5829 6221 gene locus_tag LOCUS_20650 5829 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 6387 7679 gene locus_tag LOCUS_20660 6387 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 8234 7725 gene locus_tag LOCUS_20670 8234 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence183 <1 850 gene locus_tag LOCUS_20680 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084771.1:S9 family peptidase 1774 863 gene locus_tag LOCUS_20690 1774 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2431 1787 gene locus_tag LOCUS_20700 2431 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2498 3529 gene locus_tag LOCUS_20710 2498 3529 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_20710 3823 3620 gene locus_tag LOCUS_20720 3823 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 5015 4758 gene locus_tag LOCUS_20730 5015 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 6061 5012 gene locus_tag LOCUS_20740 6061 5012 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_20740 6597 6328 gene locus_tag LOCUS_20750 6597 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 7049 6546 gene locus_tag LOCUS_20760 7049 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 7777 7046 gene locus_tag LOCUS_20770 7777 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 8361 7867 gene locus_tag LOCUS_20780 8361 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence184 <1 1413 gene locus_tag LOCUS_20790 <1 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_231847126.1:bacillithiol biosynthesis cysteine-adding enzyme BshC 2671 1502 gene locus_tag LOCUS_20800 gene bshA 2671 1502 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_20800 3423 2668 gene locus_tag LOCUS_20810 gene bshB1 3423 2668 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230642.1 protein_id gnl|my_center|LOCUS_20810 3517 5862 gene locus_tag LOCUS_20820 3517 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 5870 6967 gene locus_tag LOCUS_20830 5870 6967 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_20830 7027 7794 gene locus_tag LOCUS_20840 7027 7794 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence185 2578 3654 gene locus_tag LOCUS_20850 2578 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3702 4160 gene locus_tag LOCUS_20860 3702 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20860 4108 5244 gene locus_tag LOCUS_20870 4108 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20870 5301 6500 gene locus_tag LOCUS_20880 5301 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 7381 6671 gene locus_tag LOCUS_20890 7381 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence186 1592 3775 gene locus_tag LOCUS_20900 1592 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 4827 3823 gene locus_tag LOCUS_20910 4827 3823 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940986.1 protein_id gnl|my_center|LOCUS_20910 <8345 4898 gene locus_tag LOCUS_20920 <8345 4898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941791.1:chromosome segregation protein SMC >Feature sequence187 53 127 gene locus_tag LOCUS_t00100 53 127 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 951 763 gene locus_tag LOCUS_20930 951 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 1213 2382 gene locus_tag LOCUS_20940 1213 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 3180 2722 gene locus_tag LOCUS_20950 3180 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 4904 4104 gene locus_tag LOCUS_20960 4904 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 5172 4813 gene locus_tag LOCUS_20970 5172 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 5471 5764 gene locus_tag LOCUS_20980 5471 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 6072 7331 gene locus_tag LOCUS_20990 6072 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 7485 7560 gene locus_tag LOCUS_t00110 7485 7560 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8124 7627 gene locus_tag LOCUS_21000 8124 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence188 <1 1226 gene locus_tag LOCUS_21010 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530899.1:amylo-alpha-1,6-glucosidase 2939 1215 gene locus_tag LOCUS_21020 2939 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 4044 3010 gene locus_tag LOCUS_21030 4044 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 5765 4041 gene locus_tag LOCUS_21040 5765 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 7297 5762 gene locus_tag LOCUS_21050 7297 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence189 2090 543 gene locus_tag LOCUS_21060 2090 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 3569 2211 gene locus_tag LOCUS_21070 3569 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 3641 3868 gene locus_tag LOCUS_21080 3641 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 3865 4443 gene locus_tag LOCUS_21090 3865 4443 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072775378.1 protein_id gnl|my_center|LOCUS_21090 4575 5282 gene locus_tag LOCUS_21100 4575 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 5808 5515 gene locus_tag LOCUS_21110 5808 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 7376 5874 gene locus_tag LOCUS_21120 7376 5874 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549996.1 protein_id gnl|my_center|LOCUS_21120 >Feature sequence190 919 1926 gene locus_tag LOCUS_21130 919 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 3409 1982 gene locus_tag LOCUS_21140 gene hemL 3409 1982 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_21140 4742 3453 gene locus_tag LOCUS_21150 4742 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 6180 4801 gene locus_tag LOCUS_21160 6180 4801 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_21160 6288 7508 gene locus_tag LOCUS_21170 6288 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 7631 7924 gene locus_tag LOCUS_21180 7631 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21180 >Feature sequence191 4 924 gene locus_tag LOCUS_21190 4 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 1098 1796 gene locus_tag LOCUS_21200 1098 1796 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_21200 1789 3429 gene locus_tag LOCUS_21210 1789 3429 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_21210 3480 4127 gene locus_tag LOCUS_21220 3480 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 4176 4547 gene locus_tag LOCUS_21230 4176 4547 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108846473.1 protein_id gnl|my_center|LOCUS_21230 6412 4880 gene locus_tag LOCUS_21240 6412 4880 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970696.1 protein_id gnl|my_center|LOCUS_21240 6461 7693 gene locus_tag LOCUS_21250 6461 7693 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529727.1 protein_id gnl|my_center|LOCUS_21250 8122 7727 gene locus_tag LOCUS_21260 8122 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21260 >Feature sequence192 1151 399 gene locus_tag LOCUS_21270 1151 399 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_21270 1909 1343 gene locus_tag LOCUS_21280 1909 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2239 2012 gene locus_tag LOCUS_21290 2239 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2520 2281 gene locus_tag LOCUS_21300 2520 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 4057 2825 gene locus_tag LOCUS_21310 4057 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 6188 4206 gene locus_tag LOCUS_21320 6188 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 7289 6339 gene locus_tag LOCUS_21330 7289 6339 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192895.1 protein_id gnl|my_center|LOCUS_21330 7735 7286 gene locus_tag LOCUS_21340 7735 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence193 210 2507 gene locus_tag LOCUS_21350 210 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 3122 2526 gene locus_tag LOCUS_21360 gene recR 3122 2526 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_21360 3421 3122 gene locus_tag LOCUS_21370 3421 3122 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_21370 5313 3457 gene locus_tag LOCUS_21380 gene dnaX 5313 3457 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_21380 6093 5530 gene locus_tag LOCUS_21390 6093 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 6359 6090 gene locus_tag LOCUS_21400 6359 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 7622 6378 gene locus_tag LOCUS_21410 7622 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence194 903 211 gene locus_tag LOCUS_21420 903 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 3205 3813 gene locus_tag LOCUS_21430 3205 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 3946 4794 gene locus_tag LOCUS_21440 3946 4794 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742152.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21440 4794 6083 gene locus_tag LOCUS_21450 4794 6083 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_21450 6254 7600 gene locus_tag LOCUS_21460 6254 7600 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327635.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence195 893 261 gene locus_tag LOCUS_21470 893 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 868 1320 gene locus_tag LOCUS_21480 868 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2136 1417 gene locus_tag LOCUS_21490 gene cmk 2136 1417 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_21490 2130 3311 gene locus_tag LOCUS_21500 2130 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 4212 3223 gene locus_tag LOCUS_21510 4212 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 4940 4269 gene locus_tag LOCUS_21520 gene scpB 4940 4269 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356904.1 protein_id gnl|my_center|LOCUS_21520 5875 4997 gene locus_tag LOCUS_21530 5875 4997 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_21530 6897 5875 gene locus_tag LOCUS_21540 gene trpS 6897 5875 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583821.1 protein_id gnl|my_center|LOCUS_21540 7478 6894 gene locus_tag LOCUS_21550 7478 6894 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 protein_id gnl|my_center|LOCUS_21550 7368 7643 gene locus_tag LOCUS_21560 7368 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence196 528 256 gene locus_tag LOCUS_21570 528 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 787 518 gene locus_tag LOCUS_21580 787 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 840 1031 gene locus_tag LOCUS_21590 840 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 1312 1028 gene locus_tag LOCUS_21600 1312 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 1542 1916 gene locus_tag LOCUS_21610 1542 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2990 1956 gene locus_tag LOCUS_21620 2990 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 3620 3177 gene locus_tag LOCUS_21630 3620 3177 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 protein_id gnl|my_center|LOCUS_21630 3712 4605 gene locus_tag LOCUS_21640 3712 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 4858 4643 gene locus_tag LOCUS_21650 4858 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 5553 4882 gene locus_tag LOCUS_21660 5553 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 5869 5666 gene locus_tag LOCUS_21670 5869 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 6438 5866 gene locus_tag LOCUS_21680 6438 5866 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976326.1 protein_id gnl|my_center|LOCUS_21680 7036 7278 gene locus_tag LOCUS_21690 7036 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 7672 7313 gene locus_tag LOCUS_21700 7672 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 7934 7659 gene locus_tag LOCUS_21710 7934 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence197 593 2911 gene locus_tag LOCUS_21720 593 2911 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_21720 2973 3962 gene locus_tag LOCUS_21730 2973 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061227.1 protein_id gnl|my_center|LOCUS_21730 3959 4744 gene locus_tag LOCUS_21740 3959 4744 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_21740 4862 5899 gene locus_tag LOCUS_21750 4862 5899 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 protein_id gnl|my_center|LOCUS_21750 6035 6946 gene locus_tag LOCUS_21760 6035 6946 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence198 188 409 gene locus_tag LOCUS_21770 188 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2310 373 gene locus_tag LOCUS_21780 2310 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2530 3609 gene locus_tag LOCUS_21790 2530 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 3687 4031 gene locus_tag LOCUS_21800 3687 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 4216 5952 gene locus_tag LOCUS_21810 4216 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 5971 6411 gene locus_tag LOCUS_21820 5971 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 6422 7783 gene locus_tag LOCUS_21830 6422 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence199 <1 684 gene locus_tag LOCUS_21840 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335012.1:PQQ-like beta-propeller repeat protein 727 2013 gene locus_tag LOCUS_21850 727 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2034 3290 gene locus_tag LOCUS_21860 2034 3290 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_21860 4011 3556 gene locus_tag LOCUS_21870 4011 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921838.1 protein_id gnl|my_center|LOCUS_21870 7228 4133 gene locus_tag LOCUS_21880 7228 4133 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037353.1 protein_id gnl|my_center|LOCUS_21880 7264 7497 gene locus_tag LOCUS_21890 7264 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence200 <1 1008 gene locus_tag LOCUS_21900 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393573.1:non-homologous end-joining DNA ligase 1730 1059 gene locus_tag LOCUS_21910 1730 1059 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967335.1 protein_id gnl|my_center|LOCUS_21910 1915 1730 gene locus_tag LOCUS_21920 1915 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1914 2342 gene locus_tag LOCUS_21930 1914 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331848.1 protein_id gnl|my_center|LOCUS_21930 2416 4929 gene locus_tag LOCUS_21940 2416 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 5008 5084 gene locus_tag LOCUS_t00120 5008 5084 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5132 5207 gene locus_tag LOCUS_t00130 5132 5207 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6014 5433 gene locus_tag LOCUS_21950 6014 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 6893 6705 gene locus_tag LOCUS_21960 6893 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 7590 7665 gene locus_tag LOCUS_t00140 7590 7665 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence201 <1 658 gene locus_tag LOCUS_21970 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528753.1:amidohydrolase/deacetylase family metallohydrolase 659 1945 gene locus_tag LOCUS_21980 659 1945 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_21980 1999 3279 gene locus_tag LOCUS_21990 1999 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 4071 3613 gene locus_tag LOCUS_22000 4071 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 4259 4113 gene locus_tag LOCUS_22010 4259 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 5550 4315 gene locus_tag LOCUS_22020 5550 4315 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729293.1 protein_id gnl|my_center|LOCUS_22020 5802 5560 gene locus_tag LOCUS_22030 5802 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 7387 5804 gene locus_tag LOCUS_22040 7387 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 <8083 7408 gene locus_tag LOCUS_22050 <8083 7408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245816.1:4-hydroxy-tetrahydrodipicolinate synthase >Feature sequence202 3389 909 gene locus_tag LOCUS_22060 3389 909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_22060 3421 4896 gene locus_tag LOCUS_22070 3421 4896 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_22070 6897 4987 gene locus_tag LOCUS_22080 6897 4987 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 protein_id gnl|my_center|LOCUS_22080 7333 6980 gene locus_tag LOCUS_22090 7333 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 7523 8002 gene locus_tag LOCUS_22100 7523 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence203 2966 234 gene locus_tag LOCUS_22110 gene polA 2966 234 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_22110 2965 3771 gene locus_tag LOCUS_22120 2965 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 4406 3816 gene locus_tag LOCUS_22130 4406 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 5313 4570 gene locus_tag LOCUS_22140 5313 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 6560 5445 gene locus_tag LOCUS_22150 6560 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 7324 6557 gene locus_tag LOCUS_22160 7324 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence204 423 1691 gene locus_tag LOCUS_22170 gene glgC 423 1691 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_22170 1743 3044 gene locus_tag LOCUS_22180 gene eno 1743 3044 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880276.1 protein_id gnl|my_center|LOCUS_22180 3045 4583 gene locus_tag LOCUS_22190 gene gpmI 3045 4583 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_22190 4937 4626 gene locus_tag LOCUS_22200 4937 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 5154 6722 gene locus_tag LOCUS_22210 5154 6722 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_22210 6715 7854 gene locus_tag LOCUS_22220 6715 7854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence205 118 2541 gene locus_tag LOCUS_22230 118 2541 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_22230 2531 4651 gene locus_tag LOCUS_22240 2531 4651 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922509.1 protein_id gnl|my_center|LOCUS_22240 4665 5237 gene locus_tag LOCUS_22250 4665 5237 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888013.1 protein_id gnl|my_center|LOCUS_22250 5285 6589 gene locus_tag LOCUS_22260 5285 6589 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_22260 6673 7317 gene locus_tag LOCUS_22270 6673 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence206 637 1008 gene locus_tag LOCUS_22280 637 1008 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141202.1 protein_id gnl|my_center|LOCUS_22280 1008 3671 gene locus_tag LOCUS_22290 1008 3671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_22290 5546 3846 gene locus_tag LOCUS_22300 5546 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 6364 5585 gene locus_tag LOCUS_22310 6364 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 6805 6407 gene locus_tag LOCUS_22320 6805 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 <8032 6875 gene locus_tag LOCUS_22330 <8032 6875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928775.1:ABC transporter permease >Feature sequence207 1349 798 gene locus_tag LOCUS_22340 1349 798 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530032.1 protein_id gnl|my_center|LOCUS_22340 2886 1261 gene locus_tag LOCUS_22350 2886 1261 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941147.1 protein_id gnl|my_center|LOCUS_22350 2930 4528 gene locus_tag LOCUS_22360 gene fumA 2930 4528 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413503.1 protein_id gnl|my_center|LOCUS_22360 4711 4538 gene locus_tag LOCUS_22370 4711 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 6427 4808 gene locus_tag LOCUS_22380 6427 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 7808 6438 gene locus_tag LOCUS_22390 7808 6438 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941769.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence208 1 1071 gene locus_tag LOCUS_22400 1 1071 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_22400 1071 2378 gene locus_tag LOCUS_22410 1071 2378 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_22410 2375 3649 gene locus_tag LOCUS_22420 2375 3649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_22420 3811 4899 gene locus_tag LOCUS_22430 3811 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 4919 6163 gene locus_tag LOCUS_22440 4919 6163 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_22440 6327 7892 gene locus_tag LOCUS_22450 6327 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence209 1402 1821 gene locus_tag LOCUS_22460 1402 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1955 2203 gene locus_tag LOCUS_22470 1955 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2406 2978 gene locus_tag LOCUS_22480 2406 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 3091 4665 gene locus_tag LOCUS_22490 3091 4665 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871699.1 protein_id gnl|my_center|LOCUS_22490 4712 5566 gene locus_tag LOCUS_22500 4712 5566 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_22500 5962 5585 gene locus_tag LOCUS_22510 5962 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 <7977 6023 gene locus_tag LOCUS_22520 <7977 6023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964428.1:S9 family peptidase >Feature sequence210 592 152 gene locus_tag LOCUS_22530 592 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 962 579 gene locus_tag LOCUS_22540 962 579 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_22540 3703 878 gene locus_tag LOCUS_22550 3703 878 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_22550 4659 3967 gene locus_tag LOCUS_22560 4659 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 6482 4671 gene locus_tag LOCUS_22570 6482 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 7935 6526 gene locus_tag LOCUS_22580 7935 6526 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003305.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence211 <1 578 gene locus_tag LOCUS_22590 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038991.1:drug/metabolite exporter YedA 705 559 gene locus_tag LOCUS_22600 705 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 1596 1132 gene locus_tag LOCUS_22610 gene fabZ 1596 1132 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 protein_id gnl|my_center|LOCUS_22610 1702 3441 gene locus_tag LOCUS_22620 1702 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3438 4349 gene locus_tag LOCUS_22630 3438 4349 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015684.1 protein_id gnl|my_center|LOCUS_22630 4787 4422 gene locus_tag LOCUS_22640 4787 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 6096 5095 gene locus_tag LOCUS_22650 6096 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 6372 7247 gene locus_tag LOCUS_22660 6372 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 7751 7251 gene locus_tag LOCUS_22670 7751 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence212 3 215 gene locus_tag LOCUS_22680 3 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 451 149 gene locus_tag LOCUS_22690 451 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2322 1828 gene locus_tag LOCUS_22700 2322 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3608 2322 gene locus_tag LOCUS_22710 3608 2322 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494076.1 protein_id gnl|my_center|LOCUS_22710 3682 4017 gene locus_tag LOCUS_22720 3682 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 4124 4693 gene locus_tag LOCUS_22730 4124 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 4717 5235 gene locus_tag LOCUS_22740 4717 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 5217 7163 gene locus_tag LOCUS_22750 gene glgB 5217 7163 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141306.1 protein_id gnl|my_center|LOCUS_22750 7526 7128 gene locus_tag LOCUS_22760 7526 7128 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence213 1672 1448 gene locus_tag LOCUS_22770 1672 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 1715 4303 gene locus_tag LOCUS_22780 1715 4303 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141097.1 protein_id gnl|my_center|LOCUS_22780 4318 4779 gene locus_tag LOCUS_22790 4318 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 5313 4915 gene locus_tag LOCUS_22800 5313 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 5592 6206 gene locus_tag LOCUS_22810 5592 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 6443 7024 gene locus_tag LOCUS_22820 6443 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22820 7525 7244 gene locus_tag LOCUS_22830 7525 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence214 1778 3124 gene locus_tag LOCUS_22840 1778 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 3193 4083 gene locus_tag LOCUS_22850 3193 4083 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140485.1 protein_id gnl|my_center|LOCUS_22850 4763 4092 gene locus_tag LOCUS_22860 4763 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 6118 4763 gene locus_tag LOCUS_22870 6118 4763 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_22870 6999 6115 gene locus_tag LOCUS_22880 6999 6115 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969394.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence215 2421 607 gene locus_tag LOCUS_22890 2421 607 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_22890 3047 2421 gene locus_tag LOCUS_22900 3047 2421 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839853.1 protein_id gnl|my_center|LOCUS_22900 3191 3583 gene locus_tag LOCUS_22910 3191 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 4652 3618 gene locus_tag LOCUS_22920 4652 3618 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142937.1 protein_id gnl|my_center|LOCUS_22920 5026 4649 gene locus_tag LOCUS_22930 5026 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 5542 5045 gene locus_tag LOCUS_22940 5542 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 5577 6680 gene locus_tag LOCUS_22950 5577 6680 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227080.1 protein_id gnl|my_center|LOCUS_22950 6916 6677 gene locus_tag LOCUS_22960 6916 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22960 7726 7097 gene locus_tag LOCUS_22970 7726 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22970 >Feature sequence216 81 1289 gene locus_tag LOCUS_22980 81 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 1286 2773 gene locus_tag LOCUS_22990 gene trpE 1286 2773 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_22990 2784 3344 gene locus_tag LOCUS_23000 gene pabA 2784 3344 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369400.1 protein_id gnl|my_center|LOCUS_23000 3344 4369 gene locus_tag LOCUS_23010 gene trpD 3344 4369 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_23010 4366 5169 gene locus_tag LOCUS_23020 gene trpC 4366 5169 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389650.1 protein_id gnl|my_center|LOCUS_23020 5166 5816 gene locus_tag LOCUS_23030 5166 5816 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_23030 5809 7035 gene locus_tag LOCUS_23040 gene trpB 5809 7035 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258563.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence217 2290 926 gene locus_tag LOCUS_23050 2290 926 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256530.1 protein_id gnl|my_center|LOCUS_23050 2997 2287 gene locus_tag LOCUS_23060 2997 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 3727 3047 gene locus_tag LOCUS_23070 3727 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 4796 3837 gene locus_tag LOCUS_23080 4796 3837 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_23080 5766 4804 gene locus_tag LOCUS_23090 5766 4804 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_23090 7615 5771 gene locus_tag LOCUS_23100 7615 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence218 1573 1932 gene locus_tag LOCUS_23110 1573 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 3354 2392 gene locus_tag LOCUS_23120 3354 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3532 6408 gene locus_tag LOCUS_23130 3532 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 6759 7736 gene locus_tag LOCUS_23140 6759 7736 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence219 1056 2075 gene locus_tag LOCUS_23150 1056 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2453 2220 gene locus_tag LOCUS_23160 2453 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3511 2366 gene locus_tag LOCUS_23170 3511 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 4403 3567 gene locus_tag LOCUS_23180 4403 3567 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226734.1 protein_id gnl|my_center|LOCUS_23180 4339 4674 gene locus_tag LOCUS_23190 4339 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 5097 4942 gene locus_tag LOCUS_23200 5097 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 5926 5132 gene locus_tag LOCUS_23210 5926 5132 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228729.1 protein_id gnl|my_center|LOCUS_23210 6858 5941 gene locus_tag LOCUS_23220 6858 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence220 397 321 gene locus_tag LOCUS_t00150 397 321 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 571 885 gene locus_tag LOCUS_23230 571 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 888 3491 gene locus_tag LOCUS_23240 888 3491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928775.1 protein_id gnl|my_center|LOCUS_23240 3929 4315 gene locus_tag LOCUS_23250 3929 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 6115 4475 gene locus_tag LOCUS_23260 6115 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence221 687 2264 gene locus_tag LOCUS_23270 687 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2289 2591 gene locus_tag LOCUS_23280 2289 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2588 4441 gene locus_tag LOCUS_23290 2588 4441 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114225.1 protein_id gnl|my_center|LOCUS_23290 4634 4861 gene locus_tag LOCUS_23300 4634 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 4883 5137 gene locus_tag LOCUS_23310 4883 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence222 147 1604 gene locus_tag LOCUS_23320 147 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1730 2023 gene locus_tag LOCUS_23330 1730 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2144 2509 gene locus_tag LOCUS_23340 2144 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2588 3097 gene locus_tag LOCUS_23350 2588 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 3297 3899 gene locus_tag LOCUS_23360 3297 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 3899 4294 gene locus_tag LOCUS_23370 3899 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 4270 5253 gene locus_tag LOCUS_23380 4270 5253 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525135.1 protein_id gnl|my_center|LOCUS_23380 6682 5297 gene locus_tag LOCUS_23390 6682 5297 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_23390 7029 6688 gene locus_tag LOCUS_23400 gene uraH 7029 6688 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852246.1 protein_id gnl|my_center|LOCUS_23400 <7699 7026 gene locus_tag LOCUS_23410 <7699 7026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804441.1:allantoinase AllB >Feature sequence223 56 634 gene locus_tag LOCUS_23420 56 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 689 2323 gene locus_tag LOCUS_23430 689 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2457 3668 gene locus_tag LOCUS_23440 2457 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 4131 5471 gene locus_tag LOCUS_23450 4131 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 6536 5472 gene locus_tag LOCUS_23460 6536 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 <7662 6576 gene locus_tag LOCUS_23470 <7662 6576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257184.1:arsenosugar biosynthesis radical SAM protein ArsS >Feature sequence224 1969 788 gene locus_tag LOCUS_23480 1969 788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439496.1 protein_id gnl|my_center|LOCUS_23480 3129 1972 gene locus_tag LOCUS_23490 3129 1972 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_23490 3815 3126 gene locus_tag LOCUS_23500 3815 3126 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_23500 5145 3919 gene locus_tag LOCUS_23510 5145 3919 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275499.1 protein_id gnl|my_center|LOCUS_23510 5742 5431 gene locus_tag LOCUS_23520 5742 5431 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258010.1 protein_id gnl|my_center|LOCUS_23520 6495 5749 gene locus_tag LOCUS_23530 6495 5749 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_23530 <7647 6488 gene locus_tag LOCUS_23540 <7647 6488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258008.1:cytochrome c oxidase subunit I >Feature sequence225 62 1114 gene locus_tag LOCUS_23550 62 1114 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_23550 1111 2322 gene locus_tag LOCUS_23560 1111 2322 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_23560 2297 3076 gene locus_tag LOCUS_23570 gene surE 2297 3076 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_23570 3919 3104 gene locus_tag LOCUS_23580 3919 3104 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816960.1 protein_id gnl|my_center|LOCUS_23580 4921 4019 gene locus_tag LOCUS_23590 4921 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 6274 4943 gene locus_tag LOCUS_23600 6274 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 6414 7355 gene locus_tag LOCUS_23610 6414 7355 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086624.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence226 605 763 gene locus_tag LOCUS_23620 605 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 810 1127 gene locus_tag LOCUS_23630 810 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 1164 1523 gene locus_tag LOCUS_23640 1164 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23640 1986 1864 gene locus_tag LOCUS_23650 1986 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 2090 2320 gene locus_tag LOCUS_23660 2090 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2307 2702 gene locus_tag LOCUS_23670 gene vapc11 2307 2702 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_23670 2699 3391 gene locus_tag LOCUS_23680 2699 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 3498 4574 gene locus_tag LOCUS_23690 3498 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 4615 5397 gene locus_tag LOCUS_23700 4615 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23700 5301 5831 gene locus_tag LOCUS_23710 5301 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 6417 5968 gene locus_tag LOCUS_23720 6417 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 6572 7498 gene locus_tag LOCUS_23730 6572 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence227 906 1739 gene locus_tag LOCUS_23740 gene iolB 906 1739 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_23740 1742 2113 gene locus_tag LOCUS_23750 1742 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2110 2874 gene locus_tag LOCUS_23760 gene kduD 2110 2874 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_23760 2908 3666 gene locus_tag LOCUS_23770 2908 3666 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_23770 3663 4937 gene locus_tag LOCUS_23780 3663 4937 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_23780 4934 7075 gene locus_tag LOCUS_23790 4934 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence228 2132 1194 gene locus_tag LOCUS_23800 2132 1194 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_23800 2851 2132 gene locus_tag LOCUS_23810 2851 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 3732 2857 gene locus_tag LOCUS_23820 3732 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 3883 4647 gene locus_tag LOCUS_23830 3883 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 4655 5440 gene locus_tag LOCUS_23840 4655 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 6715 5477 gene locus_tag LOCUS_23850 6715 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 7594 6821 gene locus_tag LOCUS_23860 7594 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence229 2982 310 gene locus_tag LOCUS_23870 2982 310 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_23870 3317 6733 gene locus_tag LOCUS_23880 3317 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence230 1936 479 gene locus_tag LOCUS_23890 1936 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2484 1939 gene locus_tag LOCUS_23900 gene sigM 2484 1939 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087658.1 protein_id gnl|my_center|LOCUS_23900 2558 3034 gene locus_tag LOCUS_23910 2558 3034 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203080.1 protein_id gnl|my_center|LOCUS_23910 3009 3353 gene locus_tag LOCUS_23920 3009 3353 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176701.1 protein_id gnl|my_center|LOCUS_23920 3350 5008 gene locus_tag LOCUS_23930 3350 5008 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_23930 5103 5261 gene locus_tag LOCUS_23940 5103 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 5279 5518 gene locus_tag LOCUS_23950 5279 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 5500 5712 gene locus_tag LOCUS_23960 5500 5712 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_23960 5833 6102 gene locus_tag LOCUS_23970 5833 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 <7583 6161 gene locus_tag LOCUS_23980 <7583 6161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054949791.1:DUF2339 domain-containing protein >Feature sequence231 1778 897 gene locus_tag LOCUS_23990 1778 897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_23990 4114 2483 gene locus_tag LOCUS_24000 4114 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_24000 4340 4531 gene locus_tag LOCUS_24010 4340 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 5188 5985 gene locus_tag LOCUS_24020 gene dapB 5188 5985 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257160.1 protein_id gnl|my_center|LOCUS_24020 6496 6032 gene locus_tag LOCUS_24030 6496 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 6641 6877 gene locus_tag LOCUS_24040 6641 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 6874 7443 gene locus_tag LOCUS_24050 6874 7443 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640378.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence232 <1 678 gene locus_tag LOCUS_24060 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811541.1:sigma-54-dependent Fis family transcriptional regulator 1145 774 gene locus_tag LOCUS_24070 1145 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1558 2598 gene locus_tag LOCUS_24080 1558 2598 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109216.1 protein_id gnl|my_center|LOCUS_24080 2868 3914 gene locus_tag LOCUS_24090 2868 3914 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529828.1 protein_id gnl|my_center|LOCUS_24090 4787 3936 gene locus_tag LOCUS_24100 4787 3936 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074942.1 protein_id gnl|my_center|LOCUS_24100 4875 5321 gene locus_tag LOCUS_24110 4875 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 5376 6119 gene locus_tag LOCUS_24120 5376 6119 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_24120 7443 6271 gene locus_tag LOCUS_24130 7443 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence233 <1 930 gene locus_tag LOCUS_24140 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903881.1:BtpA/SgcQ family protein 2141 1053 gene locus_tag LOCUS_24150 2141 1053 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060820.1 protein_id gnl|my_center|LOCUS_24150 3589 2177 gene locus_tag LOCUS_24160 gene hydA 3589 2177 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393493.1 protein_id gnl|my_center|LOCUS_24160 4797 3721 gene locus_tag LOCUS_24170 4797 3721 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_24170 5902 4910 gene locus_tag LOCUS_24180 5902 4910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371220.1 protein_id gnl|my_center|LOCUS_24180 6697 6056 gene locus_tag LOCUS_24190 6697 6056 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266621.1 protein_id gnl|my_center|LOCUS_24190 <7518 6827 gene locus_tag LOCUS_24200 <7518 6827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339532.1:substrate-binding domain-containing protein >Feature sequence234 684 1433 gene locus_tag LOCUS_24210 684 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 1824 1600 gene locus_tag LOCUS_24220 1824 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 1945 2445 gene locus_tag LOCUS_24230 1945 2445 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391105.1 protein_id gnl|my_center|LOCUS_24230 3383 2472 gene locus_tag LOCUS_24240 3383 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 3382 3714 gene locus_tag LOCUS_24250 3382 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 3897 3721 gene locus_tag LOCUS_24260 3897 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 3818 4582 gene locus_tag LOCUS_24270 3818 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 5005 4586 gene locus_tag LOCUS_24280 5005 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 5955 5185 gene locus_tag LOCUS_24290 5955 5185 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_24290 7201 5975 gene locus_tag LOCUS_24300 7201 5975 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839725.1 protein_id gnl|my_center|LOCUS_24300 >Feature sequence235 2274 1357 gene locus_tag LOCUS_24310 2274 1357 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544987.1 protein_id gnl|my_center|LOCUS_24310 2615 2277 gene locus_tag LOCUS_24320 2615 2277 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123088.1 protein_id gnl|my_center|LOCUS_24320 2919 3347 gene locus_tag LOCUS_24330 gene trxC 2919 3347 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_24330 4370 3405 gene locus_tag LOCUS_24340 4370 3405 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035362.1 protein_id gnl|my_center|LOCUS_24340 4361 7000 gene locus_tag LOCUS_24350 4361 7000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_24350 7014 7355 gene locus_tag LOCUS_24360 7014 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence236 1227 544 gene locus_tag LOCUS_24370 1227 544 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_24370 2608 1220 gene locus_tag LOCUS_24380 gene secY 2608 1220 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_24380 3054 2611 gene locus_tag LOCUS_24390 gene rplO 3054 2611 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766081.1 protein_id gnl|my_center|LOCUS_24390 3266 3060 gene locus_tag LOCUS_24400 gene rpmD 3266 3060 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810130.1 protein_id gnl|my_center|LOCUS_24400 3792 3259 gene locus_tag LOCUS_24410 gene rpsE 3792 3259 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_24410 4252 3878 gene locus_tag LOCUS_24420 gene rplR 4252 3878 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459106.1 protein_id gnl|my_center|LOCUS_24420 4865 4326 gene locus_tag LOCUS_24430 gene rplF 4865 4326 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403673.1 protein_id gnl|my_center|LOCUS_24430 5352 4948 gene locus_tag LOCUS_24440 gene rpsH 5352 4948 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925182.1 protein_id gnl|my_center|LOCUS_24440 5641 5456 gene locus_tag LOCUS_24450 gene rpsN 5641 5456 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156488.1 protein_id gnl|my_center|LOCUS_24450 6204 5662 gene locus_tag LOCUS_24460 gene rplE 6204 5662 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_24460 6533 6201 gene locus_tag LOCUS_24470 gene rplX 6533 6201 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_24470 6984 6616 gene locus_tag LOCUS_24480 gene rplN 6984 6616 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854312.1 protein_id gnl|my_center|LOCUS_24480 7241 6987 gene locus_tag LOCUS_24490 gene rpsQ 7241 6987 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_24490 7432 7241 gene locus_tag LOCUS_24500 gene rpmC 7432 7241 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288664.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence237 <1 1996 gene locus_tag LOCUS_24510 <1 1996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275117.1:DUF4175 domain-containing protein 2064 3788 gene locus_tag LOCUS_24520 2064 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 3785 4663 gene locus_tag LOCUS_24530 gene xerD 3785 4663 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_24530 4785 5936 gene locus_tag LOCUS_24540 gene metK 4785 5936 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence238 3474 3040 gene locus_tag LOCUS_24550 3474 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24550 4112 3477 gene locus_tag LOCUS_24560 4112 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 4319 4395 gene locus_tag LOCUS_t00160 4319 4395 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6353 4572 gene locus_tag LOCUS_24570 6353 4572 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223305.1 protein_id gnl|my_center|LOCUS_24570 7402 6503 gene locus_tag LOCUS_24580 7402 6503 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence239 3054 1462 gene locus_tag LOCUS_24590 3054 1462 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 protein_id gnl|my_center|LOCUS_24590 3253 4452 gene locus_tag LOCUS_24600 3253 4452 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529879.1 protein_id gnl|my_center|LOCUS_24600 5670 4579 gene locus_tag LOCUS_24610 5670 4579 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929288.1 protein_id gnl|my_center|LOCUS_24610 5732 7054 gene locus_tag LOCUS_24620 5732 7054 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681529.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence240 <1 798 gene locus_tag LOCUS_24630 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202760.1:ATP-binding protein 1036 2220 gene locus_tag LOCUS_24640 1036 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 3043 2159 gene locus_tag LOCUS_24650 3043 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 3687 3046 gene locus_tag LOCUS_24660 3687 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 4200 3688 gene locus_tag LOCUS_24670 gene hpt 4200 3688 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_24670 5588 4197 gene locus_tag LOCUS_24680 5588 4197 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261780.1 protein_id gnl|my_center|LOCUS_24680 5710 6333 gene locus_tag LOCUS_24690 gene upp 5710 6333 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583176.1 protein_id gnl|my_center|LOCUS_24690 6320 7171 gene locus_tag LOCUS_24700 6320 7171 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880039.1 protein_id gnl|my_center|LOCUS_24700 7271 7345 gene locus_tag LOCUS_t00170 7271 7345 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence241 489 1529 gene locus_tag LOCUS_24710 gene queA 489 1529 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_24710 1593 2525 gene locus_tag LOCUS_24720 1593 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_24720 2629 2705 gene locus_tag LOCUS_t00180 2629 2705 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2831 4258 gene locus_tag LOCUS_24730 gene tilS 2831 4258 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_24730 4255 6189 gene locus_tag LOCUS_24740 gene ftsH 4255 6189 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_24740 6259 7125 gene locus_tag LOCUS_24750 gene folP 6259 7125 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_24750 7204 7386 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttcaatggggccggcgatgttcatcgccggagat >Feature sequence242 <1 1250 gene locus_tag LOCUS_24760 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940822.1:type IV pilus twitching motility protein PilT 1259 1711 gene locus_tag LOCUS_24770 1259 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 1759 4470 gene locus_tag LOCUS_24780 gene alaS 1759 4470 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_24780 4600 5307 gene locus_tag LOCUS_24790 4600 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 5695 5994 gene locus_tag LOCUS_24800 5695 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 6581 6102 gene locus_tag LOCUS_24810 6581 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence243 1000 497 gene locus_tag LOCUS_24820 1000 497 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 protein_id gnl|my_center|LOCUS_24820 1047 2330 gene locus_tag LOCUS_24830 1047 2330 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_24830 3312 2647 gene locus_tag LOCUS_24840 3312 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 4396 3434 gene locus_tag LOCUS_24850 4396 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 4649 5872 gene locus_tag LOCUS_24860 4649 5872 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867946.1 protein_id gnl|my_center|LOCUS_24860 5872 6942 gene locus_tag LOCUS_24870 5872 6942 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_24870 7036 7362 gene locus_tag LOCUS_24880 7036 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence244 381 25 gene locus_tag LOCUS_24890 381 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 745 434 gene locus_tag LOCUS_24900 745 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1615 776 gene locus_tag LOCUS_24910 1615 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 2216 1758 gene locus_tag LOCUS_24920 gene cueR 2216 1758 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095248.1 protein_id gnl|my_center|LOCUS_24920 2614 3663 gene locus_tag LOCUS_24930 2614 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 4063 4746 gene locus_tag LOCUS_24940 4063 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 5264 4890 gene locus_tag LOCUS_24950 5264 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 5545 5261 gene locus_tag LOCUS_24960 5545 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 5772 6431 gene locus_tag LOCUS_24970 5772 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244421.1 protein_id gnl|my_center|LOCUS_24970 <7370 6506 gene locus_tag LOCUS_24980 <7370 6506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162006391.1:heavy metal translocating P-type ATPase >Feature sequence245 <1 1616 gene locus_tag LOCUS_24990 <1 1616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972893.1:aminotransferase class V-fold PLP-dependent enzyme 2981 1677 gene locus_tag LOCUS_25000 2981 1677 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_25000 4818 2995 gene locus_tag LOCUS_25010 4818 2995 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_25010 5141 4815 gene locus_tag LOCUS_25020 5141 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 6304 5195 gene locus_tag LOCUS_25030 6304 5195 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804021.1 protein_id gnl|my_center|LOCUS_25030 6823 6350 gene locus_tag LOCUS_25040 6823 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence246 656 90 gene locus_tag LOCUS_25050 656 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 877 653 gene locus_tag LOCUS_25060 877 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 1423 1016 gene locus_tag LOCUS_25070 1423 1016 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528798.1 protein_id gnl|my_center|LOCUS_25070 2088 1522 gene locus_tag LOCUS_25080 2088 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2563 3705 gene locus_tag LOCUS_25090 2563 3705 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141892.1 protein_id gnl|my_center|LOCUS_25090 3844 4104 gene locus_tag LOCUS_25100 3844 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25100 4065 4562 gene locus_tag LOCUS_25110 4065 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25110 4453 5754 gene locus_tag LOCUS_25120 4453 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 5806 6393 gene locus_tag LOCUS_25130 5806 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 <7367 6656 gene locus_tag LOCUS_25140 <7367 6656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_150670707.1:DUF4011 domain-containing protein >Feature sequence247 1181 27 gene locus_tag LOCUS_25150 1181 27 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_25150 2338 1175 gene locus_tag LOCUS_25160 2338 1175 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257466.1 protein_id gnl|my_center|LOCUS_25160 3882 2335 gene locus_tag LOCUS_25170 3882 2335 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886617.1 protein_id gnl|my_center|LOCUS_25170 5255 3879 gene locus_tag LOCUS_25180 5255 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 6373 5252 gene locus_tag LOCUS_25190 6373 5252 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925739.1 protein_id gnl|my_center|LOCUS_25190 <7365 6370 gene locus_tag LOCUS_25200 <7365 6370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973141.1:glycosyltransferase family 4 protein >Feature sequence248 831 82 gene locus_tag LOCUS_25210 831 82 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_25210 1924 824 gene locus_tag LOCUS_25220 1924 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2611 1931 gene locus_tag LOCUS_25230 2611 1931 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109111.1 protein_id gnl|my_center|LOCUS_25230 3360 2782 gene locus_tag LOCUS_25240 3360 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 3548 5953 gene locus_tag LOCUS_25250 3548 5953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_25250 6017 6760 gene locus_tag LOCUS_25260 6017 6760 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_25260 7155 6775 gene locus_tag LOCUS_25270 7155 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 >Feature sequence249 <1 1498 gene locus_tag LOCUS_25280 <1 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942207.1:PBP1A family penicillin-binding protein 1673 2686 gene locus_tag LOCUS_25290 gene holB 1673 2686 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_25290 2726 3532 gene locus_tag LOCUS_25300 2726 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 3487 4416 gene locus_tag LOCUS_25310 gene pdxA 3487 4416 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399975.1 protein_id gnl|my_center|LOCUS_25310 4409 4885 gene locus_tag LOCUS_25320 gene smpB 4409 4885 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_25320 4935 5483 gene locus_tag LOCUS_25330 4935 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 5480 6607 gene locus_tag LOCUS_25340 5480 6607 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence250 868 1692 gene locus_tag LOCUS_25350 868 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 2183 1761 gene locus_tag LOCUS_25360 2183 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2291 3091 gene locus_tag LOCUS_25370 2291 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 3432 3118 gene locus_tag LOCUS_25380 3432 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3529 3756 gene locus_tag LOCUS_25390 3529 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 3698 4957 gene locus_tag LOCUS_25400 gene hpxK 3698 4957 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705408.1 protein_id gnl|my_center|LOCUS_25400 5118 5867 gene locus_tag LOCUS_25410 5118 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 6439 6765 gene locus_tag LOCUS_25420 6439 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence251 217 77 gene locus_tag LOCUS_25430 217 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 868 2619 gene locus_tag LOCUS_25440 868 2619 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_25440 2682 5969 gene locus_tag LOCUS_25450 2682 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 6045 6887 gene locus_tag LOCUS_25460 6045 6887 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529511.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence252 2454 5906 gene locus_tag LOCUS_25470 2454 5906 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839229.1 protein_id gnl|my_center|LOCUS_25470 5914 6639 gene locus_tag LOCUS_25480 5914 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence253 2395 1067 gene locus_tag LOCUS_25490 2395 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 3985 2402 gene locus_tag LOCUS_25500 3985 2402 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_25500 4763 4002 gene locus_tag LOCUS_25510 gene gldF 4763 4002 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_25510 5769 4756 gene locus_tag LOCUS_25520 5769 4756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_25520 5972 6217 gene locus_tag LOCUS_25530 5972 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence254 421 251 gene locus_tag LOCUS_25540 421 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 817 2973 gene locus_tag LOCUS_25550 817 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2983 3369 gene locus_tag LOCUS_25560 2983 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 3381 4454 gene locus_tag LOCUS_25570 3381 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 4477 4893 gene locus_tag LOCUS_25580 4477 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 4903 6195 gene locus_tag LOCUS_25590 4903 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence255 2014 368 gene locus_tag LOCUS_25600 gene rng 2014 368 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_25600 3317 2211 gene locus_tag LOCUS_25610 gene rodA 3317 2211 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_25610 5272 3353 gene locus_tag LOCUS_25620 gene mrdA 5272 3353 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_25620 5793 5275 gene locus_tag LOCUS_25630 5793 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 6662 5790 gene locus_tag LOCUS_25640 gene mreC 6662 5790 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence256 965 57 gene locus_tag LOCUS_25650 965 57 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296290.1 protein_id gnl|my_center|LOCUS_25650 1642 962 gene locus_tag LOCUS_25660 1642 962 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_25660 3591 1639 gene locus_tag LOCUS_25670 3591 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 3877 4881 gene locus_tag LOCUS_25680 3877 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence257 <1 648 gene locus_tag LOCUS_25690 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028054184.1:tetratricopeptide repeat protein 648 1754 gene locus_tag LOCUS_25700 648 1754 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890422.1 protein_id gnl|my_center|LOCUS_25700 1783 2640 gene locus_tag LOCUS_25710 1783 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 3310 3630 gene locus_tag LOCUS_25720 3310 3630 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356630.1 protein_id gnl|my_center|LOCUS_25720 3630 6344 gene locus_tag LOCUS_25730 3630 6344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_25730 6337 6918 gene locus_tag LOCUS_25740 6337 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence258 3334 209 gene locus_tag LOCUS_25750 3334 209 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_25750 5819 3339 gene locus_tag LOCUS_25760 5819 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence259 <1 3236 gene locus_tag LOCUS_25770 <1 3236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201854.1:S41 family peptidase 4475 3285 gene locus_tag LOCUS_25780 4475 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 4975 4472 gene locus_tag LOCUS_25790 gene rpoE 4975 4472 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_25790 5096 6622 gene locus_tag LOCUS_25800 5096 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence260 <1 2048 gene locus_tag LOCUS_25810 <1 2048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870228.1:helicase-related protein 2045 5320 gene locus_tag LOCUS_25820 2045 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 5333 6856 gene locus_tag LOCUS_25830 gene nrfD 5333 6856 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence261 2762 1377 gene locus_tag LOCUS_25840 2762 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 4070 2955 gene locus_tag LOCUS_25850 4070 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 4798 4085 gene locus_tag LOCUS_25860 4798 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence262 1686 82 gene locus_tag LOCUS_25870 gene purH 1686 82 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721490.1 protein_id gnl|my_center|LOCUS_25870 1956 2162 gene locus_tag LOCUS_25880 gene cspD 1956 2162 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193054.1 protein_id gnl|my_center|LOCUS_25880 2846 2244 gene locus_tag LOCUS_25890 2846 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3386 2958 gene locus_tag LOCUS_25900 3386 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 3621 5021 gene locus_tag LOCUS_25910 gene selA 3621 5021 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_25910 5205 7025 gene locus_tag LOCUS_25920 5205 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence263 3 1406 gene locus_tag LOCUS_25930 3 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 1546 1833 gene locus_tag LOCUS_25940 1546 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1834 3570 gene locus_tag LOCUS_25950 1834 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 5178 4567 gene locus_tag LOCUS_25960 5178 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 5503 6954 gene locus_tag LOCUS_25970 5503 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence264 280 2913 gene locus_tag LOCUS_25980 280 2913 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_25980 2960 5272 gene locus_tag LOCUS_25990 gene hrpB 2960 5272 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_25990 6391 5339 gene locus_tag LOCUS_26000 6391 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence265 456 145 gene locus_tag LOCUS_26010 456 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 811 446 gene locus_tag LOCUS_26020 811 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1310 2635 gene locus_tag LOCUS_26030 gene dnaA 1310 2635 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_26030 2932 4065 gene locus_tag LOCUS_26040 gene dnaN 2932 4065 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097262.1 protein_id gnl|my_center|LOCUS_26040 4202 6775 gene locus_tag LOCUS_26050 4202 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence266 2980 1949 gene locus_tag LOCUS_26060 gene glk 2980 1949 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_26060 3069 3938 gene locus_tag LOCUS_26070 3069 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 4275 3946 gene locus_tag LOCUS_26080 4275 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 5444 4275 gene locus_tag LOCUS_26090 5444 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 5774 5556 gene locus_tag LOCUS_26100 gene infA 5774 5556 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_26100 <7013 5841 gene locus_tag LOCUS_26110 <7013 5841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942320.1:AMP-binding protein >Feature sequence267 95 346 gene locus_tag LOCUS_26120 95 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2566 455 gene locus_tag LOCUS_26130 2566 455 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_26130 6000 2572 gene locus_tag LOCUS_26140 6000 2572 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_26140 6953 6105 gene locus_tag LOCUS_26150 6953 6105 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence268 882 331 gene locus_tag LOCUS_26160 882 331 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928824.1 protein_id gnl|my_center|LOCUS_26160 1522 950 gene locus_tag LOCUS_26170 1522 950 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014279.1 protein_id gnl|my_center|LOCUS_26170 1740 2243 gene locus_tag LOCUS_26180 1740 2243 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949067.1 protein_id gnl|my_center|LOCUS_26180 4154 2313 gene locus_tag LOCUS_26190 gene typA 4154 2313 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_26190 4830 4270 gene locus_tag LOCUS_26200 4830 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 5230 5805 gene locus_tag LOCUS_26210 5230 5805 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_26210 5802 6602 gene locus_tag LOCUS_26220 5802 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence269 1 174 gene locus_tag LOCUS_26230 1 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 321 1589 gene locus_tag LOCUS_26240 321 1589 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037551.1 protein_id gnl|my_center|LOCUS_26240 2347 1586 gene locus_tag LOCUS_26250 2347 1586 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_26250 4122 2356 gene locus_tag LOCUS_26260 4122 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 4931 4230 gene locus_tag LOCUS_26270 4931 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 6799 5000 gene locus_tag LOCUS_26280 6799 5000 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence270 <1 920 gene locus_tag LOCUS_26290 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528460.1:AI-2E family transporter 1400 930 gene locus_tag LOCUS_26300 1400 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 1461 3605 gene locus_tag LOCUS_26310 gene glgX 1461 3605 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 protein_id gnl|my_center|LOCUS_26310 3612 5726 gene locus_tag LOCUS_26320 3612 5726 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence271 675 310 gene locus_tag LOCUS_26330 675 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 611 1555 gene locus_tag LOCUS_26340 611 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1558 3987 gene locus_tag LOCUS_26350 1558 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 6120 4435 gene locus_tag LOCUS_26360 6120 4435 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989371.1 protein_id gnl|my_center|LOCUS_26360 <6862 6242 gene locus_tag LOCUS_26370 <6862 6242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000934214.1:alpha,alpha-trehalase >Feature sequence272 319 140 gene locus_tag LOCUS_26380 319 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1909 338 gene locus_tag LOCUS_26390 1909 338 CDS product acyl--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728060.1 protein_id gnl|my_center|LOCUS_26390 2044 3030 gene locus_tag LOCUS_26400 2044 3030 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807628.1 protein_id gnl|my_center|LOCUS_26400 3340 3083 gene locus_tag LOCUS_26410 3340 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 3418 4635 gene locus_tag LOCUS_26420 3418 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 4632 5822 gene locus_tag LOCUS_26430 4632 5822 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144157.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence273 389 625 gene locus_tag LOCUS_26440 389 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 748 1023 gene locus_tag LOCUS_26450 748 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 1195 1995 gene locus_tag LOCUS_26460 1195 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 5388 2215 gene locus_tag LOCUS_26470 5388 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence274 445 215 gene locus_tag LOCUS_26480 445 215 CDS product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 protein_id gnl|my_center|LOCUS_26480 351 680 gene locus_tag LOCUS_26490 351 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1174 677 gene locus_tag LOCUS_26500 1174 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 4317 1180 gene locus_tag LOCUS_26510 4317 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 4743 4402 gene locus_tag LOCUS_26520 4743 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 5042 4740 gene locus_tag LOCUS_26530 5042 4740 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414042.1 protein_id gnl|my_center|LOCUS_26530 5179 6465 gene locus_tag LOCUS_26540 5179 6465 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921346.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence275 3157 2114 gene locus_tag LOCUS_26550 3157 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 3497 3291 gene locus_tag LOCUS_26560 3497 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 3402 3755 gene locus_tag LOCUS_26570 3402 3755 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257824.1 protein_id gnl|my_center|LOCUS_26570 3752 4714 gene locus_tag LOCUS_26580 3752 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 4737 6500 gene locus_tag LOCUS_26590 4737 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence276 1 789 gene locus_tag LOCUS_26600 1 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 931 707 gene locus_tag LOCUS_26610 931 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 1848 1549 gene locus_tag LOCUS_26620 1848 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26620 2303 1845 gene locus_tag LOCUS_26630 2303 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 3325 2300 gene locus_tag LOCUS_26640 3325 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 4426 3329 gene locus_tag LOCUS_26650 4426 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 5160 4438 gene locus_tag LOCUS_26660 5160 4438 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475395.1 protein_id gnl|my_center|LOCUS_26660 6396 5176 gene locus_tag LOCUS_26670 6396 5176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214357246.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence277 1065 1301 gene locus_tag LOCUS_26680 1065 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1725 1342 gene locus_tag LOCUS_26690 1725 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 2042 4678 gene locus_tag LOCUS_26700 2042 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 <6763 4714 gene locus_tag LOCUS_26710 <6763 4714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008669087.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence278 1079 989 gene locus_tag LOCUS_t00190 1079 989 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1660 1214 gene locus_tag LOCUS_26720 gene tadA 1660 1214 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297409.1 protein_id gnl|my_center|LOCUS_26720 3251 2136 gene locus_tag LOCUS_26730 gene glf 3251 2136 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872005.1 protein_id gnl|my_center|LOCUS_26730 4220 3267 gene locus_tag LOCUS_26740 4220 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 4125 4397 gene locus_tag LOCUS_26750 4125 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 5510 4446 gene locus_tag LOCUS_26760 gene galK 5510 4446 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228053.1 protein_id gnl|my_center|LOCUS_26760 6612 5503 gene locus_tag LOCUS_26770 gene galT 6612 5503 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229184.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence279 1412 909 gene locus_tag LOCUS_26780 1412 909 CDS product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618916.1 protein_id gnl|my_center|LOCUS_26780 2680 1409 gene locus_tag LOCUS_26790 gene fabF 2680 1409 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_26790 2711 3412 gene locus_tag LOCUS_26800 2711 3412 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173676.1 protein_id gnl|my_center|LOCUS_26800 3531 5849 gene locus_tag LOCUS_26810 gene lon 3531 5849 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence280 335 81 gene locus_tag LOCUS_26820 gene rpsQ 335 81 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_26820 526 335 gene locus_tag LOCUS_26830 gene rpmC 526 335 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869921.1 protein_id gnl|my_center|LOCUS_26830 948 523 gene locus_tag LOCUS_26840 gene rplP 948 523 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_26840 1770 1081 gene locus_tag LOCUS_26850 gene rpsC 1770 1081 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_26850 2350 1877 gene locus_tag LOCUS_26860 gene rplV 2350 1877 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727673.1 protein_id gnl|my_center|LOCUS_26860 2653 2354 gene locus_tag LOCUS_26870 gene rpsS 2653 2354 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909214.1 protein_id gnl|my_center|LOCUS_26870 3559 2735 gene locus_tag LOCUS_26880 gene rplB 3559 2735 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_26880 3951 3661 gene locus_tag LOCUS_26890 gene rplW 3951 3661 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617544.1 protein_id gnl|my_center|LOCUS_26890 4595 3975 gene locus_tag LOCUS_26900 gene rplD 4595 3975 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_26900 5380 4679 gene locus_tag LOCUS_26910 gene rplC 5380 4679 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869928.1 protein_id gnl|my_center|LOCUS_26910 5799 5464 gene locus_tag LOCUS_26920 gene rpsJ 5799 5464 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_26920 <6743 5917 gene locus_tag LOCUS_26930 <6743 5917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393940.1:elongation factor G >Feature sequence281 3727 2168 gene locus_tag LOCUS_26940 3727 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 5010 3724 gene locus_tag LOCUS_26950 5010 3724 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_26950 5804 5007 gene locus_tag LOCUS_26960 5804 5007 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_26960 6466 5801 gene locus_tag LOCUS_26970 6466 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence282 209 3205 gene locus_tag LOCUS_26980 209 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 6264 3337 gene locus_tag LOCUS_26990 6264 3337 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839612.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence283 2099 159 gene locus_tag LOCUS_27000 2099 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 3110 2115 gene locus_tag LOCUS_27010 3110 2115 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546520.1 protein_id gnl|my_center|LOCUS_27010 3862 3092 gene locus_tag LOCUS_27020 gene rfbF 3862 3092 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435696.1 protein_id gnl|my_center|LOCUS_27020 4072 6345 gene locus_tag LOCUS_27030 4072 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence284 2401 2132 gene locus_tag LOCUS_27040 gene rpsO 2401 2132 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_27040 3412 2483 gene locus_tag LOCUS_27050 gene truB 3412 2483 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_27050 4527 3496 gene locus_tag LOCUS_27060 4527 3496 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_27060 4915 4505 gene locus_tag LOCUS_27070 gene rbfA 4915 4505 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_27070 <6682 4937 gene locus_tag LOCUS_27080 <6682 4937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000036341.1:translation initiation factor IF-2 >Feature sequence285 2692 482 gene locus_tag LOCUS_27090 2692 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 3928 2708 gene locus_tag LOCUS_27100 3928 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 4258 3983 gene locus_tag LOCUS_27110 4258 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence286 1809 988 gene locus_tag LOCUS_27120 1809 988 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807015.1 protein_id gnl|my_center|LOCUS_27120 1867 3204 gene locus_tag LOCUS_27130 1867 3204 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_27130 3201 3572 gene locus_tag LOCUS_27140 3201 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 3704 4150 gene locus_tag LOCUS_27150 3704 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 4268 4963 gene locus_tag LOCUS_27160 4268 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 4977 5960 gene locus_tag LOCUS_27170 4977 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 5939 6211 gene locus_tag LOCUS_27180 5939 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 6212 6427 gene locus_tag LOCUS_27190 6212 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence287 3224 300 gene locus_tag LOCUS_27200 3224 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 3559 4158 gene locus_tag LOCUS_27210 3559 4158 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence288 1311 535 gene locus_tag LOCUS_27220 1311 535 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878638.1 protein_id gnl|my_center|LOCUS_27220 2891 1308 gene locus_tag LOCUS_27230 2891 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 4240 2870 gene locus_tag LOCUS_27240 4240 2870 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_27240 5142 4249 gene locus_tag LOCUS_27250 5142 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence289 1810 212 gene locus_tag LOCUS_27260 1810 212 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_27260 4429 1991 gene locus_tag LOCUS_27270 4429 1991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_27270 4566 5171 gene locus_tag LOCUS_27280 4566 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence290 <1 1916 gene locus_tag LOCUS_27290 <1 1916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118166.1:amidohydrolase 1980 3335 gene locus_tag LOCUS_27300 1980 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3380 4651 gene locus_tag LOCUS_27310 3380 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 5069 4686 gene locus_tag LOCUS_27320 5069 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 <6539 5111 gene locus_tag LOCUS_27330 <6539 5111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003820458.1:MFS transporter >Feature sequence291 87 998 gene locus_tag LOCUS_27340 87 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 1002 2363 gene locus_tag LOCUS_27350 gene glmM 1002 2363 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_27350 2368 3078 gene locus_tag LOCUS_27360 2368 3078 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_27360 3080 3826 gene locus_tag LOCUS_27370 3080 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 3860 4471 gene locus_tag LOCUS_27380 3860 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 4476 4727 gene locus_tag LOCUS_27390 4476 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 4727 5563 gene locus_tag LOCUS_27400 4727 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 5682 5975 gene locus_tag LOCUS_27410 gene eutM 5682 5975 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_27410 5972 6247 gene locus_tag LOCUS_27420 gene eutN 5972 6247 CDS product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762193.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence292 2379 148 gene locus_tag LOCUS_27430 2379 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 2827 2369 gene locus_tag LOCUS_27440 2827 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 3048 3512 gene locus_tag LOCUS_27450 3048 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 3604 4050 gene locus_tag LOCUS_27460 3604 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 4801 4244 gene locus_tag LOCUS_27470 4801 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 5412 4834 gene locus_tag LOCUS_27480 5412 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 6289 5315 gene locus_tag LOCUS_27490 6289 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence293 2553 1300 gene locus_tag LOCUS_27500 2553 1300 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_27500 2689 4389 gene locus_tag LOCUS_27510 2689 4389 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_27510 5652 4435 gene locus_tag LOCUS_27520 5652 4435 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_27520 5722 5976 gene locus_tag LOCUS_27530 5722 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence294 1685 390 gene locus_tag LOCUS_27540 1685 390 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957943.1 protein_id gnl|my_center|LOCUS_27540 1794 3311 gene locus_tag LOCUS_27550 gene hutH 1794 3311 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_27550 3469 5064 gene locus_tag LOCUS_27560 gene hutU 3469 5064 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256864.1 protein_id gnl|my_center|LOCUS_27560 5061 6227 gene locus_tag LOCUS_27570 5061 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence295 46 840 gene locus_tag LOCUS_27580 46 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 1388 831 gene locus_tag LOCUS_27590 gene pgsA 1388 831 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_27590 1501 2571 gene locus_tag LOCUS_27600 1501 2571 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258545.1 protein_id gnl|my_center|LOCUS_27600 2568 3923 gene locus_tag LOCUS_27610 2568 3923 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_27610 4076 4149 gene locus_tag LOCUS_t00200 4076 4149 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4364 4200 gene locus_tag LOCUS_27620 4364 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 4967 5152 gene locus_tag LOCUS_27630 4967 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 5255 5518 gene locus_tag LOCUS_27640 5255 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 5532 5756 gene locus_tag LOCUS_27650 5532 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence296 1693 473 gene locus_tag LOCUS_27660 1693 473 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_27660 2898 1714 gene locus_tag LOCUS_27670 2898 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 4064 2895 gene locus_tag LOCUS_27680 4064 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 5191 4055 gene locus_tag LOCUS_27690 5191 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 <6448 5212 gene locus_tag LOCUS_27700 <6448 5212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027080.1:glycosyltransferase >Feature sequence297 <1 849 gene locus_tag LOCUS_27710 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938141.1:signal recognition particle protein 957 1235 gene locus_tag LOCUS_27720 gene rpsP 957 1235 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_27720 1232 1477 gene locus_tag LOCUS_27730 1232 1477 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_27730 1467 1991 gene locus_tag LOCUS_27740 gene rimM 1467 1991 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111677.1 protein_id gnl|my_center|LOCUS_27740 2129 2890 gene locus_tag LOCUS_27750 gene trmD 2129 2890 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_27750 2932 3282 gene locus_tag LOCUS_27760 gene rplS 2932 3282 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_27760 3398 4021 gene locus_tag LOCUS_27770 gene rnhB 3398 4021 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262424.1 protein_id gnl|my_center|LOCUS_27770 4036 5880 gene locus_tag LOCUS_27780 4036 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 5943 6143 gene locus_tag LOCUS_27790 5943 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence298 <1 908 gene locus_tag LOCUS_27800 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016327302.1:ABC transporter ATP-binding protein 924 1670 gene locus_tag LOCUS_27810 924 1670 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421578.1 protein_id gnl|my_center|LOCUS_27810 1788 2264 gene locus_tag LOCUS_27820 1788 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2808 3158 gene locus_tag LOCUS_27830 2808 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 3372 6107 gene locus_tag LOCUS_27840 3372 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence299 145 1347 gene locus_tag LOCUS_27850 145 1347 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064263.1 protein_id gnl|my_center|LOCUS_27850 2050 1361 gene locus_tag LOCUS_27860 2050 1361 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_27860 2202 2984 gene locus_tag LOCUS_27870 2202 2984 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087141.1 protein_id gnl|my_center|LOCUS_27870 3971 3060 gene locus_tag LOCUS_27880 3971 3060 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_27880 5481 3973 gene locus_tag LOCUS_27890 5481 3973 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_27890 <6404 5483 gene locus_tag LOCUS_27900 <6404 5483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838655.1:deoxyribose-phosphate aldolase >Feature sequence300 4 369 gene locus_tag LOCUS_27910 4 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 1743 895 gene locus_tag LOCUS_27920 1743 895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209786.1 protein_id gnl|my_center|LOCUS_27920 2582 1722 gene locus_tag LOCUS_27930 2582 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 3628 2579 gene locus_tag LOCUS_27940 3628 2579 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086070.1 protein_id gnl|my_center|LOCUS_27940 4755 3625 gene locus_tag LOCUS_27950 4755 3625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530249.1 protein_id gnl|my_center|LOCUS_27950 5196 5762 gene locus_tag LOCUS_27960 5196 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 5775 6275 gene locus_tag LOCUS_27970 5775 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 >Feature sequence301 <1 593 gene locus_tag LOCUS_27980 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339537.1:BtpA/SgcQ family protein 611 1426 gene locus_tag LOCUS_27990 611 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 1497 3278 gene locus_tag LOCUS_28000 1497 3278 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_28000 3275 4117 gene locus_tag LOCUS_28010 3275 4117 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255779.1 protein_id gnl|my_center|LOCUS_28010 4174 5100 gene locus_tag LOCUS_28020 4174 5100 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence302 1257 136 gene locus_tag LOCUS_28030 gene thiO 1257 136 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921239.1 protein_id gnl|my_center|LOCUS_28030 1329 1874 gene locus_tag LOCUS_28040 1329 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 4944 1963 gene locus_tag LOCUS_28050 4944 1963 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918869.1 protein_id gnl|my_center|LOCUS_28050 5036 6199 gene locus_tag LOCUS_28060 5036 6199 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268643.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence303 1 309 gene locus_tag LOCUS_28070 1 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 306 974 gene locus_tag LOCUS_28080 306 974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_28080 971 3559 gene locus_tag LOCUS_28090 971 3559 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_28090 3702 4049 gene locus_tag LOCUS_28100 gene dksA 3702 4049 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881370.1 protein_id gnl|my_center|LOCUS_28100 4046 4531 gene locus_tag LOCUS_28110 4046 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 4585 5058 gene locus_tag LOCUS_28120 gene folK 4585 5058 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_28120 5704 5192 gene locus_tag LOCUS_28130 5704 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 <6356 5749 gene locus_tag LOCUS_28140 <6356 5749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786907.1:ABC transporter permease >Feature sequence304 1768 506 gene locus_tag LOCUS_28150 1768 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28150 1682 1993 gene locus_tag LOCUS_28160 1682 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 2471 2187 gene locus_tag LOCUS_28170 2471 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 2983 2519 gene locus_tag LOCUS_28180 2983 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 3449 2988 gene locus_tag LOCUS_28190 3449 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 4641 4159 gene locus_tag LOCUS_28200 4641 4159 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970650.1 protein_id gnl|my_center|LOCUS_28200 5159 4659 gene locus_tag LOCUS_28210 5159 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 5752 5156 gene locus_tag LOCUS_28220 5752 5156 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840723.1 protein_id gnl|my_center|LOCUS_28220 >Feature sequence305 1017 37 gene locus_tag LOCUS_28230 1017 37 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 protein_id gnl|my_center|LOCUS_28230 2564 1011 gene locus_tag LOCUS_28240 2564 1011 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_28240 2445 3917 gene locus_tag LOCUS_28250 2445 3917 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_28250 5286 3928 gene locus_tag LOCUS_28260 5286 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 5354 6178 gene locus_tag LOCUS_28270 5354 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence306 499 161 gene locus_tag LOCUS_28280 499 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 1098 631 gene locus_tag LOCUS_28290 1098 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 2745 1180 gene locus_tag LOCUS_28300 2745 1180 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803772.1 protein_id gnl|my_center|LOCUS_28300 2719 4059 gene locus_tag LOCUS_28310 2719 4059 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_28310 4106 4855 gene locus_tag LOCUS_28320 4106 4855 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836211.1 protein_id gnl|my_center|LOCUS_28320 <6325 4891 gene locus_tag LOCUS_28330 <6325 4891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040461.1:M81 family metallopeptidase >Feature sequence307 1574 1395 gene locus_tag LOCUS_28340 1574 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 1704 2126 gene locus_tag LOCUS_28350 1704 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 2123 2617 gene locus_tag LOCUS_28360 2123 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28360 2662 3060 gene locus_tag LOCUS_28370 2662 3060 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014897.1 protein_id gnl|my_center|LOCUS_28370 3165 3437 gene locus_tag LOCUS_28380 gene rpsT 3165 3437 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 protein_id gnl|my_center|LOCUS_28380 4430 3423 gene locus_tag LOCUS_28390 gene holA 4430 3423 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_28390 4960 4430 gene locus_tag LOCUS_28400 4960 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 <6323 4960 gene locus_tag LOCUS_28410 <6323 4960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942849.1:leucine--tRNA ligase >Feature sequence308 168 425 gene locus_tag LOCUS_28420 168 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 1898 513 gene locus_tag LOCUS_28430 1898 513 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_28430 1956 3635 gene locus_tag LOCUS_28440 1956 3635 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_28440 6184 3719 gene locus_tag LOCUS_28450 6184 3719 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence309 986 6 gene locus_tag LOCUS_28460 986 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 1218 2411 gene locus_tag LOCUS_28470 1218 2411 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268636.1 protein_id gnl|my_center|LOCUS_28470 2425 3621 gene locus_tag LOCUS_28480 2425 3621 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038782.1 protein_id gnl|my_center|LOCUS_28480 3633 5906 gene locus_tag LOCUS_28490 3633 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence310 667 200 gene locus_tag LOCUS_28500 gene tolR 667 200 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_28500 1113 670 gene locus_tag LOCUS_28510 gene tolR 1113 670 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 protein_id gnl|my_center|LOCUS_28510 1885 1205 gene locus_tag LOCUS_28520 gene tolQ 1885 1205 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_28520 2677 1949 gene locus_tag LOCUS_28530 2677 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 5419 2909 gene locus_tag LOCUS_28540 5419 2909 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_28540 6065 5442 gene locus_tag LOCUS_28550 6065 5442 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546603.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence311 357 1373 gene locus_tag LOCUS_28560 357 1373 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976198.1 protein_id gnl|my_center|LOCUS_28560 1373 2353 gene locus_tag LOCUS_28570 1373 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2350 3753 gene locus_tag LOCUS_28580 2350 3753 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225277.1 protein_id gnl|my_center|LOCUS_28580 3998 3768 gene locus_tag LOCUS_28590 3998 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28590 5068 3911 gene locus_tag LOCUS_28600 5068 3911 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28600 5997 5065 gene locus_tag LOCUS_28610 5997 5065 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384840.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence312 <1 1177 gene locus_tag LOCUS_28620 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937589.1:glycosyltransferase 1174 2604 gene locus_tag LOCUS_28630 1174 2604 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_28630 2594 3532 gene locus_tag LOCUS_28640 2594 3532 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_28640 3765 4346 gene locus_tag LOCUS_28650 3765 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 5123 4545 gene locus_tag LOCUS_28660 5123 4545 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_28660 6214 5120 gene locus_tag LOCUS_28670 6214 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 >Feature sequence313 611 1495 gene locus_tag LOCUS_28680 611 1495 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_28680 2127 1528 gene locus_tag LOCUS_28690 gene leuD 2127 1528 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_28690 3526 2117 gene locus_tag LOCUS_28700 gene leuC 3526 2117 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143406.1 protein_id gnl|my_center|LOCUS_28700 3762 3604 gene locus_tag LOCUS_28710 3762 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 3819 6104 gene locus_tag LOCUS_28720 gene pcrA 3819 6104 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_28720 >Feature sequence314 2707 731 gene locus_tag LOCUS_28730 2707 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 4660 2720 gene locus_tag LOCUS_28740 gene asnB 4660 2720 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_28740 <6154 4668 gene locus_tag LOCUS_28750 <6154 4668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222484.1:alginate lyase family protein >Feature sequence315 426 353 gene locus_tag LOCUS_t00210 426 353 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 756 682 gene locus_tag LOCUS_t00220 756 682 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1202 951 gene locus_tag LOCUS_28760 1202 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 1431 1240 gene locus_tag LOCUS_28770 1431 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 1888 1484 gene locus_tag LOCUS_28780 1888 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 4269 2938 gene locus_tag LOCUS_28790 4269 2938 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143837.1 protein_id gnl|my_center|LOCUS_28790 5851 4394 gene locus_tag LOCUS_28800 gene cysS 5851 4394 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869759.1 protein_id gnl|my_center|LOCUS_28800 6144 5869 gene locus_tag LOCUS_28810 6144 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence316 466 56 gene locus_tag LOCUS_28820 466 56 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 protein_id gnl|my_center|LOCUS_28820 530 922 gene locus_tag LOCUS_28830 530 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 1969 1013 gene locus_tag LOCUS_28840 1969 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837916.1 protein_id gnl|my_center|LOCUS_28840 2023 2733 gene locus_tag LOCUS_28850 2023 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 5015 2742 gene locus_tag LOCUS_28860 5015 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence317 411 1877 gene locus_tag LOCUS_28870 411 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28870 2467 3150 gene locus_tag LOCUS_28880 2467 3150 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804572.1 protein_id gnl|my_center|LOCUS_28880 3626 6052 gene locus_tag LOCUS_28890 3626 6052 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence318 1310 480 gene locus_tag LOCUS_28900 1310 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 1354 3081 gene locus_tag LOCUS_28910 1354 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 3068 3910 gene locus_tag LOCUS_28920 3068 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3903 4955 gene locus_tag LOCUS_28930 3903 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 4956 5945 gene locus_tag LOCUS_28940 4956 5945 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703802.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence319 82 279 gene locus_tag LOCUS_28950 82 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 283 1422 gene locus_tag LOCUS_28960 283 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 1510 1434 gene locus_tag LOCUS_t00230 1510 1434 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1767 1692 gene locus_tag LOCUS_t00240 1767 1692 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2326 1820 gene locus_tag LOCUS_28970 2326 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 3407 2391 gene locus_tag LOCUS_28980 gene waaF 3407 2391 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_28980 3871 3404 gene locus_tag LOCUS_28990 gene rfaE2 3871 3404 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057432.1 protein_id gnl|my_center|LOCUS_28990 4886 3864 gene locus_tag LOCUS_29000 gene rfaE1 4886 3864 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_29000 5860 4883 gene locus_tag LOCUS_29010 gene waaF 5860 4883 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_29010 >Feature sequence320 997 422 gene locus_tag LOCUS_29020 997 422 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117134.1 protein_id gnl|my_center|LOCUS_29020 969 2759 gene locus_tag LOCUS_29030 969 2759 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933778.1 protein_id gnl|my_center|LOCUS_29030 2988 2779 gene locus_tag LOCUS_29040 2988 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 3603 3103 gene locus_tag LOCUS_29050 3603 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 3898 3974 gene locus_tag LOCUS_t00250 3898 3974 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4159 6006 gene locus_tag LOCUS_29060 4159 6006 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229244.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence321 127 1269 gene locus_tag LOCUS_29070 gene citZ 127 1269 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_29070 1425 3227 gene locus_tag LOCUS_29080 gene lepA 1425 3227 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_29080 3392 4090 gene locus_tag LOCUS_29090 gene lepB 3392 4090 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938005.1 protein_id gnl|my_center|LOCUS_29090 4087 4446 gene locus_tag LOCUS_29100 4087 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 5014 4406 gene locus_tag LOCUS_29110 5014 4406 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108450.1 protein_id gnl|my_center|LOCUS_29110 <6005 5011 gene locus_tag LOCUS_29120 <6005 5011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203599.1:imidazolonepropionase >Feature sequence322 1137 193 gene locus_tag LOCUS_29130 1137 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 3290 1137 gene locus_tag LOCUS_29140 3290 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 3325 4476 gene locus_tag LOCUS_29150 3325 4476 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528702.1 protein_id gnl|my_center|LOCUS_29150 4827 4504 gene locus_tag LOCUS_29160 4827 4504 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_29160 4967 5365 gene locus_tag LOCUS_29170 4967 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 5757 5362 gene locus_tag LOCUS_29180 5757 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 >Feature sequence323 1725 220 gene locus_tag LOCUS_29190 1725 220 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_29190 2687 1743 gene locus_tag LOCUS_29200 gene puuE 2687 1743 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920459.1 protein_id gnl|my_center|LOCUS_29200 3232 2687 gene locus_tag LOCUS_29210 3232 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 3287 3424 gene locus_tag LOCUS_29220 3287 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 4710 3562 gene locus_tag LOCUS_29230 4710 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 5719 4796 gene locus_tag LOCUS_29240 5719 4796 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598716.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence324 1 582 gene locus_tag LOCUS_29250 1 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29250 598 846 gene locus_tag LOCUS_29260 598 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 1465 926 gene locus_tag LOCUS_29270 1465 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 1985 1572 gene locus_tag LOCUS_29280 1985 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460651.1 protein_id gnl|my_center|LOCUS_29280 2749 2372 gene locus_tag LOCUS_29290 2749 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 3032 4393 gene locus_tag LOCUS_29300 3032 4393 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_29300 4393 5907 gene locus_tag LOCUS_29310 4393 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence325 64 912 gene locus_tag LOCUS_29320 64 912 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_29320 899 1645 gene locus_tag LOCUS_29330 899 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 2041 1742 gene locus_tag LOCUS_29340 2041 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 2468 2142 gene locus_tag LOCUS_29350 2468 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 2552 3802 gene locus_tag LOCUS_29360 2552 3802 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275477.1 protein_id gnl|my_center|LOCUS_29360 3799 4539 gene locus_tag LOCUS_29370 3799 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 <5964 4604 gene locus_tag LOCUS_29380 <5964 4604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763971.1:M20/M25/M40 family metallo-hydrolase >Feature sequence326 747 1460 gene locus_tag LOCUS_29390 747 1460 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 protein_id gnl|my_center|LOCUS_29390 2449 1733 gene locus_tag LOCUS_29400 2449 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 2448 3101 gene locus_tag LOCUS_29410 2448 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 3332 5878 gene locus_tag LOCUS_29420 3332 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence327 253 1560 gene locus_tag LOCUS_29430 253 1560 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_29430 1644 2654 gene locus_tag LOCUS_29440 1644 2654 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461454.1 protein_id gnl|my_center|LOCUS_29440 2651 4063 gene locus_tag LOCUS_29450 2651 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 4122 5333 gene locus_tag LOCUS_29460 4122 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence328 403 777 gene locus_tag LOCUS_29470 403 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 927 1130 gene locus_tag LOCUS_29480 927 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 1433 1759 gene locus_tag LOCUS_29490 1433 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 2038 2703 gene locus_tag LOCUS_29500 2038 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 2815 3483 gene locus_tag LOCUS_29510 2815 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 4179 4009 gene locus_tag LOCUS_29520 4179 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 4783 5424 gene locus_tag LOCUS_29530 4783 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 5739 5473 gene locus_tag LOCUS_29540 5739 5473 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence329 72 926 gene locus_tag LOCUS_29550 72 926 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_29550 929 2518 gene locus_tag LOCUS_29560 929 2518 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_29560 3854 2865 gene locus_tag LOCUS_29570 3854 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 3970 4797 gene locus_tag LOCUS_29580 3970 4797 CDS product IS1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081285673.1 protein_id gnl|my_center|LOCUS_29580 5709 4855 gene locus_tag LOCUS_29590 5709 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence330 2984 45 gene locus_tag LOCUS_29600 2984 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3961 3203 gene locus_tag LOCUS_29610 3961 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 4631 3945 gene locus_tag LOCUS_29620 gene hypB 4631 3945 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258628.1 protein_id gnl|my_center|LOCUS_29620 4999 4628 gene locus_tag LOCUS_29630 gene hypA 4999 4628 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258629.1 protein_id gnl|my_center|LOCUS_29630 <5888 5005 gene locus_tag LOCUS_29640 <5888 5005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728273.1:carbamoyltransferase HypF >Feature sequence331 1022 228 gene locus_tag LOCUS_29650 1022 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 1150 3630 gene locus_tag LOCUS_29660 1150 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3617 5014 gene locus_tag LOCUS_29670 3617 5014 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117989.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence332 137 601 gene locus_tag LOCUS_29680 137 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 1454 633 gene locus_tag LOCUS_29690 1454 633 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_29690 2653 1556 gene locus_tag LOCUS_29700 2653 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 2892 4337 gene locus_tag LOCUS_29710 2892 4337 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_29710 4343 5644 gene locus_tag LOCUS_29720 4343 5644 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence333 428 1792 gene locus_tag LOCUS_29730 428 1792 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_29730 1841 3010 gene locus_tag LOCUS_29740 1841 3010 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_29740 3206 4624 gene locus_tag LOCUS_29750 3206 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 4621 5598 gene locus_tag LOCUS_29760 4621 5598 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228266.1 protein_id gnl|my_center|LOCUS_29760 >Feature sequence334 1740 205 gene locus_tag LOCUS_29770 1740 205 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_29770 3830 1737 gene locus_tag LOCUS_29780 3830 1737 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_29780 4243 3854 gene locus_tag LOCUS_29790 4243 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 5133 4240 gene locus_tag LOCUS_29800 gene rsmH 5133 4240 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966431.1 protein_id gnl|my_center|LOCUS_29800 5577 5137 gene locus_tag LOCUS_29810 gene mraZ 5577 5137 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411225.1 protein_id gnl|my_center|LOCUS_29810 >Feature sequence335 710 635 gene locus_tag LOCUS_t00260 710 635 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 971 897 gene locus_tag LOCUS_t00270 971 897 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1178 1092 gene locus_tag LOCUS_t00280 1178 1092 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1466 1390 gene locus_tag LOCUS_t00290 1466 1390 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2325 1600 gene locus_tag LOCUS_29820 gene rlmB 2325 1600 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_29820 3818 2322 gene locus_tag LOCUS_29830 gene gltX 3818 2322 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810213.1 protein_id gnl|my_center|LOCUS_29830 5002 3827 gene locus_tag LOCUS_29840 5002 3827 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_29840 5731 5018 gene locus_tag LOCUS_29850 5731 5018 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence336 188 1246 gene locus_tag LOCUS_29860 188 1246 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529592.1 protein_id gnl|my_center|LOCUS_29860 1262 2209 gene locus_tag LOCUS_29870 gene rbsK 1262 2209 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528130.1 protein_id gnl|my_center|LOCUS_29870 2243 3079 gene locus_tag LOCUS_29880 2243 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 3229 4233 gene locus_tag LOCUS_29890 3229 4233 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471147.1 protein_id gnl|my_center|LOCUS_29890 <5820 4240 gene locus_tag LOCUS_29900 <5820 4240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392001.1:adenine deaminase >Feature sequence337 <1 1689 gene locus_tag LOCUS_29910 <1 1689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119978.1:asparagine synthase (glutamine-hydrolyzing) 1749 3068 gene locus_tag LOCUS_29920 gene algD 1749 3068 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110461.1 protein_id gnl|my_center|LOCUS_29920 3804 3091 gene locus_tag LOCUS_29930 3804 3091 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144231.1 protein_id gnl|my_center|LOCUS_29930 4203 3811 gene locus_tag LOCUS_29940 4203 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 4393 4896 gene locus_tag LOCUS_29950 4393 4896 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_29950 4901 5521 gene locus_tag LOCUS_29960 4901 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 >Feature sequence338 149 2224 gene locus_tag LOCUS_29970 149 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 2408 2701 gene locus_tag LOCUS_29980 2408 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29980 3797 3183 gene locus_tag LOCUS_29990 3797 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 4873 4361 gene locus_tag LOCUS_30000 4873 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30000 >Feature sequence339 2337 913 gene locus_tag LOCUS_30010 2337 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 2695 3972 gene locus_tag LOCUS_30020 2695 3972 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_30020 4002 5444 gene locus_tag LOCUS_30030 4002 5444 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence340 <1 573 gene locus_tag LOCUS_30040 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_040680916.1:IS91 family transposase 1647 1156 gene locus_tag LOCUS_30050 1647 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 1973 1644 gene locus_tag LOCUS_30060 1973 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 2045 4519 gene locus_tag LOCUS_30070 2045 4519 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_30070 5635 5342 gene locus_tag LOCUS_30080 5635 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30080 >Feature sequence341 1087 53 gene locus_tag LOCUS_30090 1087 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 1869 1099 gene locus_tag LOCUS_30100 1869 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3938 1920 gene locus_tag LOCUS_30110 3938 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 4042 4572 gene locus_tag LOCUS_30120 4042 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 <5683 4846 gene locus_tag LOCUS_30130 <5683 4846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403656.1:serine hydrolase >Feature sequence342 <1 988 gene locus_tag LOCUS_30140 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123790.1:TlpA disulfide reductase family protein 1009 3714 gene locus_tag LOCUS_30150 1009 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 >Feature sequence343 1274 1011 gene locus_tag LOCUS_30160 1274 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 2240 1866 gene locus_tag LOCUS_30170 2240 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 2685 2392 gene locus_tag LOCUS_30180 2685 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3265 3020 gene locus_tag LOCUS_30190 3265 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 3537 3184 gene locus_tag LOCUS_30200 3537 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 4426 4094 gene locus_tag LOCUS_30210 4426 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 >Feature sequence344 <1 501 gene locus_tag LOCUS_30220 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228350.1:carboxylating nicotinate-nucleotide diphosphorylase 494 1294 gene locus_tag LOCUS_30230 494 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 1309 2097 gene locus_tag LOCUS_30240 1309 2097 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_30240 2090 2800 gene locus_tag LOCUS_30250 2090 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 2804 4084 gene locus_tag LOCUS_30260 2804 4084 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_30260 4818 4093 gene locus_tag LOCUS_30270 4818 4093 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_30270 <5645 4794 gene locus_tag LOCUS_30280 <5645 4794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250186.1:arginine--tRNA ligase >Feature sequence345 1190 450 gene locus_tag LOCUS_30290 1190 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 1346 1270 gene locus_tag LOCUS_t00300 1346 1270 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1529 1356 gene locus_tag LOCUS_30300 1529 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 2232 1990 gene locus_tag LOCUS_30310 2232 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 2450 3190 gene locus_tag LOCUS_30320 2450 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 3989 3474 gene locus_tag LOCUS_30330 3989 3474 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931985.1 protein_id gnl|my_center|LOCUS_30330 4270 3998 gene locus_tag LOCUS_30340 4270 3998 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776230.1 protein_id gnl|my_center|LOCUS_30340 5081 4272 gene locus_tag LOCUS_30350 5081 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 >Feature sequence346 34 822 gene locus_tag LOCUS_30360 34 822 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138735.1 protein_id gnl|my_center|LOCUS_30360 1446 796 gene locus_tag LOCUS_30370 gene rdgB 1446 796 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926068.1 protein_id gnl|my_center|LOCUS_30370 2171 1443 gene locus_tag LOCUS_30380 gene rph 2171 1443 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460930.1 protein_id gnl|my_center|LOCUS_30380 2755 2168 gene locus_tag LOCUS_30390 2755 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 4287 2752 gene locus_tag LOCUS_30400 4287 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 4868 4518 gene locus_tag LOCUS_tm00010 4868 4518 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence347 <1 2550 gene locus_tag LOCUS_30410 <1 2550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941931.1:carbamoyl-phosphate synthase large subunit 2660 5173 gene locus_tag LOCUS_30420 2660 5173 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_30420 5170 5499 gene locus_tag LOCUS_30430 5170 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 >Feature sequence348 5210 3744 gene locus_tag LOCUS_30440 5210 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence349 <1 912 gene locus_tag LOCUS_30450 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117960.1:extracellular solute-binding protein 955 2571 gene locus_tag LOCUS_30460 955 2571 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_30460 2568 3266 gene locus_tag LOCUS_30470 2568 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 3263 3901 gene locus_tag LOCUS_30480 3263 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 3901 4338 gene locus_tag LOCUS_30490 3901 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30490 >Feature sequence350 660 376 gene locus_tag LOCUS_30500 660 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 2397 664 gene locus_tag LOCUS_30510 gene dnaK 2397 664 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083187.1 protein_id gnl|my_center|LOCUS_30510 3062 2394 gene locus_tag LOCUS_30520 3062 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3520 3200 gene locus_tag LOCUS_30530 3520 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 5589 3520 gene locus_tag LOCUS_30540 5589 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence351 600 91 gene locus_tag LOCUS_30550 600 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 870 2165 gene locus_tag LOCUS_30560 870 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 2492 2286 gene locus_tag LOCUS_30570 2492 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 2585 2788 gene locus_tag LOCUS_30580 2585 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 3603 3325 gene locus_tag LOCUS_30590 3603 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 3809 3573 gene locus_tag LOCUS_30600 3809 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 4010 4780 gene locus_tag LOCUS_30610 4010 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30610 4750 5151 gene locus_tag LOCUS_30620 4750 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30620 >Feature sequence352 111 1010 gene locus_tag LOCUS_30630 111 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 4248 1102 gene locus_tag LOCUS_30640 4248 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_30640 <5575 4296 gene locus_tag LOCUS_30650 <5575 4296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265500.1:amidohydrolase family protein >Feature sequence353 2969 567 gene locus_tag LOCUS_30660 2969 567 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928775.1 protein_id gnl|my_center|LOCUS_30660 3158 3538 gene locus_tag LOCUS_30670 3158 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 3732 3550 gene locus_tag LOCUS_30680 3732 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 4199 3825 gene locus_tag LOCUS_30690 4199 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 4585 4226 gene locus_tag LOCUS_30700 4585 4226 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_30700 5274 4705 gene locus_tag LOCUS_30710 5274 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 >Feature sequence354 315 1349 gene locus_tag LOCUS_30720 315 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1445 1639 gene locus_tag LOCUS_30730 1445 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 1658 2092 gene locus_tag LOCUS_30740 1658 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 2409 3029 gene locus_tag LOCUS_30750 2409 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 3544 3104 gene locus_tag LOCUS_30760 3544 3104 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049451.1 protein_id gnl|my_center|LOCUS_30760 3588 3911 gene locus_tag LOCUS_30770 3588 3911 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969033.1 protein_id gnl|my_center|LOCUS_30770 4165 5172 gene locus_tag LOCUS_30780 4165 5172 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_30780 >Feature sequence355 90 581 gene locus_tag LOCUS_30790 90 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 536 1324 gene locus_tag LOCUS_30800 536 1324 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333546.1 protein_id gnl|my_center|LOCUS_30800 1560 1967 gene locus_tag LOCUS_30810 1560 1967 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140715.1 protein_id gnl|my_center|LOCUS_30810 1964 2920 gene locus_tag LOCUS_30820 1964 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 2996 4051 gene locus_tag LOCUS_30830 2996 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 4048 5538 gene locus_tag LOCUS_30840 4048 5538 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_30840 >Feature sequence356 1412 447 gene locus_tag LOCUS_30850 1412 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 4037 1623 gene locus_tag LOCUS_30860 4037 1623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_30860 5394 4174 gene locus_tag LOCUS_30870 5394 4174 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 protein_id gnl|my_center|LOCUS_30870 >Feature sequence357 154 831 gene locus_tag LOCUS_30880 gene dapB 154 831 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933509.1 protein_id gnl|my_center|LOCUS_30880 855 1781 gene locus_tag LOCUS_30890 gene dapA 855 1781 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_30890 1778 2617 gene locus_tag LOCUS_30900 1778 2617 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_30900 2605 3600 gene locus_tag LOCUS_30910 gene argE 2605 3600 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614786.1 protein_id gnl|my_center|LOCUS_30910 4003 3578 gene locus_tag LOCUS_30920 4003 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 4102 5493 gene locus_tag LOCUS_30930 4102 5493 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108072.1 protein_id gnl|my_center|LOCUS_30930 >Feature sequence358 431 225 gene locus_tag LOCUS_30940 431 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 642 1988 gene locus_tag LOCUS_30950 642 1988 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_30950 2258 2070 gene locus_tag LOCUS_30960 2258 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30960 2795 2454 gene locus_tag LOCUS_30970 2795 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 4945 3476 gene locus_tag LOCUS_30980 4945 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence359 638 357 gene locus_tag LOCUS_30990 638 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30990 2079 946 gene locus_tag LOCUS_31000 2079 946 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142594.1 protein_id gnl|my_center|LOCUS_31000 2179 3018 gene locus_tag LOCUS_31010 2179 3018 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644133.1 protein_id gnl|my_center|LOCUS_31010 3011 3688 gene locus_tag LOCUS_31020 3011 3688 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 protein_id gnl|my_center|LOCUS_31020 3676 4395 gene locus_tag LOCUS_31030 3676 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 4750 5448 gene locus_tag LOCUS_31040 4750 5448 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728671.1 protein_id gnl|my_center|LOCUS_31040 >Feature sequence360 532 2958 gene locus_tag LOCUS_31050 532 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 2867 3172 gene locus_tag LOCUS_31060 2867 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3418 3200 gene locus_tag LOCUS_31070 3418 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3831 3514 gene locus_tag LOCUS_31080 3831 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 4474 3845 gene locus_tag LOCUS_31090 4474 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 4776 4477 gene locus_tag LOCUS_31100 4776 4477 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171395.1 protein_id gnl|my_center|LOCUS_31100 <5534 4778 gene locus_tag LOCUS_31110 <5534 4778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921919.1:DNA helicase RecQ >Feature sequence361 610 44 gene locus_tag LOCUS_31120 610 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 3314 657 gene locus_tag LOCUS_31130 3314 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 4399 3305 gene locus_tag LOCUS_31140 4399 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 5453 4521 gene locus_tag LOCUS_31150 5453 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 >Feature sequence362 616 1227 gene locus_tag LOCUS_31160 616 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1217 2839 gene locus_tag LOCUS_31170 1217 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 2953 4248 gene locus_tag LOCUS_31180 2953 4248 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_31180 4307 5056 gene locus_tag LOCUS_31190 4307 5056 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence363 <1 731 gene locus_tag LOCUS_31200 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928775.1:ABC transporter permease 877 1953 gene locus_tag LOCUS_31210 877 1953 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_31210 3207 1966 gene locus_tag LOCUS_31220 3207 1966 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_31220 3262 5166 gene locus_tag LOCUS_31230 gene selB 3262 5166 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_31230 >Feature sequence364 2231 306 gene locus_tag LOCUS_31240 2231 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 2723 2274 gene locus_tag LOCUS_31250 2723 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 2753 3781 gene locus_tag LOCUS_31260 2753 3781 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_31260 3786 5162 gene locus_tag LOCUS_31270 3786 5162 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_31270 >Feature sequence365 606 1952 gene locus_tag LOCUS_31280 606 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 2688 2023 gene locus_tag LOCUS_31290 2688 2023 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 protein_id gnl|my_center|LOCUS_31290 3570 2695 gene locus_tag LOCUS_31300 3570 2695 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_31300 4656 4012 gene locus_tag LOCUS_31310 4656 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 >Feature sequence366 <1 1164 gene locus_tag LOCUS_31320 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:response regulator 2108 1161 gene locus_tag LOCUS_31330 2108 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 2495 2274 gene locus_tag LOCUS_31340 2495 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 2725 2492 gene locus_tag LOCUS_31350 2725 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 2852 4249 gene locus_tag LOCUS_31360 2852 4249 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_31360 >Feature sequence367 360 737 gene locus_tag LOCUS_31370 360 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 734 2590 gene locus_tag LOCUS_31380 734 2590 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_31380 2662 2802 gene locus_tag LOCUS_31390 2662 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 <5504 2968 gene locus_tag LOCUS_31400 <5504 2968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920556.1:S9 family peptidase >Feature sequence368 514 1740 gene locus_tag LOCUS_31410 514 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 2316 1900 gene locus_tag LOCUS_31420 2316 1900 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_31420 2950 2408 gene locus_tag LOCUS_31430 2950 2408 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_31430 5478 2947 gene locus_tag LOCUS_31440 5478 2947 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942422.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence369 2 229 gene locus_tag LOCUS_31450 2 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 208 498 gene locus_tag LOCUS_31460 208 498 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942472.1 protein_id gnl|my_center|LOCUS_31460 577 1623 gene locus_tag LOCUS_31470 gene aroF 577 1623 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_31470 1698 2474 gene locus_tag LOCUS_31480 1698 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2512 4458 gene locus_tag LOCUS_31490 2512 4458 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391442.1 protein_id gnl|my_center|LOCUS_31490 >Feature sequence370 <1 642 gene locus_tag LOCUS_31500 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527905.1:protein-methionine-sulfoxide reductase heme-binding subunit MsrQ 1789 542 gene locus_tag LOCUS_31510 1789 542 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_31510 1991 4078 gene locus_tag LOCUS_31520 1991 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 5313 4243 gene locus_tag LOCUS_31530 gene solA 5313 4243 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_31530 >Feature sequence371 447 1268 gene locus_tag LOCUS_31540 447 1268 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_31540 1261 1971 gene locus_tag LOCUS_31550 1261 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 2543 1986 gene locus_tag LOCUS_31560 2543 1986 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065398.1 protein_id gnl|my_center|LOCUS_31560 2582 3268 gene locus_tag LOCUS_31570 2582 3268 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_31570 3479 3383 gene locus_tag LOCUS_t00310 3479 3383 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 4093 3491 gene locus_tag LOCUS_31580 4093 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 4407 4201 gene locus_tag LOCUS_31590 4407 4201 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357750.1 protein_id gnl|my_center|LOCUS_31590 4642 5232 gene locus_tag LOCUS_31600 4642 5232 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940878.1 protein_id gnl|my_center|LOCUS_31600 5284 5359 gene locus_tag LOCUS_t00320 5284 5359 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence372 <1 1482 gene locus_tag LOCUS_31610 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256318.1:SdrD B-like domain-containing protein 1479 3281 gene locus_tag LOCUS_31620 1479 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 5081 3324 gene locus_tag LOCUS_31630 5081 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence373 218 427 gene locus_tag LOCUS_31640 218 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 432 1982 gene locus_tag LOCUS_31650 gene gatA 432 1982 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_31650 3008 1983 gene locus_tag LOCUS_31660 3008 1983 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368889.1 protein_id gnl|my_center|LOCUS_31660 4657 3047 gene locus_tag LOCUS_31670 4657 3047 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965042.1 protein_id gnl|my_center|LOCUS_31670 4875 5120 gene locus_tag LOCUS_31680 4875 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 >Feature sequence374 2620 1406 gene locus_tag LOCUS_31690 2620 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 2819 2649 gene locus_tag LOCUS_31700 2819 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 4784 2823 gene locus_tag LOCUS_31710 4784 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 <5435 4804 gene locus_tag LOCUS_31720 <5435 4804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258274.1:AAA family ATPase >Feature sequence375 2213 1269 gene locus_tag LOCUS_31730 2213 1269 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014235.1 protein_id gnl|my_center|LOCUS_31730 3201 2242 gene locus_tag LOCUS_31740 3201 2242 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854749.1 protein_id gnl|my_center|LOCUS_31740 4733 3198 gene locus_tag LOCUS_31750 4733 3198 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223211.1 protein_id gnl|my_center|LOCUS_31750 >Feature sequence376 1858 590 gene locus_tag LOCUS_31760 gene crtI 1858 590 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31760 2668 2036 gene locus_tag LOCUS_31770 2668 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31770 3911 3168 gene locus_tag LOCUS_31780 3911 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 4504 3908 gene locus_tag LOCUS_31790 4504 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 5183 4731 gene locus_tag LOCUS_31800 5183 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 >Feature sequence377 2179 1430 gene locus_tag LOCUS_31810 2179 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 2586 2218 gene locus_tag LOCUS_31820 2586 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 3072 2680 gene locus_tag LOCUS_31830 3072 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 3903 3148 gene locus_tag LOCUS_31840 3903 3148 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257722.1 protein_id gnl|my_center|LOCUS_31840 5015 4038 gene locus_tag LOCUS_31850 5015 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 >Feature sequence378 593 39 gene locus_tag LOCUS_31860 593 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 1177 590 gene locus_tag LOCUS_31870 1177 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 1212 1481 gene locus_tag LOCUS_31880 1212 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 2157 1702 gene locus_tag LOCUS_31890 2157 1702 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329996.1 protein_id gnl|my_center|LOCUS_31890 2479 2216 gene locus_tag LOCUS_31900 2479 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 3099 2575 gene locus_tag LOCUS_31910 3099 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31910 3347 3105 gene locus_tag LOCUS_31920 3347 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170106.1 protein_id gnl|my_center|LOCUS_31920 3846 3502 gene locus_tag LOCUS_31930 3846 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 3934 4815 gene locus_tag LOCUS_31940 gene sigJ 3934 4815 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_31940 >Feature sequence379 1010 231 gene locus_tag LOCUS_31950 1010 231 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228734.1 protein_id gnl|my_center|LOCUS_31950 1691 1026 gene locus_tag LOCUS_31960 1691 1026 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31960 2197 1775 gene locus_tag LOCUS_31970 2197 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 2312 2674 gene locus_tag LOCUS_31980 2312 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 2899 5337 gene locus_tag LOCUS_31990 2899 5337 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_31990 >Feature sequence380 3424 2060 gene locus_tag LOCUS_32000 3424 2060 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_32000 3849 3400 gene locus_tag LOCUS_32010 3849 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 4085 4570 gene locus_tag LOCUS_32020 4085 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 <5368 4629 gene locus_tag LOCUS_32030 <5368 4629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972893.1:aminotransferase class V-fold PLP-dependent enzyme >Feature sequence381 1481 48 gene locus_tag LOCUS_32040 1481 48 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_32040 2994 1474 gene locus_tag LOCUS_32050 2994 1474 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_32050 5275 3212 gene locus_tag LOCUS_32060 gene nuoL 5275 3212 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240771.1 protein_id gnl|my_center|LOCUS_32060 >Feature sequence382 2684 2106 gene locus_tag LOCUS_32070 2684 2106 CDS product CDP-archaeol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836864.1 protein_id gnl|my_center|LOCUS_32070 3640 2681 gene locus_tag LOCUS_32080 3640 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 4668 3736 gene locus_tag LOCUS_32090 4668 3736 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_32090 >Feature sequence383 1037 546 gene locus_tag LOCUS_32100 1037 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 1728 2393 gene locus_tag LOCUS_32110 1728 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32110 2368 2820 gene locus_tag LOCUS_32120 2368 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32120 3068 4138 gene locus_tag LOCUS_32130 3068 4138 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_32130 4260 4820 gene locus_tag LOCUS_32140 4260 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 5077 5283 gene locus_tag LOCUS_32150 5077 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence384 156 422 gene locus_tag LOCUS_32160 156 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 428 970 gene locus_tag LOCUS_32170 gene nusG 428 970 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525645.1 protein_id gnl|my_center|LOCUS_32170 1061 1486 gene locus_tag LOCUS_32180 gene rplK 1061 1486 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_32180 1729 2433 gene locus_tag LOCUS_32190 gene rplA 1729 2433 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_32190 2436 2963 gene locus_tag LOCUS_32200 gene rplJ 2436 2963 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356426.1 protein_id gnl|my_center|LOCUS_32200 3003 3395 gene locus_tag LOCUS_32210 gene rplL 3003 3395 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence385 407 3301 gene locus_tag LOCUS_32220 407 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence386 1343 663 gene locus_tag LOCUS_32230 1343 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 1965 1384 gene locus_tag LOCUS_32240 1965 1384 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_32240 2738 2019 gene locus_tag LOCUS_32250 2738 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 3735 2758 gene locus_tag LOCUS_32260 3735 2758 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967133.1 protein_id gnl|my_center|LOCUS_32260 4556 3732 gene locus_tag LOCUS_32270 4556 3732 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531519.1 protein_id gnl|my_center|LOCUS_32270 4621 4896 gene locus_tag LOCUS_32280 4621 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 >Feature sequence387 917 147 gene locus_tag LOCUS_32290 917 147 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_32290 1042 3672 gene locus_tag LOCUS_32300 1042 3672 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_32300 3746 4090 gene locus_tag LOCUS_32310 3746 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 4121 5116 gene locus_tag LOCUS_32320 gene corA 4121 5116 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_32320 >Feature sequence388 1359 763 gene locus_tag LOCUS_32330 1359 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 2552 1365 gene locus_tag LOCUS_32340 2552 1365 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103770.1 protein_id gnl|my_center|LOCUS_32340 3643 2654 gene locus_tag LOCUS_32350 gene glpX 3643 2654 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545655.1 protein_id gnl|my_center|LOCUS_32350 4859 3657 gene locus_tag LOCUS_32360 4859 3657 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_32360 >Feature sequence389 <1 1071 gene locus_tag LOCUS_32370 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092111.1:alginate O-acetyltransferase 4366 1241 gene locus_tag LOCUS_32380 4366 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 4347 5201 gene locus_tag LOCUS_32390 4347 5201 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 protein_id gnl|my_center|LOCUS_32390 >Feature sequence390 2325 418 gene locus_tag LOCUS_32400 gene bamA 2325 418 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 protein_id gnl|my_center|LOCUS_32400 2724 2533 gene locus_tag LOCUS_32410 2724 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 4415 2808 gene locus_tag LOCUS_32420 4415 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 4895 4617 gene locus_tag LOCUS_32430 4895 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 5077 4925 gene locus_tag LOCUS_32440 5077 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 >Feature sequence391 1494 4532 gene locus_tag LOCUS_32450 1494 4532 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_32450 5115 4639 gene locus_tag LOCUS_32460 5115 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence392 1567 194 gene locus_tag LOCUS_32470 1567 194 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_32470 3048 1567 gene locus_tag LOCUS_32480 3048 1567 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_32480 5104 3062 gene locus_tag LOCUS_32490 gene ligA 5104 3062 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192539.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence393 525 1100 gene locus_tag LOCUS_32500 525 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 1087 1560 gene locus_tag LOCUS_32510 1087 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 1662 2408 gene locus_tag LOCUS_32520 1662 2408 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_32520 2535 2756 gene locus_tag LOCUS_32530 2535 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 2753 3238 gene locus_tag LOCUS_32540 2753 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 4212 3289 gene locus_tag LOCUS_32550 4212 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 >Feature sequence394 71 3274 gene locus_tag LOCUS_32560 71 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 3537 4652 gene locus_tag LOCUS_32570 3537 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 >Feature sequence395 <1 769 gene locus_tag LOCUS_32580 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729718.1:NAD(P)/FAD-dependent oxidoreductase 1238 825 gene locus_tag LOCUS_32590 1238 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 1956 1624 gene locus_tag LOCUS_32600 1956 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 2381 1953 gene locus_tag LOCUS_32610 2381 1953 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626168.1 protein_id gnl|my_center|LOCUS_32610 3380 2445 gene locus_tag LOCUS_32620 3380 2445 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257434.1 protein_id gnl|my_center|LOCUS_32620 4708 3377 gene locus_tag LOCUS_32630 4708 3377 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_32630 4827 5141 gene locus_tag LOCUS_32640 gene clpS 4827 5141 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640501.1 protein_id gnl|my_center|LOCUS_32640 >Feature sequence396 <1 2030 gene locus_tag LOCUS_32650 <1 2030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730185.1:ATP-dependent DNA helicase 2096 3067 gene locus_tag LOCUS_32660 2096 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 3078 3800 gene locus_tag LOCUS_32670 3078 3800 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_32670 3797 4432 gene locus_tag LOCUS_32680 3797 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 4577 4843 gene locus_tag LOCUS_32690 4577 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 >Feature sequence397 1128 2363 gene locus_tag LOCUS_32700 1128 2363 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879900.1 protein_id gnl|my_center|LOCUS_32700 2365 3879 gene locus_tag LOCUS_32710 2365 3879 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_32710 3921 4925 gene locus_tag LOCUS_32720 3921 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence398 1271 51 gene locus_tag LOCUS_32730 1271 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 2149 1268 gene locus_tag LOCUS_32740 2149 1268 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_32740 3145 2153 gene locus_tag LOCUS_32750 3145 2153 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640601.1 protein_id gnl|my_center|LOCUS_32750 3268 4182 gene locus_tag LOCUS_32760 gene murQ 3268 4182 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837885.1 protein_id gnl|my_center|LOCUS_32760 4925 4179 gene locus_tag LOCUS_32770 gene nagB 4925 4179 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987104.1 protein_id gnl|my_center|LOCUS_32770 >Feature sequence399 1001 141 gene locus_tag LOCUS_32780 gene cpaB 1001 141 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 protein_id gnl|my_center|LOCUS_32780 1486 1061 gene locus_tag LOCUS_32790 1486 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 2012 1512 gene locus_tag LOCUS_32800 2012 1512 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 protein_id gnl|my_center|LOCUS_32800 2178 2005 gene locus_tag LOCUS_32810 2178 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 2524 2342 gene locus_tag LOCUS_32820 2524 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 2788 2606 gene locus_tag LOCUS_32830 2788 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 3217 3495 gene locus_tag LOCUS_32840 3217 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 >Feature sequence400 305 1408 gene locus_tag LOCUS_32850 305 1408 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258119.1 protein_id gnl|my_center|LOCUS_32850 1438 2697 gene locus_tag LOCUS_32860 1438 2697 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256852.1 protein_id gnl|my_center|LOCUS_32860 2694 3935 gene locus_tag LOCUS_32870 2694 3935 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257659.1 protein_id gnl|my_center|LOCUS_32870 >Feature sequence401 596 913 gene locus_tag LOCUS_32880 596 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 1656 925 gene locus_tag LOCUS_32890 1656 925 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083896.1 protein_id gnl|my_center|LOCUS_32890 1741 3402 gene locus_tag LOCUS_32900 gene boxC 1741 3402 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_32900 3538 4956 gene locus_tag LOCUS_32910 gene boxB 3538 4956 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence402 663 214 gene locus_tag LOCUS_32920 663 214 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970949.1 protein_id gnl|my_center|LOCUS_32920 2698 1343 gene locus_tag LOCUS_32930 2698 1343 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327635.1 protein_id gnl|my_center|LOCUS_32930 3844 2897 gene locus_tag LOCUS_32940 3844 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 4088 4273 gene locus_tag LOCUS_32950 4088 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence403 1324 146 gene locus_tag LOCUS_32960 1324 146 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173522.1 protein_id gnl|my_center|LOCUS_32960 1822 1358 gene locus_tag LOCUS_32970 1822 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 3075 1822 gene locus_tag LOCUS_32980 3075 1822 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_32980 3387 3079 gene locus_tag LOCUS_32990 3387 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 4363 3725 gene locus_tag LOCUS_33000 4363 3725 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_33000 <5163 4360 gene locus_tag LOCUS_33010 <5163 4360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973239.1:HAMP domain-containing sensor histidine kinase >Feature sequence404 <1 800 gene locus_tag LOCUS_33020 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000216350.1:homoserine dehydrogenase 797 1540 gene locus_tag LOCUS_33030 797 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 1588 2769 gene locus_tag LOCUS_33040 1588 2769 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839746.1 protein_id gnl|my_center|LOCUS_33040 2883 4172 gene locus_tag LOCUS_33050 2883 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 4323 4138 gene locus_tag LOCUS_33060 4323 4138 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037304.1 protein_id gnl|my_center|LOCUS_33060 >Feature sequence405 1577 12 gene locus_tag LOCUS_33070 1577 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 1886 1620 gene locus_tag LOCUS_33080 1886 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 1897 3354 gene locus_tag LOCUS_33090 1897 3354 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339151.1 protein_id gnl|my_center|LOCUS_33090 4448 3456 gene locus_tag LOCUS_33100 gene moaA 4448 3456 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950828.1 protein_id gnl|my_center|LOCUS_33100 <5146 4546 gene locus_tag LOCUS_33110 <5146 4546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142040.1:class I SAM-dependent methyltransferase >Feature sequence406 438 55 gene locus_tag LOCUS_33120 438 55 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863690.1 protein_id gnl|my_center|LOCUS_33120 549 1439 gene locus_tag LOCUS_33130 gene sigJ 549 1439 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_33130 2041 1820 gene locus_tag LOCUS_33140 2041 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33140 2337 2170 gene locus_tag LOCUS_33150 2337 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33150 2909 2334 gene locus_tag LOCUS_33160 2909 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33160 3691 3239 gene locus_tag LOCUS_33170 3691 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092142.1 protein_id gnl|my_center|LOCUS_33170 4363 4815 gene locus_tag LOCUS_33180 4363 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 >Feature sequence407 4631 45 gene locus_tag LOCUS_33190 4631 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 5031 5103 gene locus_tag LOCUS_t00330 5031 5103 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence408 1875 646 gene locus_tag LOCUS_33200 1875 646 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808460.1 protein_id gnl|my_center|LOCUS_33200 3459 1876 gene locus_tag LOCUS_33210 gene murJ 3459 1876 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_33210 4113 3661 gene locus_tag LOCUS_33220 4113 3661 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939079.1 protein_id gnl|my_center|LOCUS_33220 <5098 4123 gene locus_tag LOCUS_33230 <5098 4123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249842.1:glycosyltransferase family 4 protein >Feature sequence409 695 51 gene locus_tag LOCUS_33240 gene msrA 695 51 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_33240 1810 710 gene locus_tag LOCUS_33250 1810 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_33250 2857 1811 gene locus_tag LOCUS_33260 2857 1811 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328620.1 protein_id gnl|my_center|LOCUS_33260 2888 3745 gene locus_tag LOCUS_33270 2888 3745 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265531.1 protein_id gnl|my_center|LOCUS_33270 4226 3822 gene locus_tag LOCUS_33280 gene msrB 4226 3822 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529102.1 protein_id gnl|my_center|LOCUS_33280 >Feature sequence410 562 475 gene locus_tag LOCUS_t00340 562 475 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2899 3048 gene locus_tag LOCUS_33290 2899 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 3275 3664 gene locus_tag LOCUS_33300 3275 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 4818 3703 gene locus_tag LOCUS_33310 4818 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 >Feature sequence411 2562 3122 gene locus_tag LOCUS_33320 2562 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3504 3088 gene locus_tag LOCUS_33330 3504 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 <5086 4546 gene locus_tag LOCUS_33340 <5086 4546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931401.1:IS481 family transposase >Feature sequence412 280 1902 gene locus_tag LOCUS_33350 280 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 1974 3110 gene locus_tag LOCUS_33360 1974 3110 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_33360 3984 3634 gene locus_tag LOCUS_33370 3984 3634 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339103.1 protein_id gnl|my_center|LOCUS_33370 >Feature sequence413 3626 705 gene locus_tag LOCUS_33380 3626 705 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257050.1 protein_id gnl|my_center|LOCUS_33380 <5071 3635 gene locus_tag LOCUS_33390 <5071 3635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257046.1:maltose alpha-D-glucosyltransferase >Feature sequence414 352 861 gene locus_tag LOCUS_33400 352 861 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940698.1 protein_id gnl|my_center|LOCUS_33400 891 2198 gene locus_tag LOCUS_33410 gene hisS 891 2198 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258794.1 protein_id gnl|my_center|LOCUS_33410 2201 3973 gene locus_tag LOCUS_33420 gene aspS 2201 3973 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460332.1 protein_id gnl|my_center|LOCUS_33420 4189 4980 gene locus_tag LOCUS_33430 4189 4980 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_33430 >Feature sequence415 433 245 gene locus_tag LOCUS_33440 433 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 592 1245 gene locus_tag LOCUS_33450 592 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 1445 2359 gene locus_tag LOCUS_33460 1445 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33460 2356 2865 gene locus_tag LOCUS_33470 2356 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33470 2886 3200 gene locus_tag LOCUS_33480 2886 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33480 3245 3511 gene locus_tag LOCUS_33490 3245 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 >Feature sequence416 379 1395 gene locus_tag LOCUS_33500 379 1395 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240161.1 protein_id gnl|my_center|LOCUS_33500 1436 2308 gene locus_tag LOCUS_33510 1436 2308 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948944.1 protein_id gnl|my_center|LOCUS_33510 2305 3033 gene locus_tag LOCUS_33520 2305 3033 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_33520 3808 2969 gene locus_tag LOCUS_33530 3808 2969 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_33530 <5023 3868 gene locus_tag LOCUS_33540 <5023 3868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942973.1:trehalose-6-phosphate synthase >Feature sequence417 4216 1172 gene locus_tag LOCUS_33550 4216 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 4984 4436 gene locus_tag LOCUS_33560 4984 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 >Feature sequence418 7 501 gene locus_tag LOCUS_33570 7 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 707 1684 gene locus_tag LOCUS_33580 707 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 1685 2527 gene locus_tag LOCUS_33590 1685 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 2544 3443 gene locus_tag LOCUS_33600 2544 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 4418 3501 gene locus_tag LOCUS_33610 4418 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 >Feature sequence419 76 3258 gene locus_tag LOCUS_33620 gene fdh 76 3258 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225067.1 transl_except (pos:649..651,aa:Sec) note codon on position 192 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_33620 3255 4151 gene locus_tag LOCUS_33630 3255 4151 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145933610.1 protein_id gnl|my_center|LOCUS_33630 >Feature sequence420 280 59 gene locus_tag LOCUS_33640 280 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 1205 417 gene locus_tag LOCUS_33650 1205 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 1554 2300 gene locus_tag LOCUS_33660 gene mutM 1554 2300 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257743.1 protein_id gnl|my_center|LOCUS_33660 3453 2269 gene locus_tag LOCUS_33670 3453 2269 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929520.1 protein_id gnl|my_center|LOCUS_33670 >Feature sequence421 2743 86 gene locus_tag LOCUS_33680 2743 86 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041976239.1 protein_id gnl|my_center|LOCUS_33680 2923 3423 gene locus_tag LOCUS_33690 2923 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33690 3318 4457 gene locus_tag LOCUS_33700 3318 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33700 >Feature sequence422 1084 176 gene locus_tag LOCUS_33710 gene rocF 1084 176 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_33710 1164 1406 gene locus_tag LOCUS_33720 1164 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 2021 1407 gene locus_tag LOCUS_33730 2021 1407 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258089.1 protein_id gnl|my_center|LOCUS_33730 3375 2011 gene locus_tag LOCUS_33740 gene hemY 3375 2011 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_33740 4429 3431 gene locus_tag LOCUS_33750 gene hemE 4429 3431 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567889.1 protein_id gnl|my_center|LOCUS_33750 >Feature sequence423 619 996 gene locus_tag LOCUS_33760 619 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 1080 2816 gene locus_tag LOCUS_33770 1080 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 3515 3312 gene locus_tag LOCUS_33780 3515 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 4435 3515 gene locus_tag LOCUS_33790 4435 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 >Feature sequence424 600 1916 gene locus_tag LOCUS_33800 600 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265931.1 protein_id gnl|my_center|LOCUS_33800 2047 3021 gene locus_tag LOCUS_33810 2047 3021 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 protein_id gnl|my_center|LOCUS_33810 3414 3058 gene locus_tag LOCUS_33820 3414 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence425 148 954 gene locus_tag LOCUS_33830 148 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 1009 1710 gene locus_tag LOCUS_33840 gene eda 1009 1710 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_33840 1722 2750 gene locus_tag LOCUS_33850 1722 2750 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_33850 4308 2860 gene locus_tag LOCUS_33860 4308 2860 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064062.1 protein_id gnl|my_center|LOCUS_33860 >Feature sequence426 142 1293 gene locus_tag LOCUS_33870 gene tgt 142 1293 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_33870 1296 1637 gene locus_tag LOCUS_33880 gene yajC 1296 1637 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810745.1 protein_id gnl|my_center|LOCUS_33880 1640 3247 gene locus_tag LOCUS_33890 gene secD 1640 3247 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939106.1 protein_id gnl|my_center|LOCUS_33890 3263 4222 gene locus_tag LOCUS_33900 gene secF 3263 4222 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_33900 >Feature sequence427 787 443 gene locus_tag LOCUS_33910 787 443 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889253.1 protein_id gnl|my_center|LOCUS_33910 911 1738 gene locus_tag LOCUS_33920 911 1738 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258640.1 protein_id gnl|my_center|LOCUS_33920 2134 1769 gene locus_tag LOCUS_33930 2134 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 2228 4414 gene locus_tag LOCUS_33940 2228 4414 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_33940 >Feature sequence428 1125 781 gene locus_tag LOCUS_33950 1125 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 1457 1179 gene locus_tag LOCUS_33960 1457 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 1828 1454 gene locus_tag LOCUS_33970 1828 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 2292 2068 gene locus_tag LOCUS_33980 2292 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 2572 2282 gene locus_tag LOCUS_33990 2572 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 2949 2569 gene locus_tag LOCUS_34000 2949 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 <4909 3187 gene locus_tag LOCUS_34010 <4909 3187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222299.1:DUF3631 domain-containing protein >Feature sequence429 2442 73 gene locus_tag LOCUS_34020 2442 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 3426 2683 gene locus_tag LOCUS_34030 3426 2683 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404569.1 protein_id gnl|my_center|LOCUS_34030 >Feature sequence430 179 931 gene locus_tag LOCUS_34040 179 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 1075 1575 gene locus_tag LOCUS_34050 1075 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 2887 1778 gene locus_tag LOCUS_34060 2887 1778 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942406.1 protein_id gnl|my_center|LOCUS_34060 >Feature sequence431 816 235 gene locus_tag LOCUS_34070 816 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 1056 4172 gene locus_tag LOCUS_34080 1056 4172 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039201.1 protein_id gnl|my_center|LOCUS_34080 >Feature sequence432 816 1511 gene locus_tag LOCUS_34090 816 1511 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230968.1 protein_id gnl|my_center|LOCUS_34090 1535 2047 gene locus_tag LOCUS_34100 1535 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 2055 2636 gene locus_tag LOCUS_34110 2055 2636 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_34110 2886 3179 gene locus_tag LOCUS_34120 2886 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 3226 4083 gene locus_tag LOCUS_34130 3226 4083 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618835.1 protein_id gnl|my_center|LOCUS_34130 4681 4070 gene locus_tag LOCUS_34140 4681 4070 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532395.1 protein_id gnl|my_center|LOCUS_34140 >Feature sequence433 1067 246 gene locus_tag LOCUS_34150 gene cdaA 1067 246 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_34150 1353 1084 gene locus_tag LOCUS_34160 1353 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 2108 1464 gene locus_tag LOCUS_34170 2108 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 2466 2212 gene locus_tag LOCUS_34180 2466 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 3159 2704 gene locus_tag LOCUS_34190 3159 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 3428 3156 gene locus_tag LOCUS_34200 3428 3156 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393074.1 protein_id gnl|my_center|LOCUS_34200 4132 3716 gene locus_tag LOCUS_34210 4132 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 4557 4129 gene locus_tag LOCUS_34220 4557 4129 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065140.1 protein_id gnl|my_center|LOCUS_34220 >Feature sequence434 787 47 gene locus_tag LOCUS_34230 787 47 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730515.1 protein_id gnl|my_center|LOCUS_34230 994 1317 gene locus_tag LOCUS_34240 994 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 1443 2006 gene locus_tag LOCUS_34250 1443 2006 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_34250 2013 2507 gene locus_tag LOCUS_34260 2013 2507 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889423.1 protein_id gnl|my_center|LOCUS_34260 2504 3010 gene locus_tag LOCUS_34270 2504 3010 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142812.1 protein_id gnl|my_center|LOCUS_34270 4180 3062 gene locus_tag LOCUS_34280 gene ada 4180 3062 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_34280 <4834 4177 gene locus_tag LOCUS_34290 <4834 4177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391104.1:DNA-3-methyladenine glycosylase 2 >Feature sequence435 3979 545 gene locus_tag LOCUS_34300 3979 545 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_34300 4653 3976 gene locus_tag LOCUS_34310 4653 3976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_34310 >Feature sequence436 1055 1873 gene locus_tag LOCUS_34320 1055 1873 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027270.1 protein_id gnl|my_center|LOCUS_34320 3763 2108 gene locus_tag LOCUS_34330 3763 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 <4811 3791 gene locus_tag LOCUS_34340 <4811 3791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970431.1:serine/threonine protein kinase >Feature sequence437 239 39 gene locus_tag LOCUS_34350 239 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 1310 288 gene locus_tag LOCUS_34360 1310 288 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262256.1 protein_id gnl|my_center|LOCUS_34360 3452 1344 gene locus_tag LOCUS_34370 3452 1344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928775.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34370 4323 3829 gene locus_tag LOCUS_34380 4323 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 4808 4500 gene locus_tag LOCUS_34390 4808 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 >Feature sequence438 1567 1725 gene locus_tag LOCUS_34400 1567 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 2022 1810 gene locus_tag LOCUS_34410 2022 1810 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_34410 2207 2019 gene locus_tag LOCUS_34420 2207 2019 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_34420 2569 3387 gene locus_tag LOCUS_34430 2569 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 <4802 3553 gene locus_tag LOCUS_34440 <4802 3553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962267.1:T9SS type A sorting domain-containing protein >Feature sequence439 <1 2372 gene locus_tag LOCUS_34450 <1 2372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117740.1:prolyl oligopeptidase family serine peptidase 2514 3119 gene locus_tag LOCUS_34460 2514 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 3300 3809 gene locus_tag LOCUS_34470 3300 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 >Feature sequence440 91 549 gene locus_tag LOCUS_34480 91 549 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840117.1 protein_id gnl|my_center|LOCUS_34480 942 1262 gene locus_tag LOCUS_34490 942 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 1915 1361 gene locus_tag LOCUS_34500 1915 1361 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_34500 2048 2521 gene locus_tag LOCUS_34510 2048 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 2651 3010 gene locus_tag LOCUS_34520 2651 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 >Feature sequence441 1731 226 gene locus_tag LOCUS_34530 gene atoC 1731 226 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_34530 2042 2269 gene locus_tag LOCUS_34540 2042 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 3012 2317 gene locus_tag LOCUS_34550 3012 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 3090 4079 gene locus_tag LOCUS_34560 gene msrP 3090 4079 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920589.1 protein_id gnl|my_center|LOCUS_34560 4094 4702 gene locus_tag LOCUS_34570 gene msrQ 4094 4702 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527905.1 protein_id gnl|my_center|LOCUS_34570 >Feature sequence442 <1 602 gene locus_tag LOCUS_34580 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142040.1:class I SAM-dependent methyltransferase 599 1384 gene locus_tag LOCUS_34590 599 1384 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_34590 1446 2195 gene locus_tag LOCUS_34600 1446 2195 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_34600 2192 2740 gene locus_tag LOCUS_34610 gene ruvC 2192 2740 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_34610 2737 3342 gene locus_tag LOCUS_34620 gene ruvA 2737 3342 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_34620 3370 4386 gene locus_tag LOCUS_34630 gene ruvB 3370 4386 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_34630 >Feature sequence443 311 2197 gene locus_tag LOCUS_34640 311 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 2194 2454 gene locus_tag LOCUS_34650 2194 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 3658 2975 gene locus_tag LOCUS_34660 3658 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence444 3498 985 gene locus_tag LOCUS_34670 3498 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 >Feature sequence445 244 1011 gene locus_tag LOCUS_34680 244 1011 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_34680 1008 2630 gene locus_tag LOCUS_34690 1008 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 2692 3204 gene locus_tag LOCUS_34700 2692 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 3201 3980 gene locus_tag LOCUS_34710 3201 3980 CDS product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013614293.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence446 <1 956 gene locus_tag LOCUS_34720 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529647.1:sensor histidine kinase KdpD note possible pseudo, frameshifted 956 1312 gene locus_tag LOCUS_34730 956 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 1309 2007 gene locus_tag LOCUS_34740 1309 2007 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_34740 3331 2075 gene locus_tag LOCUS_34750 3331 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_34750 >Feature sequence447 394 2190 gene locus_tag LOCUS_34760 394 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 >Feature sequence448 1478 699 gene locus_tag LOCUS_34770 1478 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 2422 1475 gene locus_tag LOCUS_34780 2422 1475 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_34780 3131 2448 gene locus_tag LOCUS_34790 3131 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 3142 4572 gene locus_tag LOCUS_34800 3142 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 >Feature sequence449 1043 2266 gene locus_tag LOCUS_34810 1043 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 2332 2718 gene locus_tag LOCUS_34820 2332 2718 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_34820 2945 3196 gene locus_tag LOCUS_34830 2945 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34830 3239 4018 gene locus_tag LOCUS_34840 3239 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34840 4015 4206 gene locus_tag LOCUS_34850 4015 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 >Feature sequence450 3 164 gene locus_tag LOCUS_34860 3 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 571 131 gene locus_tag LOCUS_34870 571 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 939 571 gene locus_tag LOCUS_34880 939 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 1347 2306 gene locus_tag LOCUS_34890 1347 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530069.1 protein_id gnl|my_center|LOCUS_34890 2306 3397 gene locus_tag LOCUS_34900 2306 3397 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144241.1 protein_id gnl|my_center|LOCUS_34900 <4640 3552 gene locus_tag LOCUS_34910 <4640 3552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141271.1:ABC transporter permease >Feature sequence451 1446 364 gene locus_tag LOCUS_34920 gene dusB 1446 364 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_34920 1962 1465 gene locus_tag LOCUS_34930 1962 1465 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_34930 3191 1965 gene locus_tag LOCUS_34940 3191 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 <4635 3226 gene locus_tag LOCUS_34950 <4635 3226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814875.1:transcription-repair coupling factor >Feature sequence452 2216 1305 gene locus_tag LOCUS_34960 gene speB 2216 1305 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_34960 3286 2213 gene locus_tag LOCUS_34970 3286 2213 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_34970 4632 3304 gene locus_tag LOCUS_34980 4632 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 >Feature sequence453 717 1529 gene locus_tag LOCUS_34990 717 1529 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925131.1 protein_id gnl|my_center|LOCUS_34990 1684 2994 gene locus_tag LOCUS_35000 1684 2994 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240281.1 protein_id gnl|my_center|LOCUS_35000 3053 4126 gene locus_tag LOCUS_35010 3053 4126 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_35010 >Feature sequence454 <1 1116 gene locus_tag LOCUS_35020 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943734.1:ribonuclease J 1118 3487 gene locus_tag LOCUS_35030 1118 3487 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_35030 >Feature sequence455 850 56 gene locus_tag LOCUS_35040 850 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 924 1223 gene locus_tag LOCUS_35050 924 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 1490 3646 gene locus_tag LOCUS_35060 1490 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 >Feature sequence456 1487 492 gene locus_tag LOCUS_35070 1487 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 3385 2378 gene locus_tag LOCUS_35080 3385 2378 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807825.1 protein_id gnl|my_center|LOCUS_35080 3779 4354 gene locus_tag LOCUS_35090 3779 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814756.1 protein_id gnl|my_center|LOCUS_35090 >Feature sequence457 752 2299 gene locus_tag LOCUS_35100 752 2299 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_35100 2511 2771 gene locus_tag LOCUS_35110 2511 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35110 3026 3259 gene locus_tag LOCUS_35120 3026 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 3256 3489 gene locus_tag LOCUS_35130 3256 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 3486 3830 gene locus_tag LOCUS_35140 3486 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 4080 3916 gene locus_tag LOCUS_35150 4080 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 4574 4236 gene locus_tag LOCUS_35160 4574 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 >Feature sequence458 139 1560 gene locus_tag LOCUS_35170 139 1560 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_35170 1557 2651 gene locus_tag LOCUS_35180 1557 2651 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_35180 >Feature sequence459 504 1388 gene locus_tag LOCUS_35190 504 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35190 1392 1931 gene locus_tag LOCUS_35200 1392 1931 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092594.1 protein_id gnl|my_center|LOCUS_35200 1998 2441 gene locus_tag LOCUS_35210 gene mscL 1998 2441 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_35210 4394 2517 gene locus_tag LOCUS_35220 4394 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 >Feature sequence460 3882 1852 gene locus_tag LOCUS_35230 3882 1852 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_35230 <4578 3895 gene locus_tag LOCUS_35240 <4578 3895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532462.1:diaminopropionate ammonia-lyase >Feature sequence461 2411 60 gene locus_tag LOCUS_35250 2411 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 >Feature sequence462 <1 577 gene locus_tag LOCUS_35260 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928775.1:ABC transporter permease 1845 598 gene locus_tag LOCUS_35270 1845 598 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085746.1 protein_id gnl|my_center|LOCUS_35270 1930 2298 gene locus_tag LOCUS_35280 1930 2298 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140688.1 protein_id gnl|my_center|LOCUS_35280 3136 2768 gene locus_tag LOCUS_35290 3136 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 3211 3531 gene locus_tag LOCUS_35300 3211 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35300 3547 4563 gene locus_tag LOCUS_35310 3547 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35310 >Feature sequence463 1011 190 gene locus_tag LOCUS_35320 1011 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 1120 2880 gene locus_tag LOCUS_35330 1120 2880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_35330 >Feature sequence464 18 935 gene locus_tag LOCUS_35340 18 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 986 2050 gene locus_tag LOCUS_35350 986 2050 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_35350 4391 2103 gene locus_tag LOCUS_35360 4391 2103 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_35360 >Feature sequence465 1740 1225 gene locus_tag LOCUS_35370 gene pcaG 1740 1225 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083750.1 protein_id gnl|my_center|LOCUS_35370 2432 1737 gene locus_tag LOCUS_35380 gene pcaH 2432 1737 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223753.1 protein_id gnl|my_center|LOCUS_35380 3205 2429 gene locus_tag LOCUS_35390 3205 2429 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402699.1 protein_id gnl|my_center|LOCUS_35390 4041 3202 gene locus_tag LOCUS_35400 4041 3202 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_35400 4279 4355 gene locus_tag LOCUS_t00350 4279 4355 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence466 1541 726 gene locus_tag LOCUS_35410 1541 726 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065502.1 protein_id gnl|my_center|LOCUS_35410 <4530 2893 gene locus_tag LOCUS_35420 <4530 2893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048538435.1:S9 family peptidase >Feature sequence467 1302 676 gene locus_tag LOCUS_35430 1302 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 1502 1317 gene locus_tag LOCUS_35440 1502 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 2389 1499 gene locus_tag LOCUS_35450 2389 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 2649 3362 gene locus_tag LOCUS_35460 2649 3362 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974308.1 protein_id gnl|my_center|LOCUS_35460 >Feature sequence468 1678 1289 gene locus_tag LOCUS_35470 1678 1289 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336246.1 protein_id gnl|my_center|LOCUS_35470 1853 2989 gene locus_tag LOCUS_35480 1853 2989 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_35480 3093 3719 gene locus_tag LOCUS_35490 3093 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence469 3840 7 gene locus_tag LOCUS_35500 3840 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 4088 3840 gene locus_tag LOCUS_35510 4088 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 >Feature sequence470 1646 519 gene locus_tag LOCUS_35520 1646 519 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237078.1 protein_id gnl|my_center|LOCUS_35520 2829 2032 gene locus_tag LOCUS_35530 2829 2032 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_35530 2922 3140 gene locus_tag LOCUS_35540 2922 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 3890 3603 gene locus_tag LOCUS_35550 3890 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 4282 3932 gene locus_tag LOCUS_35560 4282 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence471 794 561 gene locus_tag LOCUS_35570 794 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 1083 847 gene locus_tag LOCUS_35580 1083 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 1362 1592 gene locus_tag LOCUS_35590 1362 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 2144 1551 gene locus_tag LOCUS_35600 2144 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 2661 2182 gene locus_tag LOCUS_35610 2661 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 3997 2768 gene locus_tag LOCUS_35620 3997 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 >Feature sequence472 1380 1832 gene locus_tag LOCUS_35630 1380 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 2433 2071 gene locus_tag LOCUS_35640 2433 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 2639 2430 gene locus_tag LOCUS_35650 2639 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 2745 2963 gene locus_tag LOCUS_35660 2745 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 >Feature sequence473 1421 189 gene locus_tag LOCUS_35670 1421 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 1904 3868 gene locus_tag LOCUS_35680 1904 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 >Feature sequence474 907 8 gene locus_tag LOCUS_35690 907 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 1334 3388 gene locus_tag LOCUS_35700 1334 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 4354 3404 gene locus_tag LOCUS_35710 4354 3404 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_35710 >Feature sequence475 730 308 gene locus_tag LOCUS_35720 730 308 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_35720 1117 800 gene locus_tag LOCUS_35730 1117 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 1401 1114 gene locus_tag LOCUS_35740 1401 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 1845 2057 gene locus_tag LOCUS_35750 1845 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 2162 2479 gene locus_tag LOCUS_35760 2162 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 2795 3163 gene locus_tag LOCUS_35770 2795 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence476 624 1088 gene locus_tag LOCUS_35780 624 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 1085 1948 gene locus_tag LOCUS_35790 1085 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 3801 1909 gene locus_tag LOCUS_35800 3801 1909 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528118.1 protein_id gnl|my_center|LOCUS_35800 >Feature sequence477 983 582 gene locus_tag LOCUS_35810 983 582 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 protein_id gnl|my_center|LOCUS_35810 1210 986 gene locus_tag LOCUS_35820 1210 986 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 protein_id gnl|my_center|LOCUS_35820 1368 2198 gene locus_tag LOCUS_35830 1368 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 2186 3124 gene locus_tag LOCUS_35840 2186 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35840 3154 3381 gene locus_tag LOCUS_35850 3154 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 3557 3384 gene locus_tag LOCUS_35860 3557 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 >Feature sequence478 465 289 gene locus_tag LOCUS_35870 465 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35870 618 2339 gene locus_tag LOCUS_35880 618 2339 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731142.1 protein_id gnl|my_center|LOCUS_35880 2715 2494 gene locus_tag LOCUS_35890 2715 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 3356 2712 gene locus_tag LOCUS_35900 3356 2712 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405446.1 protein_id gnl|my_center|LOCUS_35900 4273 3356 gene locus_tag LOCUS_35910 4273 3356 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_35910 >Feature sequence479 1288 125 gene locus_tag LOCUS_35920 1288 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 2542 1727 gene locus_tag LOCUS_35930 2542 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 2567 2848 gene locus_tag LOCUS_35940 2567 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 2853 3626 gene locus_tag LOCUS_35950 2853 3626 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_35950 >Feature sequence480 1010 2029 gene locus_tag LOCUS_35960 1010 2029 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_35960 2078 2605 gene locus_tag LOCUS_35970 2078 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 4168 2651 gene locus_tag LOCUS_35980 4168 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence481 1287 319 gene locus_tag LOCUS_35990 1287 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35990 1786 1241 gene locus_tag LOCUS_36000 1786 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36000 2500 2288 gene locus_tag LOCUS_36010 2500 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 <4414 2532 gene locus_tag LOCUS_36020 <4414 2532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105396.1:catalase HPII >Feature sequence482 1108 92 gene locus_tag LOCUS_36030 1108 92 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_36030 1129 2559 gene locus_tag LOCUS_36040 1129 2559 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766461.1 protein_id gnl|my_center|LOCUS_36040 3431 2556 gene locus_tag LOCUS_36050 3431 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 3462 4391 gene locus_tag LOCUS_36060 3462 4391 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_36060 >Feature sequence483 1517 678 gene locus_tag LOCUS_36070 gene hpnD 1517 678 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_36070 2467 1565 gene locus_tag LOCUS_36080 gene hpnC 2467 1565 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_36080 3043 2501 gene locus_tag LOCUS_36090 3043 2501 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_36090 3142 3870 gene locus_tag LOCUS_36100 3142 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36100 3867 4265 gene locus_tag LOCUS_36110 gene mutT 3867 4265 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210424.1 protein_id gnl|my_center|LOCUS_36110 >Feature sequence484 3903 781 gene locus_tag LOCUS_36120 3903 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 4084 4245 gene locus_tag LOCUS_36130 4084 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 >Feature sequence485 3137 546 gene locus_tag LOCUS_36140 3137 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 3550 3254 gene locus_tag LOCUS_36150 3550 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 4107 3814 gene locus_tag LOCUS_36160 4107 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 >Feature sequence486 2842 1283 gene locus_tag LOCUS_36170 2842 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 <4371 2916 gene locus_tag LOCUS_36180 <4371 2916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_119597939.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence487 553 1116 gene locus_tag LOCUS_36190 gene def 553 1116 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814412.1 protein_id gnl|my_center|LOCUS_36190 2730 1126 gene locus_tag LOCUS_36200 2730 1126 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_36200 2699 3199 gene locus_tag LOCUS_36210 2699 3199 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_36210 3473 3946 gene locus_tag LOCUS_36220 3473 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 >Feature sequence488 520 1230 gene locus_tag LOCUS_36230 520 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 2264 3214 gene locus_tag LOCUS_36240 2264 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 3214 4332 gene locus_tag LOCUS_36250 3214 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 >Feature sequence489 54 3566 gene locus_tag LOCUS_36260 54 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 4097 3690 gene locus_tag LOCUS_36270 4097 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 >Feature sequence490 724 8 gene locus_tag LOCUS_36280 724 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 1089 736 gene locus_tag LOCUS_36290 1089 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 1155 1358 gene locus_tag LOCUS_36300 1155 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 >Feature sequence491 <1 1344 gene locus_tag LOCUS_36310 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120982.1:DUF1501 domain-containing protein 1439 1798 gene locus_tag LOCUS_36320 1439 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 2360 3733 gene locus_tag LOCUS_36330 2360 3733 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_36330 3830 4219 gene locus_tag LOCUS_36340 3830 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 >Feature sequence492 521 1054 gene locus_tag LOCUS_36350 521 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 1290 1057 gene locus_tag LOCUS_36360 1290 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 1321 1629 gene locus_tag LOCUS_36370 1321 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 2025 1642 gene locus_tag LOCUS_36380 2025 1642 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_36380 2267 2022 gene locus_tag LOCUS_36390 2267 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 2777 3091 gene locus_tag LOCUS_36400 2777 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 3102 4214 gene locus_tag LOCUS_36410 3102 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36410 >Feature sequence493 1348 410 gene locus_tag LOCUS_36420 1348 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 1468 2265 gene locus_tag LOCUS_36430 1468 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 2366 3010 gene locus_tag LOCUS_36440 gene coxH3 2366 3010 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_36440 >Feature sequence494 2540 801 gene locus_tag LOCUS_36450 2540 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 3711 2560 gene locus_tag LOCUS_36460 3711 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 <4330 3698 gene locus_tag LOCUS_36470 <4330 3698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721805.1:RNA polymerase sigma factor >Feature sequence495 2125 1148 gene locus_tag LOCUS_36480 2125 1148 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_36480 3400 3552 gene locus_tag LOCUS_36490 3400 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 <4330 3727 gene locus_tag LOCUS_36500 <4330 3727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943492.1:DNA-directed RNA polymerase subunit beta' >Feature sequence496 1793 1458 gene locus_tag LOCUS_36510 1793 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 1832 2593 gene locus_tag LOCUS_36520 1832 2593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_36520 2594 4270 gene locus_tag LOCUS_36530 2594 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 >Feature sequence497 311 541 gene locus_tag LOCUS_36540 311 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 1041 637 gene locus_tag LOCUS_36550 1041 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 1176 1733 gene locus_tag LOCUS_36560 1176 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 3239 1737 gene locus_tag LOCUS_36570 3239 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 3754 3542 gene locus_tag LOCUS_36580 3754 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 >Feature sequence498 2299 1154 gene locus_tag LOCUS_36590 2299 1154 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_36590 3427 2351 gene locus_tag LOCUS_36600 3427 2351 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942406.1 protein_id gnl|my_center|LOCUS_36600 3523 3783 gene locus_tag LOCUS_36610 3523 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36610 3850 4137 gene locus_tag LOCUS_36620 3850 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence499 3541 3047 gene locus_tag LOCUS_36630 3541 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 3683 3943 gene locus_tag LOCUS_36640 3683 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 >Feature sequence500 1285 866 gene locus_tag LOCUS_36650 1285 866 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336246.1 protein_id gnl|my_center|LOCUS_36650 2668 1418 gene locus_tag LOCUS_36660 2668 1418 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970459.1 protein_id gnl|my_center|LOCUS_36660 2790 4229 gene locus_tag LOCUS_36670 gene rpsA 2790 4229 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650125.1 protein_id gnl|my_center|LOCUS_36670 >Feature sequence501 2139 4271 gene locus_tag LOCUS_36680 gene glgX 2139 4271 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence502 269 1924 gene locus_tag LOCUS_36690 269 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 2033 3508 gene locus_tag LOCUS_36700 2033 3508 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_36700 3511 4266 gene locus_tag LOCUS_36710 3511 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 >Feature sequence503 1469 1858 gene locus_tag LOCUS_36720 1469 1858 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877160.1 protein_id gnl|my_center|LOCUS_36720 1911 2891 gene locus_tag LOCUS_36730 1911 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 4163 2991 gene locus_tag LOCUS_36740 gene pcaD 4163 2991 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920269.1 protein_id gnl|my_center|LOCUS_36740 >Feature sequence504 <1 701 gene locus_tag LOCUS_36750 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393167.1:thioredoxin domain-containing protein 718 1491 gene locus_tag LOCUS_36760 718 1491 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029956.1 protein_id gnl|my_center|LOCUS_36760 1496 1843 gene locus_tag LOCUS_36770 1496 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 2099 2770 gene locus_tag LOCUS_36780 2099 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 <4289 2828 gene locus_tag LOCUS_36790 <4289 2828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071716.1:prolyl oligopeptidase family serine peptidase >Feature sequence505 733 1179 gene locus_tag LOCUS_36800 gene rplM 733 1179 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_36800 1179 1574 gene locus_tag LOCUS_36810 gene rpsI 1179 1574 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421105.1 protein_id gnl|my_center|LOCUS_36810 1662 2459 gene locus_tag LOCUS_36820 gene rpsB 1662 2459 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_36820 2636 3229 gene locus_tag LOCUS_36830 gene tsf 2636 3229 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_36830 3410 4126 gene locus_tag LOCUS_36840 gene pyrH 3410 4126 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_36840 >Feature sequence506 1461 2027 gene locus_tag LOCUS_36850 1461 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925589.1 protein_id gnl|my_center|LOCUS_36850 2057 3496 gene locus_tag LOCUS_36860 2057 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 >Feature sequence507 1836 853 gene locus_tag LOCUS_36870 gene lpxK 1836 853 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_36870 3340 1928 gene locus_tag LOCUS_36880 3340 1928 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_36880 >Feature sequence508 1797 1531 gene locus_tag LOCUS_36890 1797 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 3094 1790 gene locus_tag LOCUS_36900 3094 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 4188 3145 gene locus_tag LOCUS_36910 gene hypE 4188 3145 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_36910 >Feature sequence509 <1 1284 gene locus_tag LOCUS_36920 <1 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143058.1:TldD/PmbA family protein 1479 1889 gene locus_tag LOCUS_36930 1479 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 1991 2377 gene locus_tag LOCUS_36940 1991 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 2392 2601 gene locus_tag LOCUS_36950 2392 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 3209 4072 gene locus_tag LOCUS_36960 3209 4072 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_36960 >Feature sequence510 59 1438 gene locus_tag LOCUS_36970 gene glmU 59 1438 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_36970 1546 3384 gene locus_tag LOCUS_36980 gene glmS 1546 3384 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_36980 <4240 3452 gene locus_tag LOCUS_36990 <4240 3452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089175.1:2-isopropylmalate synthase >Feature sequence511 <1 784 gene locus_tag LOCUS_37000 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989931.1:FAD-dependent oxidoreductase 775 1914 gene locus_tag LOCUS_37010 775 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 1919 3283 gene locus_tag LOCUS_37020 1919 3283 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_37020 3276 3482 gene locus_tag LOCUS_37030 3276 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 3885 3490 gene locus_tag LOCUS_37040 3885 3490 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_37040 >Feature sequence512 1529 333 gene locus_tag LOCUS_37050 1529 333 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113355.1 protein_id gnl|my_center|LOCUS_37050 2968 1526 gene locus_tag LOCUS_37060 2968 1526 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_37060 3991 2987 gene locus_tag LOCUS_37070 3991 2987 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615834.1 protein_id gnl|my_center|LOCUS_37070 >Feature sequence513 1685 165 gene locus_tag LOCUS_37080 1685 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 2212 1682 gene locus_tag LOCUS_37090 2212 1682 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_37090 2733 2212 gene locus_tag LOCUS_37100 2733 2212 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891350.1 protein_id gnl|my_center|LOCUS_37100 3621 4025 gene locus_tag LOCUS_37110 3621 4025 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664252.1 protein_id gnl|my_center|LOCUS_37110 >Feature sequence514 635 63 gene locus_tag LOCUS_37120 635 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 848 1900 gene locus_tag LOCUS_37130 848 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 2127 3608 gene locus_tag LOCUS_37140 2127 3608 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_37140 >Feature sequence515 <1 2055 gene locus_tag LOCUS_37150 <1 2055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259048.1:molybdopterin-dependent oxidoreductase 2052 3107 gene locus_tag LOCUS_37160 2052 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 3392 3093 gene locus_tag LOCUS_37170 3392 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 4216 3389 gene locus_tag LOCUS_37180 4216 3389 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541103.1 protein_id gnl|my_center|LOCUS_37180 >Feature sequence516 413 1651 gene locus_tag LOCUS_37190 gene pepT 413 1651 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401270.1 protein_id gnl|my_center|LOCUS_37190 1676 2053 gene locus_tag LOCUS_37200 1676 2053 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929155.1 protein_id gnl|my_center|LOCUS_37200 2148 4088 gene locus_tag LOCUS_37210 2148 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 >Feature sequence517 <1 2762 gene locus_tag LOCUS_37220 <1 2762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167441479.1:amidohydrolase family protein 2809 2994 gene locus_tag LOCUS_37230 2809 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37230 3073 3948 gene locus_tag LOCUS_37240 3073 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37240 >Feature sequence518 1666 269 gene locus_tag LOCUS_37250 1666 269 CDS product DUF255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289401.1 protein_id gnl|my_center|LOCUS_37250 1972 2178 gene locus_tag LOCUS_37260 1972 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 2178 2645 gene locus_tag LOCUS_37270 2178 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 2666 3694 gene locus_tag LOCUS_37280 2666 3694 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_37280 >Feature sequence519 1432 260 gene locus_tag LOCUS_37290 1432 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 1949 2953 gene locus_tag LOCUS_37300 1949 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 3004 3897 gene locus_tag LOCUS_37310 3004 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 >Feature sequence520 <1 2134 gene locus_tag LOCUS_37320 <1 2134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966435.1:fused MFS/spermidine synthase 2254 3489 gene locus_tag LOCUS_37330 2254 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 >Feature sequence521 1083 1928 gene locus_tag LOCUS_37340 1083 1928 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943921.1 protein_id gnl|my_center|LOCUS_37340 1963 3330 gene locus_tag LOCUS_37350 1963 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 3225 3821 gene locus_tag LOCUS_37360 3225 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 >Feature sequence522 1166 1342 gene locus_tag LOCUS_37370 1166 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 3150 1492 gene locus_tag LOCUS_37380 3150 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 3175 4119 gene locus_tag LOCUS_37390 3175 4119 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_37390 >Feature sequence523 873 148 gene locus_tag LOCUS_37400 873 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 1331 870 gene locus_tag LOCUS_37410 1331 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 2814 1882 gene locus_tag LOCUS_37420 2814 1882 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545034.1 protein_id gnl|my_center|LOCUS_37420 3358 2861 gene locus_tag LOCUS_37430 3358 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 <4194 3359 gene locus_tag LOCUS_37440 <4194 3359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963269.1:AAA family ATPase >Feature sequence524 1130 399 gene locus_tag LOCUS_37450 1130 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 1345 1127 gene locus_tag LOCUS_37460 1345 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 1497 1342 gene locus_tag LOCUS_37470 1497 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 2429 1494 gene locus_tag LOCUS_37480 2429 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 3437 2847 gene locus_tag LOCUS_37490 3437 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 >Feature sequence525 1563 748 gene locus_tag LOCUS_37500 1563 748 CDS product TylF/MycF/NovP-related O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328770.1 protein_id gnl|my_center|LOCUS_37500 2585 1593 gene locus_tag LOCUS_37510 gene gmd 2585 1593 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_37510 >Feature sequence526 1996 965 gene locus_tag LOCUS_37520 1996 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 2715 1993 gene locus_tag LOCUS_37530 2715 1993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_37530 3838 2720 gene locus_tag LOCUS_37540 3838 2720 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 protein_id gnl|my_center|LOCUS_37540 >Feature sequence527 1322 3760 gene locus_tag LOCUS_37550 1322 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 >Feature sequence528 717 1145 gene locus_tag LOCUS_37560 717 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 1227 1547 gene locus_tag LOCUS_37570 1227 1547 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 protein_id gnl|my_center|LOCUS_37570 1531 1995 gene locus_tag LOCUS_37580 1531 1995 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969510.1 protein_id gnl|my_center|LOCUS_37580 2067 2315 gene locus_tag LOCUS_37590 2067 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 2322 2729 gene locus_tag LOCUS_37600 2322 2729 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223051.1 protein_id gnl|my_center|LOCUS_37600 2958 3317 gene locus_tag LOCUS_37610 2958 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 3712 3551 gene locus_tag LOCUS_37620 3712 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37620 >Feature sequence529 1021 104 gene locus_tag LOCUS_37630 1021 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 <4144 1121 gene locus_tag LOCUS_37640 <4144 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037631.1:TonB-dependent receptor >Feature sequence530 458 766 gene locus_tag LOCUS_37650 458 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 771 1100 gene locus_tag LOCUS_37660 771 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 1219 2289 gene locus_tag LOCUS_37670 1219 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 2299 2916 gene locus_tag LOCUS_37680 2299 2916 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_37680 2913 4109 gene locus_tag LOCUS_37690 2913 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 >Feature sequence531 1517 375 gene locus_tag LOCUS_37700 gene dnaJ 1517 375 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_37700 2060 1524 gene locus_tag LOCUS_37710 2060 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 3120 2047 gene locus_tag LOCUS_37720 gene hrcA 3120 2047 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_37720 4127 3162 gene locus_tag LOCUS_37730 4127 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 >Feature sequence532 684 511 gene locus_tag LOCUS_37740 684 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 1539 1859 gene locus_tag LOCUS_37750 1539 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 2616 1840 gene locus_tag LOCUS_37760 2616 1840 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_37760 >Feature sequence533 1177 422 gene locus_tag LOCUS_37770 1177 422 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 protein_id gnl|my_center|LOCUS_37770 2198 1293 gene locus_tag LOCUS_37780 gene dapA 2198 1293 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172098.1 protein_id gnl|my_center|LOCUS_37780 3815 2445 gene locus_tag LOCUS_37790 gene hemL 3815 2445 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_37790 >Feature sequence534 224 1291 gene locus_tag LOCUS_37800 224 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 1427 1251 gene locus_tag LOCUS_37810 1427 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 2541 1669 gene locus_tag LOCUS_37820 2541 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 3337 2633 gene locus_tag LOCUS_37830 3337 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 3689 3841 gene locus_tag LOCUS_37840 3689 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 >Feature sequence535 124 819 gene locus_tag LOCUS_37850 gene queC 124 819 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_37850 819 1988 gene locus_tag LOCUS_37860 819 1988 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_37860 2839 1967 gene locus_tag LOCUS_37870 2839 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 <4098 3450 gene locus_tag LOCUS_37880 <4098 3450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957323.1:D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase >Feature sequence536 326 652 gene locus_tag LOCUS_37890 326 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 649 3309 gene locus_tag LOCUS_37900 649 3309 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_37900 3527 4045 gene locus_tag LOCUS_37910 3527 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 >Feature sequence537 1442 459 gene locus_tag LOCUS_37920 1442 459 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_37920 2302 1673 gene locus_tag LOCUS_37930 gene rpsD 2302 1673 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_37930 2872 2420 gene locus_tag LOCUS_37940 gene rpsK 2872 2420 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_37940 3338 2964 gene locus_tag LOCUS_37950 gene rpsM 3338 2964 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_37950 3806 3552 gene locus_tag LOCUS_37960 gene infA 3806 3552 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879986.1 protein_id gnl|my_center|LOCUS_37960 >Feature sequence538 2642 1656 gene locus_tag LOCUS_37970 2642 1656 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_37970 3850 2639 gene locus_tag LOCUS_37980 3850 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 >Feature sequence539 495 1409 gene locus_tag LOCUS_37990 gene dapA 495 1409 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_37990 1509 2615 gene locus_tag LOCUS_38000 1509 2615 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970668.1 protein_id gnl|my_center|LOCUS_38000 2681 2980 gene locus_tag LOCUS_38010 2681 2980 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808669.1 protein_id gnl|my_center|LOCUS_38010 >Feature sequence540 93 413 gene locus_tag LOCUS_38020 93 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 545 1570 gene locus_tag LOCUS_38030 545 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38030 1567 1794 gene locus_tag LOCUS_38040 1567 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38040 1830 3452 gene locus_tag LOCUS_38050 1830 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 >Feature sequence541 <1 854 gene locus_tag LOCUS_38060 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072122.1:GGDEF domain-containing protein 990 1064 gene locus_tag LOCUS_t00360 990 1064 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2190 2360 gene locus_tag LOCUS_38070 2190 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 >Feature sequence542 97 675 gene locus_tag LOCUS_38080 97 675 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403906.1 protein_id gnl|my_center|LOCUS_38080 727 1380 gene locus_tag LOCUS_38090 727 1380 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942483.1 protein_id gnl|my_center|LOCUS_38090 1468 2382 gene locus_tag LOCUS_38100 1468 2382 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_38100 2865 2398 gene locus_tag LOCUS_38110 2865 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 3149 2862 gene locus_tag LOCUS_38120 3149 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 <4056 3254 gene locus_tag LOCUS_38130 <4056 3254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286449.1:glucose-1-phosphate thymidylyltransferase RfbA >Feature sequence543 2350 1832 gene locus_tag LOCUS_38140 2350 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 2515 2877 gene locus_tag LOCUS_38150 2515 2877 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140688.1 protein_id gnl|my_center|LOCUS_38150 >Feature sequence544 <1 533 gene locus_tag LOCUS_38160 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268339.1:ATP-binding cassette domain-containing protein 1203 649 gene locus_tag LOCUS_38170 1203 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791841.1 protein_id gnl|my_center|LOCUS_38170 2134 1280 gene locus_tag LOCUS_38180 2134 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 3700 2162 gene locus_tag LOCUS_38190 3700 2162 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_38190 4042 3734 gene locus_tag LOCUS_38200 4042 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 >Feature sequence545 <1 1181 gene locus_tag LOCUS_38210 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256645.1:D-alanine--D-alanine ligase family protein 1178 2743 gene locus_tag LOCUS_38220 1178 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 <4035 3427 gene locus_tag LOCUS_38230 <4035 3427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876951.1:peptidylprolyl isomerase >Feature sequence546 1361 1074 gene locus_tag LOCUS_38240 1361 1074 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225640.1 protein_id gnl|my_center|LOCUS_38240 1926 1372 gene locus_tag LOCUS_38250 1926 1372 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_38250 2137 1931 gene locus_tag LOCUS_38260 2137 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 2649 2119 gene locus_tag LOCUS_38270 2649 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38270 2945 2649 gene locus_tag LOCUS_38280 2945 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38280 3609 2950 gene locus_tag LOCUS_38290 3609 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38290 >Feature sequence547 <1 546 gene locus_tag LOCUS_38300 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527563.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD 527 1168 gene locus_tag LOCUS_38310 527 1168 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_38310 1177 2415 gene locus_tag LOCUS_38320 1177 2415 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_38320 2633 3994 gene locus_tag LOCUS_38330 gene ffh 2633 3994 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_38330 >Feature sequence548 250 882 gene locus_tag LOCUS_38340 250 882 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_38340 879 1346 gene locus_tag LOCUS_38350 879 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 1550 2068 gene locus_tag LOCUS_38360 1550 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 2277 3407 gene locus_tag LOCUS_38370 2277 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 3850 3548 gene locus_tag LOCUS_38380 3850 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 >Feature sequence549 <4029 1081 gene locus_tag LOCUS_38390 <4029 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403935.1:efflux RND transporter permease subunit >Feature sequence550 1112 504 gene locus_tag LOCUS_38400 1112 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 2094 1189 gene locus_tag LOCUS_38410 2094 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 <4024 2094 gene locus_tag LOCUS_38420 <4024 2094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259345.1:CHAT domain-containing protein >Feature sequence551 1376 360 gene locus_tag LOCUS_38430 1376 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 2185 1373 gene locus_tag LOCUS_38440 2185 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 4021 2444 gene locus_tag LOCUS_38450 4021 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 >Feature sequence552 1178 258 gene locus_tag LOCUS_38460 1178 258 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176672.1 protein_id gnl|my_center|LOCUS_38460 1505 1834 gene locus_tag LOCUS_38470 1505 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38470 2012 2602 gene locus_tag LOCUS_38480 2012 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38480 2503 2796 gene locus_tag LOCUS_38490 2503 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38490 2886 3458 gene locus_tag LOCUS_38500 2886 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38500 3386 3784 gene locus_tag LOCUS_38510 3386 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 >Feature sequence553 <1 1179 gene locus_tag LOCUS_38520 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926593.1:mandelate racemase/muconate lactonizing enzyme family protein 1222 2196 gene locus_tag LOCUS_38530 1222 2196 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925213.1 protein_id gnl|my_center|LOCUS_38530 2325 3452 gene locus_tag LOCUS_38540 2325 3452 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089925.1 protein_id gnl|my_center|LOCUS_38540 3458 3802 gene locus_tag LOCUS_38550 3458 3802 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808669.1 protein_id gnl|my_center|LOCUS_38550 >Feature sequence554 119 397 gene locus_tag LOCUS_38560 119 397 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 protein_id gnl|my_center|LOCUS_38560 394 612 gene locus_tag LOCUS_38570 394 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 702 1346 gene locus_tag LOCUS_38580 702 1346 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_38580 1343 1879 gene locus_tag LOCUS_38590 1343 1879 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_38590 2804 1854 gene locus_tag LOCUS_38600 2804 1854 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_38600 2959 2801 gene locus_tag LOCUS_38610 2959 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 3248 3889 gene locus_tag LOCUS_38620 gene queE 3248 3889 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769397.1 protein_id gnl|my_center|LOCUS_38620 >Feature sequence555 <1 540 gene locus_tag LOCUS_38630 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000872105.1:50S ribosomal protein L11 methyltransferase 917 699 gene locus_tag LOCUS_38640 917 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 1672 935 gene locus_tag LOCUS_38650 1672 935 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_38650 1756 2748 gene locus_tag LOCUS_38660 1756 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 2842 3822 gene locus_tag LOCUS_38670 gene ilvE 2842 3822 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_38670 >Feature sequence556 2097 184 gene locus_tag LOCUS_38680 2097 184 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330711.1 protein_id gnl|my_center|LOCUS_38680 2109 2612 gene locus_tag LOCUS_38690 2109 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 3140 2655 gene locus_tag LOCUS_38700 3140 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 <4003 3312 gene locus_tag LOCUS_38710 <4003 3312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259557.1:2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase >Feature sequence557 911 75 gene locus_tag LOCUS_38720 gene fdhD 911 75 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 protein_id gnl|my_center|LOCUS_38720 1902 952 gene locus_tag LOCUS_38730 1902 952 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_38730 2902 1940 gene locus_tag LOCUS_38740 gene ilvA 2902 1940 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_38740 <3991 2899 gene locus_tag LOCUS_38750 <3991 2899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868364.1:RidA family protein >Feature sequence558 895 1497 gene locus_tag LOCUS_38760 895 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 1494 2504 gene locus_tag LOCUS_38770 1494 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 2520 2882 gene locus_tag LOCUS_38780 2520 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 2879 3148 gene locus_tag LOCUS_38790 2879 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 3373 3092 gene locus_tag LOCUS_38800 3373 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 >Feature sequence559 <1 683 gene locus_tag LOCUS_38810 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112959.1:SDR family oxidoreductase 2294 3592 gene locus_tag LOCUS_38820 2294 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 >Feature sequence560 1128 1355 gene locus_tag LOCUS_38830 1128 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 1635 1970 gene locus_tag LOCUS_38840 1635 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 2366 2536 gene locus_tag LOCUS_38850 2366 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 2685 2533 gene locus_tag LOCUS_38860 2685 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 >Feature sequence561 <1 501 gene locus_tag LOCUS_38870 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679769.1:outer membrane lipoprotein-sorting protein >Feature sequence562 <1 897 gene locus_tag LOCUS_38880 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975788.1:adenosylhomocysteinase 1701 1045 gene locus_tag LOCUS_38890 1701 1045 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403639.1 protein_id gnl|my_center|LOCUS_38890 1792 3819 gene locus_tag LOCUS_38900 1792 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 >Feature sequence563 534 67 gene locus_tag LOCUS_38910 534 67 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790233.1 protein_id gnl|my_center|LOCUS_38910 637 1035 gene locus_tag LOCUS_38920 637 1035 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121968.1 protein_id gnl|my_center|LOCUS_38920 1028 1948 gene locus_tag LOCUS_38930 1028 1948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228542.1 protein_id gnl|my_center|LOCUS_38930 1945 3411 gene locus_tag LOCUS_38940 1945 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 >Feature sequence564 1514 963 gene locus_tag LOCUS_38950 1514 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 2071 1460 gene locus_tag LOCUS_38960 2071 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 2993 3445 gene locus_tag LOCUS_38970 2993 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 >Feature sequence565 1256 981 gene locus_tag LOCUS_38980 1256 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 1618 1274 gene locus_tag LOCUS_38990 1618 1274 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_38990 1829 2674 gene locus_tag LOCUS_39000 1829 2674 CDS product TIGR02587 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389744.1 protein_id gnl|my_center|LOCUS_39000 2671 3042 gene locus_tag LOCUS_39010 2671 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 3402 3052 gene locus_tag LOCUS_39020 3402 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39020 >Feature sequence566 1342 182 gene locus_tag LOCUS_39030 gene megL 1342 182 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 protein_id gnl|my_center|LOCUS_39030 2812 1352 gene locus_tag LOCUS_39040 2812 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 3288 2809 gene locus_tag LOCUS_39050 gene greA 3288 2809 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940503.1 protein_id gnl|my_center|LOCUS_39050 >Feature sequence567 661 2517 gene locus_tag LOCUS_39060 661 2517 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530026.1 protein_id gnl|my_center|LOCUS_39060 3270 2629 gene locus_tag LOCUS_39070 3270 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 3527 3252 gene locus_tag LOCUS_39080 3527 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 3901 3551 gene locus_tag LOCUS_39090 3901 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 >Feature sequence568 1136 714 gene locus_tag LOCUS_39100 gene arfB 1136 714 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 protein_id gnl|my_center|LOCUS_39100 1537 1148 gene locus_tag LOCUS_39110 1537 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 2306 1539 gene locus_tag LOCUS_39120 2306 1539 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_39120 3455 2445 gene locus_tag LOCUS_39130 3455 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 >Feature sequence569 442 864 gene locus_tag LOCUS_39140 gene cadR 442 864 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768479.1 protein_id gnl|my_center|LOCUS_39140 861 1184 gene locus_tag LOCUS_39150 861 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 1186 1401 gene locus_tag LOCUS_39160 1186 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 1480 1785 gene locus_tag LOCUS_39170 1480 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 2051 3169 gene locus_tag LOCUS_39180 2051 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 3226 3726 gene locus_tag LOCUS_39190 3226 3726 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395796.1 protein_id gnl|my_center|LOCUS_39190 >Feature sequence570 <1 547 gene locus_tag LOCUS_39200 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583055.1:zinc-dependent alcohol dehydrogenase family protein 556 1632 gene locus_tag LOCUS_39210 556 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 3230 1773 gene locus_tag LOCUS_39220 3230 1773 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226019.1 protein_id gnl|my_center|LOCUS_39220 >Feature sequence571 918 307 gene locus_tag LOCUS_39230 918 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 1668 1186 gene locus_tag LOCUS_39240 1668 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 2683 1790 gene locus_tag LOCUS_39250 2683 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 >Feature sequence572 160 1878 gene locus_tag LOCUS_39260 160 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 2026 2175 gene locus_tag LOCUS_39270 2026 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 2215 2583 gene locus_tag LOCUS_39280 2215 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 >Feature sequence573 521 3799 gene locus_tag LOCUS_39290 521 3799 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_39290 >Feature sequence574 1456 188 gene locus_tag LOCUS_39300 1456 188 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_39300 1753 1595 gene locus_tag LOCUS_39310 1753 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 3757 2309 gene locus_tag LOCUS_39320 3757 2309 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164880.1 protein_id gnl|my_center|LOCUS_39320 >Feature sequence575 1964 1593 gene locus_tag LOCUS_39330 gene gcvH 1964 1593 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_39330 3205 2090 gene locus_tag LOCUS_39340 gene gcvT 3205 2090 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_39340 3332 3856 gene locus_tag LOCUS_39350 3332 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 >Feature sequence576 2813 1728 gene locus_tag LOCUS_39360 2813 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 <3889 2813 gene locus_tag LOCUS_39370 <3889 2813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924817.1:bi-domain-containing oxidoreductase >Feature sequence577 444 190 gene locus_tag LOCUS_39380 444 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 2333 495 gene locus_tag LOCUS_39390 2333 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 2902 2330 gene locus_tag LOCUS_39400 2902 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 >Feature sequence578 225 1601 gene locus_tag LOCUS_39410 225 1601 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942946.1 protein_id gnl|my_center|LOCUS_39410 >Feature sequence579 476 907 gene locus_tag LOCUS_39420 476 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 911 1498 gene locus_tag LOCUS_39430 gene aat 911 1498 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259206.1 protein_id gnl|my_center|LOCUS_39430 1894 1505 gene locus_tag LOCUS_39440 gene apaG 1894 1505 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172741.1 protein_id gnl|my_center|LOCUS_39440 3067 1982 gene locus_tag LOCUS_39450 3067 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 >Feature sequence580 3831 2032 gene locus_tag LOCUS_39460 3831 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 >Feature sequence581 392 90 gene locus_tag LOCUS_39470 gene nuoK 392 90 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159229.1 protein_id gnl|my_center|LOCUS_39470 916 395 gene locus_tag LOCUS_39480 916 395 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329056.1 protein_id gnl|my_center|LOCUS_39480 1957 929 gene locus_tag LOCUS_39490 gene nuoH 1957 929 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_39490 3436 2111 gene locus_tag LOCUS_39500 gene nuoF 3436 2111 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_39500 3834 3553 gene locus_tag LOCUS_39510 3834 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 >Feature sequence582 91 675 gene locus_tag LOCUS_39520 91 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 733 1302 gene locus_tag LOCUS_39530 733 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 1322 2623 gene locus_tag LOCUS_39540 1322 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 >Feature sequence583 1134 211 gene locus_tag LOCUS_39550 1134 211 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_39550 2514 1159 gene locus_tag LOCUS_39560 2514 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 2947 2600 gene locus_tag LOCUS_39570 2947 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 2975 3637 gene locus_tag LOCUS_39580 2975 3637 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080389.1 protein_id gnl|my_center|LOCUS_39580 >Feature sequence584 1217 318 gene locus_tag LOCUS_39590 1217 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 1307 2698 gene locus_tag LOCUS_39600 1307 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 2752 3090 gene locus_tag LOCUS_39610 2752 3090 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921237.1 protein_id gnl|my_center|LOCUS_39610 >Feature sequence585 107 1186 gene locus_tag LOCUS_39620 107 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 1191 2522 gene locus_tag LOCUS_39630 1191 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 >Feature sequence586 399 599 gene locus_tag LOCUS_39640 399 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 596 1006 gene locus_tag LOCUS_39650 596 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 1095 1979 gene locus_tag LOCUS_39660 1095 1979 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143730.1 protein_id gnl|my_center|LOCUS_39660 1980 2396 gene locus_tag LOCUS_39670 1980 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 3007 2462 gene locus_tag LOCUS_39680 3007 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 <3781 3065 gene locus_tag LOCUS_39690 <3781 3065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928760.1:transferrin receptor-like dimerization domain-containing protein >Feature sequence587 9 1127 gene locus_tag LOCUS_39700 9 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 1926 2297 gene locus_tag LOCUS_39710 1926 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 2817 2317 gene locus_tag LOCUS_39720 2817 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 3176 2814 gene locus_tag LOCUS_39730 3176 2814 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140688.1 protein_id gnl|my_center|LOCUS_39730 3655 3452 gene locus_tag LOCUS_39740 3655 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 >Feature sequence588 172 1491 gene locus_tag LOCUS_39750 gene rsmB 172 1491 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_39750 1505 2227 gene locus_tag LOCUS_39760 1505 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 2224 2928 gene locus_tag LOCUS_39770 gene rpe 2224 2928 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_39770 2930 3325 gene locus_tag LOCUS_39780 2930 3325 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925121.1 protein_id gnl|my_center|LOCUS_39780 >Feature sequence589 476 3292 gene locus_tag LOCUS_39790 476 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 >Feature sequence590 3050 1245 gene locus_tag LOCUS_39800 3050 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 >Feature sequence591 957 271 gene locus_tag LOCUS_39810 957 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 2009 1098 gene locus_tag LOCUS_39820 gene era 2009 1098 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_39820 3312 2053 gene locus_tag LOCUS_39830 3312 2053 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_39830 >Feature sequence592 427 98 gene locus_tag LOCUS_39840 427 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 1025 501 gene locus_tag LOCUS_39850 1025 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 1186 1977 gene locus_tag LOCUS_39860 1186 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39860 1871 2392 gene locus_tag LOCUS_39870 1871 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39870 <3721 2307 gene locus_tag LOCUS_39880 <3721 2307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050754218.1:DDE-type integrase/transposase/recombinase >Feature sequence593 <1 685 gene locus_tag LOCUS_39890 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942466.1:N-acetylmuramoyl-L-alanine amidase 984 751 gene locus_tag LOCUS_39900 984 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 2632 1121 gene locus_tag LOCUS_39910 2632 1121 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_39910 2674 3117 gene locus_tag LOCUS_39920 2674 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 3519 3127 gene locus_tag LOCUS_39930 3519 3127 CDS product desampylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903329.1 protein_id gnl|my_center|LOCUS_39930 >Feature sequence594 1813 461 gene locus_tag LOCUS_39940 1813 461 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529973.1 protein_id gnl|my_center|LOCUS_39940 3225 1810 gene locus_tag LOCUS_39950 3225 1810 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 protein_id gnl|my_center|LOCUS_39950 >Feature sequence595 542 922 gene locus_tag LOCUS_39960 542 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 2222 1665 gene locus_tag LOCUS_39970 2222 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 2200 3027 gene locus_tag LOCUS_39980 2200 3027 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532904.1 protein_id gnl|my_center|LOCUS_39980 3256 3549 gene locus_tag LOCUS_39990 3256 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39990 >Feature sequence596 340 1857 gene locus_tag LOCUS_40000 gene istA 340 1857 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189327688.1 protein_id gnl|my_center|LOCUS_40000 1854 2651 gene locus_tag LOCUS_40010 gene istB 1854 2651 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_40010 2840 3271 gene locus_tag LOCUS_40020 2840 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 >Feature sequence597 2426 648 gene locus_tag LOCUS_40030 2426 648 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_40030 3280 2423 gene locus_tag LOCUS_40040 3280 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 >Feature sequence598 1299 169 gene locus_tag LOCUS_40050 1299 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 2924 1302 gene locus_tag LOCUS_40060 2924 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 3044 3241 gene locus_tag LOCUS_40070 3044 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 >Feature sequence599 <1 3048 gene locus_tag LOCUS_40080 <1 3048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037631.1:TonB-dependent receptor >Feature sequence600 <1 1918 gene locus_tag LOCUS_40090 <1 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014855724.1:N-6 DNA methylase 2283 2086 gene locus_tag LOCUS_40100 2283 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 2452 3183 gene locus_tag LOCUS_40110 2452 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 >Feature sequence601 1959 817 gene locus_tag LOCUS_40120 1959 817 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440662.1 protein_id gnl|my_center|LOCUS_40120 <3649 1984 gene locus_tag LOCUS_40130 <3649 1984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141201.1:ABC transporter permease 2968 2887 gene locus_tag LOCUS_t00370 2968 2887 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence602 381 782 gene locus_tag LOCUS_40140 381 782 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224534.1 protein_id gnl|my_center|LOCUS_40140 793 1962 gene locus_tag LOCUS_40150 793 1962 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_40150 3063 2020 gene locus_tag LOCUS_40160 3063 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 >Feature sequence603 232 1611 gene locus_tag LOCUS_40170 232 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 1676 2791 gene locus_tag LOCUS_40180 1676 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 >Feature sequence604 441 172 gene locus_tag LOCUS_40190 441 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40190 3415 971 gene locus_tag LOCUS_40200 3415 971 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928775.1 protein_id gnl|my_center|LOCUS_40200 >Feature sequence605 265 834 gene locus_tag LOCUS_40210 265 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 924 1868 gene locus_tag LOCUS_40220 924 1868 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339003.1 protein_id gnl|my_center|LOCUS_40220 <3624 2009 gene locus_tag LOCUS_40230 <3624 2009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141201.1:ABC transporter permease >Feature sequence606 520 732 gene locus_tag LOCUS_40240 520 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 1731 970 gene locus_tag LOCUS_40250 1731 970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141078.1 protein_id gnl|my_center|LOCUS_40250 2820 1819 gene locus_tag LOCUS_40260 2820 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 3329 3057 gene locus_tag LOCUS_40270 3329 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 >Feature sequence607 3198 1615 gene locus_tag LOCUS_40280 3198 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 >Feature sequence608 91 1080 gene locus_tag LOCUS_40290 91 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 1077 2093 gene locus_tag LOCUS_40300 1077 2093 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128948541.1 protein_id gnl|my_center|LOCUS_40300 2943 2221 gene locus_tag LOCUS_40310 2943 2221 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887903.1 protein_id gnl|my_center|LOCUS_40310 3286 3110 gene locus_tag LOCUS_40320 3286 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 3477 3283 gene locus_tag LOCUS_40330 3477 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 >Feature sequence609 2 853 gene locus_tag LOCUS_40340 2 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 1269 907 gene locus_tag LOCUS_40350 1269 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 2197 1289 gene locus_tag LOCUS_40360 2197 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 2913 2194 gene locus_tag LOCUS_40370 2913 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 >Feature sequence610 522 1130 gene locus_tag LOCUS_40380 522 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 1990 1262 gene locus_tag LOCUS_40390 1990 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 2208 2017 gene locus_tag LOCUS_40400 2208 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 3494 2403 gene locus_tag LOCUS_40410 3494 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 >Feature sequence611 509 225 gene locus_tag LOCUS_40420 509 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 771 592 gene locus_tag LOCUS_40430 771 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 1080 1979 gene locus_tag LOCUS_40440 1080 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 2544 2230 gene locus_tag LOCUS_40450 2544 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40450 3578 2544 gene locus_tag LOCUS_40460 3578 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40460 >Feature sequence612 <1 1067 gene locus_tag LOCUS_40470 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:amidohydrolase family protein >Feature sequence613 1062 166 gene locus_tag LOCUS_40480 gene garR 1062 166 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 protein_id gnl|my_center|LOCUS_40480 1557 1291 gene locus_tag LOCUS_40490 1557 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 3406 1685 gene locus_tag LOCUS_40500 3406 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_40500 >Feature sequence614 1617 1384 gene locus_tag LOCUS_40510 1617 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 1837 1607 gene locus_tag LOCUS_40520 1837 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 2052 1834 gene locus_tag LOCUS_40530 2052 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 2300 2049 gene locus_tag LOCUS_40540 2300 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 2689 2297 gene locus_tag LOCUS_40550 2689 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 3000 2683 gene locus_tag LOCUS_40560 3000 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 3155 3000 gene locus_tag LOCUS_40570 3155 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 3364 3095 gene locus_tag LOCUS_40580 3364 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 >Feature sequence615 89 586 gene locus_tag LOCUS_40590 89 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 590 2539 gene locus_tag LOCUS_40600 gene acs 590 2539 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_40600 2616 3302 gene locus_tag LOCUS_40610 2616 3302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_40610 >Feature sequence616 2155 647 gene locus_tag LOCUS_40620 2155 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 2039 2248 gene locus_tag LOCUS_40630 2039 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 >Feature sequence617 <3556 1183 gene locus_tag LOCUS_40640 <3556 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037795.1:TonB-dependent receptor >Feature sequence618 <1 1520 gene locus_tag LOCUS_40650 <1 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882974.1:4-alpha-glucanotransferase 1565 2662 gene locus_tag LOCUS_40660 1565 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_40660 >Feature sequence619 2935 1553 gene locus_tag LOCUS_40670 2935 1553 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_40670 >Feature sequence620 414 61 gene locus_tag LOCUS_40680 414 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 932 513 gene locus_tag LOCUS_40690 932 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 1001 2323 gene locus_tag LOCUS_40700 1001 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 2320 3123 gene locus_tag LOCUS_40710 2320 3123 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_40710 >Feature sequence621 1673 1305 gene locus_tag LOCUS_40720 1673 1305 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921237.1 protein_id gnl|my_center|LOCUS_40720 >Feature sequence622 1301 960 gene locus_tag LOCUS_40730 1301 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 1419 1853 gene locus_tag LOCUS_40740 1419 1853 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 protein_id gnl|my_center|LOCUS_40740 1853 2563 gene locus_tag LOCUS_40750 1853 2563 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390641.1 protein_id gnl|my_center|LOCUS_40750 >Feature sequence623 <1 2863 gene locus_tag LOCUS_40760 <1 2863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:amidohydrolase family protein 3455 2883 gene locus_tag LOCUS_40770 3455 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 >Feature sequence624 >Feature sequence625 3436 968 gene locus_tag LOCUS_40780 3436 968 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_40780 >Feature sequence626 630 82 gene locus_tag LOCUS_40790 630 82 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_40790 2022 634 gene locus_tag LOCUS_40800 gene nrfD 2022 634 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_40800 <3513 2022 gene locus_tag LOCUS_40810 <3513 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258002.1:TAT-variant-translocated molybdopterin oxidoreductase >Feature sequence627 2140 3072 gene locus_tag LOCUS_40820 2140 3072 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_40820 >Feature sequence628 <1 1397 gene locus_tag LOCUS_40830 <1 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265821.1:M28 family metallopeptidase 2117 1404 gene locus_tag LOCUS_40840 2117 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 2358 3071 gene locus_tag LOCUS_40850 2358 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 >Feature sequence629 1685 852 gene locus_tag LOCUS_40860 gene yihA 1685 852 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288491.1 protein_id gnl|my_center|LOCUS_40860 <3491 1696 gene locus_tag LOCUS_40870 <3491 1696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392068.1:endopeptidase La >Feature sequence630 437 1489 gene locus_tag LOCUS_40880 437 1489 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028537.1 protein_id gnl|my_center|LOCUS_40880 1486 2877 gene locus_tag LOCUS_40890 gene argH 1486 2877 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_40890 >Feature sequence631 1066 2037 gene locus_tag LOCUS_40900 1066 2037 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_40900 3065 2049 gene locus_tag LOCUS_40910 3065 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 >Feature sequence632 <1 1369 gene locus_tag LOCUS_40920 <1 1369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141163.1:GMC family oxidoreductase 1395 2966 gene locus_tag LOCUS_40930 1395 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 >Feature sequence633 2695 1397 gene locus_tag LOCUS_40940 2695 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 >Feature sequence634 11 3316 gene locus_tag LOCUS_40950 11 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 >Feature sequence635 848 411 gene locus_tag LOCUS_40960 848 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 1357 878 gene locus_tag LOCUS_40970 1357 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 1602 1348 gene locus_tag LOCUS_40980 1602 1348 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413429.1 protein_id gnl|my_center|LOCUS_40980 >Feature sequence636 <1 1403 gene locus_tag LOCUS_40990 <1 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162445741.1:sensor histidine kinase 1404 2057 gene locus_tag LOCUS_41000 1404 2057 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_41000 2159 2533 gene locus_tag LOCUS_41010 2159 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 2530 3315 gene locus_tag LOCUS_41020 2530 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 >Feature sequence637 990 232 gene locus_tag LOCUS_41030 990 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 1979 1188 gene locus_tag LOCUS_41040 1979 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 2600 2776 gene locus_tag LOCUS_41050 2600 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 >Feature sequence638 907 572 gene locus_tag LOCUS_41060 907 572 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080692.1 protein_id gnl|my_center|LOCUS_41060 1415 897 gene locus_tag LOCUS_41070 1415 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 1443 1730 gene locus_tag LOCUS_41080 1443 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 2321 3202 gene locus_tag LOCUS_41090 2321 3202 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119394.1 protein_id gnl|my_center|LOCUS_41090 >Feature sequence639 554 757 gene locus_tag LOCUS_41100 554 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 817 1194 gene locus_tag LOCUS_41110 817 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 1737 1366 gene locus_tag LOCUS_41120 1737 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41120 2012 1785 gene locus_tag LOCUS_41130 2012 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 2755 2009 gene locus_tag LOCUS_41140 2755 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41140 >Feature sequence640 829 494 gene locus_tag LOCUS_41150 829 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 1625 846 gene locus_tag LOCUS_41160 1625 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 3261 1627 gene locus_tag LOCUS_41170 3261 1627 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730391.1 protein_id gnl|my_center|LOCUS_41170 >Feature sequence641 1351 302 gene locus_tag LOCUS_41180 1351 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 3353 1353 gene locus_tag LOCUS_41190 3353 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 >Feature sequence642 3 659 gene locus_tag LOCUS_41200 3 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 807 2816 gene locus_tag LOCUS_41210 gene uvrB 807 2816 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_41210 >Feature sequence643 <3435 852 gene locus_tag LOCUS_41220 <3435 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986841.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence644 267 1244 gene locus_tag LOCUS_41230 267 1244 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316066.1 protein_id gnl|my_center|LOCUS_41230 1530 3338 gene locus_tag LOCUS_41240 1530 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 >Feature sequence645 460 837 gene locus_tag LOCUS_41250 460 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 1664 861 gene locus_tag LOCUS_41260 1664 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41260 2920 1646 gene locus_tag LOCUS_41270 2920 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41270 3270 2974 gene locus_tag LOCUS_41280 3270 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41280 >Feature sequence646 <1 1076 gene locus_tag LOCUS_41290 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392064.1:trigger factor 1100 1702 gene locus_tag LOCUS_41300 gene clpP 1100 1702 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_41300 1828 3084 gene locus_tag LOCUS_41310 gene clpX 1828 3084 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_41310 >Feature sequence647 <1 1586 gene locus_tag LOCUS_41320 <1 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918824.1:CocE/NonD family hydrolase 2194 2012 gene locus_tag LOCUS_41330 2194 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 >Feature sequence648 1341 952 gene locus_tag LOCUS_41340 1341 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 2006 1467 gene locus_tag LOCUS_41350 2006 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41350 >Feature sequence649 <1 1947 gene locus_tag LOCUS_41360 <1 1947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140636.1:response regulator >Feature sequence650 72 1178 gene locus_tag LOCUS_41370 gene mtaB 72 1178 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_41370 2354 1266 gene locus_tag LOCUS_41380 gene rlmN 2354 1266 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_41380 >Feature sequence651 <3377 2440 gene locus_tag LOCUS_41390 <3377 2440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066875.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence652 1160 825 gene locus_tag LOCUS_41400 1160 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 1942 1127 gene locus_tag LOCUS_41410 1942 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 >Feature sequence653 >Feature sequence654 290 1399 gene locus_tag LOCUS_41420 290 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 1333 1785 gene locus_tag LOCUS_41430 1333 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 1767 2420 gene locus_tag LOCUS_41440 1767 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 2440 2841 gene locus_tag LOCUS_41450 2440 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 2928 3311 gene locus_tag LOCUS_41460 2928 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 >Feature sequence655 >Feature sequence656 257 1063 gene locus_tag LOCUS_41470 257 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41470 1113 1550 gene locus_tag LOCUS_41480 1113 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41480 1547 2350 gene locus_tag LOCUS_41490 gene istB 1547 2350 CDS product IS21-like element ISSme2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970475.1 protein_id gnl|my_center|LOCUS_41490 2851 2642 gene locus_tag LOCUS_41500 2851 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 >Feature sequence657 1127 450 gene locus_tag LOCUS_41510 1127 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 1327 1127 gene locus_tag LOCUS_41520 1327 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 2652 1228 gene locus_tag LOCUS_41530 2652 1228 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061735.1 protein_id gnl|my_center|LOCUS_41530 >Feature sequence658 141 1052 gene locus_tag LOCUS_41540 141 1052 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071741117.1 protein_id gnl|my_center|LOCUS_41540 1049 2236 gene locus_tag LOCUS_41550 1049 2236 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987004.1 protein_id gnl|my_center|LOCUS_41550 2220 2987 gene locus_tag LOCUS_41560 2220 2987 CDS product CmcI family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987003.1 protein_id gnl|my_center|LOCUS_41560 >Feature sequence659 <3322 1214 gene locus_tag LOCUS_41570 <3322 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087702.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence660 606 373 gene locus_tag LOCUS_41580 606 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41580 1124 753 gene locus_tag LOCUS_41590 1124 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 2166 2321 gene locus_tag LOCUS_41600 2166 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 >Feature sequence661 94 273 gene locus_tag LOCUS_41610 94 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 355 930 gene locus_tag LOCUS_41620 355 930 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_41620 935 1717 gene locus_tag LOCUS_41630 935 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 1782 3275 gene locus_tag LOCUS_41640 1782 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 >Feature sequence662 1392 847 gene locus_tag LOCUS_41650 1392 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 2572 1379 gene locus_tag LOCUS_41660 2572 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_41660 3207 2602 gene locus_tag LOCUS_41670 3207 2602 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258003.1 protein_id gnl|my_center|LOCUS_41670 >Feature sequence663 575 72 gene locus_tag LOCUS_41680 gene uraD 575 72 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804455.1 protein_id gnl|my_center|LOCUS_41680 1632 556 gene locus_tag LOCUS_41690 gene alc 1632 556 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553942.1 protein_id gnl|my_center|LOCUS_41690 1631 2464 gene locus_tag LOCUS_41700 gene pucL 1631 2464 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 protein_id gnl|my_center|LOCUS_41700 >Feature sequence664 <1 1086 gene locus_tag LOCUS_41710 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207561.1:efflux RND transporter permease subunit 1143 3278 gene locus_tag LOCUS_41720 1143 3278 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215916.1 protein_id gnl|my_center|LOCUS_41720 >Feature sequence665 183 2018 gene locus_tag LOCUS_41730 183 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 >Feature sequence666 595 125 gene locus_tag LOCUS_41740 595 125 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249766.1 protein_id gnl|my_center|LOCUS_41740 1424 612 gene locus_tag LOCUS_41750 1424 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 1627 3087 gene locus_tag LOCUS_41760 gene lysN 1627 3087 CDS product 2-aminoadipate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227918.1 protein_id gnl|my_center|LOCUS_41760 >Feature sequence667 2044 194 gene locus_tag LOCUS_41770 2044 194 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_41770 >Feature sequence668 1270 932 gene locus_tag LOCUS_41780 1270 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 2013 1282 gene locus_tag LOCUS_41790 2013 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 2052 2705 gene locus_tag LOCUS_41800 2052 2705 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_41800 2985 2659 gene locus_tag LOCUS_41810 2985 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 >Feature sequence669 2734 2390 gene locus_tag LOCUS_41820 2734 2390 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_41820 2798 3010 gene locus_tag LOCUS_41830 2798 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 >Feature sequence670 1534 1818 gene locus_tag LOCUS_41840 1534 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 1845 2975 gene locus_tag LOCUS_41850 1845 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_41850 >Feature sequence671 3085 101 gene locus_tag LOCUS_41860 3085 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 >Feature sequence672 929 2806 gene locus_tag LOCUS_41870 929 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 >Feature sequence673 865 371 gene locus_tag LOCUS_41880 865 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 2633 1002 gene locus_tag LOCUS_41890 gene groL 2633 1002 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_41890 3070 2759 gene locus_tag LOCUS_41900 gene groES 3070 2759 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_41900 >Feature sequence674 1538 390 gene locus_tag LOCUS_41910 1538 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_41910 1837 1544 gene locus_tag LOCUS_41920 1837 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_41920 2499 1843 gene locus_tag LOCUS_41930 2499 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_41930 >Feature sequence675 252 629 gene locus_tag LOCUS_41940 252 629 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528007.1 protein_id gnl|my_center|LOCUS_41940 714 1718 gene locus_tag LOCUS_41950 714 1718 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969623.1 protein_id gnl|my_center|LOCUS_41950 1755 2249 gene locus_tag LOCUS_41960 1755 2249 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878483.1 protein_id gnl|my_center|LOCUS_41960 2242 2925 gene locus_tag LOCUS_41970 2242 2925 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530118.1 protein_id gnl|my_center|LOCUS_41970 >Feature sequence676 519 1814 gene locus_tag LOCUS_41980 519 1814 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141757.1 protein_id gnl|my_center|LOCUS_41980 <3244 1836 gene locus_tag LOCUS_41990 <3244 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123734.1:tetratricopeptide repeat protein >Feature sequence677 2655 2122 gene locus_tag LOCUS_42000 2655 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42000 >Feature sequence678 1388 2659 gene locus_tag LOCUS_42010 1388 2659 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_42010 >Feature sequence679 2501 1611 gene locus_tag LOCUS_42020 2501 1611 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_42020 3158 2511 gene locus_tag LOCUS_42030 3158 2511 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885396.1 protein_id gnl|my_center|LOCUS_42030 >Feature sequence680 >Feature sequence681 >Feature sequence682 237 743 gene locus_tag LOCUS_42040 237 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42040 981 772 gene locus_tag LOCUS_42050 981 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 2351 945 gene locus_tag LOCUS_42060 2351 945 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_42060 3211 2507 gene locus_tag LOCUS_42070 3211 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 >Feature sequence683 1541 489 gene locus_tag LOCUS_42080 1541 489 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084879622.1 protein_id gnl|my_center|LOCUS_42080 2870 1932 gene locus_tag LOCUS_42090 2870 1932 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224439.1 protein_id gnl|my_center|LOCUS_42090 >Feature sequence684 540 1118 gene locus_tag LOCUS_42100 540 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 1445 2191 gene locus_tag LOCUS_42110 1445 2191 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038620.1 protein_id gnl|my_center|LOCUS_42110 <3209 2585 gene locus_tag LOCUS_42120 <3209 2585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927086.1:radical SAM protein >Feature sequence685 308 1561 gene locus_tag LOCUS_42130 308 1561 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932205.1 protein_id gnl|my_center|LOCUS_42130 2797 1526 gene locus_tag LOCUS_42140 2797 1526 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_42140 >Feature sequence686 799 92 gene locus_tag LOCUS_42150 799 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 893 1654 gene locus_tag LOCUS_42160 893 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 1732 2553 gene locus_tag LOCUS_42170 1732 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 >Feature sequence687 1075 113 gene locus_tag LOCUS_42180 1075 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 2751 1072 gene locus_tag LOCUS_42190 2751 1072 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_42190 >Feature sequence688 1232 1417 gene locus_tag LOCUS_42200 1232 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 1538 1855 gene locus_tag LOCUS_42210 1538 1855 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928838.1 protein_id gnl|my_center|LOCUS_42210 >Feature sequence689 1020 31 gene locus_tag LOCUS_42220 1020 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 1733 1086 gene locus_tag LOCUS_42230 1733 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 3060 1759 gene locus_tag LOCUS_42240 3060 1759 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 protein_id gnl|my_center|LOCUS_42240 >Feature sequence690 88 1908 gene locus_tag LOCUS_42250 gene ptsG 88 1908 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475719.1 protein_id gnl|my_center|LOCUS_42250 2344 2235 gene locus_tag LOCUS_r00010 2344 2235 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence691 1645 773 gene locus_tag LOCUS_42260 1645 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 2211 1708 gene locus_tag LOCUS_42270 2211 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 >Feature sequence692 <1 881 gene locus_tag LOCUS_42280 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942675.1:type IV pilus assembly protein PilM 878 1489 gene locus_tag LOCUS_42290 878 1489 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_42290 1535 2140 gene locus_tag LOCUS_42300 1535 2140 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_42300 2149 2616 gene locus_tag LOCUS_42310 2149 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 >Feature sequence693 576 779 gene locus_tag LOCUS_42320 576 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 1819 803 gene locus_tag LOCUS_42330 1819 803 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_42330 <3164 1816 gene locus_tag LOCUS_42340 <3164 1816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038616.1:pitrilysin family protein >Feature sequence694 664 113 gene locus_tag LOCUS_42350 664 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 1876 935 gene locus_tag LOCUS_42360 1876 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 1999 2205 gene locus_tag LOCUS_42370 1999 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 2759 3028 gene locus_tag LOCUS_42380 2759 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 >Feature sequence695 276 1 gene locus_tag LOCUS_42390 276 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 381 818 gene locus_tag LOCUS_42400 381 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 820 1629 gene locus_tag LOCUS_42410 820 1629 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_42410 1622 3043 gene locus_tag LOCUS_42420 gene xseA 1622 3043 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_42420 >Feature sequence696 973 191 gene locus_tag LOCUS_42430 973 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 1290 1496 gene locus_tag LOCUS_42440 1290 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 1772 2119 gene locus_tag LOCUS_42450 1772 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 2483 2728 gene locus_tag LOCUS_42460 2483 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 2802 3077 gene locus_tag LOCUS_42470 2802 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42470 >Feature sequence697 >Feature sequence698 703 212 gene locus_tag LOCUS_42480 703 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42480 1358 618 gene locus_tag LOCUS_42490 1358 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 1603 1358 gene locus_tag LOCUS_42500 1603 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 1705 2034 gene locus_tag LOCUS_42510 1705 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 >Feature sequence699 525 166 gene locus_tag LOCUS_42520 525 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 610 1764 gene locus_tag LOCUS_42530 610 1764 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114757.1 protein_id gnl|my_center|LOCUS_42530 2299 1793 gene locus_tag LOCUS_42540 2299 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 2608 3111 gene locus_tag LOCUS_42550 2608 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 >Feature sequence700 350 141 gene locus_tag LOCUS_42560 350 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 2523 475 gene locus_tag LOCUS_42570 2523 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 2746 2925 gene locus_tag LOCUS_42580 2746 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 >Feature sequence701 <1 818 gene locus_tag LOCUS_42590 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259543.1:galactokinase 1666 1124 gene locus_tag LOCUS_42600 1666 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 2634 2236 gene locus_tag LOCUS_42610 2634 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 >Feature sequence702 560 796 gene locus_tag LOCUS_42620 560 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 1036 2226 gene locus_tag LOCUS_42630 1036 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 2918 2427 gene locus_tag LOCUS_42640 2918 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42640 >Feature sequence703 1102 1515 gene locus_tag LOCUS_42650 gene tnpA 1102 1515 CDS product IS200/IS605-like element ISDra9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888562.1 protein_id gnl|my_center|LOCUS_42650 2372 2611 gene locus_tag LOCUS_42660 2372 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 >Feature sequence704 <1 879 gene locus_tag LOCUS_42670 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004116465.1:Stk1 family PASTA domain-containing Ser/Thr kinase 1446 2036 gene locus_tag LOCUS_42680 1446 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 2202 2002 gene locus_tag LOCUS_42690 2202 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 2508 2236 gene locus_tag LOCUS_42700 2508 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 2974 2432 gene locus_tag LOCUS_42710 2974 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 >Feature sequence705 123 1136 gene locus_tag LOCUS_42720 123 1136 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108412.1 protein_id gnl|my_center|LOCUS_42720 1325 2104 gene locus_tag LOCUS_42730 1325 2104 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532424.1 protein_id gnl|my_center|LOCUS_42730 2751 2110 gene locus_tag LOCUS_42740 2751 2110 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148701912.1 protein_id gnl|my_center|LOCUS_42740 >Feature sequence706 <1 2158 gene locus_tag LOCUS_42750 <1 2158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029269.1:Stk1 family PASTA domain-containing Ser/Thr kinase 2646 2185 gene locus_tag LOCUS_42760 2646 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 >Feature sequence707 51 680 gene locus_tag LOCUS_42770 51 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 828 1034 gene locus_tag LOCUS_42780 828 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 1337 1104 gene locus_tag LOCUS_42790 1337 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 1582 1346 gene locus_tag LOCUS_42800 1582 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42800 2867 2511 gene locus_tag LOCUS_42810 2867 2511 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946356.1 protein_id gnl|my_center|LOCUS_42810 >Feature sequence708 <1 552 gene locus_tag LOCUS_42820 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085265.1:IS630-like element ISBj5 family transposase 2647 644 gene locus_tag LOCUS_42830 2647 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 >Feature sequence709 902 330 gene locus_tag LOCUS_42840 902 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 2333 1158 gene locus_tag LOCUS_42850 2333 1158 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_42850 2857 2330 gene locus_tag LOCUS_42860 2857 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 >Feature sequence710 873 7 gene locus_tag LOCUS_42870 873 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 1535 909 gene locus_tag LOCUS_42880 1535 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 2197 1532 gene locus_tag LOCUS_42890 gene modB 2197 1532 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090882.1 protein_id gnl|my_center|LOCUS_42890 2943 2194 gene locus_tag LOCUS_42900 gene modA 2943 2194 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097515.1 protein_id gnl|my_center|LOCUS_42900 >Feature sequence711 224 766 gene locus_tag LOCUS_42910 224 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 2066 837 gene locus_tag LOCUS_42920 2066 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 2923 2063 gene locus_tag LOCUS_42930 2923 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 >Feature sequence712 229 1602 gene locus_tag LOCUS_42940 229 1602 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_42940 2419 1556 gene locus_tag LOCUS_42950 2419 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 >Feature sequence713 <1 1717 gene locus_tag LOCUS_42960 <1 1717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922281.1:methionine synthase 2952 1621 gene locus_tag LOCUS_42970 2952 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 >Feature sequence714 2219 2392 gene locus_tag LOCUS_42980 2219 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 2418 2600 gene locus_tag LOCUS_42990 2418 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 >Feature sequence715 942 343 gene locus_tag LOCUS_43000 942 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 941 1948 gene locus_tag LOCUS_43010 941 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 2143 2898 gene locus_tag LOCUS_43020 2143 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 >Feature sequence716 2 322 gene locus_tag LOCUS_43030 2 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 420 1475 gene locus_tag LOCUS_43040 gene dmlA 420 1475 CDS product multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978516.1 protein_id gnl|my_center|LOCUS_43040 2878 1565 gene locus_tag LOCUS_43050 2878 1565 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 protein_id gnl|my_center|LOCUS_43050 >Feature sequence717 164 343 gene locus_tag LOCUS_43060 164 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 1207 830 gene locus_tag LOCUS_43070 1207 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 1573 2559 gene locus_tag LOCUS_43080 1573 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 2668 2913 gene locus_tag LOCUS_43090 2668 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 >Feature sequence718 1182 835 gene locus_tag LOCUS_43100 1182 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 2197 1568 gene locus_tag LOCUS_43110 2197 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 >Feature sequence719 636 1592 gene locus_tag LOCUS_43120 636 1592 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920780.1 protein_id gnl|my_center|LOCUS_43120 1633 2940 gene locus_tag LOCUS_43130 1633 2940 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_43130 >Feature sequence720 1458 322 gene locus_tag LOCUS_43140 1458 322 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_43140 2393 1455 gene locus_tag LOCUS_43150 2393 1455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_43150 >Feature sequence721 1252 689 gene locus_tag LOCUS_43160 1252 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 2599 1280 gene locus_tag LOCUS_43170 2599 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 >Feature sequence722 1996 782 gene locus_tag LOCUS_43180 1996 782 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_43180 2279 2953 gene locus_tag LOCUS_43190 2279 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 >Feature sequence723 1409 483 gene locus_tag LOCUS_43200 1409 483 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335393.1 protein_id gnl|my_center|LOCUS_43200 2386 1421 gene locus_tag LOCUS_43210 2386 1421 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939400.1 protein_id gnl|my_center|LOCUS_43210 <3004 2394 gene locus_tag LOCUS_43220 <3004 2394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294683.1:CpaF family protein >Feature sequence724 706 1917 gene locus_tag LOCUS_43230 gene istA 706 1917 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189327688.1 protein_id gnl|my_center|LOCUS_43230 1914 2705 gene locus_tag LOCUS_43240 gene istB 1914 2705 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_43240 >Feature sequence725 <3000 1815 gene locus_tag LOCUS_43250 <3000 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021981.1:IS1182-like element ISMac2 family transposase >Feature sequence726 1274 975 gene locus_tag LOCUS_43260 1274 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 <2999 1658 gene locus_tag LOCUS_43270 <2999 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003148161.1:two-partner secretion system adhesin CdrA >Feature sequence727 176 1234 gene locus_tag LOCUS_43280 176 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 1859 1134 gene locus_tag LOCUS_43290 1859 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 1967 2266 gene locus_tag LOCUS_43300 1967 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 2750 2403 gene locus_tag LOCUS_43310 2750 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 >Feature sequence728 2727 232 gene locus_tag LOCUS_43320 gene gyrA 2727 232 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_43320 >Feature sequence729 104 1375 gene locus_tag LOCUS_43330 104 1375 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_43330 2391 1426 gene locus_tag LOCUS_43340 2391 1426 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_43340 2851 2471 gene locus_tag LOCUS_43350 2851 2471 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742210.1 protein_id gnl|my_center|LOCUS_43350 >Feature sequence730 <1 1810 gene locus_tag LOCUS_43360 <1 1810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393251.1:phenylalanine--tRNA ligase subunit beta 1883 2164 gene locus_tag LOCUS_43370 1883 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 2169 2492 gene locus_tag LOCUS_43380 2169 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 >Feature sequence731 1766 492 gene locus_tag LOCUS_43390 1766 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 1759 1977 gene locus_tag LOCUS_43400 1759 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 2805 2527 gene locus_tag LOCUS_43410 2805 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 >Feature sequence732 604 1602 gene locus_tag LOCUS_43420 gene rsgA 604 1602 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_43420 1685 2554 gene locus_tag LOCUS_43430 1685 2554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669583.1 protein_id gnl|my_center|LOCUS_43430 >Feature sequence733 <1 2862 gene locus_tag LOCUS_43440 <1 2862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941986.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence734 1449 2357 gene locus_tag LOCUS_43450 1449 2357 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_43450 >Feature sequence735 97 876 gene locus_tag LOCUS_43460 97 876 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_43460 1449 2771 gene locus_tag LOCUS_43470 1449 2771 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705185.1 protein_id gnl|my_center|LOCUS_43470 >Feature sequence736 427 134 gene locus_tag LOCUS_43480 427 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 739 437 gene locus_tag LOCUS_43490 739 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 1631 1161 gene locus_tag LOCUS_43500 1631 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 2694 1729 gene locus_tag LOCUS_43510 2694 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43510 >Feature sequence737 2521 2162 gene locus_tag LOCUS_43520 2521 2162 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142423.1 protein_id gnl|my_center|LOCUS_43520 >Feature sequence738 1 2868 gene locus_tag LOCUS_43530 1 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 >Feature sequence739 <1 1212 gene locus_tag LOCUS_43540 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_098062761.1:ectonucleotide pyrophosphatase/phosphodiesterase 1519 2856 gene locus_tag LOCUS_43550 1519 2856 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225610.1 protein_id gnl|my_center|LOCUS_43550 >Feature sequence740 1556 1056 gene locus_tag LOCUS_43560 1556 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 >Feature sequence741 536 1705 gene locus_tag LOCUS_43570 536 1705 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_43570 <2902 1749 gene locus_tag LOCUS_43580 <2902 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459676.1:ATP-dependent 6-phosphofructokinase >Feature sequence742 470 1225 gene locus_tag LOCUS_43590 470 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 1236 2393 gene locus_tag LOCUS_43600 1236 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 >Feature sequence743 <1 2795 gene locus_tag LOCUS_43610 <1 2795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103036562.1:TonB-dependent receptor >Feature sequence744 899 465 gene locus_tag LOCUS_43620 899 465 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_43620 1289 1134 gene locus_tag LOCUS_43630 1289 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 1565 1807 gene locus_tag LOCUS_43640 1565 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 1794 2237 gene locus_tag LOCUS_43650 1794 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 >Feature sequence745 109 2736 gene locus_tag LOCUS_43660 109 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 >Feature sequence746 280 1140 gene locus_tag LOCUS_43670 280 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 1207 2385 gene locus_tag LOCUS_43680 1207 2385 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249503.1 protein_id gnl|my_center|LOCUS_43680 >Feature sequence747 132 884 gene locus_tag LOCUS_43690 132 884 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403295.1 protein_id gnl|my_center|LOCUS_43690 1175 837 gene locus_tag LOCUS_43700 gene ytxJ 1175 837 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404063.1 protein_id gnl|my_center|LOCUS_43700 1532 1230 gene locus_tag LOCUS_43710 1532 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 1675 2298 gene locus_tag LOCUS_43720 1675 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 2368 2853 gene locus_tag LOCUS_43730 2368 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 >Feature sequence748 2001 1351 gene locus_tag LOCUS_43740 2001 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43740 2177 1998 gene locus_tag LOCUS_43750 2177 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 <2858 2281 gene locus_tag LOCUS_43760 <2858 2281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546519.1:radical SAM protein >Feature sequence749 139 1452 gene locus_tag LOCUS_43770 139 1452 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948975.1 protein_id gnl|my_center|LOCUS_43770 1476 2534 gene locus_tag LOCUS_43780 1476 2534 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528916.1 protein_id gnl|my_center|LOCUS_43780 >Feature sequence750 2189 594 gene locus_tag LOCUS_43790 2189 594 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_43790 <2853 2197 gene locus_tag LOCUS_43800 <2853 2197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023173416.1:aquaporin >Feature sequence751 992 1315 gene locus_tag LOCUS_43810 992 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 >Feature sequence752 >Feature sequence753 2123 843 gene locus_tag LOCUS_43820 gene gltP 2123 843 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821127.1 protein_id gnl|my_center|LOCUS_43820 >Feature sequence754 289 522 gene locus_tag LOCUS_43830 289 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 984 1931 gene locus_tag LOCUS_43840 984 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43840 >Feature sequence755 588 1544 gene locus_tag LOCUS_43850 588 1544 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_43850 1570 2256 gene locus_tag LOCUS_43860 1570 2256 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_43860 2308 2565 gene locus_tag LOCUS_43870 2308 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43870 >Feature sequence756 1117 956 gene locus_tag LOCUS_43880 1117 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43880 1397 1137 gene locus_tag LOCUS_43890 1397 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 1624 1397 gene locus_tag LOCUS_43900 1624 1397 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_43900 2637 2380 gene locus_tag LOCUS_43910 2637 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 >Feature sequence757 1155 43 gene locus_tag LOCUS_43920 1155 43 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_43920 2026 1211 gene locus_tag LOCUS_43930 2026 1211 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_43930 <2836 2023 gene locus_tag LOCUS_43940 <2836 2023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257167.1:glycosyltransferase family 1 protein >Feature sequence758 1139 2248 gene locus_tag LOCUS_43950 1139 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 2249 2416 gene locus_tag LOCUS_43960 2249 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 >Feature sequence759 1567 704 gene locus_tag LOCUS_43970 1567 704 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082405.1 protein_id gnl|my_center|LOCUS_43970 2831 1557 gene locus_tag LOCUS_43980 2831 1557 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082406.1 protein_id gnl|my_center|LOCUS_43980 >Feature sequence760 <1 1483 gene locus_tag LOCUS_43990 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056482.1:TolC family protein 1480 2583 gene locus_tag LOCUS_44000 1480 2583 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142028.1 protein_id gnl|my_center|LOCUS_44000 >Feature sequence761 89 820 gene locus_tag LOCUS_44010 89 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 957 1697 gene locus_tag LOCUS_44020 957 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 >Feature sequence762 172 8 gene locus_tag LOCUS_44030 172 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 1511 357 gene locus_tag LOCUS_44040 1511 357 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967105.1 protein_id gnl|my_center|LOCUS_44040 2037 1516 gene locus_tag LOCUS_44050 2037 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 >Feature sequence763 2416 1295 gene locus_tag LOCUS_44060 gene carA 2416 1295 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_44060 >Feature sequence764 <1 771 gene locus_tag LOCUS_44070 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004203722.1:Tol-Pal system beta propeller repeat protein TolB 1216 2736 gene locus_tag LOCUS_44080 1216 2736 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_44080 >Feature sequence765 289 80 gene locus_tag LOCUS_44090 289 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 <2816 304 gene locus_tag LOCUS_44100 <2816 304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029132.1:cytochrome P450 >Feature sequence766 576 289 gene locus_tag LOCUS_44110 576 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 894 643 gene locus_tag LOCUS_44120 894 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44120 1303 1046 gene locus_tag LOCUS_44130 1303 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44130 1567 1364 gene locus_tag LOCUS_44140 1567 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 >Feature sequence767 <1 877 gene locus_tag LOCUS_44150 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257603.1:SDR family oxidoreductase 921 1790 gene locus_tag LOCUS_44160 921 1790 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223827.1 protein_id gnl|my_center|LOCUS_44160 2349 2167 gene locus_tag LOCUS_44170 2349 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 >Feature sequence768 185 1390 gene locus_tag LOCUS_44180 185 1390 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 protein_id gnl|my_center|LOCUS_44180 1859 1404 gene locus_tag LOCUS_44190 1859 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 <2806 1938 gene locus_tag LOCUS_44200 <2806 1938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531518.1:nucleotidyltransferase family protein >Feature sequence769 1389 601 gene locus_tag LOCUS_44210 1389 601 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027189.1 protein_id gnl|my_center|LOCUS_44210 1829 2065 gene locus_tag LOCUS_44220 1829 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 2055 2495 gene locus_tag LOCUS_44230 2055 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 >Feature sequence770 2226 1012 gene locus_tag LOCUS_44240 2226 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 >Feature sequence771 1649 630 gene locus_tag LOCUS_44250 1649 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 >Feature sequence772 <1 515 gene locus_tag LOCUS_44260 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272585.1:PEP/pyruvate-binding domain-containing protein 512 1078 gene locus_tag LOCUS_44270 512 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 1075 2079 gene locus_tag LOCUS_44280 1075 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 >Feature sequence773 2663 1602 gene locus_tag LOCUS_44290 2663 1602 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921037.1 protein_id gnl|my_center|LOCUS_44290 >Feature sequence774 501 1 gene locus_tag LOCUS_44300 501 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 512 808 gene locus_tag LOCUS_44310 512 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 1395 874 gene locus_tag LOCUS_44320 1395 874 CDS product DUF417 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111736.1 protein_id gnl|my_center|LOCUS_44320 1819 2007 gene locus_tag LOCUS_44330 1819 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 2058 2591 gene locus_tag LOCUS_44340 2058 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 >Feature sequence775 370 1779 gene locus_tag LOCUS_44350 370 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 1776 2555 gene locus_tag LOCUS_44360 gene istB 1776 2555 CDS product IS21-like element ISSme2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970475.1 protein_id gnl|my_center|LOCUS_44360 >Feature sequence776 <1 681 gene locus_tag LOCUS_44370 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206210853.1:MG2 domain-containing protein >Feature sequence777 415 1203 gene locus_tag LOCUS_44380 gene fadH 415 1203 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660904.1 protein_id gnl|my_center|LOCUS_44380 1281 2015 gene locus_tag LOCUS_44390 1281 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 >Feature sequence778 <1 512 gene locus_tag LOCUS_44400 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941009.1:NADH dehydrogenase (quinone) subunit D 563 775 gene locus_tag LOCUS_44410 563 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 832 1170 gene locus_tag LOCUS_44420 832 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 1177 1416 gene locus_tag LOCUS_44430 1177 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 1753 1998 gene locus_tag LOCUS_44440 1753 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 1995 2384 gene locus_tag LOCUS_44450 1995 2384 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969348.1 protein_id gnl|my_center|LOCUS_44450 >Feature sequence779 814 203 gene locus_tag LOCUS_44460 814 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 1356 826 gene locus_tag LOCUS_44470 1356 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 2456 1356 gene locus_tag LOCUS_44480 2456 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 >Feature sequence780 3 395 gene locus_tag LOCUS_44490 3 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 1705 830 gene locus_tag LOCUS_44500 gene blaBJP 1705 830 CDS product subclass B3 metallo-beta-lactamase BJP-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088970.1 protein_id gnl|my_center|LOCUS_44500 <2745 1732 gene locus_tag LOCUS_44510 <2745 1732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928775.1:ABC transporter permease >Feature sequence781 2173 1814 gene locus_tag LOCUS_44520 2173 1814 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356630.1 protein_id gnl|my_center|LOCUS_44520 >Feature sequence782 3 1601 gene locus_tag LOCUS_44530 3 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 >Feature sequence783 2 394 gene locus_tag LOCUS_44540 2 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 715 425 gene locus_tag LOCUS_44550 715 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 1922 987 gene locus_tag LOCUS_44560 1922 987 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_44560 <2730 1922 gene locus_tag LOCUS_44570 <2730 1922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704200.1:glycerol-3-phosphate 1-O-acyltransferase PlsB >Feature sequence784 366 674 gene locus_tag LOCUS_44580 366 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 682 1902 gene locus_tag LOCUS_44590 682 1902 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130602656.1 protein_id gnl|my_center|LOCUS_44590 2043 2195 gene locus_tag LOCUS_44600 2043 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 >Feature sequence785 <1 546 gene locus_tag LOCUS_44610 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421524.1:amidase <2724 552 gene locus_tag LOCUS_44620 <2724 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118053.1:beta-lactam sensor/signal transducer >Feature sequence786 812 432 gene locus_tag LOCUS_44630 812 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 2444 1176 gene locus_tag LOCUS_44640 2444 1176 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233175.1 protein_id gnl|my_center|LOCUS_44640 >Feature sequence787 437 1423 gene locus_tag LOCUS_44650 437 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44650 1598 1819 gene locus_tag LOCUS_44660 1598 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 2272 1871 gene locus_tag LOCUS_44670 2272 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 2516 2671 gene locus_tag LOCUS_44680 2516 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 >Feature sequence788 754 221 gene locus_tag LOCUS_44690 754 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 1503 751 gene locus_tag LOCUS_44700 1503 751 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393577.1 protein_id gnl|my_center|LOCUS_44700 2267 1500 gene locus_tag LOCUS_44710 2267 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 2424 2615 gene locus_tag LOCUS_44720 2424 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 >Feature sequence789 81 413 gene locus_tag LOCUS_44730 81 413 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706836.1 protein_id gnl|my_center|LOCUS_44730 410 772 gene locus_tag LOCUS_44740 410 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 2626 887 gene locus_tag LOCUS_44750 2626 887 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389689.1 protein_id gnl|my_center|LOCUS_44750 >Feature sequence790 587 345 gene locus_tag LOCUS_44760 587 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 912 1475 gene locus_tag LOCUS_44770 912 1475 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063830.1 protein_id gnl|my_center|LOCUS_44770 1494 1928 gene locus_tag LOCUS_44780 1494 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44780 >Feature sequence791 141 1745 gene locus_tag LOCUS_44790 141 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 2623 1889 gene locus_tag LOCUS_44800 2623 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44800 >Feature sequence792 744 262 gene locus_tag LOCUS_44810 744 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 2612 741 gene locus_tag LOCUS_44820 2612 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 >Feature sequence793 306 1247 gene locus_tag LOCUS_44830 306 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 >Feature sequence794 188 748 gene locus_tag LOCUS_44840 188 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 800 1417 gene locus_tag LOCUS_44850 800 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 2589 1411 gene locus_tag LOCUS_44860 2589 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 >Feature sequence795 701 129 gene locus_tag LOCUS_44870 701 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 796 1224 gene locus_tag LOCUS_44880 796 1224 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 protein_id gnl|my_center|LOCUS_44880 1681 1226 gene locus_tag LOCUS_44890 gene dut 1681 1226 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_44890 >Feature sequence796 403 62 gene locus_tag LOCUS_44900 403 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 837 418 gene locus_tag LOCUS_44910 837 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 2097 1030 gene locus_tag LOCUS_44920 2097 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 2483 2097 gene locus_tag LOCUS_44930 2483 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 >Feature sequence797 <1 682 gene locus_tag LOCUS_44940 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938383.1:phosphate ABC transporter ATP-binding protein PstB 683 1369 gene locus_tag LOCUS_44950 gene phoU 683 1369 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_44950 >Feature sequence798 82 744 gene locus_tag LOCUS_44960 82 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 2178 814 gene locus_tag LOCUS_44970 2178 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 >Feature sequence799 145 645 gene locus_tag LOCUS_44980 145 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44980 >Feature sequence800 >Feature sequence801 <2661 21 gene locus_tag LOCUS_44990 <2661 21 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence802 77 1876 gene locus_tag LOCUS_45000 77 1876 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894103.1 protein_id gnl|my_center|LOCUS_45000 1892 2446 gene locus_tag LOCUS_45010 1892 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 >Feature sequence803 520 221 gene locus_tag LOCUS_45020 520 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45020 896 1465 gene locus_tag LOCUS_45030 896 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45030 1475 1873 gene locus_tag LOCUS_45040 1475 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 2644 1907 gene locus_tag LOCUS_45050 2644 1907 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_45050 >Feature sequence804 <1 616 gene locus_tag LOCUS_45060 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036954.1:flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase 898 677 gene locus_tag LOCUS_45070 898 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 2294 891 gene locus_tag LOCUS_45080 2294 891 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 protein_id gnl|my_center|LOCUS_45080 >Feature sequence805 451 837 gene locus_tag LOCUS_45090 451 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 2123 840 gene locus_tag LOCUS_45100 2123 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 2377 2213 gene locus_tag LOCUS_45110 2377 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 >Feature sequence806 1220 375 gene locus_tag LOCUS_45120 1220 375 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331794.1 protein_id gnl|my_center|LOCUS_45120 1313 2590 gene locus_tag LOCUS_45130 1313 2590 CDS product acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531219.1 protein_id gnl|my_center|LOCUS_45130 >Feature sequence807 337 1203 gene locus_tag LOCUS_45140 gene xrt 337 1203 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_45140 1200 1823 gene locus_tag LOCUS_45150 1200 1823 CDS product EpsI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176634.1 protein_id gnl|my_center|LOCUS_45150 >Feature sequence808 1191 637 gene locus_tag LOCUS_45160 1191 637 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393557.1 protein_id gnl|my_center|LOCUS_45160 2261 1842 gene locus_tag LOCUS_45170 2261 1842 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075890604.1 protein_id gnl|my_center|LOCUS_45170 2491 2267 gene locus_tag LOCUS_45180 2491 2267 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143788.1 protein_id gnl|my_center|LOCUS_45180 >Feature sequence809 2490 1255 gene locus_tag LOCUS_45190 2490 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 >Feature sequence810 827 1204 gene locus_tag LOCUS_45200 827 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 >Feature sequence811 1360 1013 gene locus_tag LOCUS_45210 1360 1013 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618815.1 protein_id gnl|my_center|LOCUS_45210 >Feature sequence812 1922 1008 gene locus_tag LOCUS_45220 gene cysK 1922 1008 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 protein_id gnl|my_center|LOCUS_45220 2161 1973 gene locus_tag LOCUS_45230 2161 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 >Feature sequence813 555 842 gene locus_tag LOCUS_45240 555 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 1287 844 gene locus_tag LOCUS_45250 1287 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 2359 1337 gene locus_tag LOCUS_45260 2359 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 >Feature sequence814 330 782 gene locus_tag LOCUS_45270 330 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 803 1564 gene locus_tag LOCUS_45280 803 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 1781 1494 gene locus_tag LOCUS_45290 1781 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 <2612 1786 gene locus_tag LOCUS_45300 <2612 1786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393249.1:PHP domain-containing protein >Feature sequence815 574 762 gene locus_tag LOCUS_45310 574 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 844 1365 gene locus_tag LOCUS_45320 844 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 2602 1640 gene locus_tag LOCUS_45330 2602 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 >Feature sequence816 1722 2384 gene locus_tag LOCUS_45340 gene gph 1722 2384 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390779.1 protein_id gnl|my_center|LOCUS_45340 2396 2590 gene locus_tag LOCUS_45350 2396 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 >Feature sequence817 378 596 gene locus_tag LOCUS_45360 378 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 615 914 gene locus_tag LOCUS_45370 615 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 <2599 1099 gene locus_tag LOCUS_45380 <2599 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258635.1:ExeM/NucH family extracellular endonuclease >Feature sequence818 342 1160 gene locus_tag LOCUS_45390 342 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 1471 1166 gene locus_tag LOCUS_45400 1471 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 >Feature sequence819 513 427 gene locus_tag LOCUS_t00380 513 427 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 803 2095 gene locus_tag LOCUS_45410 gene egtB 803 2095 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_45410 >Feature sequence820 1101 544 gene locus_tag LOCUS_45420 1101 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 2415 1198 gene locus_tag LOCUS_45430 2415 1198 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_45430 >Feature sequence821 <1 784 gene locus_tag LOCUS_45440 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121937.1:class I SAM-dependent methyltransferase 2286 805 gene locus_tag LOCUS_45450 2286 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 >Feature sequence822 1739 1155 gene locus_tag LOCUS_45460 1739 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 >Feature sequence823 778 395 gene locus_tag LOCUS_45470 778 395 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390973.1 protein_id gnl|my_center|LOCUS_45470 884 2272 gene locus_tag LOCUS_45480 884 2272 CDS product CUAEP/CCAEP-tail radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257877.1 protein_id gnl|my_center|LOCUS_45480 >Feature sequence824 47 292 gene locus_tag LOCUS_45490 47 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 >Feature sequence825 1680 307 gene locus_tag LOCUS_45500 gene mgtE 1680 307 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_45500 >Feature sequence826 116 1159 gene locus_tag LOCUS_45510 116 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 1143 2156 gene locus_tag LOCUS_45520 gene thiL 1143 2156 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_45520 >Feature sequence827 >Feature sequence828 106 1983 gene locus_tag LOCUS_45530 106 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45530 1920 2543 gene locus_tag LOCUS_45540 1920 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45540 >Feature sequence829 395 66 gene locus_tag LOCUS_45550 395 66 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023176144.1 protein_id gnl|my_center|LOCUS_45550 496 675 gene locus_tag LOCUS_45560 496 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 1267 866 gene locus_tag LOCUS_45570 1267 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 1369 2190 gene locus_tag LOCUS_45580 1369 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45580 >Feature sequence830 <1 591 gene locus_tag LOCUS_45590 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203082.1:SpoIIE family protein phosphatase 593 880 gene locus_tag LOCUS_45600 593 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 877 2094 gene locus_tag LOCUS_45610 gene lysS 877 2094 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867559.1 protein_id gnl|my_center|LOCUS_45610 >Feature sequence831 2 601 gene locus_tag LOCUS_45620 2 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 614 1429 gene locus_tag LOCUS_45630 614 1429 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_45630 1470 1883 gene locus_tag LOCUS_45640 1470 1883 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173494.1 protein_id gnl|my_center|LOCUS_45640 1958 2464 gene locus_tag LOCUS_45650 1958 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 >Feature sequence832 211 59 gene locus_tag LOCUS_45660 211 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 798 421 gene locus_tag LOCUS_45670 798 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 2225 1059 gene locus_tag LOCUS_45680 2225 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 >Feature sequence833 1374 739 gene locus_tag LOCUS_45690 1374 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 >Feature sequence834 275 514 gene locus_tag LOCUS_45700 275 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45700 481 654 gene locus_tag LOCUS_45710 481 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 636 1061 gene locus_tag LOCUS_45720 636 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 1142 1696 gene locus_tag LOCUS_45730 1142 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 1696 2184 gene locus_tag LOCUS_45740 gene tsaA 1696 2184 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 protein_id gnl|my_center|LOCUS_45740 >Feature sequence835 2122 677 gene locus_tag LOCUS_45750 gene moeB 2122 677 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143401.1 protein_id gnl|my_center|LOCUS_45750 >Feature sequence836 1512 847 gene locus_tag LOCUS_45760 1512 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 >Feature sequence837 345 124 gene locus_tag LOCUS_45770 345 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 536 1267 gene locus_tag LOCUS_45780 536 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 2509 1325 gene locus_tag LOCUS_45790 2509 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 >Feature sequence838 740 1075 gene locus_tag LOCUS_45800 740 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 >Feature sequence839 833 30 gene locus_tag LOCUS_45810 833 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 1301 1462 gene locus_tag LOCUS_45820 1301 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 2462 1509 gene locus_tag LOCUS_45830 2462 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 >Feature sequence840 844 398 gene locus_tag LOCUS_45840 844 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 1245 841 gene locus_tag LOCUS_45850 1245 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 1445 1242 gene locus_tag LOCUS_45860 1445 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 2376 1468 gene locus_tag LOCUS_45870 2376 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 >Feature sequence841 322 2472 gene locus_tag LOCUS_45880 322 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 >Feature sequence842 1700 378 gene locus_tag LOCUS_45890 1700 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 <2494 1781 gene locus_tag LOCUS_45900 <2494 1781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003411413.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence843 <1 1119 gene locus_tag LOCUS_45910 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141277.1:FG-GAP-like repeat-containing protein 1156 2262 gene locus_tag LOCUS_45920 1156 2262 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931373.1 protein_id gnl|my_center|LOCUS_45920 >Feature sequence844 415 1500 gene locus_tag LOCUS_45930 415 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 >Feature sequence845 952 677 gene locus_tag LOCUS_45940 952 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 <2476 956 gene locus_tag LOCUS_45950 <2476 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009967303.1:serine protease AprX >Feature sequence846 2232 1222 gene locus_tag LOCUS_45960 gene coxB 2232 1222 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_45960 >Feature sequence847 1750 551 gene locus_tag LOCUS_45970 1750 551 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228930.1 protein_id gnl|my_center|LOCUS_45970 >Feature sequence848 <1 705 gene locus_tag LOCUS_45980 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038986.1:ABC transporter ATP-binding protein >Feature sequence849 695 390 gene locus_tag LOCUS_45990 695 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 1068 790 gene locus_tag LOCUS_46000 1068 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 >Feature sequence850 976 188 gene locus_tag LOCUS_46010 976 188 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222024.1 protein_id gnl|my_center|LOCUS_46010 <2445 1001 gene locus_tag LOCUS_46020 <2445 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948144.1:sodium:solute symporter family protein >Feature sequence851 >Feature sequence852 131 487 gene locus_tag LOCUS_46030 131 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 507 695 gene locus_tag LOCUS_46040 507 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 726 1151 gene locus_tag LOCUS_46050 726 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 1158 1793 gene locus_tag LOCUS_46060 1158 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46060 >Feature sequence853 1074 34 gene locus_tag LOCUS_46070 1074 34 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941594.1 protein_id gnl|my_center|LOCUS_46070 1943 1089 gene locus_tag LOCUS_46080 1943 1089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941593.1 protein_id gnl|my_center|LOCUS_46080 >Feature sequence854 2151 805 gene locus_tag LOCUS_46090 2151 805 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 protein_id gnl|my_center|LOCUS_46090 >Feature sequence855 337 1038 gene locus_tag LOCUS_46100 337 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 1354 1022 gene locus_tag LOCUS_46110 1354 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 >Feature sequence856 1191 2285 gene locus_tag LOCUS_46120 1191 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 >Feature sequence857 443 916 gene locus_tag LOCUS_46130 gene rpsG 443 916 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_46130 >Feature sequence858 504 1061 gene locus_tag LOCUS_46140 504 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46140 1924 1142 gene locus_tag LOCUS_46150 1924 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 2127 2333 gene locus_tag LOCUS_46160 2127 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 >Feature sequence859 <1 2250 gene locus_tag LOCUS_46170 <1 2250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141201.1:ABC transporter permease >Feature sequence860 >Feature sequence861 757 1605 gene locus_tag LOCUS_46180 757 1605 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711605.1 protein_id gnl|my_center|LOCUS_46180 <2380 1646 gene locus_tag LOCUS_46190 <2380 1646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920401.1:M28 family metallopeptidase >Feature sequence862 619 2190 gene locus_tag LOCUS_46200 619 2190 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931965.1 protein_id gnl|my_center|LOCUS_46200 >Feature sequence863 257 1528 gene locus_tag LOCUS_46210 257 1528 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704265.1 protein_id gnl|my_center|LOCUS_46210 1571 2074 gene locus_tag LOCUS_46220 1571 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 >Feature sequence864 <1 720 gene locus_tag LOCUS_46230 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942670.1:chorismate synthase 717 1226 gene locus_tag LOCUS_46240 gene def 717 1226 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_46240 1236 2285 gene locus_tag LOCUS_46250 gene fmt 1236 2285 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_46250 >Feature sequence865 981 1601 gene locus_tag LOCUS_46260 981 1601 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728747.1 protein_id gnl|my_center|LOCUS_46260 >Feature sequence866 >Feature sequence867 1989 2141 gene locus_tag LOCUS_46270 1989 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 >Feature sequence868 >Feature sequence869 <2347 1335 gene locus_tag LOCUS_46280 <2347 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384240.1:P1 family peptidase >Feature sequence870 >Feature sequence871 59 1426 gene locus_tag LOCUS_46290 59 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46290 1515 1820 gene locus_tag LOCUS_46300 1515 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46300 1914 2285 gene locus_tag LOCUS_46310 1914 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46310 >Feature sequence872 438 1616 gene locus_tag LOCUS_46320 438 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 >Feature sequence873 736 921 gene locus_tag LOCUS_46330 736 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 1198 1845 gene locus_tag LOCUS_46340 gene eda 1198 1845 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_46340 >Feature sequence874 1263 496 gene locus_tag LOCUS_46350 1263 496 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_46350 2222 1278 gene locus_tag LOCUS_46360 2222 1278 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_46360 >Feature sequence875 407 1444 gene locus_tag LOCUS_46370 gene istA 407 1444 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047902700.1 protein_id gnl|my_center|LOCUS_46370 >Feature sequence876 105 728 gene locus_tag LOCUS_46380 105 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 709 1692 gene locus_tag LOCUS_46390 709 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 >Feature sequence877 <1 1012 gene locus_tag LOCUS_46400 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119973.1:Na+:solute symporter 1030 1824 gene locus_tag LOCUS_46410 1030 1824 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776793.1 protein_id gnl|my_center|LOCUS_46410 >Feature sequence878 <1 822 gene locus_tag LOCUS_46420 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245307.1:RluA family pseudouridine synthase >Feature sequence879 <1 1299 gene locus_tag LOCUS_46430 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107138.1:glycoside hydrolase family 88 protein 1329 2084 gene locus_tag LOCUS_46440 1329 2084 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242402.1 protein_id gnl|my_center|LOCUS_46440 >Feature sequence880 >Feature sequence881 2077 806 gene locus_tag LOCUS_46450 2077 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 >Feature sequence882 <2256 1018 gene locus_tag LOCUS_46460 <2256 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940957.1:DNA repair protein RadA >Feature sequence883 887 1975 gene locus_tag LOCUS_46470 887 1975 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 protein_id gnl|my_center|LOCUS_46470 >Feature sequence884 503 2137 gene locus_tag LOCUS_46480 503 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 >Feature sequence885 797 60 gene locus_tag LOCUS_46490 gene mshB 797 60 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_46490 957 1952 gene locus_tag LOCUS_46500 957 1952 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 protein_id gnl|my_center|LOCUS_46500 >Feature sequence886 >Feature sequence887 1555 641 gene locus_tag LOCUS_46510 1555 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46510 2157 1654 gene locus_tag LOCUS_46520 2157 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46520 >Feature sequence888 1007 189 gene locus_tag LOCUS_46530 1007 189 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970863.1 protein_id gnl|my_center|LOCUS_46530 >Feature sequence889 583 350 gene locus_tag LOCUS_46540 583 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 1496 921 gene locus_tag LOCUS_46550 1496 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 >Feature sequence890 42 977 gene locus_tag LOCUS_46560 42 977 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_46560 >Feature sequence891 1940 726 gene locus_tag LOCUS_46570 1940 726 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306554.1 protein_id gnl|my_center|LOCUS_46570 >Feature sequence892 227 757 gene locus_tag LOCUS_46580 227 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 649 981 gene locus_tag LOCUS_46590 649 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 1057 1248 gene locus_tag LOCUS_46600 1057 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 1349 1762 gene locus_tag LOCUS_46610 1349 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 >Feature sequence893 88 2142 gene locus_tag LOCUS_46620 88 2142 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_46620 >Feature sequence894 75 1124 gene locus_tag LOCUS_46630 75 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 1148 1909 gene locus_tag LOCUS_46640 1148 1909 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815133.1 protein_id gnl|my_center|LOCUS_46640 >Feature sequence895 312 97 gene locus_tag LOCUS_46650 312 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 814 293 gene locus_tag LOCUS_46660 814 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 <2187 1300 gene locus_tag LOCUS_46670 <2187 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073369.1:M28 family metallopeptidase >Feature sequence896 132 980 gene locus_tag LOCUS_46680 132 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 1183 1620 gene locus_tag LOCUS_46690 1183 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 1551 1715 gene locus_tag LOCUS_46700 1551 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 >Feature sequence897 2123 1548 gene locus_tag LOCUS_46710 2123 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 >Feature sequence898 1755 403 gene locus_tag LOCUS_46720 1755 403 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356440.1 protein_id gnl|my_center|LOCUS_46720 >Feature sequence899 225 1577 gene locus_tag LOCUS_46730 225 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094616.1 protein_id gnl|my_center|LOCUS_46730 >Feature sequence900 487 206 gene locus_tag LOCUS_46740 487 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 633 1115 gene locus_tag LOCUS_46750 633 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 1221 1619 gene locus_tag LOCUS_46760 1221 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 2049 1675 gene locus_tag LOCUS_46770 gene crcB 2049 1675 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253076.1 protein_id gnl|my_center|LOCUS_46770 >Feature sequence901 <1 2027 gene locus_tag LOCUS_46780 <1 2027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920838.1:TonB-dependent receptor >Feature sequence902 <1 934 gene locus_tag LOCUS_46790 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390841.1:oligosaccharide flippase family protein 960 1865 gene locus_tag LOCUS_46800 960 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 >Feature sequence903 1004 147 gene locus_tag LOCUS_46810 1004 147 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_46810 1215 2000 gene locus_tag LOCUS_46820 1215 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 >Feature sequence904 1284 1054 gene locus_tag LOCUS_46830 1284 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 >Feature sequence905 1534 554 gene locus_tag LOCUS_46840 1534 554 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815564.1 protein_id gnl|my_center|LOCUS_46840 <2160 1531 gene locus_tag LOCUS_46850 <2160 1531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973036.1:ABC transporter substrate-binding protein >Feature sequence906 471 1109 gene locus_tag LOCUS_46860 471 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 1117 1818 gene locus_tag LOCUS_46870 1117 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 >Feature sequence907 1042 686 gene locus_tag LOCUS_46880 1042 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 1923 1753 gene locus_tag LOCUS_46890 1923 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 2069 1920 gene locus_tag LOCUS_46900 2069 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 >Feature sequence908 <1 1199 gene locus_tag LOCUS_46910 <1 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930412.1:type I-U CRISPR-associated helicase/endonuclease Cas3 >Feature sequence909 942 1217 gene locus_tag LOCUS_46920 942 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 >Feature sequence910 146 1411 gene locus_tag LOCUS_46930 146 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 1674 1522 gene locus_tag LOCUS_46940 1674 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 1686 1913 gene locus_tag LOCUS_46950 1686 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 >Feature sequence911 418 1668 gene locus_tag LOCUS_46960 418 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46960 1668 2045 gene locus_tag LOCUS_46970 1668 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 >Feature sequence912 >Feature sequence913 297 458 gene locus_tag LOCUS_46980 297 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 1503 1087 gene locus_tag LOCUS_46990 1503 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 1928 1521 gene locus_tag LOCUS_47000 1928 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 >Feature sequence914 <1 1317 gene locus_tag LOCUS_47010 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880932.1:ABC transporter substrate-binding protein >Feature sequence915 1959 1426 gene locus_tag LOCUS_47020 1959 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 >Feature sequence916 106 1269 gene locus_tag LOCUS_47030 106 1269 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_47030 >Feature sequence917 879 385 gene locus_tag LOCUS_47040 879 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 1120 1506 gene locus_tag LOCUS_47050 1120 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 1980 1516 gene locus_tag LOCUS_47060 1980 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 >Feature sequence918 <1 687 gene locus_tag LOCUS_47070 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006310732.1:ABC transporter permease 699 1604 gene locus_tag LOCUS_47080 699 1604 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_47080 >Feature sequence919 342 1619 gene locus_tag LOCUS_47090 342 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 >Feature sequence920 1733 1227 gene locus_tag LOCUS_47100 1733 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 >Feature sequence921 1496 774 gene locus_tag LOCUS_47110 1496 774 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_47110 <2065 1496 gene locus_tag LOCUS_47120 <2065 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421621.1:glycosyltransferase family 2 protein >Feature sequence922 1540 410 gene locus_tag LOCUS_47130 1540 410 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164689163.1 protein_id gnl|my_center|LOCUS_47130 1986 1540 gene locus_tag LOCUS_47140 1986 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 >Feature sequence923 >Feature sequence924 >Feature sequence925 903 1832 gene locus_tag LOCUS_47150 903 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142031.1 protein_id gnl|my_center|LOCUS_47150 >Feature sequence926 326 871 gene locus_tag LOCUS_47160 326 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 873 1709 gene locus_tag LOCUS_47170 873 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 >Feature sequence927 <2035 947 gene locus_tag LOCUS_47180 <2035 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880579.1:3-isopropylmalate dehydratase large subunit >Feature sequence928 <1 1196 gene locus_tag LOCUS_47190 <1 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259063.1:carbohydrate-binding domain-containing protein note possible pseudo, internal stop codon 1239 1793 gene locus_tag LOCUS_47200 1239 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47200 >Feature sequence929 >Feature sequence930 >Feature sequence931 1816 179 gene locus_tag LOCUS_47210 1816 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 >Feature sequence932 1851 1246 gene locus_tag LOCUS_47220 1851 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47220 >Feature sequence933 1452 418 gene locus_tag LOCUS_47230 1452 418 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861524.1 protein_id gnl|my_center|LOCUS_47230 >Feature sequence934 <2009 1139 gene locus_tag LOCUS_47240 <2009 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027217.1:prephenate dehydrogenase >Feature sequence935 <2008 1356 gene locus_tag LOCUS_47250 <2008 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167441479.1:amidohydrolase family protein >Feature sequence936 <1 505 gene locus_tag LOCUS_47260 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061332.1:carbohydrate kinase family protein 502 1797 gene locus_tag LOCUS_47270 502 1797 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 protein_id gnl|my_center|LOCUS_47270 >Feature sequence937 322 1191 gene locus_tag LOCUS_47280 322 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47280 1188 1370 gene locus_tag LOCUS_47290 1188 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 1413 1655 gene locus_tag LOCUS_47300 1413 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 >Feature sequence938 359 829 gene locus_tag LOCUS_47310 359 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47310 718 963 gene locus_tag LOCUS_47320 718 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47320 1126 1596 gene locus_tag LOCUS_47330 1126 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330