>Feature sequence0001 <1 1583 gene locus_tag LOCUS_00010 <1 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000378318.1:MraY family glycosyltransferase 1628 4018 gene locus_tag LOCUS_00020 gene prsT 1628 4018 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_00020 4108 5349 gene locus_tag LOCUS_00030 4108 5349 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974189.1 protein_id gnl|my_center|LOCUS_00030 5346 6854 gene locus_tag LOCUS_00040 5346 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6859 8250 gene locus_tag LOCUS_00050 6859 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8437 9258 gene locus_tag LOCUS_00060 8437 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9493 10710 gene locus_tag LOCUS_00070 9493 10710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10710 12692 gene locus_tag LOCUS_00080 10710 12692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12807 13649 gene locus_tag LOCUS_00090 12807 13649 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_00090 13749 15344 gene locus_tag LOCUS_00100 13749 15344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 >Feature sequence0002 690 238 gene locus_tag LOCUS_00110 gene mraZ 690 238 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939783.1 protein_id gnl|my_center|LOCUS_00110 1009 2031 gene locus_tag LOCUS_00120 1009 2031 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939785.1 protein_id gnl|my_center|LOCUS_00120 2148 2834 gene locus_tag LOCUS_00130 2148 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 3005 3703 gene locus_tag LOCUS_00140 3005 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 4164 3700 gene locus_tag LOCUS_00150 4164 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 4456 5595 gene locus_tag LOCUS_00160 4456 5595 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_00160 5595 6014 gene locus_tag LOCUS_00170 5595 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 5915 6478 gene locus_tag LOCUS_00180 5915 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 6475 6906 gene locus_tag LOCUS_00190 6475 6906 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921451.1 protein_id gnl|my_center|LOCUS_00190 9543 6913 gene locus_tag LOCUS_00200 9543 6913 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938725.1 protein_id gnl|my_center|LOCUS_00200 9972 9658 gene locus_tag LOCUS_00210 9972 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938727.1 protein_id gnl|my_center|LOCUS_00210 10079 10753 gene locus_tag LOCUS_00220 10079 10753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 10855 10930 gene locus_tag LOCUS_t00010 10855 10930 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12424 11216 gene locus_tag LOCUS_00230 12424 11216 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 protein_id gnl|my_center|LOCUS_00230 12852 13097 gene locus_tag LOCUS_00240 12852 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 13094 14068 gene locus_tag LOCUS_00250 13094 14068 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150678942.1 protein_id gnl|my_center|LOCUS_00250 >Feature sequence0003 1036 164 gene locus_tag LOCUS_00260 1036 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940655.1 protein_id gnl|my_center|LOCUS_00260 1849 1121 gene locus_tag LOCUS_00270 1849 1121 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792195.1 protein_id gnl|my_center|LOCUS_00270 2771 1842 gene locus_tag LOCUS_00280 2771 1842 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939124.1 protein_id gnl|my_center|LOCUS_00280 3096 2776 gene locus_tag LOCUS_00290 gene trxA 3096 2776 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_00290 4351 3251 gene locus_tag LOCUS_00300 gene tsaD 4351 3251 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939126.1 protein_id gnl|my_center|LOCUS_00300 5391 4360 gene locus_tag LOCUS_00310 gene fbp 5391 4360 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_00310 6193 5453 gene locus_tag LOCUS_00320 6193 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 7189 6356 gene locus_tag LOCUS_00330 7189 6356 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939129.1 protein_id gnl|my_center|LOCUS_00330 7493 7173 gene locus_tag LOCUS_00340 7493 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 7778 7503 gene locus_tag LOCUS_00350 7778 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939131.1 protein_id gnl|my_center|LOCUS_00350 8378 7818 gene locus_tag LOCUS_00360 gene pgsA 8378 7818 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_00360 9222 8401 gene locus_tag LOCUS_00370 9222 8401 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939133.1 protein_id gnl|my_center|LOCUS_00370 10012 9389 gene locus_tag LOCUS_00380 10012 9389 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524381.1 protein_id gnl|my_center|LOCUS_00380 10212 10658 gene locus_tag LOCUS_00390 10212 10658 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 protein_id gnl|my_center|LOCUS_00390 10721 12049 gene locus_tag LOCUS_00400 10721 12049 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_00400 13844 12102 gene locus_tag LOCUS_00410 13844 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 >Feature sequence0004 914 54 gene locus_tag LOCUS_00420 914 54 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_00420 2797 911 gene locus_tag LOCUS_00430 2797 911 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_00430 3834 3013 gene locus_tag LOCUS_00440 3834 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 4145 3831 gene locus_tag LOCUS_00450 4145 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 4761 4150 gene locus_tag LOCUS_00460 4761 4150 CDS product DUF4881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937459.1 protein_id gnl|my_center|LOCUS_00460 5869 4823 gene locus_tag LOCUS_00470 5869 4823 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937460.1 protein_id gnl|my_center|LOCUS_00470 6197 5898 gene locus_tag LOCUS_00480 6197 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937461.1 protein_id gnl|my_center|LOCUS_00480 6530 9022 gene locus_tag LOCUS_00490 6530 9022 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937462.1 protein_id gnl|my_center|LOCUS_00490 >Feature sequence0005 3540 868 gene locus_tag LOCUS_00500 3540 868 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940472.1 protein_id gnl|my_center|LOCUS_00500 3742 5403 gene locus_tag LOCUS_00510 3742 5403 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_00510 5433 5831 gene locus_tag LOCUS_00520 5433 5831 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545664.1 protein_id gnl|my_center|LOCUS_00520 5803 6801 gene locus_tag LOCUS_00530 5803 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 6850 8520 gene locus_tag LOCUS_00540 6850 8520 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792640.1 protein_id gnl|my_center|LOCUS_00540 8510 10216 gene locus_tag LOCUS_00550 8510 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 10217 10873 gene locus_tag LOCUS_00560 gene lipB 10217 10873 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938205.1 protein_id gnl|my_center|LOCUS_00560 >Feature sequence0006 323 1165 gene locus_tag LOCUS_00570 323 1165 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_00570 1321 2055 gene locus_tag LOCUS_00580 1321 2055 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_00580 2108 4132 gene locus_tag LOCUS_00590 2108 4132 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_00590 5819 4239 gene locus_tag LOCUS_00600 5819 4239 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_00600 6739 5993 gene locus_tag LOCUS_00610 6739 5993 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937490.1 protein_id gnl|my_center|LOCUS_00610 7516 6749 gene locus_tag LOCUS_00620 gene modA 7516 6749 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937488.1 protein_id gnl|my_center|LOCUS_00620 8246 7539 gene locus_tag LOCUS_00630 gene modB 8246 7539 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 protein_id gnl|my_center|LOCUS_00630 8455 8198 gene locus_tag LOCUS_00640 8455 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 9597 8485 gene locus_tag LOCUS_00650 9597 8485 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787310.1 protein_id gnl|my_center|LOCUS_00650 9893 10732 gene locus_tag LOCUS_00660 gene nifH 9893 10732 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176593.1 protein_id gnl|my_center|LOCUS_00660 10763 11107 gene locus_tag LOCUS_00670 10763 11107 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176592.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence0007 568 2052 gene locus_tag LOCUS_00680 568 2052 CDS product outer membrane homotrimeric porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938098.1 protein_id gnl|my_center|LOCUS_00680 2325 3857 gene locus_tag LOCUS_00690 2325 3857 CDS product outer membrane homotrimeric porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938098.1 protein_id gnl|my_center|LOCUS_00690 4157 5539 gene locus_tag LOCUS_00700 4157 5539 CDS product outer membrane homotrimeric porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938098.1 protein_id gnl|my_center|LOCUS_00700 5728 7002 gene locus_tag LOCUS_00710 gene hisD 5728 7002 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938097.1 protein_id gnl|my_center|LOCUS_00710 7045 7953 gene locus_tag LOCUS_00720 7045 7953 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938096.1 protein_id gnl|my_center|LOCUS_00720 8426 8737 gene locus_tag LOCUS_00730 gene rpsF 8426 8737 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938255.1 protein_id gnl|my_center|LOCUS_00730 8741 9001 gene locus_tag LOCUS_00740 gene rpsR 8741 9001 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938256.1 protein_id gnl|my_center|LOCUS_00740 9007 9498 gene locus_tag LOCUS_00750 gene rplI 9007 9498 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938257.1 protein_id gnl|my_center|LOCUS_00750 >Feature sequence0008 <1 1404 gene locus_tag LOCUS_00760 <1 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011787306.1:nitrogenase iron-molybdenum cofactor biosynthesis protein NifE 1408 2811 gene locus_tag LOCUS_00770 1408 2811 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933204.1 protein_id gnl|my_center|LOCUS_00770 2840 4147 gene locus_tag LOCUS_00780 2840 4147 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787304.1 protein_id gnl|my_center|LOCUS_00780 4165 4410 gene locus_tag LOCUS_00790 4165 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 4904 4536 gene locus_tag LOCUS_00800 4904 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 5264 5034 gene locus_tag LOCUS_00810 5264 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 5558 6127 gene locus_tag LOCUS_00820 5558 6127 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003572929.1 protein_id gnl|my_center|LOCUS_00820 6124 6663 gene locus_tag LOCUS_00830 gene pyrR 6124 6663 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938679.1 protein_id gnl|my_center|LOCUS_00830 6686 7246 gene locus_tag LOCUS_00840 gene thrB 6686 7246 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939791.1 protein_id gnl|my_center|LOCUS_00840 7243 7845 gene locus_tag LOCUS_00850 7243 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939792.1 protein_id gnl|my_center|LOCUS_00850 8093 8497 gene locus_tag LOCUS_00860 8093 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 9528 8653 gene locus_tag LOCUS_00870 9528 8653 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939603.1 protein_id gnl|my_center|LOCUS_00870 10104 9628 gene locus_tag LOCUS_00880 10104 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 >Feature sequence0009 756 202 gene locus_tag LOCUS_00890 gene frr 756 202 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_00890 1480 758 gene locus_tag LOCUS_00900 gene pyrH 1480 758 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938170.1 protein_id gnl|my_center|LOCUS_00900 2191 1568 gene locus_tag LOCUS_00910 gene tsf 2191 1568 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869491.1 protein_id gnl|my_center|LOCUS_00910 2973 2197 gene locus_tag LOCUS_00920 gene rpsB 2973 2197 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938173.1 protein_id gnl|my_center|LOCUS_00920 3905 3129 gene locus_tag LOCUS_00930 3905 3129 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938174.1 protein_id gnl|my_center|LOCUS_00930 4304 3915 gene locus_tag LOCUS_00940 4304 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 5249 4401 gene locus_tag LOCUS_00950 5249 4401 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938660.1 protein_id gnl|my_center|LOCUS_00950 5513 5391 gene locus_tag LOCUS_00960 5513 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 6569 5544 gene locus_tag LOCUS_00970 6569 5544 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938989.1 protein_id gnl|my_center|LOCUS_00970 7774 6812 gene locus_tag LOCUS_00980 7774 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 <10093 7868 gene locus_tag LOCUS_00990 <10093 7868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937802.1:DNA polymerase I >Feature sequence0010 38 1498 gene locus_tag LOCUS_01000 38 1498 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937786.1 protein_id gnl|my_center|LOCUS_01000 2537 1527 gene locus_tag LOCUS_01010 2537 1527 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_01010 4762 2630 gene locus_tag LOCUS_01020 4762 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 5331 4942 gene locus_tag LOCUS_01030 gene rpsI 5331 4942 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_01030 5782 5354 gene locus_tag LOCUS_01040 gene rplM 5782 5354 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939788.1 protein_id gnl|my_center|LOCUS_01040 8535 5893 gene locus_tag LOCUS_01050 gene alaS 8535 5893 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938388.1 protein_id gnl|my_center|LOCUS_01050 <9637 8603 gene locus_tag LOCUS_01060 <9637 8603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938389.1:recombinase RecA >Feature sequence0011 2619 2104 gene locus_tag LOCUS_01070 2619 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 3151 2630 gene locus_tag LOCUS_01080 3151 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 4158 3340 gene locus_tag LOCUS_01090 4158 3340 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967051.1 protein_id gnl|my_center|LOCUS_01090 5357 4167 gene locus_tag LOCUS_01100 5357 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 6666 5476 gene locus_tag LOCUS_01110 6666 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 7685 6663 gene locus_tag LOCUS_01120 7685 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8401 7682 gene locus_tag LOCUS_01130 8401 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 9466 8405 gene locus_tag LOCUS_01140 9466 8405 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090704.1 protein_id gnl|my_center|LOCUS_01140 >Feature sequence0012 1546 629 gene locus_tag LOCUS_01150 1546 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 2216 1710 gene locus_tag LOCUS_01160 2216 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 2378 3340 gene locus_tag LOCUS_01170 2378 3340 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243262.1 protein_id gnl|my_center|LOCUS_01170 4680 3349 gene locus_tag LOCUS_01180 4680 3349 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938700.1 protein_id gnl|my_center|LOCUS_01180 5841 4759 gene locus_tag LOCUS_01190 gene amrS 5841 4759 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409338.1 protein_id gnl|my_center|LOCUS_01190 6971 5856 gene locus_tag LOCUS_01200 6971 5856 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938072.1 protein_id gnl|my_center|LOCUS_01200 7188 8162 gene locus_tag LOCUS_01210 7188 8162 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938071.1 protein_id gnl|my_center|LOCUS_01210 8682 8359 gene locus_tag LOCUS_01220 8682 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 >Feature sequence0013 340 459 gene locus_tag LOCUS_01230 340 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 548 2335 gene locus_tag LOCUS_01240 gene kdpA 548 2335 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185359.1 protein_id gnl|my_center|LOCUS_01240 2363 4483 gene locus_tag LOCUS_01250 gene kdpB 2363 4483 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 protein_id gnl|my_center|LOCUS_01250 4496 5122 gene locus_tag LOCUS_01260 gene kdpC 4496 5122 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_01260 5163 7943 gene locus_tag LOCUS_01270 5163 7943 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_01270 7940 8662 gene locus_tag LOCUS_01280 7940 8662 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_01280 >Feature sequence0014 299 392 gene locus_tag LOCUS_t00020 299 392 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 469 936 gene locus_tag LOCUS_01290 469 936 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704516.1 protein_id gnl|my_center|LOCUS_01290 2216 966 gene locus_tag LOCUS_01300 2216 966 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_01300 2689 2267 gene locus_tag LOCUS_01310 2689 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 3592 2744 gene locus_tag LOCUS_01320 3592 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 3926 4001 gene locus_tag LOCUS_t00030 3926 4001 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4075 4527 gene locus_tag LOCUS_01330 4075 4527 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629306.1 protein_id gnl|my_center|LOCUS_01330 4597 5616 gene locus_tag LOCUS_01340 gene rfbB 4597 5616 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938659.1 protein_id gnl|my_center|LOCUS_01340 5613 6509 gene locus_tag LOCUS_01350 gene rfbD 5613 6509 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938658.1 protein_id gnl|my_center|LOCUS_01350 6546 7625 gene locus_tag LOCUS_01360 6546 7625 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940459.1 protein_id gnl|my_center|LOCUS_01360 7639 8475 gene locus_tag LOCUS_01370 7639 8475 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940460.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence0015 776 177 gene locus_tag LOCUS_01380 776 177 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939236.1 protein_id gnl|my_center|LOCUS_01380 2638 773 gene locus_tag LOCUS_01390 gene iorA 2638 773 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939237.1 protein_id gnl|my_center|LOCUS_01390 3346 2654 gene locus_tag LOCUS_01400 3346 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 3726 4997 gene locus_tag LOCUS_01410 3726 4997 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939239.1 protein_id gnl|my_center|LOCUS_01410 5110 5778 gene locus_tag LOCUS_01420 gene nadD 5110 5778 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939240.1 protein_id gnl|my_center|LOCUS_01420 7282 5810 gene locus_tag LOCUS_01430 7282 5810 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940350.1 protein_id gnl|my_center|LOCUS_01430 8123 7317 gene locus_tag LOCUS_01440 8123 7317 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940371.1 protein_id gnl|my_center|LOCUS_01440 >Feature sequence0016 292 948 gene locus_tag LOCUS_01450 292 948 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_01450 1000 2214 gene locus_tag LOCUS_01460 1000 2214 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940083.1 protein_id gnl|my_center|LOCUS_01460 2232 5468 gene locus_tag LOCUS_01470 2232 5468 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940082.1 protein_id gnl|my_center|LOCUS_01470 5468 6886 gene locus_tag LOCUS_01480 5468 6886 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791655.1 protein_id gnl|my_center|LOCUS_01480 7860 6952 gene locus_tag LOCUS_01490 7860 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 >Feature sequence0017 <1 666 gene locus_tag LOCUS_01500 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937788.1:ADP-glyceromanno-heptose 6-epimerase 689 3319 gene locus_tag LOCUS_01510 gene lptD 689 3319 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792614.1 protein_id gnl|my_center|LOCUS_01510 3336 5156 gene locus_tag LOCUS_01520 3336 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 5291 6427 gene locus_tag LOCUS_01530 gene alr 5291 6427 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938254.1 protein_id gnl|my_center|LOCUS_01530 6444 6635 gene locus_tag LOCUS_01540 6444 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 6743 7648 gene locus_tag LOCUS_01550 6743 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 7645 8220 gene locus_tag LOCUS_01560 7645 8220 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_01560 >Feature sequence0018 1569 1003 gene locus_tag LOCUS_01570 1569 1003 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294626.1 protein_id gnl|my_center|LOCUS_01570 3410 2184 gene locus_tag LOCUS_01580 3410 2184 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_01580 3809 8242 gene locus_tag LOCUS_01590 3809 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 >Feature sequence0019 920 453 gene locus_tag LOCUS_01600 920 453 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938301.1 protein_id gnl|my_center|LOCUS_01600 1356 913 gene locus_tag LOCUS_01610 1356 913 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792591.1 protein_id gnl|my_center|LOCUS_01610 1519 2742 gene locus_tag LOCUS_01620 1519 2742 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938299.1 protein_id gnl|my_center|LOCUS_01620 3253 2762 gene locus_tag LOCUS_01630 3253 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 3572 4453 gene locus_tag LOCUS_01640 3572 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 4472 5062 gene locus_tag LOCUS_01650 4472 5062 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_01650 5300 5079 gene locus_tag LOCUS_01660 5300 5079 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938662.1 protein_id gnl|my_center|LOCUS_01660 5414 5800 gene locus_tag LOCUS_01670 5414 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 5818 6696 gene locus_tag LOCUS_01680 5818 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 6700 7389 gene locus_tag LOCUS_01690 6700 7389 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938666.1 protein_id gnl|my_center|LOCUS_01690 7470 7784 gene locus_tag LOCUS_01700 7470 7784 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938667.1 protein_id gnl|my_center|LOCUS_01700 >Feature sequence0020 <1 1859 gene locus_tag LOCUS_01710 <1 1859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207301211.1:transketolase 2001 2984 gene locus_tag LOCUS_01720 gene glpX 2001 2984 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938831.1 protein_id gnl|my_center|LOCUS_01720 3253 3053 gene locus_tag LOCUS_01730 3253 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940344.1 protein_id gnl|my_center|LOCUS_01730 3246 3398 gene locus_tag LOCUS_01740 3246 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3395 4468 gene locus_tag LOCUS_01750 3395 4468 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938354.1 protein_id gnl|my_center|LOCUS_01750 4662 5153 gene locus_tag LOCUS_01760 4662 5153 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014810586.1 protein_id gnl|my_center|LOCUS_01760 5324 6265 gene locus_tag LOCUS_01770 gene cysK 5324 6265 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937966.1 protein_id gnl|my_center|LOCUS_01770 6284 7234 gene locus_tag LOCUS_01780 6284 7234 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937965.1 protein_id gnl|my_center|LOCUS_01780 7345 7761 gene locus_tag LOCUS_01790 7345 7761 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_01790 7785 8081 gene locus_tag LOCUS_01800 7785 8081 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937703.1 protein_id gnl|my_center|LOCUS_01800 >Feature sequence0021 358 552 gene locus_tag LOCUS_01810 358 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 556 1338 gene locus_tag LOCUS_01820 556 1338 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940432.1 protein_id gnl|my_center|LOCUS_01820 1562 1362 gene locus_tag LOCUS_01830 1562 1362 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940433.1 protein_id gnl|my_center|LOCUS_01830 1644 2957 gene locus_tag LOCUS_01840 1644 2957 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_01840 2965 3762 gene locus_tag LOCUS_01850 gene mqnB 2965 3762 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791464.1 protein_id gnl|my_center|LOCUS_01850 3797 4765 gene locus_tag LOCUS_01860 3797 4765 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940437.1 protein_id gnl|my_center|LOCUS_01860 4777 7272 gene locus_tag LOCUS_01870 4777 7272 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940438.1 protein_id gnl|my_center|LOCUS_01870 >Feature sequence0022 <1 1419 gene locus_tag LOCUS_01880 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791908.1:outer membrane protein assembly factor BamA 1479 2015 gene locus_tag LOCUS_01890 1479 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 2031 3065 gene locus_tag LOCUS_01900 gene lpxD 2031 3065 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939642.1 protein_id gnl|my_center|LOCUS_01900 3058 3534 gene locus_tag LOCUS_01910 gene fabZ 3058 3534 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939641.1 protein_id gnl|my_center|LOCUS_01910 3534 4343 gene locus_tag LOCUS_01920 gene lpxA 3534 4343 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939640.1 protein_id gnl|my_center|LOCUS_01920 4395 5216 gene locus_tag LOCUS_01930 gene lpxI 4395 5216 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence0023 280 2007 gene locus_tag LOCUS_01940 280 2007 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937481.1 protein_id gnl|my_center|LOCUS_01940 2607 2188 gene locus_tag LOCUS_01950 2607 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01950 3420 2686 gene locus_tag LOCUS_01960 3420 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01960 4095 3436 gene locus_tag LOCUS_01970 4095 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937574.1 protein_id gnl|my_center|LOCUS_01970 5809 4238 gene locus_tag LOCUS_01980 5809 4238 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_01980 6729 6010 gene locus_tag LOCUS_01990 gene lepB 6729 6010 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938005.1 protein_id gnl|my_center|LOCUS_01990 <8014 6772 gene locus_tag LOCUS_02000 <8014 6772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938004.1:translation elongation factor 4 >Feature sequence0024 1769 60 gene locus_tag LOCUS_02010 gene fliD 1769 60 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938162.1 protein_id gnl|my_center|LOCUS_02010 2810 1914 gene locus_tag LOCUS_02020 2810 1914 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938734.1 protein_id gnl|my_center|LOCUS_02020 3110 6553 gene locus_tag LOCUS_02030 3110 6553 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085112.1 protein_id gnl|my_center|LOCUS_02030 6770 7300 gene locus_tag LOCUS_02040 6770 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence0025 705 28 gene locus_tag LOCUS_02050 705 28 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946654.1 protein_id gnl|my_center|LOCUS_02050 1917 754 gene locus_tag LOCUS_02060 1917 754 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 protein_id gnl|my_center|LOCUS_02060 2645 1950 gene locus_tag LOCUS_02070 2645 1950 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792434.1 protein_id gnl|my_center|LOCUS_02070 2722 3939 gene locus_tag LOCUS_02080 2722 3939 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_02080 4418 3945 gene locus_tag LOCUS_02090 gene rnhA 4418 3945 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937992.1 protein_id gnl|my_center|LOCUS_02090 4987 4415 gene locus_tag LOCUS_02100 4987 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 5142 5873 gene locus_tag LOCUS_02110 5142 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 6102 6578 gene locus_tag LOCUS_02120 6102 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 7108 6737 gene locus_tag LOCUS_02130 7108 6737 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966792.1 protein_id gnl|my_center|LOCUS_02130 7239 7727 gene locus_tag LOCUS_02140 7239 7727 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966791.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence0026 1526 300 gene locus_tag LOCUS_02150 1526 300 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_02150 2231 1527 gene locus_tag LOCUS_02160 2231 1527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_02160 3474 2233 gene locus_tag LOCUS_02170 3474 2233 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_02170 3868 4809 gene locus_tag LOCUS_02180 3868 4809 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176672.1 protein_id gnl|my_center|LOCUS_02180 4811 5371 gene locus_tag LOCUS_02190 4811 5371 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392537.1 protein_id gnl|my_center|LOCUS_02190 5391 6632 gene locus_tag LOCUS_02200 5391 6632 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_02200 6642 6953 gene locus_tag LOCUS_02210 6642 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence0027 76 639 gene locus_tag LOCUS_02220 76 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 993 2624 gene locus_tag LOCUS_02230 993 2624 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972722.1 protein_id gnl|my_center|LOCUS_02230 3658 2621 gene locus_tag LOCUS_02240 3658 2621 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901552.1 protein_id gnl|my_center|LOCUS_02240 4630 4040 gene locus_tag LOCUS_02250 4630 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 6744 4627 gene locus_tag LOCUS_02260 6744 4627 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273527.1 protein_id gnl|my_center|LOCUS_02260 7533 6766 gene locus_tag LOCUS_02270 7533 6766 CDS product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070230.1 protein_id gnl|my_center|LOCUS_02270 >Feature sequence0028 <1 873 gene locus_tag LOCUS_02280 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938363.1:aconitate hydratase 907 2817 gene locus_tag LOCUS_02290 907 2817 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_02290 4969 2942 gene locus_tag LOCUS_02300 4969 2942 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792407.1 protein_id gnl|my_center|LOCUS_02300 5234 6676 gene locus_tag LOCUS_02310 5234 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 <7814 6673 gene locus_tag LOCUS_02320 <7814 6673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941701.1:sigma-54 dependent transcriptional regulator >Feature sequence0029 269 1438 gene locus_tag LOCUS_02330 269 1438 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939815.1 protein_id gnl|my_center|LOCUS_02330 1428 3986 gene locus_tag LOCUS_02340 1428 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 6485 3993 gene locus_tag LOCUS_02350 6485 3993 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940515.1 protein_id gnl|my_center|LOCUS_02350 <7749 6559 gene locus_tag LOCUS_02360 <7749 6559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940516.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence0030 <1 1208 gene locus_tag LOCUS_02370 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225996812.1:alpha/beta hydrolase 1319 2512 gene locus_tag LOCUS_02380 1319 2512 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_02380 2922 3566 gene locus_tag LOCUS_02390 2922 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 3583 4563 gene locus_tag LOCUS_02400 3583 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 7163 4638 gene locus_tag LOCUS_02410 7163 4638 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_02410 >Feature sequence0031 1113 169 gene locus_tag LOCUS_02420 gene mdh 1113 169 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153230.1 protein_id gnl|my_center|LOCUS_02420 1301 1711 gene locus_tag LOCUS_02430 1301 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3388 1886 gene locus_tag LOCUS_02440 3388 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 4452 3382 gene locus_tag LOCUS_02450 4452 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 5407 4658 gene locus_tag LOCUS_02460 5407 4658 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939585.1 protein_id gnl|my_center|LOCUS_02460 <7402 5576 gene locus_tag LOCUS_02470 <7402 5576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937760.1:UvrD-helicase domain-containing protein >Feature sequence0032 109 1890 gene locus_tag LOCUS_02480 109 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 2246 2434 gene locus_tag LOCUS_02490 2246 2434 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938662.1 protein_id gnl|my_center|LOCUS_02490 2489 3361 gene locus_tag LOCUS_02500 gene motA 2489 3361 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546161.1 protein_id gnl|my_center|LOCUS_02500 3397 4356 gene locus_tag LOCUS_02510 3397 4356 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546155.1 protein_id gnl|my_center|LOCUS_02510 4367 5089 gene locus_tag LOCUS_02520 4367 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 5517 5086 gene locus_tag LOCUS_02530 5517 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 5919 5590 gene locus_tag LOCUS_02540 5919 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 6588 5977 gene locus_tag LOCUS_02550 gene wrbA 6588 5977 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_02550 6793 7173 gene locus_tag LOCUS_02560 6793 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence0033 2640 1171 gene locus_tag LOCUS_02570 2640 1171 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_02570 3285 2644 gene locus_tag LOCUS_02580 3285 2644 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_02580 4198 3290 gene locus_tag LOCUS_02590 4198 3290 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_02590 4613 4807 gene locus_tag LOCUS_02600 4613 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 4937 6577 gene locus_tag LOCUS_02610 4937 6577 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392693.1 protein_id gnl|my_center|LOCUS_02610 >Feature sequence0034 1990 2187 gene locus_tag LOCUS_02620 1990 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 2275 2350 gene locus_tag LOCUS_t00040 2275 2350 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3071 2856 gene locus_tag LOCUS_02630 3071 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 3027 4586 gene locus_tag LOCUS_02640 gene tpsB2 3027 4586 CDS product two-partner secretion system transporter TpsB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147036.1 protein_id gnl|my_center|LOCUS_02640 >Feature sequence0035 24 1058 gene locus_tag LOCUS_02650 gene flgA 24 1058 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294608.1 protein_id gnl|my_center|LOCUS_02650 1093 1788 gene locus_tag LOCUS_02660 1093 1788 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937821.1 protein_id gnl|my_center|LOCUS_02660 1813 2955 gene locus_tag LOCUS_02670 1813 2955 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937822.1 protein_id gnl|my_center|LOCUS_02670 2957 3592 gene locus_tag LOCUS_02680 2957 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 3682 4164 gene locus_tag LOCUS_02690 3682 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 4165 6300 gene locus_tag LOCUS_02700 gene flgK 4165 6300 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937825.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence0036 617 345 gene locus_tag LOCUS_02710 617 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 1796 636 gene locus_tag LOCUS_02720 1796 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940477.1 protein_id gnl|my_center|LOCUS_02720 2404 1796 gene locus_tag LOCUS_02730 2404 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 3020 2481 gene locus_tag LOCUS_02740 gene aroL 3020 2481 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938191.1 protein_id gnl|my_center|LOCUS_02740 3186 4199 gene locus_tag LOCUS_02750 gene ychF 3186 4199 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_02750 4253 4477 gene locus_tag LOCUS_02760 4253 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 6479 4512 gene locus_tag LOCUS_02770 6479 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 7061 6492 gene locus_tag LOCUS_02780 7061 6492 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937707.1 protein_id gnl|my_center|LOCUS_02780 >Feature sequence0037 732 1190 gene locus_tag LOCUS_02790 gene mscL 732 1190 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_02790 1635 4985 gene locus_tag LOCUS_02800 1635 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 5769 4987 gene locus_tag LOCUS_02810 5769 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 6044 6883 gene locus_tag LOCUS_02820 6044 6883 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972415.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence0038 558 878 gene locus_tag LOCUS_02830 558 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 1009 1533 gene locus_tag LOCUS_02840 1009 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 1523 1951 gene locus_tag LOCUS_02850 1523 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 1961 2464 gene locus_tag LOCUS_02860 1961 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 2473 4557 gene locus_tag LOCUS_02870 2473 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 4575 4907 gene locus_tag LOCUS_02880 4575 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 4913 5455 gene locus_tag LOCUS_02890 4913 5455 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791595.1 protein_id gnl|my_center|LOCUS_02890 5452 6261 gene locus_tag LOCUS_02900 5452 6261 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_02900 <6930 6355 gene locus_tag LOCUS_02910 <6930 6355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987089.1:M15 family metallopeptidase >Feature sequence0039 1074 199 gene locus_tag LOCUS_02920 1074 199 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088174.1 protein_id gnl|my_center|LOCUS_02920 2848 1049 gene locus_tag LOCUS_02930 2848 1049 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776640.1 protein_id gnl|my_center|LOCUS_02930 3866 2868 gene locus_tag LOCUS_02940 3866 2868 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067556.1 protein_id gnl|my_center|LOCUS_02940 4958 3981 gene locus_tag LOCUS_02950 4958 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_02950 6489 4966 gene locus_tag LOCUS_02960 6489 4966 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088170.1 protein_id gnl|my_center|LOCUS_02960 >Feature sequence0040 1079 81 gene locus_tag LOCUS_02970 gene hemB 1079 81 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938156.1 protein_id gnl|my_center|LOCUS_02970 2425 1241 gene locus_tag LOCUS_02980 gene ahbC 2425 1241 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_02980 3715 2555 gene locus_tag LOCUS_02990 3715 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 4169 3816 gene locus_tag LOCUS_03000 4169 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 5231 4173 gene locus_tag LOCUS_03010 5231 4173 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792670.1 protein_id gnl|my_center|LOCUS_03010 6552 5311 gene locus_tag LOCUS_03020 6552 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 >Feature sequence0041 2183 636 gene locus_tag LOCUS_03030 gene guaA 2183 636 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938342.1 protein_id gnl|my_center|LOCUS_03030 3661 2204 gene locus_tag LOCUS_03040 gene guaB 3661 2204 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938343.1 protein_id gnl|my_center|LOCUS_03040 4441 3821 gene locus_tag LOCUS_03050 4441 3821 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938344.1 protein_id gnl|my_center|LOCUS_03050 4580 4425 gene locus_tag LOCUS_03060 4580 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 5264 4584 gene locus_tag LOCUS_03070 gene ccsA 5264 4584 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_03070 5969 5292 gene locus_tag LOCUS_03080 5969 5292 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938347.1 protein_id gnl|my_center|LOCUS_03080 6634 5963 gene locus_tag LOCUS_03090 6634 5963 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938348.1 protein_id gnl|my_center|LOCUS_03090 >Feature sequence0042 1450 3372 gene locus_tag LOCUS_03100 1450 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 3424 3702 gene locus_tag LOCUS_03110 3424 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 5661 3751 gene locus_tag LOCUS_03120 5661 3751 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937567.1 protein_id gnl|my_center|LOCUS_03120 6138 5779 gene locus_tag LOCUS_03130 6138 5779 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937568.1 protein_id gnl|my_center|LOCUS_03130 6568 6140 gene locus_tag LOCUS_03140 6568 6140 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937569.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence0043 2283 535 gene locus_tag LOCUS_03150 2283 535 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938738.1 protein_id gnl|my_center|LOCUS_03150 2623 2548 gene locus_tag LOCUS_t00050 2623 2548 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2868 4499 gene locus_tag LOCUS_03160 gene lysS 2868 4499 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791906.1 protein_id gnl|my_center|LOCUS_03160 4496 5725 gene locus_tag LOCUS_03170 4496 5725 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_03170 >Feature sequence0044 597 1931 gene locus_tag LOCUS_03180 597 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 1972 3687 gene locus_tag LOCUS_03190 1972 3687 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938568.1 protein_id gnl|my_center|LOCUS_03190 3698 4939 gene locus_tag LOCUS_03200 3698 4939 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938567.1 protein_id gnl|my_center|LOCUS_03200 5213 5659 gene locus_tag LOCUS_03210 5213 5659 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167122675.1 protein_id gnl|my_center|LOCUS_03210 5757 6197 gene locus_tag LOCUS_03220 5757 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 >Feature sequence0045 331 1314 gene locus_tag LOCUS_03230 gene xerC 331 1314 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_03230 1357 1794 gene locus_tag LOCUS_03240 1357 1794 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937348.1 protein_id gnl|my_center|LOCUS_03240 2387 1878 gene locus_tag LOCUS_03250 2387 1878 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_03250 3570 2437 gene locus_tag LOCUS_03260 3570 2437 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939342.1 protein_id gnl|my_center|LOCUS_03260 4870 3650 gene locus_tag LOCUS_03270 gene lhgO 4870 3650 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958479.1 protein_id gnl|my_center|LOCUS_03270 5033 4887 gene locus_tag LOCUS_03280 5033 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 6389 5061 gene locus_tag LOCUS_03290 6389 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 >Feature sequence0046 500 1354 gene locus_tag LOCUS_03300 500 1354 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939174.1 protein_id gnl|my_center|LOCUS_03300 1364 3109 gene locus_tag LOCUS_03310 1364 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939173.1 protein_id gnl|my_center|LOCUS_03310 3229 4425 gene locus_tag LOCUS_03320 3229 4425 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938186.1 protein_id gnl|my_center|LOCUS_03320 4454 5110 gene locus_tag LOCUS_03330 4454 5110 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939172.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence0047 1 750 gene locus_tag LOCUS_03340 1 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 910 4506 gene locus_tag LOCUS_03350 910 4506 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939119.1 protein_id gnl|my_center|LOCUS_03350 4939 4580 gene locus_tag LOCUS_03360 4939 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 5915 5004 gene locus_tag LOCUS_03370 5915 5004 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_03370 >Feature sequence0048 1129 176 gene locus_tag LOCUS_03380 1129 176 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_03380 3550 1652 gene locus_tag LOCUS_03390 3550 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 3902 5770 gene locus_tag LOCUS_03400 3902 5770 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937349.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence0049 123 767 gene locus_tag LOCUS_03410 123 767 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_03410 966 1766 gene locus_tag LOCUS_03420 966 1766 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937693.1 protein_id gnl|my_center|LOCUS_03420 1865 2575 gene locus_tag LOCUS_03430 1865 2575 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_03430 2579 3379 gene locus_tag LOCUS_03440 2579 3379 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937695.1 protein_id gnl|my_center|LOCUS_03440 3376 4071 gene locus_tag LOCUS_03450 3376 4071 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937696.1 protein_id gnl|my_center|LOCUS_03450 4094 5527 gene locus_tag LOCUS_03460 4094 5527 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937697.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence0050 2176 1496 gene locus_tag LOCUS_03470 2176 1496 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_03470 2329 2769 gene locus_tag LOCUS_03480 gene fliJ 2329 2769 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938212.1 protein_id gnl|my_center|LOCUS_03480 2750 3382 gene locus_tag LOCUS_03490 2750 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 3423 4334 gene locus_tag LOCUS_03500 3423 4334 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938210.1 protein_id gnl|my_center|LOCUS_03500 4264 6075 gene locus_tag LOCUS_03510 4264 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 >Feature sequence0051 1778 450 gene locus_tag LOCUS_03520 1778 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 1845 1921 gene locus_tag LOCUS_t00060 1845 1921 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2023 3021 gene locus_tag LOCUS_03530 2023 3021 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937367.1 protein_id gnl|my_center|LOCUS_03530 3014 3433 gene locus_tag LOCUS_03540 3014 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 3430 4173 gene locus_tag LOCUS_03550 3430 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 4749 4186 gene locus_tag LOCUS_03560 4749 4186 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266302.1 protein_id gnl|my_center|LOCUS_03560 5149 4856 gene locus_tag LOCUS_03570 5149 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence0052 1216 1431 gene locus_tag LOCUS_03580 1216 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 2412 1954 gene locus_tag LOCUS_03590 2412 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 2584 3888 gene locus_tag LOCUS_03600 2584 3888 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940529.1 protein_id gnl|my_center|LOCUS_03600 3927 4943 gene locus_tag LOCUS_03610 gene cydB 3927 4943 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940528.1 protein_id gnl|my_center|LOCUS_03610 5584 5066 gene locus_tag LOCUS_03620 5584 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 >Feature sequence0053 9 1667 gene locus_tag LOCUS_03630 9 1667 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939091.1 protein_id gnl|my_center|LOCUS_03630 1667 2833 gene locus_tag LOCUS_03640 1667 2833 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939090.1 protein_id gnl|my_center|LOCUS_03640 4396 2960 gene locus_tag LOCUS_03650 4396 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 5339 4407 gene locus_tag LOCUS_03660 5339 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence0054 3676 1685 gene locus_tag LOCUS_03670 3676 1685 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937567.1 protein_id gnl|my_center|LOCUS_03670 4138 3785 gene locus_tag LOCUS_03680 4138 3785 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937568.1 protein_id gnl|my_center|LOCUS_03680 4909 4265 gene locus_tag LOCUS_03690 4909 4265 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939255.1 protein_id gnl|my_center|LOCUS_03690 <6070 4925 gene locus_tag LOCUS_03700 <6070 4925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939254.1:FAD/NAD(P)-binding oxidoreductase >Feature sequence0055 754 515 gene locus_tag LOCUS_03710 754 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 919 1950 gene locus_tag LOCUS_03720 919 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2147 1947 gene locus_tag LOCUS_03730 2147 1947 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939599.1 protein_id gnl|my_center|LOCUS_03730 4721 2178 gene locus_tag LOCUS_03740 4721 2178 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939598.1 protein_id gnl|my_center|LOCUS_03740 5062 5556 gene locus_tag LOCUS_03750 5062 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 >Feature sequence0056 <1 514 gene locus_tag LOCUS_03760 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792552.1:sigma-54 dependent transcriptional regulator 676 1284 gene locus_tag LOCUS_03770 676 1284 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940338.1 protein_id gnl|my_center|LOCUS_03770 1277 2128 gene locus_tag LOCUS_03780 gene sfsA 1277 2128 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940482.1 protein_id gnl|my_center|LOCUS_03780 2517 2613 gene locus_tag LOCUS_t00070 2517 2613 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3275 4243 gene locus_tag LOCUS_03790 3275 4243 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030618.1 protein_id gnl|my_center|LOCUS_03790 5265 4240 gene locus_tag LOCUS_03800 5265 4240 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140943.1 protein_id gnl|my_center|LOCUS_03800 5888 5274 gene locus_tag LOCUS_03810 5888 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence0057 <1 694 gene locus_tag LOCUS_03820 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940164.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN 802 1356 gene locus_tag LOCUS_03830 802 1356 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_03830 1460 2626 gene locus_tag LOCUS_03840 1460 2626 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_03840 2634 3740 gene locus_tag LOCUS_03850 2634 3740 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_03850 3973 5694 gene locus_tag LOCUS_03860 3973 5694 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003660.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence0058 <1 1601 gene locus_tag LOCUS_03870 <1 1601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929325.1:tetratricopeptide repeat protein 3858 1699 gene locus_tag LOCUS_03880 3858 1699 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939360.1 protein_id gnl|my_center|LOCUS_03880 5528 3858 gene locus_tag LOCUS_03890 5528 3858 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence0059 405 1307 gene locus_tag LOCUS_03900 405 1307 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941184.1 protein_id gnl|my_center|LOCUS_03900 1415 4276 gene locus_tag LOCUS_03910 1415 4276 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052877.1 protein_id gnl|my_center|LOCUS_03910 5683 4502 gene locus_tag LOCUS_03920 5683 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence0060 1 1485 gene locus_tag LOCUS_03930 1 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 1495 2847 gene locus_tag LOCUS_03940 1495 2847 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940618.1 protein_id gnl|my_center|LOCUS_03940 3027 2872 gene locus_tag LOCUS_03950 3027 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 2990 5155 gene locus_tag LOCUS_03960 2990 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 <5915 5152 gene locus_tag LOCUS_03970 <5915 5152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799131.1:EAL domain-containing protein >Feature sequence0061 568 2244 gene locus_tag LOCUS_03980 568 2244 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940448.1 protein_id gnl|my_center|LOCUS_03980 2326 3327 gene locus_tag LOCUS_03990 2326 3327 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940449.1 protein_id gnl|my_center|LOCUS_03990 3415 3966 gene locus_tag LOCUS_04000 3415 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3993 4514 gene locus_tag LOCUS_04010 3993 4514 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294635.1 protein_id gnl|my_center|LOCUS_04010 5374 4691 gene locus_tag LOCUS_04020 5374 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 >Feature sequence0062 1 711 gene locus_tag LOCUS_04030 1 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 713 1102 gene locus_tag LOCUS_04040 gene dsrJ 713 1102 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938584.1 protein_id gnl|my_center|LOCUS_04040 1099 1872 gene locus_tag LOCUS_04050 1099 1872 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938583.1 protein_id gnl|my_center|LOCUS_04050 1883 3070 gene locus_tag LOCUS_04060 gene nrfD 1883 3070 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938582.1 protein_id gnl|my_center|LOCUS_04060 3355 3152 gene locus_tag LOCUS_04070 3355 3152 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942197.1 protein_id gnl|my_center|LOCUS_04070 3457 4698 gene locus_tag LOCUS_04080 gene hisS 3457 4698 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940623.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence0063 <1 1113 gene locus_tag LOCUS_04090 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582463.1:phosphoglycerate dehydrogenase 1249 2877 gene locus_tag LOCUS_04100 1249 2877 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256867.1 protein_id gnl|my_center|LOCUS_04100 3084 3728 gene locus_tag LOCUS_04110 3084 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 4251 3790 gene locus_tag LOCUS_04120 4251 3790 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 protein_id gnl|my_center|LOCUS_04120 4910 4248 gene locus_tag LOCUS_04130 4910 4248 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940346.1 protein_id gnl|my_center|LOCUS_04130 5698 4907 gene locus_tag LOCUS_04140 gene deoC 5698 4907 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389958.1 protein_id gnl|my_center|LOCUS_04140 5820 5698 gene locus_tag LOCUS_04150 5820 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 >Feature sequence0064 180 1043 gene locus_tag LOCUS_04160 gene dapF 180 1043 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939153.1 protein_id gnl|my_center|LOCUS_04160 4851 1051 gene locus_tag LOCUS_04170 4851 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 >Feature sequence0065 930 136 gene locus_tag LOCUS_04180 930 136 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_04180 2720 981 gene locus_tag LOCUS_04190 2720 981 CDS product GNVR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176617.1 protein_id gnl|my_center|LOCUS_04190 3102 2734 gene locus_tag LOCUS_04200 3102 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 3535 3302 gene locus_tag LOCUS_04210 3535 3302 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941244.1 protein_id gnl|my_center|LOCUS_04210 3889 3671 gene locus_tag LOCUS_04220 gene infA 3889 3671 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937325.1 protein_id gnl|my_center|LOCUS_04220 4724 3969 gene locus_tag LOCUS_04230 4724 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence0066 429 1091 gene locus_tag LOCUS_04240 429 1091 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258352.1 protein_id gnl|my_center|LOCUS_04240 1390 3369 gene locus_tag LOCUS_04250 1390 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3472 3939 gene locus_tag LOCUS_04260 3472 3939 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938034.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence0067 419 2209 gene locus_tag LOCUS_04270 419 2209 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937324.1 protein_id gnl|my_center|LOCUS_04270 >Feature sequence0068 1701 790 gene locus_tag LOCUS_04280 1701 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 2133 1852 gene locus_tag LOCUS_04290 2133 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3540 2314 gene locus_tag LOCUS_04300 3540 2314 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937801.1 protein_id gnl|my_center|LOCUS_04300 <5435 3537 gene locus_tag LOCUS_04310 <5435 3537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043629133.1:carbamoyltransferase HypF >Feature sequence0069 309 818 gene locus_tag LOCUS_04320 309 818 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_04320 831 1580 gene locus_tag LOCUS_04330 831 1580 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_04330 1714 2004 gene locus_tag LOCUS_04340 1714 2004 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939113.1 protein_id gnl|my_center|LOCUS_04340 2095 3318 gene locus_tag LOCUS_04350 2095 3318 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939114.1 protein_id gnl|my_center|LOCUS_04350 3353 5263 gene locus_tag LOCUS_04360 gene mnmG 3353 5263 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939115.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence0070 2626 2234 gene locus_tag LOCUS_04370 2626 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 2920 3738 gene locus_tag LOCUS_04380 2920 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 3950 5371 gene locus_tag LOCUS_04390 gene pyk 3950 5371 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939784.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence0071 1309 335 gene locus_tag LOCUS_04400 1309 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 1844 1401 gene locus_tag LOCUS_04410 1844 1401 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922464.1 protein_id gnl|my_center|LOCUS_04410 3582 1861 gene locus_tag LOCUS_04420 3582 1861 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940470.1 protein_id gnl|my_center|LOCUS_04420 4113 3598 gene locus_tag LOCUS_04430 4113 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 4314 4664 gene locus_tag LOCUS_04440 4314 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938073.1 protein_id gnl|my_center|LOCUS_04440 4826 5221 gene locus_tag LOCUS_04450 4826 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 >Feature sequence0072 3180 1522 gene locus_tag LOCUS_04460 3180 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 4112 3318 gene locus_tag LOCUS_04470 4112 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 4620 4126 gene locus_tag LOCUS_04480 4620 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 5153 4617 gene locus_tag LOCUS_04490 5153 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence0073 651 187 gene locus_tag LOCUS_04500 651 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 2293 1022 gene locus_tag LOCUS_04510 2293 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 3604 2402 gene locus_tag LOCUS_04520 3604 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3815 4204 gene locus_tag LOCUS_04530 3815 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4201 4833 gene locus_tag LOCUS_04540 4201 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence0074 482 1420 gene locus_tag LOCUS_04550 gene mtgA 482 1420 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933680.1 protein_id gnl|my_center|LOCUS_04550 1472 1915 gene locus_tag LOCUS_04560 1472 1915 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940309.1 protein_id gnl|my_center|LOCUS_04560 1931 2845 gene locus_tag LOCUS_04570 gene ubiA 1931 2845 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792606.1 protein_id gnl|my_center|LOCUS_04570 2882 4174 gene locus_tag LOCUS_04580 2882 4174 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_04580 4881 4345 gene locus_tag LOCUS_04590 4881 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence0075 935 1792 gene locus_tag LOCUS_04600 gene motA 935 1792 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546161.1 protein_id gnl|my_center|LOCUS_04600 1779 2555 gene locus_tag LOCUS_04610 1779 2555 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939878.1 protein_id gnl|my_center|LOCUS_04610 3617 2634 gene locus_tag LOCUS_04620 3617 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4605 3727 gene locus_tag LOCUS_04630 4605 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 <5239 4670 gene locus_tag LOCUS_04640 <5239 4670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792222.1:carbonic anhydrase >Feature sequence0076 2247 880 gene locus_tag LOCUS_04650 2247 880 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938250.1 protein_id gnl|my_center|LOCUS_04650 2969 2268 gene locus_tag LOCUS_04660 2969 2268 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937892.1 protein_id gnl|my_center|LOCUS_04660 4006 2996 gene locus_tag LOCUS_04670 gene argB 4006 2996 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938759.1 protein_id gnl|my_center|LOCUS_04670 4233 4084 gene locus_tag LOCUS_04680 4233 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 4424 4891 gene locus_tag LOCUS_04690 4424 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 >Feature sequence0077 <1 779 gene locus_tag LOCUS_04700 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938377.1:protein jag 870 2270 gene locus_tag LOCUS_04710 gene mnmE 870 2270 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938378.1 protein_id gnl|my_center|LOCUS_04710 2861 2460 gene locus_tag LOCUS_04720 2861 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 3216 3884 gene locus_tag LOCUS_04730 3216 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 3892 4986 gene locus_tag LOCUS_04740 3892 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence0078 357 1772 gene locus_tag LOCUS_04750 357 1772 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294683.1 protein_id gnl|my_center|LOCUS_04750 1783 2748 gene locus_tag LOCUS_04760 1783 2748 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939400.1 protein_id gnl|my_center|LOCUS_04760 2759 3721 gene locus_tag LOCUS_04770 2759 3721 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792065.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence0079 852 1019 gene locus_tag LOCUS_04780 852 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 1125 4466 gene locus_tag LOCUS_04790 1125 4466 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939340.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence0080 24 1022 gene locus_tag LOCUS_04800 gene rsmH 24 1022 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939782.1 protein_id gnl|my_center|LOCUS_04800 1019 1309 gene locus_tag LOCUS_04810 1019 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939781.1 protein_id gnl|my_center|LOCUS_04810 1325 3301 gene locus_tag LOCUS_04820 1325 3301 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939780.1 protein_id gnl|my_center|LOCUS_04820 3301 4803 gene locus_tag LOCUS_04830 3301 4803 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939779.1 protein_id gnl|my_center|LOCUS_04830 >Feature sequence0081 440 1882 gene locus_tag LOCUS_04840 440 1882 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940275.1 protein_id gnl|my_center|LOCUS_04840 1907 3286 gene locus_tag LOCUS_04850 1907 3286 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_04850 3296 3877 gene locus_tag LOCUS_04860 3296 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 >Feature sequence0082 <1 1067 gene locus_tag LOCUS_04870 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939339.1:ATP-dependent 6-phosphofructokinase 1542 1141 gene locus_tag LOCUS_04880 1542 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 1820 1545 gene locus_tag LOCUS_04890 1820 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3566 1938 gene locus_tag LOCUS_04900 3566 1938 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937938.1 protein_id gnl|my_center|LOCUS_04900 3982 3707 gene locus_tag LOCUS_04910 gene fliQ 3982 3707 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937354.1 protein_id gnl|my_center|LOCUS_04910 4863 3994 gene locus_tag LOCUS_04920 gene fliP 4863 3994 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524186.1 protein_id gnl|my_center|LOCUS_04920 5128 4748 gene locus_tag LOCUS_04930 5128 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence0083 1174 827 gene locus_tag LOCUS_04940 1174 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 1742 2152 gene locus_tag LOCUS_04950 1742 2152 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939712.1 protein_id gnl|my_center|LOCUS_04950 2179 2547 gene locus_tag LOCUS_04960 2179 2547 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939713.1 protein_id gnl|my_center|LOCUS_04960 2870 2634 gene locus_tag LOCUS_04970 2870 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 3212 4390 gene locus_tag LOCUS_04980 3212 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 4523 4936 gene locus_tag LOCUS_04990 4523 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence0084 <1 588 gene locus_tag LOCUS_05000 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005167723.1:CDP-glucose 4,6-dehydratase 601 1164 gene locus_tag LOCUS_05010 gene rfbC 601 1164 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015242878.1 protein_id gnl|my_center|LOCUS_05010 1161 2387 gene locus_tag LOCUS_05020 1161 2387 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613583.1 protein_id gnl|my_center|LOCUS_05020 2434 4197 gene locus_tag LOCUS_05030 2434 4197 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence0085 <1 861 gene locus_tag LOCUS_05040 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176664.1:response regulator 1051 1464 gene locus_tag LOCUS_05050 gene ruvX 1051 1464 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_05050 1461 2492 gene locus_tag LOCUS_05060 1461 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2638 2847 gene locus_tag LOCUS_05070 2638 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2941 4917 gene locus_tag LOCUS_05080 2941 4917 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence0086 <1 1255 gene locus_tag LOCUS_05090 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937846.1:DUF3365 domain-containing protein 1256 2653 gene locus_tag LOCUS_05100 1256 2653 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937845.1 protein_id gnl|my_center|LOCUS_05100 2924 2709 gene locus_tag LOCUS_05110 2924 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 3162 4157 gene locus_tag LOCUS_05120 gene selD 3162 4157 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:B8DNL1 protein_id gnl|my_center|LOCUS_05120 <5015 4154 gene locus_tag LOCUS_05130 <5015 4154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011793125.1:deoxyribodipyrimidine photo-lyase >Feature sequence0087 1283 405 gene locus_tag LOCUS_05140 1283 405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876244.1 protein_id gnl|my_center|LOCUS_05140 1453 1779 gene locus_tag LOCUS_05150 1453 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3257 1791 gene locus_tag LOCUS_05160 3257 1791 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392614.1 protein_id gnl|my_center|LOCUS_05160 4019 3264 gene locus_tag LOCUS_05170 4019 3264 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938201.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05170 4923 4141 gene locus_tag LOCUS_05180 4923 4141 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938201.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence0088 <1 614 gene locus_tag LOCUS_05190 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015263309.1:sensor histidine kinase 646 1278 gene locus_tag LOCUS_05200 646 1278 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943846.1 protein_id gnl|my_center|LOCUS_05200 4497 1336 gene locus_tag LOCUS_05210 4497 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence0089 2464 788 gene locus_tag LOCUS_05220 gene ettA 2464 788 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_05220 4025 2502 gene locus_tag LOCUS_05230 4025 2502 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938762.1 protein_id gnl|my_center|LOCUS_05230 4218 4538 gene locus_tag LOCUS_05240 4218 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 >Feature sequence0090 >Feature sequence0091 1985 828 gene locus_tag LOCUS_05250 1985 828 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454927.1 protein_id gnl|my_center|LOCUS_05250 2270 2938 gene locus_tag LOCUS_05260 2270 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 3018 3281 gene locus_tag LOCUS_05270 3018 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 3480 4382 gene locus_tag LOCUS_05280 3480 4382 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942049.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence0092 2002 1187 gene locus_tag LOCUS_05290 2002 1187 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938270.1 protein_id gnl|my_center|LOCUS_05290 2764 2018 gene locus_tag LOCUS_05300 2764 2018 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404657.1 protein_id gnl|my_center|LOCUS_05300 2970 3836 gene locus_tag LOCUS_05310 gene rfbA 2970 3836 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904719.1 protein_id gnl|my_center|LOCUS_05310 4586 4398 gene locus_tag LOCUS_05320 4586 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 >Feature sequence0093 250 1032 gene locus_tag LOCUS_05330 250 1032 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792490.1 protein_id gnl|my_center|LOCUS_05330 1019 1780 gene locus_tag LOCUS_05340 1019 1780 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938532.1 protein_id gnl|my_center|LOCUS_05340 1893 3428 gene locus_tag LOCUS_05350 1893 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3816 3562 gene locus_tag LOCUS_05360 3816 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 4006 4212 gene locus_tag LOCUS_05370 4006 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4256 4507 gene locus_tag LOCUS_05380 4256 4507 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939842.1 protein_id gnl|my_center|LOCUS_05380 >Feature sequence0094 1125 493 gene locus_tag LOCUS_05390 1125 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 2330 1092 gene locus_tag LOCUS_05400 gene coaBC 2330 1092 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940609.1 protein_id gnl|my_center|LOCUS_05400 2902 2327 gene locus_tag LOCUS_05410 2902 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 3741 3028 gene locus_tag LOCUS_05420 3741 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence0095 <1 540 gene locus_tag LOCUS_05430 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941582.1:DEAD/DEAH box helicase 697 2205 gene locus_tag LOCUS_05440 697 2205 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940282.1 protein_id gnl|my_center|LOCUS_05440 2496 3875 gene locus_tag LOCUS_05450 2496 3875 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940286.1 protein_id gnl|my_center|LOCUS_05450 >Feature sequence0096 1308 337 gene locus_tag LOCUS_05460 1308 337 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294587.1 protein_id gnl|my_center|LOCUS_05460 2370 1426 gene locus_tag LOCUS_05470 gene pomA 2370 1426 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418107.1 protein_id gnl|my_center|LOCUS_05470 3119 2385 gene locus_tag LOCUS_05480 3119 2385 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937359.1 protein_id gnl|my_center|LOCUS_05480 3319 4212 gene locus_tag LOCUS_05490 3319 4212 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence0097 815 501 gene locus_tag LOCUS_05500 815 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 1844 852 gene locus_tag LOCUS_05510 1844 852 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_05510 2699 1974 gene locus_tag LOCUS_05520 2699 1974 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938322.1 protein_id gnl|my_center|LOCUS_05520 4435 2696 gene locus_tag LOCUS_05530 gene coaE 4435 2696 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938323.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence0098 247 861 gene locus_tag LOCUS_05540 gene cysC 247 861 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763240.1 protein_id gnl|my_center|LOCUS_05540 858 1544 gene locus_tag LOCUS_05550 858 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 1617 3059 gene locus_tag LOCUS_05560 gene miaB 1617 3059 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938283.1 protein_id gnl|my_center|LOCUS_05560 3062 3559 gene locus_tag LOCUS_05570 3062 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3566 4222 gene locus_tag LOCUS_05580 3566 4222 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence0099 1657 680 gene locus_tag LOCUS_05590 1657 680 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_05590 1919 4345 gene locus_tag LOCUS_05600 1919 4345 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938876.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence0100 <1 650 gene locus_tag LOCUS_05610 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939581.1:inorganic phosphate transporter 780 1391 gene locus_tag LOCUS_05620 780 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 1673 2791 gene locus_tag LOCUS_05630 1673 2791 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025517.1 protein_id gnl|my_center|LOCUS_05630 2797 3231 gene locus_tag LOCUS_05640 2797 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 3224 3541 gene locus_tag LOCUS_05650 3224 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 3538 4659 gene locus_tag LOCUS_05660 3538 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 4800 4725 gene locus_tag LOCUS_t00080 4800 4725 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0101 2401 1118 gene locus_tag LOCUS_05670 2401 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 3715 2441 gene locus_tag LOCUS_05680 3715 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 <4790 3746 gene locus_tag LOCUS_05690 <4790 3746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112050.1:mycofactocin radical SAM maturase >Feature sequence0102 240 497 gene locus_tag LOCUS_05700 240 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 2921 606 gene locus_tag LOCUS_05710 2921 606 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939570.1 protein_id gnl|my_center|LOCUS_05710 3716 3183 gene locus_tag LOCUS_05720 3716 3183 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945236.1 protein_id gnl|my_center|LOCUS_05720 3782 4240 gene locus_tag LOCUS_05730 3782 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence0103 412 173 gene locus_tag LOCUS_05740 412 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 1435 569 gene locus_tag LOCUS_05750 1435 569 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792819.1 protein_id gnl|my_center|LOCUS_05750 2147 1503 gene locus_tag LOCUS_05760 2147 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 2321 3640 gene locus_tag LOCUS_05770 2321 3640 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence0104 832 479 gene locus_tag LOCUS_05780 832 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2059 1043 gene locus_tag LOCUS_05790 gene gyaR 2059 1043 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_05790 2853 2056 gene locus_tag LOCUS_05800 2853 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3713 2856 gene locus_tag LOCUS_05810 3713 2856 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 protein_id gnl|my_center|LOCUS_05810 4554 3754 gene locus_tag LOCUS_05820 gene phnC 4554 3754 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_05820 >Feature sequence0105 658 20 gene locus_tag LOCUS_05830 658 20 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_05830 1062 655 gene locus_tag LOCUS_05840 gene queD 1062 655 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_05840 <4692 1214 gene locus_tag LOCUS_05850 <4692 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940284.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence0106 270 449 gene locus_tag LOCUS_05860 270 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 878 456 gene locus_tag LOCUS_05870 878 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 1929 919 gene locus_tag LOCUS_05880 gene thiL 1929 919 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937468.1 protein_id gnl|my_center|LOCUS_05880 2943 2002 gene locus_tag LOCUS_05890 2943 2002 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_05890 3206 2940 gene locus_tag LOCUS_05900 3206 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence0107 63 821 gene locus_tag LOCUS_05910 gene pstB 63 821 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_05910 832 1497 gene locus_tag LOCUS_05920 gene phoU 832 1497 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938384.1 protein_id gnl|my_center|LOCUS_05920 1770 2720 gene locus_tag LOCUS_05930 1770 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932890.1 protein_id gnl|my_center|LOCUS_05930 3551 2739 gene locus_tag LOCUS_05940 3551 2739 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence0108 501 64 gene locus_tag LOCUS_05950 501 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 636 1559 gene locus_tag LOCUS_05960 636 1559 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940615.1 protein_id gnl|my_center|LOCUS_05960 1658 2671 gene locus_tag LOCUS_05970 1658 2671 CDS product bifunctional ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940616.1 protein_id gnl|my_center|LOCUS_05970 2887 4266 gene locus_tag LOCUS_05980 2887 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence0109 2523 958 gene locus_tag LOCUS_05990 2523 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 <4622 2511 gene locus_tag LOCUS_06000 <4622 2511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195875.1:alginate lyase family protein >Feature sequence0110 463 388 gene locus_tag LOCUS_t00090 463 388 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 550 475 gene locus_tag LOCUS_t00100 550 475 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 778 3360 gene locus_tag LOCUS_06010 778 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3726 3451 gene locus_tag LOCUS_06020 3726 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence0111 <1 1478 gene locus_tag LOCUS_06030 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938180.1:elongation factor G 1634 2353 gene locus_tag LOCUS_06040 1634 2353 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933691.1 protein_id gnl|my_center|LOCUS_06040 2355 4007 gene locus_tag LOCUS_06050 2355 4007 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938175.1 protein_id gnl|my_center|LOCUS_06050 <4595 4017 gene locus_tag LOCUS_06060 <4595 4017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943663.1:flagellar export chaperone FliS >Feature sequence0112 2269 1163 gene locus_tag LOCUS_06070 gene ald 2269 1163 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_06070 2778 2266 gene locus_tag LOCUS_06080 2778 2266 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089070.1 protein_id gnl|my_center|LOCUS_06080 2977 3690 gene locus_tag LOCUS_06090 2977 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence0113 <1 680 gene locus_tag LOCUS_06100 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940521.1:fumarate reductase iron-sulfur subunit 711 1547 gene locus_tag LOCUS_06110 711 1547 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940522.1 protein_id gnl|my_center|LOCUS_06110 1547 2089 gene locus_tag LOCUS_06120 1547 2089 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940523.1 protein_id gnl|my_center|LOCUS_06120 2395 3042 gene locus_tag LOCUS_06130 2395 3042 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_06130 3039 4106 gene locus_tag LOCUS_06140 3039 4106 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939675.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence0114 <1 1001 gene locus_tag LOCUS_06150 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941162.1:DUF362 domain-containing protein 1697 1014 gene locus_tag LOCUS_06160 gene thiE 1697 1014 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939635.1 protein_id gnl|my_center|LOCUS_06160 2506 1700 gene locus_tag LOCUS_06170 gene thiM 2506 1700 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939636.1 protein_id gnl|my_center|LOCUS_06170 2714 3967 gene locus_tag LOCUS_06180 2714 3967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_06180 4112 4187 gene locus_tag LOCUS_t00110 4112 4187 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4201 4277 gene locus_tag LOCUS_t00120 4201 4277 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0115 <1 985 gene locus_tag LOCUS_06190 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939776.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 982 2091 gene locus_tag LOCUS_06200 gene ftsW 982 2091 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791803.1 protein_id gnl|my_center|LOCUS_06200 2088 3176 gene locus_tag LOCUS_06210 gene murG 2088 3176 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939774.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence0116 1426 452 gene locus_tag LOCUS_06220 1426 452 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_06220 2486 1896 gene locus_tag LOCUS_06230 2486 1896 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939628.1 protein_id gnl|my_center|LOCUS_06230 2616 3011 gene locus_tag LOCUS_06240 2616 3011 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_06240 3033 3761 gene locus_tag LOCUS_06250 3033 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence0117 1124 498 gene locus_tag LOCUS_06260 1124 498 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938551.1 protein_id gnl|my_center|LOCUS_06260 1298 2998 gene locus_tag LOCUS_06270 1298 2998 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791922.1 protein_id gnl|my_center|LOCUS_06270 3118 3600 gene locus_tag LOCUS_06280 3118 3600 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939793.1 protein_id gnl|my_center|LOCUS_06280 4360 3620 gene locus_tag LOCUS_06290 4360 3620 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792531.1 protein_id gnl|my_center|LOCUS_06290 >Feature sequence0118 2964 307 gene locus_tag LOCUS_06300 gene mutS 2964 307 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938938.1 protein_id gnl|my_center|LOCUS_06300 4116 2977 gene locus_tag LOCUS_06310 4116 2977 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938939.1 protein_id gnl|my_center|LOCUS_06310 4470 4132 gene locus_tag LOCUS_06320 4470 4132 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938940.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence0119 3333 2827 gene locus_tag LOCUS_06330 3333 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3525 3449 gene locus_tag LOCUS_t00130 3525 3449 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4315 3584 gene locus_tag LOCUS_06340 4315 3584 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938751.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence0120 <1 1069 gene locus_tag LOCUS_06350 <1 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792158.1:transcription-repair coupling factor 1069 2094 gene locus_tag LOCUS_06360 1069 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 2167 3141 gene locus_tag LOCUS_06370 2167 3141 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792159.1 protein_id gnl|my_center|LOCUS_06370 3169 4215 gene locus_tag LOCUS_06380 3169 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence0121 <1 504 gene locus_tag LOCUS_06390 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021984.1:chemotaxis protein CheB 2409 790 gene locus_tag LOCUS_06400 2409 790 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087273407.1 protein_id gnl|my_center|LOCUS_06400 2766 2572 gene locus_tag LOCUS_06410 2766 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 3779 2862 gene locus_tag LOCUS_06420 3779 2862 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940076.1 protein_id gnl|my_center|LOCUS_06420 <4457 3893 gene locus_tag LOCUS_06430 <4457 3893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937891.1:formate dehydrogenase subunit beta >Feature sequence0122 1027 530 gene locus_tag LOCUS_06440 1027 530 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939786.1 protein_id gnl|my_center|LOCUS_06440 1181 1951 gene locus_tag LOCUS_06450 1181 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 1961 3523 gene locus_tag LOCUS_06460 gene rlmD 1961 3523 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938223.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence0123 540 1436 gene locus_tag LOCUS_06470 540 1436 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938626.1 protein_id gnl|my_center|LOCUS_06470 2328 1468 gene locus_tag LOCUS_06480 2328 1468 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940024.1 protein_id gnl|my_center|LOCUS_06480 3413 2328 gene locus_tag LOCUS_06490 gene mqnC 3413 2328 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_06490 <4437 3410 gene locus_tag LOCUS_06500 <4437 3410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940022.1:aminofutalosine synthase MqnE >Feature sequence0124 2229 1549 gene locus_tag LOCUS_06510 2229 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2532 3659 gene locus_tag LOCUS_06520 2532 3659 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939122.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence0125 390 1865 gene locus_tag LOCUS_06530 390 1865 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940410.1 protein_id gnl|my_center|LOCUS_06530 1875 2522 gene locus_tag LOCUS_06540 gene rdgB 1875 2522 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940412.1 protein_id gnl|my_center|LOCUS_06540 2551 4377 gene locus_tag LOCUS_06550 gene glmS 2551 4377 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940414.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence0126 <1 1210 gene locus_tag LOCUS_06560 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938476.1:aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein 2491 2123 gene locus_tag LOCUS_06570 gene mazF 2491 2123 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887062.1 protein_id gnl|my_center|LOCUS_06570 2730 2488 gene locus_tag LOCUS_06580 2730 2488 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_06580 4006 2858 gene locus_tag LOCUS_06590 4006 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence0127 1334 1708 gene locus_tag LOCUS_06600 gene crcB 1334 1708 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938890.1 protein_id gnl|my_center|LOCUS_06600 1940 2353 gene locus_tag LOCUS_06610 1940 2353 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_06610 3861 2422 gene locus_tag LOCUS_06620 3861 2422 CDS product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791846.1 protein_id gnl|my_center|LOCUS_06620 4344 4015 gene locus_tag LOCUS_06630 4344 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence0128 1267 572 gene locus_tag LOCUS_06640 1267 572 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939331.1 protein_id gnl|my_center|LOCUS_06640 1622 1260 gene locus_tag LOCUS_06650 1622 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 4177 1646 gene locus_tag LOCUS_06660 4177 1646 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791682.1 protein_id gnl|my_center|LOCUS_06660 >Feature sequence0129 67 1779 gene locus_tag LOCUS_06670 67 1779 CDS product LytS/YhcK type 5TM receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792810.1 protein_id gnl|my_center|LOCUS_06670 1980 3797 gene locus_tag LOCUS_06680 1980 3797 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545972.1 protein_id gnl|my_center|LOCUS_06680 3913 4200 gene locus_tag LOCUS_06690 3913 4200 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205409681.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence0130 704 459 gene locus_tag LOCUS_06700 704 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 863 1999 gene locus_tag LOCUS_06710 863 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2074 3510 gene locus_tag LOCUS_06720 2074 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 3515 4150 gene locus_tag LOCUS_06730 3515 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence0131 64 1377 gene locus_tag LOCUS_06740 64 1377 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938189.1 protein_id gnl|my_center|LOCUS_06740 1398 2600 gene locus_tag LOCUS_06750 1398 2600 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_06750 2603 3031 gene locus_tag LOCUS_06760 2603 3031 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_06760 3130 3984 gene locus_tag LOCUS_06770 3130 3984 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_06770 4282 4019 gene locus_tag LOCUS_06780 4282 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence0132 1691 1443 gene locus_tag LOCUS_06790 1691 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 1948 1733 gene locus_tag LOCUS_06800 1948 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2236 2850 gene locus_tag LOCUS_06810 2236 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3097 2903 gene locus_tag LOCUS_06820 3097 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3286 3990 gene locus_tag LOCUS_06830 gene cbiR 3286 3990 CDS product cobamide remodeling phosphodiesterase CbiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294611.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence0133 3871 2681 gene locus_tag LOCUS_06840 3871 2681 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546440.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence0134 1345 1124 gene locus_tag LOCUS_06850 gene rpoZ 1345 1124 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940500.1 protein_id gnl|my_center|LOCUS_06850 2709 1396 gene locus_tag LOCUS_06860 2709 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2968 3729 gene locus_tag LOCUS_06870 2968 3729 CDS product tRNA 2-thiocytidine biosynthesis TtcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940499.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence0135 325 687 gene locus_tag LOCUS_06880 325 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 846 1754 gene locus_tag LOCUS_06890 846 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 2265 1855 gene locus_tag LOCUS_06900 2265 1855 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957963.1 protein_id gnl|my_center|LOCUS_06900 2675 2262 gene locus_tag LOCUS_06910 2675 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3068 2685 gene locus_tag LOCUS_06920 3068 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 3416 3078 gene locus_tag LOCUS_06930 3416 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence0136 1919 963 gene locus_tag LOCUS_06940 1919 963 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940161.1 protein_id gnl|my_center|LOCUS_06940 3167 1986 gene locus_tag LOCUS_06950 3167 1986 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_06950 <4205 3327 gene locus_tag LOCUS_06960 <4205 3327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940198.1:homocysteine biosynthesis protein >Feature sequence0137 <4192 1114 gene locus_tag LOCUS_06970 <4192 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088084.1:PAS domain S-box protein >Feature sequence0138 80 1282 gene locus_tag LOCUS_06980 80 1282 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938231.1 protein_id gnl|my_center|LOCUS_06980 1289 1852 gene locus_tag LOCUS_06990 1289 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791841.1 protein_id gnl|my_center|LOCUS_06990 2934 1849 gene locus_tag LOCUS_07000 2934 1849 CDS product DUF1786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940672.1 protein_id gnl|my_center|LOCUS_07000 3086 3958 gene locus_tag LOCUS_07010 3086 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 4184 3936 gene locus_tag LOCUS_07020 4184 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence0139 >Feature sequence0140 956 1816 gene locus_tag LOCUS_07030 956 1816 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937428.1 protein_id gnl|my_center|LOCUS_07030 2419 1826 gene locus_tag LOCUS_07040 2419 1826 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023860.1 protein_id gnl|my_center|LOCUS_07040 2929 2495 gene locus_tag LOCUS_07050 2929 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 <4109 3045 gene locus_tag LOCUS_07060 <4109 3045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940210.1:glutamine--tRNA ligase/YqeY domain fusion protein >Feature sequence0141 1577 258 gene locus_tag LOCUS_07070 1577 258 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937573.1 protein_id gnl|my_center|LOCUS_07070 2261 1602 gene locus_tag LOCUS_07080 2261 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937574.1 protein_id gnl|my_center|LOCUS_07080 3541 2282 gene locus_tag LOCUS_07090 3541 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937575.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence0142 1918 482 gene locus_tag LOCUS_07100 1918 482 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939501.1 protein_id gnl|my_center|LOCUS_07100 2325 1942 gene locus_tag LOCUS_07110 2325 1942 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939502.1 protein_id gnl|my_center|LOCUS_07110 3149 2406 gene locus_tag LOCUS_07120 3149 2406 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939503.1 protein_id gnl|my_center|LOCUS_07120 3899 3153 gene locus_tag LOCUS_07130 3899 3153 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939504.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence0143 <1 587 gene locus_tag LOCUS_07140 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938112.1:molecular chaperone DnaK 698 2782 gene locus_tag LOCUS_07150 698 2782 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524277.1 protein_id gnl|my_center|LOCUS_07150 2797 3081 gene locus_tag LOCUS_07160 gene gatC 2797 3081 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938110.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence0144 674 1846 gene locus_tag LOCUS_07170 674 1846 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933143.1 protein_id gnl|my_center|LOCUS_07170 1872 2657 gene locus_tag LOCUS_07180 1872 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 2762 3544 gene locus_tag LOCUS_07190 2762 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 >Feature sequence0145 <1 1026 gene locus_tag LOCUS_07200 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940427.1:cobalamin biosynthesis protein 1028 1822 gene locus_tag LOCUS_07210 gene cobJ 1028 1822 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940428.1 protein_id gnl|my_center|LOCUS_07210 1984 2391 gene locus_tag LOCUS_07220 1984 2391 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940429.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence0146 <1 502 gene locus_tag LOCUS_07230 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937967.1:cysteine desulfurase NifS 2646 715 gene locus_tag LOCUS_07240 gene acs 2646 715 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938049.1 protein_id gnl|my_center|LOCUS_07240 3686 2805 gene locus_tag LOCUS_07250 3686 2805 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938050.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence0147 <1 815 gene locus_tag LOCUS_07260 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808433.1:DUF362 domain-containing protein 825 2690 gene locus_tag LOCUS_07270 825 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2762 3994 gene locus_tag LOCUS_07280 2762 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence0148 837 256 gene locus_tag LOCUS_07290 gene sigZ 837 256 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261608.1 protein_id gnl|my_center|LOCUS_07290 1650 853 gene locus_tag LOCUS_07300 1650 853 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_07300 3521 1896 gene locus_tag LOCUS_07310 3521 1896 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024233.1 protein_id gnl|my_center|LOCUS_07310 3717 3896 gene locus_tag LOCUS_07320 3717 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence0149 <1 630 gene locus_tag LOCUS_07330 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286835.1:phosphoenolpyruvate carboxykinase (ATP) 983 768 gene locus_tag LOCUS_07340 983 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1268 2425 gene locus_tag LOCUS_07350 1268 2425 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_07350 2427 3374 gene locus_tag LOCUS_07360 2427 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 3768 3475 gene locus_tag LOCUS_07370 3768 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence0150 226 1041 gene locus_tag LOCUS_07380 226 1041 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938214.1 protein_id gnl|my_center|LOCUS_07380 1038 1778 gene locus_tag LOCUS_07390 1038 1778 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938213.1 protein_id gnl|my_center|LOCUS_07390 1803 2798 gene locus_tag LOCUS_07400 gene sppA 1803 2798 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941487.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence0151 3 3866 gene locus_tag LOCUS_07410 gene cobN 3 3866 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020926.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence0152 <1 1229 gene locus_tag LOCUS_07420 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938906.1:phenylacetate--CoA ligase 1270 1701 gene locus_tag LOCUS_07430 1270 1701 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_07430 1798 3228 gene locus_tag LOCUS_07440 1798 3228 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356999.1 protein_id gnl|my_center|LOCUS_07440 3254 3652 gene locus_tag LOCUS_07450 3254 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 3914 3735 gene locus_tag LOCUS_07460 3914 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence0153 1372 650 gene locus_tag LOCUS_07470 gene lptB 1372 650 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938918.1 protein_id gnl|my_center|LOCUS_07470 2614 1373 gene locus_tag LOCUS_07480 2614 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3198 2611 gene locus_tag LOCUS_07490 3198 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3744 3199 gene locus_tag LOCUS_07500 3744 3199 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938916.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence0154 3548 2241 gene locus_tag LOCUS_07510 3548 2241 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937466.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence0155 1550 618 gene locus_tag LOCUS_07520 1550 618 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294642.1 protein_id gnl|my_center|LOCUS_07520 2051 1683 gene locus_tag LOCUS_07530 2051 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2660 2055 gene locus_tag LOCUS_07540 2660 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937717.1 protein_id gnl|my_center|LOCUS_07540 <3882 2694 gene locus_tag LOCUS_07550 <3882 2694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937718.1:glycosyltransferase family 9 protein >Feature sequence0156 <1 1153 gene locus_tag LOCUS_07560 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941825.1:ABC transporter permease 1498 1172 gene locus_tag LOCUS_07570 1498 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 1626 2105 gene locus_tag LOCUS_07580 1626 2105 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence0157 <1 738 gene locus_tag LOCUS_07590 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038132.1:tol-pal system protein YbgF 776 1993 gene locus_tag LOCUS_07600 776 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 2024 2356 gene locus_tag LOCUS_07610 2024 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940661.1 protein_id gnl|my_center|LOCUS_07610 2360 3226 gene locus_tag LOCUS_07620 2360 3226 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939346.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence0158 2796 313 gene locus_tag LOCUS_07630 2796 313 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939179.1 protein_id gnl|my_center|LOCUS_07630 3054 3365 gene locus_tag LOCUS_07640 3054 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3372 3809 gene locus_tag LOCUS_07650 3372 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence0159 3106 3741 gene locus_tag LOCUS_07660 3106 3741 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880277.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence0160 40 1557 gene locus_tag LOCUS_07670 40 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2526 1714 gene locus_tag LOCUS_07680 gene cysQ 2526 1714 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_07680 3128 2523 gene locus_tag LOCUS_07690 3128 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence0161 423 1064 gene locus_tag LOCUS_07700 423 1064 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939708.1 protein_id gnl|my_center|LOCUS_07700 1251 2057 gene locus_tag LOCUS_07710 1251 2057 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_07710 2067 2900 gene locus_tag LOCUS_07720 2067 2900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938541.1 protein_id gnl|my_center|LOCUS_07720 2955 3398 gene locus_tag LOCUS_07730 gene mlaD 2955 3398 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938540.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence0162 <1 871 gene locus_tag LOCUS_07740 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937885.1:ATP-binding protein 888 1604 gene locus_tag LOCUS_07750 888 1604 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937884.1 protein_id gnl|my_center|LOCUS_07750 1621 2169 gene locus_tag LOCUS_07760 1621 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence0163 2823 577 gene locus_tag LOCUS_07770 2823 577 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_07770 <3760 3039 gene locus_tag LOCUS_07780 <3760 3039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939087.1:elongation factor G >Feature sequence0164 19 1749 gene locus_tag LOCUS_07790 19 1749 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_07790 1730 2662 gene locus_tag LOCUS_07800 gene sppA 1730 2662 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940407.1 protein_id gnl|my_center|LOCUS_07800 3178 2864 gene locus_tag LOCUS_07810 3178 2864 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938537.1 protein_id gnl|my_center|LOCUS_07810 <3760 3175 gene locus_tag LOCUS_07820 <3760 3175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943860.1:4Fe-4S binding protein >Feature sequence0165 892 71 gene locus_tag LOCUS_07830 892 71 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_07830 1920 889 gene locus_tag LOCUS_07840 1920 889 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938970.1 protein_id gnl|my_center|LOCUS_07840 2142 1930 gene locus_tag LOCUS_07850 2142 1930 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081411.1 protein_id gnl|my_center|LOCUS_07850 2313 3398 gene locus_tag LOCUS_07860 gene gcvT 2313 3398 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938973.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence0166 766 257 gene locus_tag LOCUS_07870 766 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 1082 1330 gene locus_tag LOCUS_07880 1082 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2949 1336 gene locus_tag LOCUS_07890 2949 1336 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_07890 <3681 3075 gene locus_tag LOCUS_07900 <3681 3075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939769.1:cell division protein FtsZ >Feature sequence0167 <1 870 gene locus_tag LOCUS_07910 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938952.1:LptF/LptG family permease 1484 900 gene locus_tag LOCUS_07920 gene yihA 1484 900 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938953.1 protein_id gnl|my_center|LOCUS_07920 1584 2060 gene locus_tag LOCUS_07930 1584 2060 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938954.1 protein_id gnl|my_center|LOCUS_07930 2118 2681 gene locus_tag LOCUS_07940 gene efp 2118 2681 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938955.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence0168 <1 580 gene locus_tag LOCUS_07950 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939105.1:protein translocase subunit SecF 1344 676 gene locus_tag LOCUS_07960 1344 676 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939218.1 protein_id gnl|my_center|LOCUS_07960 2440 1397 gene locus_tag LOCUS_07970 gene tilS 2440 1397 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792378.1 protein_id gnl|my_center|LOCUS_07970 2781 2443 gene locus_tag LOCUS_07980 2781 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3649 2795 gene locus_tag LOCUS_07990 3649 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence0169 1862 2752 gene locus_tag LOCUS_08000 1862 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 <3637 3047 gene locus_tag LOCUS_08010 <3637 3047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000370406.1:lactate utilization protein C >Feature sequence0170 36 1409 gene locus_tag LOCUS_08020 gene nifK 36 1409 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933202.1 protein_id gnl|my_center|LOCUS_08020 1516 2712 gene locus_tag LOCUS_08030 gene nifB 1516 2712 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_08030 2745 3047 gene locus_tag LOCUS_08040 2745 3047 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176588.1 protein_id gnl|my_center|LOCUS_08040 3071 3544 gene locus_tag LOCUS_08050 3071 3544 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754241.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence0171 1193 780 gene locus_tag LOCUS_08060 1193 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1530 1219 gene locus_tag LOCUS_08070 1530 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2156 1587 gene locus_tag LOCUS_08080 2156 1587 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965913.1 protein_id gnl|my_center|LOCUS_08080 3142 2306 gene locus_tag LOCUS_08090 3142 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence0172 <1 783 gene locus_tag LOCUS_08100 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939772.1:UDP-N-acetylmuramate dehydrogenase 783 1628 gene locus_tag LOCUS_08110 783 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1683 2918 gene locus_tag LOCUS_08120 gene ftsA 1683 2918 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence0173 3247 2129 gene locus_tag LOCUS_08130 3247 2129 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387905.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence0174 620 2617 gene locus_tag LOCUS_08140 620 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294578.1 protein_id gnl|my_center|LOCUS_08140 2617 3171 gene locus_tag LOCUS_08150 2617 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence0175 1510 299 gene locus_tag LOCUS_08160 1510 299 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_08160 2796 1507 gene locus_tag LOCUS_08170 2796 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence0176 273 1106 gene locus_tag LOCUS_08180 273 1106 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939671.1 protein_id gnl|my_center|LOCUS_08180 2154 1699 gene locus_tag LOCUS_08190 2154 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2540 2241 gene locus_tag LOCUS_08200 2540 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence0177 1321 254 gene locus_tag LOCUS_08210 1321 254 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_08210 1758 1390 gene locus_tag LOCUS_08220 1758 1390 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940054.1 protein_id gnl|my_center|LOCUS_08220 2936 1854 gene locus_tag LOCUS_08230 2936 1854 CDS product lpg1639 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947366.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence0178 1816 2619 gene locus_tag LOCUS_08240 1816 2619 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937767.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence0179 52 876 gene locus_tag LOCUS_08250 gene mazG 52 876 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938482.1 protein_id gnl|my_center|LOCUS_08250 1163 873 gene locus_tag LOCUS_08260 1163 873 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791814.1 protein_id gnl|my_center|LOCUS_08260 2324 1269 gene locus_tag LOCUS_08270 2324 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 2642 2914 gene locus_tag LOCUS_08280 2642 2914 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence0180 147 1976 gene locus_tag LOCUS_08290 147 1976 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_08290 2062 2568 gene locus_tag LOCUS_08300 2062 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 3475 2579 gene locus_tag LOCUS_08310 3475 2579 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence0181 601 3084 gene locus_tag LOCUS_08320 gene gyrA 601 3084 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524181.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence0182 182 484 gene locus_tag LOCUS_08330 182 484 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932932.1 protein_id gnl|my_center|LOCUS_08330 740 3316 gene locus_tag LOCUS_08340 740 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence0183 2254 1277 gene locus_tag LOCUS_08350 2254 1277 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939207.1 protein_id gnl|my_center|LOCUS_08350 2582 3367 gene locus_tag LOCUS_08360 2582 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence0184 <3480 2251 gene locus_tag LOCUS_08370 <3480 2251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583223.1:ABC transporter substrate-binding protein >Feature sequence0185 305 667 gene locus_tag LOCUS_08380 305 667 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939487.1 protein_id gnl|my_center|LOCUS_08380 717 1823 gene locus_tag LOCUS_08390 717 1823 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792173.1 protein_id gnl|my_center|LOCUS_08390 2713 1838 gene locus_tag LOCUS_08400 2713 1838 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937980.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence0186 22 1548 gene locus_tag LOCUS_08410 gene lnt 22 1548 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_08410 1604 2695 gene locus_tag LOCUS_08420 gene prfB 1604 2695 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939147.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence0187 1978 1046 gene locus_tag LOCUS_08430 1978 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence0188 1137 625 gene locus_tag LOCUS_08440 gene purE 1137 625 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937794.1 protein_id gnl|my_center|LOCUS_08440 2428 1148 gene locus_tag LOCUS_08450 gene purD 2428 1148 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937795.1 protein_id gnl|my_center|LOCUS_08450 2630 2965 gene locus_tag LOCUS_08460 2630 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence0189 646 266 gene locus_tag LOCUS_08470 gene gcvH 646 266 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938719.1 protein_id gnl|my_center|LOCUS_08470 999 1613 gene locus_tag LOCUS_08480 999 1613 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942123.1 protein_id gnl|my_center|LOCUS_08480 1617 2504 gene locus_tag LOCUS_08490 1617 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2550 3320 gene locus_tag LOCUS_08500 2550 3320 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294676.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence0190 1865 762 gene locus_tag LOCUS_08510 1865 762 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938231.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence0191 1112 261 gene locus_tag LOCUS_08520 1112 261 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544975.1 protein_id gnl|my_center|LOCUS_08520 2458 1217 gene locus_tag LOCUS_08530 2458 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3327 2587 gene locus_tag LOCUS_08540 3327 2587 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938543.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence0192 <3416 2432 gene locus_tag LOCUS_08550 <3416 2432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938740.1:DUF3880 domain-containing protein >Feature sequence0193 <1 997 gene locus_tag LOCUS_08560 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943098.1:YihY/virulence factor BrkB family protein 1161 991 gene locus_tag LOCUS_08570 1161 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1319 1783 gene locus_tag LOCUS_08580 1319 1783 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938241.1 protein_id gnl|my_center|LOCUS_08580 2429 1788 gene locus_tag LOCUS_08590 2429 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 <3407 2426 gene locus_tag LOCUS_08600 <3407 2426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938027.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence0194 2806 1259 gene locus_tag LOCUS_08610 2806 1259 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937753.1 protein_id gnl|my_center|LOCUS_08610 3114 2809 gene locus_tag LOCUS_08620 3114 2809 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545871.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence0195 1455 154 gene locus_tag LOCUS_08630 1455 154 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337145.1 protein_id gnl|my_center|LOCUS_08630 2114 1452 gene locus_tag LOCUS_08640 2114 1452 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228583.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence0196 <1 505 gene locus_tag LOCUS_08650 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937773.1:aminodeoxychorismate/anthranilate synthase component II 523 1578 gene locus_tag LOCUS_08660 gene trpD 523 1578 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937774.1 protein_id gnl|my_center|LOCUS_08660 1580 2371 gene locus_tag LOCUS_08670 1580 2371 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937775.1 protein_id gnl|my_center|LOCUS_08670 2368 3099 gene locus_tag LOCUS_08680 2368 3099 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792872.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence0197 1482 604 gene locus_tag LOCUS_08690 gene ispH 1482 604 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937366.1 protein_id gnl|my_center|LOCUS_08690 2666 1593 gene locus_tag LOCUS_08700 2666 1593 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937365.1 protein_id gnl|my_center|LOCUS_08700 2901 2975 gene locus_tag LOCUS_t00140 2901 2975 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2982 3067 gene locus_tag LOCUS_t00150 2982 3067 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3134 3210 gene locus_tag LOCUS_t00160 3134 3210 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3250 3325 gene locus_tag LOCUS_t00170 3250 3325 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0198 285 1691 gene locus_tag LOCUS_08710 285 1691 CDS product MiaB/RimO family radical SAM methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938196.1 protein_id gnl|my_center|LOCUS_08710 1688 2266 gene locus_tag LOCUS_08720 1688 2266 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082414.1 protein_id gnl|my_center|LOCUS_08720 2257 3138 gene locus_tag LOCUS_08730 2257 3138 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938197.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence0199 1084 761 gene locus_tag LOCUS_08740 1084 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1360 1094 gene locus_tag LOCUS_08750 1360 1094 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_08750 3366 1570 gene locus_tag LOCUS_08760 gene cysS 3366 1570 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020794.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence0200 1527 310 gene locus_tag LOCUS_08770 1527 310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939709.1 protein_id gnl|my_center|LOCUS_08770 2785 1829 gene locus_tag LOCUS_08780 gene fabD 2785 1829 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938545.1 protein_id gnl|my_center|LOCUS_08780 <3365 2822 gene locus_tag LOCUS_08790 <3365 2822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938881.1:DNA repair protein RadA >Feature sequence0201 1919 63 gene locus_tag LOCUS_08800 1919 63 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940520.1 protein_id gnl|my_center|LOCUS_08800 2586 1930 gene locus_tag LOCUS_08810 2586 1930 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940519.1 protein_id gnl|my_center|LOCUS_08810 3362 2925 gene locus_tag LOCUS_08820 3362 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence0202 962 156 gene locus_tag LOCUS_08830 962 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1144 2958 gene locus_tag LOCUS_08840 1144 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence0203 163 1383 gene locus_tag LOCUS_08850 163 1383 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence0204 1265 225 gene locus_tag LOCUS_08860 1265 225 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_08860 1385 2458 gene locus_tag LOCUS_08870 1385 2458 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938091.1 protein_id gnl|my_center|LOCUS_08870 2455 2985 gene locus_tag LOCUS_08880 2455 2985 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938092.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence0205 247 1341 gene locus_tag LOCUS_08890 247 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1397 2350 gene locus_tag LOCUS_08900 1397 2350 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938291.1 protein_id gnl|my_center|LOCUS_08900 3192 2518 gene locus_tag LOCUS_08910 3192 2518 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938496.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence0206 2556 421 gene locus_tag LOCUS_08920 2556 421 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262294.1 protein_id gnl|my_center|LOCUS_08920 2955 2590 gene locus_tag LOCUS_08930 2955 2590 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939802.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence0207 2 847 gene locus_tag LOCUS_08940 2 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1076 1705 gene locus_tag LOCUS_08950 1076 1705 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256835.1 protein_id gnl|my_center|LOCUS_08950 1721 2914 gene locus_tag LOCUS_08960 1721 2914 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868793.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence0208 61 1299 gene locus_tag LOCUS_08970 61 1299 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence0209 <1 641 gene locus_tag LOCUS_08980 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011793113.1:sulfite exporter TauE/SafE family protein 643 1368 gene locus_tag LOCUS_08990 643 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937444.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence0210 2891 1578 gene locus_tag LOCUS_09000 2891 1578 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938380.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence0211 2 682 gene locus_tag LOCUS_09010 2 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 763 2424 gene locus_tag LOCUS_09020 763 2424 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940541.1 protein_id gnl|my_center|LOCUS_09020 2579 3205 gene locus_tag LOCUS_09030 2579 3205 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940291.1 protein_id gnl|my_center|LOCUS_09030 >Feature sequence0212 508 1284 gene locus_tag LOCUS_09040 gene lgt 508 1284 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937326.1 protein_id gnl|my_center|LOCUS_09040 1857 1333 gene locus_tag LOCUS_09050 1857 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2977 1931 gene locus_tag LOCUS_09060 2977 1931 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792396.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence0213 1399 614 gene locus_tag LOCUS_09070 1399 614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088703.1 protein_id gnl|my_center|LOCUS_09070 2052 1399 gene locus_tag LOCUS_09080 2052 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence0214 3245 483 gene locus_tag LOCUS_09090 3245 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence0215 182 2461 gene locus_tag LOCUS_09100 182 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence0216 210 1940 gene locus_tag LOCUS_09110 210 1940 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_09110 2276 2533 gene locus_tag LOCUS_09120 2276 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2535 2900 gene locus_tag LOCUS_09130 2535 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence0217 1353 418 gene locus_tag LOCUS_09140 gene folP 1353 418 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938575.1 protein_id gnl|my_center|LOCUS_09140 <3237 1350 gene locus_tag LOCUS_09150 <3237 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938574.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence0218 54 1190 gene locus_tag LOCUS_09160 54 1190 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence0219 697 2022 gene locus_tag LOCUS_09170 697 2022 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939193.1 protein_id gnl|my_center|LOCUS_09170 3035 2019 gene locus_tag LOCUS_09180 3035 2019 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940234.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence0220 <1 1154 gene locus_tag LOCUS_09190 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880333.1:GGDEF domain-containing protein 1317 2312 gene locus_tag LOCUS_09200 1317 2312 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937701.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence0221 1449 721 gene locus_tag LOCUS_09210 1449 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1719 2150 gene locus_tag LOCUS_09220 1719 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 <3219 2178 gene locus_tag LOCUS_09230 <3219 2178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938529.1:[protein-PII] uridylyltransferase >Feature sequence0222 1729 1055 gene locus_tag LOCUS_09240 1729 1055 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939611.1 protein_id gnl|my_center|LOCUS_09240 2625 1729 gene locus_tag LOCUS_09250 2625 1729 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939612.1 protein_id gnl|my_center|LOCUS_09250 2928 2677 gene locus_tag LOCUS_09260 2928 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence0223 41 337 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgccccccgcgcgggggcgtggattgaaac 963 376 gene locus_tag LOCUS_09270 963 376 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_09270 2047 1043 gene locus_tag LOCUS_09280 2047 1043 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937871.1 protein_id gnl|my_center|LOCUS_09280 <3207 2166 gene locus_tag LOCUS_09290 <3207 2166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002117074.1:AI-2E family transporter >Feature sequence0224 1274 474 gene locus_tag LOCUS_09300 1274 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2253 1255 gene locus_tag LOCUS_09310 gene fliG 2253 1255 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937619.1 protein_id gnl|my_center|LOCUS_09310 <3206 2255 gene locus_tag LOCUS_09320 <3206 2255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937620.1:flagellar basal-body MS-ring/collar protein FliF >Feature sequence0225 34 2271 gene locus_tag LOCUS_09330 34 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence0226 2583 2496 gene locus_tag LOCUS_t00180 2583 2496 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0227 1445 369 gene locus_tag LOCUS_09340 gene mraY 1445 369 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939777.1 protein_id gnl|my_center|LOCUS_09340 2884 1442 gene locus_tag LOCUS_09350 gene murF 2884 1442 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939778.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence0228 1350 850 gene locus_tag LOCUS_09360 1350 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1467 1664 gene locus_tag LOCUS_09370 1467 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1748 2089 gene locus_tag LOCUS_09380 1748 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence0229 80 1225 gene locus_tag LOCUS_09390 gene dsrB 80 1225 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937710.1 protein_id gnl|my_center|LOCUS_09390 1292 1534 gene locus_tag LOCUS_09400 1292 1534 CDS product dissimilatory sulfite reductase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937711.1 protein_id gnl|my_center|LOCUS_09400 1634 3049 gene locus_tag LOCUS_09410 1634 3049 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937712.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence0230 2 1147 gene locus_tag LOCUS_09420 2 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 <3152 1369 gene locus_tag LOCUS_09430 <3152 1369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391425.1:carbamoyltransferase >Feature sequence0231 105 1421 gene locus_tag LOCUS_09440 105 1421 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842634.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence0232 526 2547 gene locus_tag LOCUS_09450 526 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 <3144 2636 gene locus_tag LOCUS_09460 <3144 2636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938524.1:thiol peroxidase >Feature sequence0233 86 10 gene locus_tag LOCUS_t00190 86 10 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 878 156 gene locus_tag LOCUS_09470 878 156 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937605.1 protein_id gnl|my_center|LOCUS_09470 1579 947 gene locus_tag LOCUS_09480 1579 947 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940530.1 protein_id gnl|my_center|LOCUS_09480 1964 1611 gene locus_tag LOCUS_09490 1964 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940531.1 protein_id gnl|my_center|LOCUS_09490 2857 1967 gene locus_tag LOCUS_09500 2857 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence0234 >Feature sequence0235 1077 85 gene locus_tag LOCUS_09510 1077 85 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_09510 1319 1819 gene locus_tag LOCUS_09520 gene ahbB 1319 1819 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940425.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence0236 1072 1497 gene locus_tag LOCUS_09530 1072 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence0237 <1 1171 gene locus_tag LOCUS_09540 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939912.1:molecular chaperone HtpG <3128 1289 gene locus_tag LOCUS_09550 <3128 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939737.1:ribonuclease R >Feature sequence0238 3 284 gene locus_tag LOCUS_09560 3 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 303 869 gene locus_tag LOCUS_09570 gene amrA 303 869 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938040.1 protein_id gnl|my_center|LOCUS_09570 1018 3036 gene locus_tag LOCUS_09580 1018 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence0239 377 631 gene locus_tag LOCUS_09590 377 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1399 653 gene locus_tag LOCUS_09600 1399 653 CDS product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937672.1 protein_id gnl|my_center|LOCUS_09600 1986 1387 gene locus_tag LOCUS_09610 1986 1387 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792977.1 protein_id gnl|my_center|LOCUS_09610 2172 2855 gene locus_tag LOCUS_09620 2172 2855 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629591.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence0240 1229 444 gene locus_tag LOCUS_09630 1229 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 <3078 1226 gene locus_tag LOCUS_09640 <3078 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391988.1:molybdopterin-dependent oxidoreductase >Feature sequence0241 <1 1243 gene locus_tag LOCUS_09650 <1 1243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939245.1:bifunctional diguanylate cyclase/phosphodiesterase 1813 1301 gene locus_tag LOCUS_09660 1813 1301 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_09660 <3076 1906 gene locus_tag LOCUS_09670 <3076 1906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938194.1:ATP-dependent RecD-like DNA helicase >Feature sequence0242 2150 267 gene locus_tag LOCUS_09680 gene asnB 2150 267 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533108.1 protein_id gnl|my_center|LOCUS_09680 <3065 2169 gene locus_tag LOCUS_09690 <3065 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545566.1:SDR family oxidoreductase >Feature sequence0243 2987 600 gene locus_tag LOCUS_09700 2987 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence0244 <3060 1137 gene locus_tag LOCUS_09710 <3060 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021984.1:chemotaxis protein CheB >Feature sequence0245 601 29 gene locus_tag LOCUS_09720 601 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 844 1566 gene locus_tag LOCUS_09730 844 1566 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938888.1 protein_id gnl|my_center|LOCUS_09730 1823 2758 gene locus_tag LOCUS_09740 1823 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence0246 1257 247 gene locus_tag LOCUS_09750 1257 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2377 1283 gene locus_tag LOCUS_09760 2377 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 <3051 2377 gene locus_tag LOCUS_09770 <3051 2377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403384.1:acylneuraminate cytidylyltransferase family protein >Feature sequence0247 423 2411 gene locus_tag LOCUS_09780 423 2411 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958448.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence0248 1043 474 gene locus_tag LOCUS_09790 1043 474 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793169.1 protein_id gnl|my_center|LOCUS_09790 2818 1370 gene locus_tag LOCUS_09800 2818 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence0249 343 1482 gene locus_tag LOCUS_09810 343 1482 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 protein_id gnl|my_center|LOCUS_09810 1479 2570 gene locus_tag LOCUS_09820 1479 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence0250 408 1016 gene locus_tag LOCUS_09830 408 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2037 1081 gene locus_tag LOCUS_09840 2037 1081 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088659.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence0251 <1 574 gene locus_tag LOCUS_09850 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064072.1:ABC transporter ATP-binding protein 576 1373 gene locus_tag LOCUS_09860 576 1373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_09860 1869 1483 gene locus_tag LOCUS_09870 1869 1483 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_09870 2915 1884 gene locus_tag LOCUS_09880 2915 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938657.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence0252 1010 312 gene locus_tag LOCUS_09890 gene rnc 1010 312 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence0253 266 1462 gene locus_tag LOCUS_09900 266 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1459 2352 gene locus_tag LOCUS_09910 1459 2352 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771849.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence0254 907 1587 gene locus_tag LOCUS_09920 907 1587 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528671.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence0255 978 2063 gene locus_tag LOCUS_09930 978 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09930 2060 2545 gene locus_tag LOCUS_09940 2060 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09940 2923 2663 gene locus_tag LOCUS_09950 2923 2663 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939210.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence0256 1129 119 gene locus_tag LOCUS_09960 1129 119 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629424.1 protein_id gnl|my_center|LOCUS_09960 2037 1138 gene locus_tag LOCUS_09970 2037 1138 CDS product WcbI family polysaccharide biosynthesis putative acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791626.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence0257 551 763 gene locus_tag LOCUS_09980 551 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 747 2531 gene locus_tag LOCUS_09990 747 2531 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence0258 <1 533 gene locus_tag LOCUS_10000 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791433.1:ATP-binding protein 595 1968 gene locus_tag LOCUS_10010 595 1968 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence0259 <1 1561 gene locus_tag LOCUS_10020 <1 1561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939110.1:glutamate synthase-related protein 1579 2025 gene locus_tag LOCUS_10030 1579 2025 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941894.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence0260 244 62 gene locus_tag LOCUS_10040 244 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1652 276 gene locus_tag LOCUS_10050 gene glmU 1652 276 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939937.1 protein_id gnl|my_center|LOCUS_10050 2206 1784 gene locus_tag LOCUS_10060 2206 1784 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_10060 <2960 2213 gene locus_tag LOCUS_10070 <2960 2213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940789.1:F0F1 ATP synthase subunit beta >Feature sequence0261 <1 2888 gene locus_tag LOCUS_10080 <1 2888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940281.1:ABC transporter substrate binding protein >Feature sequence0262 1290 628 gene locus_tag LOCUS_10090 1290 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1461 1294 gene locus_tag LOCUS_10100 1461 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1746 2579 gene locus_tag LOCUS_10110 gene nifU 1746 2579 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence0263 748 140 gene locus_tag LOCUS_10120 748 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1422 748 gene locus_tag LOCUS_10130 1422 748 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938427.1 protein_id gnl|my_center|LOCUS_10130 1760 1419 gene locus_tag LOCUS_10140 1760 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2026 1757 gene locus_tag LOCUS_10150 2026 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2561 2313 gene locus_tag LOCUS_10160 2561 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2919 2563 gene locus_tag LOCUS_10170 2919 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence0264 <1 1672 gene locus_tag LOCUS_10180 <1 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941940.1:ATP-binding protein 1669 2202 gene locus_tag LOCUS_10190 1669 2202 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_10190 <2936 2267 gene locus_tag LOCUS_10200 <2936 2267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940215.1:sigma-54 dependent transcriptional regulator >Feature sequence0265 2 1198 gene locus_tag LOCUS_10210 2 1198 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938394.1 protein_id gnl|my_center|LOCUS_10210 1222 2607 gene locus_tag LOCUS_10220 gene argH 1222 2607 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938393.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence0266 >Feature sequence0267 1510 950 gene locus_tag LOCUS_10230 1510 950 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938692.1 protein_id gnl|my_center|LOCUS_10230 2909 1680 gene locus_tag LOCUS_10240 gene rny 2909 1680 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939940.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence0268 470 745 gene locus_tag LOCUS_10250 470 745 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939150.1 protein_id gnl|my_center|LOCUS_10250 960 1631 gene locus_tag LOCUS_10260 960 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1667 2545 gene locus_tag LOCUS_10270 gene dapA 1667 2545 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence0269 1429 305 gene locus_tag LOCUS_10280 1429 305 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937849.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence0270 558 220 gene locus_tag LOCUS_10290 558 220 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938528.1 protein_id gnl|my_center|LOCUS_10290 1793 588 gene locus_tag LOCUS_10300 1793 588 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938527.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence0271 505 1284 gene locus_tag LOCUS_10310 505 1284 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938546.1 protein_id gnl|my_center|LOCUS_10310 1469 1251 gene locus_tag LOCUS_10320 1469 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938547.1 protein_id gnl|my_center|LOCUS_10320 2004 1525 gene locus_tag LOCUS_10330 2004 1525 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938550.1 protein_id gnl|my_center|LOCUS_10330 2691 2008 gene locus_tag LOCUS_10340 2691 2008 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629591.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence0272 563 1171 gene locus_tag LOCUS_10350 563 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1543 1223 gene locus_tag LOCUS_10360 1543 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1678 2100 gene locus_tag LOCUS_10370 1678 2100 CDS product DUF296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943617.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence0273 62 703 gene locus_tag LOCUS_10380 gene gmk 62 703 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938199.1 protein_id gnl|my_center|LOCUS_10380 703 1479 gene locus_tag LOCUS_10390 gene pyrF 703 1479 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938200.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence0274 199 741 gene locus_tag LOCUS_10400 199 741 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 protein_id gnl|my_center|LOCUS_10400 751 1560 gene locus_tag LOCUS_10410 gene cpaB 751 1560 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939395.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence0275 1754 597 gene locus_tag LOCUS_10420 gene mutY 1754 597 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629788.1 protein_id gnl|my_center|LOCUS_10420 2542 1760 gene locus_tag LOCUS_10430 gene gpmA 2542 1760 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295305.1 protein_id gnl|my_center|LOCUS_10430 2865 2554 gene locus_tag LOCUS_10440 2865 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence0276 1305 694 gene locus_tag LOCUS_10450 gene recR 1305 694 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940458.1 protein_id gnl|my_center|LOCUS_10450 1610 1308 gene locus_tag LOCUS_10460 1610 1308 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940457.1 protein_id gnl|my_center|LOCUS_10460 <2863 1708 gene locus_tag LOCUS_10470 <2863 1708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940456.1:DNA polymerase III subunit gamma/tau >Feature sequence0277 827 138 gene locus_tag LOCUS_10480 gene cmk 827 138 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938327.1 protein_id gnl|my_center|LOCUS_10480 1920 820 gene locus_tag LOCUS_10490 gene hisC 1920 820 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938328.1 protein_id gnl|my_center|LOCUS_10490 2525 2082 gene locus_tag LOCUS_10500 2525 2082 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938329.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence0278 963 484 gene locus_tag LOCUS_10510 gene smpB 963 484 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938129.1 protein_id gnl|my_center|LOCUS_10510 2509 968 gene locus_tag LOCUS_10520 gene ptsP 2509 968 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092157593.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence0279 1032 406 gene locus_tag LOCUS_10530 1032 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1617 1057 gene locus_tag LOCUS_10540 1617 1057 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940335.1 protein_id gnl|my_center|LOCUS_10540 2551 1817 gene locus_tag LOCUS_10550 2551 1817 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937891.1 protein_id gnl|my_center|LOCUS_10550 2847 2563 gene locus_tag LOCUS_10560 2847 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence0280 2142 775 gene locus_tag LOCUS_10570 2142 775 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence0281 1643 528 gene locus_tag LOCUS_10580 gene rodA 1643 528 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938086.1 protein_id gnl|my_center|LOCUS_10580 <2839 1640 gene locus_tag LOCUS_10590 <2839 1640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938087.1:penicillin-binding protein 2 >Feature sequence0282 <1 655 gene locus_tag LOCUS_10600 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938893.1:ATP-dependent Clp protease ATP-binding subunit ClpA 672 1427 gene locus_tag LOCUS_10610 gene aat 672 1427 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_10610 2488 1412 gene locus_tag LOCUS_10620 2488 1412 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence0283 971 3 gene locus_tag LOCUS_10630 971 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1783 968 gene locus_tag LOCUS_10640 1783 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2292 1780 gene locus_tag LOCUS_10650 2292 1780 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941805.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence0284 <1 939 gene locus_tag LOCUS_10660 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942619.1:NAD-dependent 4,6-dehydratase LegB 950 1954 gene locus_tag LOCUS_10670 950 1954 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331295.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence0285 1713 1039 gene locus_tag LOCUS_10680 1713 1039 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937607.1 protein_id gnl|my_center|LOCUS_10680 <2812 2205 gene locus_tag LOCUS_10690 <2812 2205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938229.1:glutamate 5-kinase >Feature sequence0286 <1 1543 gene locus_tag LOCUS_10700 <1 1543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014524248.1:high-molecular-weight cytochrome c 1575 2645 gene locus_tag LOCUS_10710 1575 2645 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937841.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence0287 755 1963 gene locus_tag LOCUS_10720 755 1963 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence0288 1 963 gene locus_tag LOCUS_10730 1 963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_10730 960 1940 gene locus_tag LOCUS_10740 960 1940 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892059.1 protein_id gnl|my_center|LOCUS_10740 1972 2568 gene locus_tag LOCUS_10750 1972 2568 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226951.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence0289 232 1560 gene locus_tag LOCUS_10760 gene tolB 232 1560 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524613.1 protein_id gnl|my_center|LOCUS_10760 1699 2253 gene locus_tag LOCUS_10770 gene pal 1699 2253 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940363.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence0290 690 776 gene locus_tag LOCUS_t00200 690 776 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1242 2144 gene locus_tag LOCUS_10780 1242 2144 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942049.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence0291 303 1349 gene locus_tag LOCUS_10790 303 1349 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940313.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence0292 100 465 gene locus_tag LOCUS_10800 100 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 521 1036 gene locus_tag LOCUS_10810 521 1036 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939497.1 protein_id gnl|my_center|LOCUS_10810 1613 1194 gene locus_tag LOCUS_10820 1613 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2473 1586 gene locus_tag LOCUS_10830 2473 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937941.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence0293 2 577 gene locus_tag LOCUS_10840 2 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 580 1446 gene locus_tag LOCUS_10850 gene cas7c 580 1446 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_10850 1503 2162 gene locus_tag LOCUS_10860 gene cas4 1503 2162 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176710.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence0294 293 1429 gene locus_tag LOCUS_10870 293 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792214.1 protein_id gnl|my_center|LOCUS_10870 1442 1681 gene locus_tag LOCUS_10880 1442 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1688 2653 gene locus_tag LOCUS_10890 gene purU 1688 2653 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228594.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence0295 1039 1440 gene locus_tag LOCUS_10900 1039 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 <2774 1679 gene locus_tag LOCUS_10910 <2774 1679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937784.1:NADP-dependent isocitrate dehydrogenase >Feature sequence0296 2424 805 gene locus_tag LOCUS_10920 2424 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence0297 <1 678 gene locus_tag LOCUS_10930 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937767.1:2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase 918 1082 gene locus_tag LOCUS_10940 918 1082 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_10940 1682 1284 gene locus_tag LOCUS_10950 1682 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2564 1767 gene locus_tag LOCUS_10960 gene folE2 2564 1767 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629168.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence0298 933 463 gene locus_tag LOCUS_10970 gene ribE 933 463 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938494.1 protein_id gnl|my_center|LOCUS_10970 2198 981 gene locus_tag LOCUS_10980 2198 981 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938495.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence0299 <1 1647 gene locus_tag LOCUS_10990 <1 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937790.1:DNA mismatch repair endonuclease MutL >Feature sequence0300 1397 471 gene locus_tag LOCUS_11000 1397 471 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144407.1 protein_id gnl|my_center|LOCUS_11000 2414 1425 gene locus_tag LOCUS_11010 gene glpX 2414 1425 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938831.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence0301 1608 352 gene locus_tag LOCUS_11020 gene ispD 1608 352 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938747.1 protein_id gnl|my_center|LOCUS_11020 <2746 2089 gene locus_tag LOCUS_11030 <2746 2089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938748.1:C4-type zinc ribbon domain-containing protein >Feature sequence0302 1645 185 gene locus_tag LOCUS_11040 gene gcvPB 1645 185 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938717.1 protein_id gnl|my_center|LOCUS_11040 <2736 1642 gene locus_tag LOCUS_11050 <2736 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938718.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPA >Feature sequence0303 >Feature sequence0304 <1 1236 gene locus_tag LOCUS_11060 <1 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940570.1:peptidase U32 family protein 1464 2300 gene locus_tag LOCUS_11070 1464 2300 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939259.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence0305 <1 921 gene locus_tag LOCUS_11080 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937404.1:glycosyltransferase 1543 1052 gene locus_tag LOCUS_11090 1543 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 <2711 1573 gene locus_tag LOCUS_11100 <2711 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938386.1:GAK system CofD-like protein >Feature sequence0306 718 1308 gene locus_tag LOCUS_11110 gene rfbC 718 1308 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938000.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence0307 1509 634 gene locus_tag LOCUS_11120 gene galU 1509 634 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792462.1 protein_id gnl|my_center|LOCUS_11120 <2705 1551 gene locus_tag LOCUS_11130 <2705 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938578.1:phosphoglucosamine mutase >Feature sequence0308 563 844 gene locus_tag LOCUS_11140 563 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938946.1 protein_id gnl|my_center|LOCUS_11140 899 1537 gene locus_tag LOCUS_11150 gene fsa 899 1537 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393880.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence0309 158 2245 gene locus_tag LOCUS_11160 gene glyS 158 2245 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939183.1 protein_id gnl|my_center|LOCUS_11160 2351 2626 gene locus_tag LOCUS_11170 gene rpsT 2351 2626 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence0310 1458 367 gene locus_tag LOCUS_11180 gene bioB 1458 367 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791775.1 protein_id gnl|my_center|LOCUS_11180 2347 1433 gene locus_tag LOCUS_11190 gene rsmI 2347 1433 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938133.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence0311 587 1153 gene locus_tag LOCUS_11200 587 1153 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940325.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence0312 1 498 gene locus_tag LOCUS_11210 1 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 506 1009 gene locus_tag LOCUS_11220 gene def 506 1009 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_11220 994 2031 gene locus_tag LOCUS_11230 gene fmt 994 2031 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940620.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence0313 2440 1409 gene locus_tag LOCUS_11240 gene nadA 2440 1409 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939095.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence0314 570 1586 gene locus_tag LOCUS_11250 570 1586 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940154.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence0315 1 756 gene locus_tag LOCUS_11260 1 756 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_11260 760 1806 gene locus_tag LOCUS_11270 760 1806 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391254.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence0316 <1 2260 gene locus_tag LOCUS_11280 <1 2260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626250.1:bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase >Feature sequence0317 245 643 gene locus_tag LOCUS_11290 245 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1179 796 gene locus_tag LOCUS_11300 1179 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939266.1 protein_id gnl|my_center|LOCUS_11300 1357 1974 gene locus_tag LOCUS_11310 gene rdgC 1357 1974 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939729.1 protein_id gnl|my_center|LOCUS_11310 1990 2514 gene locus_tag LOCUS_11320 1990 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791831.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence0318 580 1860 gene locus_tag LOCUS_11330 580 1860 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940462.1 protein_id gnl|my_center|LOCUS_11330 2216 1875 gene locus_tag LOCUS_11340 2216 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence0319 268 492 gene locus_tag LOCUS_11350 268 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1585 815 gene locus_tag LOCUS_11360 1585 815 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_11360 <2638 1678 gene locus_tag LOCUS_11370 <2638 1678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339170.1:ribulose-bisphosphate carboxylase >Feature sequence0320 1407 700 gene locus_tag LOCUS_11380 1407 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2278 1526 gene locus_tag LOCUS_11390 2278 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence0321 <2633 974 gene locus_tag LOCUS_11400 <2633 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938896.1:excinuclease ABC subunit UvrB >Feature sequence0322 >Feature sequence0323 <1 524 gene locus_tag LOCUS_11410 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937395.1:S-methyl-5-thioribose-1-phosphate isomerase 742 1527 gene locus_tag LOCUS_11420 742 1527 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence0324 <1 1729 gene locus_tag LOCUS_11430 <1 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941958.1:methyl-accepting chemotaxis protein 1740 2234 gene locus_tag LOCUS_11440 1740 2234 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941344.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence0325 502 1392 gene locus_tag LOCUS_11450 502 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1427 2455 gene locus_tag LOCUS_11460 1427 2455 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546047.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence0326 828 2576 gene locus_tag LOCUS_11470 828 2576 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence0327 28 1524 gene locus_tag LOCUS_11480 gene murJ 28 1524 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_11480 <2600 1752 gene locus_tag LOCUS_11490 <2600 1752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294638.1:GGDEF and EAL domain-containing protein >Feature sequence0328 2204 1584 gene locus_tag LOCUS_11500 2204 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence0329 >Feature sequence0330 16 1416 gene locus_tag LOCUS_11510 16 1416 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_11510 <2580 1478 gene locus_tag LOCUS_11520 <2580 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939556.1:hybrid sensor histidine kinase/response regulator >Feature sequence0331 1709 672 gene locus_tag LOCUS_11530 gene plsX 1709 672 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_11530 1881 1702 gene locus_tag LOCUS_11540 gene rpmF 1881 1702 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_11540 2457 1936 gene locus_tag LOCUS_11550 2457 1936 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938506.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence0332 1 381 gene locus_tag LOCUS_11560 1 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 470 2206 gene locus_tag LOCUS_11570 470 2206 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939485.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence0333 85 903 gene locus_tag LOCUS_11580 85 903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_11580 958 2193 gene locus_tag LOCUS_11590 958 2193 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940511.1 protein_id gnl|my_center|LOCUS_11590 2336 2262 gene locus_tag LOCUS_t00210 2336 2262 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2489 2415 gene locus_tag LOCUS_t00220 2489 2415 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2569 2495 gene locus_tag LOCUS_t00230 2569 2495 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0334 491 336 gene locus_tag LOCUS_11600 491 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 510 659 gene locus_tag LOCUS_11610 510 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 760 2049 gene locus_tag LOCUS_11620 760 2049 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937312.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence0335 743 2527 gene locus_tag LOCUS_11630 743 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence0336 1512 754 gene locus_tag LOCUS_11640 1512 754 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941950.1 protein_id gnl|my_center|LOCUS_11640 <2550 1569 gene locus_tag LOCUS_11650 <2550 1569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403383.1:nucleotidyltransferase family protein >Feature sequence0337 <2550 1363 gene locus_tag LOCUS_11660 <2550 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942985.1:potassium transporter Kup >Feature sequence0338 <1 717 gene locus_tag LOCUS_11670 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937978.1:transporter substrate-binding domain-containing protein 727 1641 gene locus_tag LOCUS_11680 727 1641 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937979.1 protein_id gnl|my_center|LOCUS_11680 1764 2015 gene locus_tag LOCUS_11690 1764 2015 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938182.1 protein_id gnl|my_center|LOCUS_11690 2012 2344 gene locus_tag LOCUS_11700 2012 2344 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938183.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence0339 310 972 gene locus_tag LOCUS_11710 310 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1668 1138 gene locus_tag LOCUS_11720 1668 1138 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016360999.1 protein_id gnl|my_center|LOCUS_11720 2538 2466 gene locus_tag LOCUS_t00240 2538 2466 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0340 1256 1741 gene locus_tag LOCUS_11730 1256 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2327 1722 gene locus_tag LOCUS_11740 2327 1722 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941436.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence0341 841 1464 gene locus_tag LOCUS_11750 841 1464 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_11750 <2533 1543 gene locus_tag LOCUS_11760 <2533 1543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792407.1:methyl-accepting chemotaxis protein >Feature sequence0342 1866 460 gene locus_tag LOCUS_11770 gene waaA 1866 460 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038436.1 protein_id gnl|my_center|LOCUS_11770 <2531 1835 gene locus_tag LOCUS_11780 <2531 1835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937641.1:D-alanine--D-alanine ligase >Feature sequence0343 2127 964 gene locus_tag LOCUS_11790 2127 964 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939904.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence0344 1491 262 gene locus_tag LOCUS_11800 1491 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence0345 329 1009 gene locus_tag LOCUS_11810 329 1009 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940564.1 protein_id gnl|my_center|LOCUS_11810 <2490 1013 gene locus_tag LOCUS_11820 <2490 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943890.1:excinuclease ABC subunit UvrC >Feature sequence0346 >Feature sequence0347 1561 638 gene locus_tag LOCUS_11830 1561 638 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791450.1 protein_id gnl|my_center|LOCUS_11830 2219 1743 gene locus_tag LOCUS_11840 2219 1743 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038585.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence0348 855 508 gene locus_tag LOCUS_11850 855 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11850 1976 768 gene locus_tag LOCUS_11860 1976 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 >Feature sequence0349 921 31 gene locus_tag LOCUS_11870 921 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 2184 985 gene locus_tag LOCUS_11880 2184 985 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938060.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence0350 1798 335 gene locus_tag LOCUS_11890 gene xseA 1798 335 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938641.1 protein_id gnl|my_center|LOCUS_11890 <2466 1847 gene locus_tag LOCUS_11900 <2466 1847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938640.1:proline--tRNA ligase >Feature sequence0351 971 1732 gene locus_tag LOCUS_11910 971 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1729 1989 gene locus_tag LOCUS_11920 1729 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792913.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence0352 895 1632 gene locus_tag LOCUS_11930 895 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1568 1939 gene locus_tag LOCUS_11940 1568 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence0353 1437 484 gene locus_tag LOCUS_11950 gene xerD 1437 484 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792251.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence0354 <1 996 gene locus_tag LOCUS_11960 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011793041.1:sulfite exporter TauE/SafE family protein 1083 1577 gene locus_tag LOCUS_11970 1083 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence0355 <1 583 gene locus_tag LOCUS_11980 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937796.1:phenylacetate--CoA ligase 643 2271 gene locus_tag LOCUS_11990 643 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence0356 1021 599 gene locus_tag LOCUS_12000 1021 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317528.1 protein_id gnl|my_center|LOCUS_12000 <2445 1200 gene locus_tag LOCUS_12010 <2445 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263240.1:ATP-binding protein >Feature sequence0357 172 1119 gene locus_tag LOCUS_12020 172 1119 CDS product CobD/CbiB family cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939512.1 protein_id gnl|my_center|LOCUS_12020 1998 1204 gene locus_tag LOCUS_12030 gene proC 1998 1204 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939605.1 protein_id gnl|my_center|LOCUS_12030 2422 2003 gene locus_tag LOCUS_12040 gene ndk 2422 2003 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939606.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence0358 >Feature sequence0359 <1 2105 gene locus_tag LOCUS_12050 <1 2105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932315.1:magnesium-translocating P-type ATPase >Feature sequence0360 <2430 91 gene locus_tag LOCUS_12060 <2430 91 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545860.1:cytochrome c family protein >Feature sequence0361 60 278 gene locus_tag LOCUS_12070 gene rpmB 60 278 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938507.1 protein_id gnl|my_center|LOCUS_12070 548 2350 gene locus_tag LOCUS_12080 gene pabB 548 2350 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence0362 2 1456 gene locus_tag LOCUS_12090 2 1456 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_12090 1512 2330 gene locus_tag LOCUS_12100 gene larE 1512 2330 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224945.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence0363 <1 651 gene locus_tag LOCUS_12110 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937777.1:tryptophan synthase subunit beta 648 1427 gene locus_tag LOCUS_12120 gene trpA 648 1427 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937778.1 protein_id gnl|my_center|LOCUS_12120 <2417 1551 gene locus_tag LOCUS_12130 <2417 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939720.1:methionine adenosyltransferase >Feature sequence0364 89 640 gene locus_tag LOCUS_12140 89 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 <2410 677 gene locus_tag LOCUS_12150 <2410 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 >Feature sequence0365 975 481 gene locus_tag LOCUS_12160 975 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1449 991 gene locus_tag LOCUS_12170 1449 991 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939197.1 protein_id gnl|my_center|LOCUS_12170 1844 1443 gene locus_tag LOCUS_12180 1844 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 <2409 1727 gene locus_tag LOCUS_12190 <2409 1727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939196.1:NAD(P)H-hydrate dehydratase note possible pseudo, frameshifted >Feature sequence0366 872 60 gene locus_tag LOCUS_12200 872 60 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938651.1 protein_id gnl|my_center|LOCUS_12200 1180 869 gene locus_tag LOCUS_12210 1180 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1393 1788 gene locus_tag LOCUS_12220 1393 1788 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence0367 479 835 gene locus_tag LOCUS_12230 479 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 897 2285 gene locus_tag LOCUS_12240 897 2285 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039558.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence0368 <1 1745 gene locus_tag LOCUS_12250 <1 1745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939948.1:ATP-binding protein <2400 1766 gene locus_tag LOCUS_12260 <2400 1766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941940.1:ATP-binding protein >Feature sequence0369 <1 797 gene locus_tag LOCUS_12270 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074055.1:diguanylate cyclase 1036 1608 gene locus_tag LOCUS_12280 1036 1608 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938113.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence0370 2362 1625 gene locus_tag LOCUS_12290 gene hisA 2362 1625 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938337.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence0371 414 4 gene locus_tag LOCUS_12300 414 4 CDS product ech hydrogenase subunit EchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937736.1 protein_id gnl|my_center|LOCUS_12300 1507 419 gene locus_tag LOCUS_12310 1507 419 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_12310 1966 1508 gene locus_tag LOCUS_12320 1966 1508 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937738.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence0372 <1 2139 gene locus_tag LOCUS_12330 <1 2139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937936.1:PBP1A family penicillin-binding protein >Feature sequence0373 1735 425 gene locus_tag LOCUS_12340 1735 425 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence0374 425 919 gene locus_tag LOCUS_12350 425 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792331.1 protein_id gnl|my_center|LOCUS_12350 979 1617 gene locus_tag LOCUS_12360 979 1617 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938891.1 protein_id gnl|my_center|LOCUS_12360 1662 1973 gene locus_tag LOCUS_12370 1662 1973 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938892.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence0375 1177 380 gene locus_tag LOCUS_12380 gene cobM 1177 380 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791695.1 protein_id gnl|my_center|LOCUS_12380 <2336 1302 gene locus_tag LOCUS_12390 <2336 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940443.1:FprA family A-type flavoprotein >Feature sequence0376 1 510 gene locus_tag LOCUS_12400 1 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 578 1207 gene locus_tag LOCUS_12410 578 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1309 2250 gene locus_tag LOCUS_12420 1309 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence0377 <1 615 gene locus_tag LOCUS_12430 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940481.1:pyridoxal phosphate-dependent aminotransferase 657 2060 gene locus_tag LOCUS_12440 657 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940480.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence0378 113 1735 gene locus_tag LOCUS_12450 gene yidC 113 1735 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938376.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence0379 1732 413 gene locus_tag LOCUS_12460 1732 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence0380 217 1860 gene locus_tag LOCUS_12470 217 1860 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938144.1 protein_id gnl|my_center|LOCUS_12470 1823 2116 gene locus_tag LOCUS_12480 1823 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence0381 709 1776 gene locus_tag LOCUS_12490 709 1776 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_12490 1842 2255 gene locus_tag LOCUS_12500 1842 2255 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence0382 350 910 gene locus_tag LOCUS_12510 gene pyrE 350 910 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940203.1 protein_id gnl|my_center|LOCUS_12510 980 2284 gene locus_tag LOCUS_12520 980 2284 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940204.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence0383 1063 5 gene locus_tag LOCUS_12530 gene aroC 1063 5 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_12530 2201 1104 gene locus_tag LOCUS_12540 2201 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence0384 763 1692 gene locus_tag LOCUS_12550 763 1692 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence0385 173 787 gene locus_tag LOCUS_12560 173 787 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_12560 842 1585 gene locus_tag LOCUS_12570 842 1585 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939534.1 protein_id gnl|my_center|LOCUS_12570 1590 2096 gene locus_tag LOCUS_12580 gene ruvC 1590 2096 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939533.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence0386 1181 45 gene locus_tag LOCUS_12590 1181 45 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_12590 1049 949 gene locus_tag LOCUS_t00250 1049 949 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1564 1184 gene locus_tag LOCUS_12600 1564 1184 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence0387 1565 63 gene locus_tag LOCUS_12610 1565 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence0388 >Feature sequence0389 100 387 gene locus_tag LOCUS_12620 100 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 506 1231 gene locus_tag LOCUS_12630 506 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence0390 1216 344 gene locus_tag LOCUS_12640 1216 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1450 1935 gene locus_tag LOCUS_12650 1450 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence0391 1166 780 gene locus_tag LOCUS_12660 1166 780 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940496.1 protein_id gnl|my_center|LOCUS_12660 1534 1163 gene locus_tag LOCUS_12670 1534 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2034 1834 gene locus_tag LOCUS_12680 2034 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence0392 1989 829 gene locus_tag LOCUS_12690 1989 829 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943156.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence0393 7 921 gene locus_tag LOCUS_12700 7 921 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_12700 921 1637 gene locus_tag LOCUS_12710 921 1637 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence0394 1110 157 gene locus_tag LOCUS_12720 1110 157 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940173.1 protein_id gnl|my_center|LOCUS_12720 1530 1294 gene locus_tag LOCUS_12730 gene rpmE 1530 1294 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940172.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence0395 <1 1187 gene locus_tag LOCUS_12740 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937635.1:glycosyltransferase family 4 protein 1184 1819 gene locus_tag LOCUS_12750 1184 1819 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence0396 <1 894 gene locus_tag LOCUS_12760 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266825.1:PAS domain-containing sensor histidine kinase >Feature sequence0397 2146 1721 gene locus_tag LOCUS_12770 2146 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence0398 <1 853 gene locus_tag LOCUS_12780 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937733.1:chromate efflux transporter 981 1169 gene locus_tag LOCUS_12790 981 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1902 1234 gene locus_tag LOCUS_12800 1902 1234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938048.1 protein_id gnl|my_center|LOCUS_12800 2201 1911 gene locus_tag LOCUS_12810 2201 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence0399 1152 124 gene locus_tag LOCUS_12820 1152 124 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957343.1 protein_id gnl|my_center|LOCUS_12820 <2189 1319 gene locus_tag LOCUS_12830 <2189 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878758.1:4Fe-4S binding protein >Feature sequence0400 1112 1525 gene locus_tag LOCUS_12840 1112 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 <2178 1463 gene locus_tag LOCUS_12850 <2178 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940463.1:transglycosylase SLT domain-containing protein >Feature sequence0401 >Feature sequence0402 261 794 gene locus_tag LOCUS_12860 261 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1067 834 gene locus_tag LOCUS_12870 1067 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1411 1073 gene locus_tag LOCUS_12880 1411 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence0403 796 1014 gene locus_tag LOCUS_12890 796 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1637 1077 gene locus_tag LOCUS_12900 1637 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence0404 <1 657 gene locus_tag LOCUS_12910 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294664.1:PAS domain-containing sensor histidine kinase 1841 654 gene locus_tag LOCUS_12920 1841 654 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144327.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence0405 59 1462 gene locus_tag LOCUS_12930 59 1462 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938128.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence0406 597 1022 gene locus_tag LOCUS_12940 597 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 2118 1096 gene locus_tag LOCUS_12950 2118 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence0407 1256 615 gene locus_tag LOCUS_12960 gene fsa 1256 615 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393880.1 protein_id gnl|my_center|LOCUS_12960 1592 1311 gene locus_tag LOCUS_12970 1592 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938946.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence0408 1 513 gene locus_tag LOCUS_12980 1 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1804 524 gene locus_tag LOCUS_12990 1804 524 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939627.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence0409 >Feature sequence0410 1 291 gene locus_tag LOCUS_13000 1 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 <2149 469 gene locus_tag LOCUS_13010 <2149 469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940628.1:dihydroxy-acid dehydratase >Feature sequence0411 1362 424 gene locus_tag LOCUS_13020 1362 424 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940461.1 protein_id gnl|my_center|LOCUS_13020 1783 1478 gene locus_tag LOCUS_13030 1783 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence0412 1007 516 gene locus_tag LOCUS_13040 gene rimI 1007 516 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938967.1 protein_id gnl|my_center|LOCUS_13040 1146 1643 gene locus_tag LOCUS_13050 1146 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 <2137 1615 gene locus_tag LOCUS_13060 <2137 1615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938969.1:inositol monophosphatase family protein >Feature sequence0413 582 1064 gene locus_tag LOCUS_13070 582 1064 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524292.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence0414 1915 905 gene locus_tag LOCUS_13080 gene trpS 1915 905 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937453.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence0415 2097 781 gene locus_tag LOCUS_13090 2097 781 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940512.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence0416 1598 630 gene locus_tag LOCUS_13100 1598 630 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937812.1 protein_id gnl|my_center|LOCUS_13100 1914 1570 gene locus_tag LOCUS_13110 gene rbfA 1914 1570 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence0417 223 855 gene locus_tag LOCUS_13120 223 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 834 1304 gene locus_tag LOCUS_13130 834 1304 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_13130 <2097 1419 gene locus_tag LOCUS_13140 <2097 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939886.1:sodium:calcium antiporter >Feature sequence0418 <1 526 gene locus_tag LOCUS_13150 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939199.1:aspartate kinase >Feature sequence0419 490 8 gene locus_tag LOCUS_13160 490 8 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_13160 631 1212 gene locus_tag LOCUS_13170 631 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1861 1235 gene locus_tag LOCUS_13180 1861 1235 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence0420 <1 1068 gene locus_tag LOCUS_13190 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938119.1:fused MFS/spermidine synthase 1092 1823 gene locus_tag LOCUS_13200 1092 1823 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence0421 1211 393 gene locus_tag LOCUS_13210 gene aroE 1211 393 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937426.1 protein_id gnl|my_center|LOCUS_13210 2089 1220 gene locus_tag LOCUS_13220 2089 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence0422 1615 134 gene locus_tag LOCUS_13230 1615 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1475 1378 gene locus_tag LOCUS_t00260 1475 1378 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0423 1157 684 gene locus_tag LOCUS_13240 gene dut 1157 684 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791926.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence0424 >Feature sequence0425 627 130 gene locus_tag LOCUS_13250 627 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1530 706 gene locus_tag LOCUS_13260 1530 706 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence0426 1 408 gene locus_tag LOCUS_13270 1 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence0427 1522 614 gene locus_tag LOCUS_13280 1522 614 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940340.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence0428 >Feature sequence0429 <1 972 gene locus_tag LOCUS_13290 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940440.1:methyl-accepting chemotaxis protein 1014 1343 gene locus_tag LOCUS_13300 1014 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1531 1932 gene locus_tag LOCUS_13310 1531 1932 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence0430 135 602 gene locus_tag LOCUS_13320 135 602 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938878.1 protein_id gnl|my_center|LOCUS_13320 606 1130 gene locus_tag LOCUS_13330 gene hpt 606 1130 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938879.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence0431 208 480 gene locus_tag LOCUS_13340 208 480 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_13340 598 1194 gene locus_tag LOCUS_13350 598 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence0432 1229 450 gene locus_tag LOCUS_13360 1229 450 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940571.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence0433 <1 1030 gene locus_tag LOCUS_13370 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938148.1:FAD-dependent oxidoreductase >Feature sequence0434 547 1698 gene locus_tag LOCUS_13380 547 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940477.1 protein_id gnl|my_center|LOCUS_13380 1730 2002 gene locus_tag LOCUS_13390 1730 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence0435 >Feature sequence0436 1 537 gene locus_tag LOCUS_13400 1 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 539 1048 gene locus_tag LOCUS_13410 539 1048 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257850.1 protein_id gnl|my_center|LOCUS_13410 1045 1353 gene locus_tag LOCUS_13420 gene nuoK 1045 1353 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813222.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence0437 <2050 1096 gene locus_tag LOCUS_13430 <2050 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937769.1:prephenate dehydratase >Feature sequence0438 >Feature sequence0439 160 1479 gene locus_tag LOCUS_13440 gene bioA 160 1479 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence0440 <1 1826 gene locus_tag LOCUS_13450 <1 1826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939500.1:acetyl-CoA carboxylase carboxyl transferase subunit alpha/beta >Feature sequence0441 >Feature sequence0442 811 218 gene locus_tag LOCUS_13460 811 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence0443 946 140 gene locus_tag LOCUS_13470 946 140 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626073.1 protein_id gnl|my_center|LOCUS_13470 1571 939 gene locus_tag LOCUS_13480 gene tmk 1571 939 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939417.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence0444 <2037 906 gene locus_tag LOCUS_13490 <2037 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869553.1:ABC transporter substrate-binding protein >Feature sequence0445 <1 838 gene locus_tag LOCUS_13500 <1 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938869.1:M48 family metallopeptidase 898 1872 gene locus_tag LOCUS_13510 898 1872 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937757.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence0446 582 675 gene locus_tag LOCUS_t00270 582 675 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 707 1195 gene locus_tag LOCUS_13520 707 1195 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704516.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence0447 <1 957 gene locus_tag LOCUS_13530 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938758.1:glycosyltransferase <2027 954 gene locus_tag LOCUS_13540 <2027 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938975.1:replication-associated recombination protein A >Feature sequence0448 230 526 gene locus_tag LOCUS_13550 230 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 526 933 gene locus_tag LOCUS_13560 526 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 944 1339 gene locus_tag LOCUS_13570 944 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence0449 476 1432 gene locus_tag LOCUS_13580 476 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 <2022 1483 gene locus_tag LOCUS_13590 <2022 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001021122.1:tyrosine--tRNA ligase >Feature sequence0450 162 722 gene locus_tag LOCUS_13600 162 722 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939526.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence0451 1368 127 gene locus_tag LOCUS_13610 1368 127 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963645.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence0452 1051 368 gene locus_tag LOCUS_13620 1051 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence0453 1 441 gene locus_tag LOCUS_13630 1 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 447 1778 gene locus_tag LOCUS_13640 447 1778 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939416.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence0454 36 1352 gene locus_tag LOCUS_13650 36 1352 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937721.1 protein_id gnl|my_center|LOCUS_13650 1493 1417 gene locus_tag LOCUS_t00280 1493 1417 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1803 1585 gene locus_tag LOCUS_13660 1803 1585 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence0455 >Feature sequence0456 <1 1062 gene locus_tag LOCUS_13670 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939350.1:chemotaxis protein CheA >Feature sequence0457 1830 736 gene locus_tag LOCUS_13680 1830 736 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240446.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence0458 1040 165 gene locus_tag LOCUS_13690 1040 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence0459 547 350 gene locus_tag LOCUS_13700 547 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 728 1102 gene locus_tag LOCUS_13710 728 1102 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937449.1 protein_id gnl|my_center|LOCUS_13710 1824 1099 gene locus_tag LOCUS_13720 1824 1099 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_13720 1931 2007 gene locus_tag LOCUS_t00290 1931 2007 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0460 1524 424 gene locus_tag LOCUS_13730 1524 424 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792509.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence0461 >Feature sequence0462 >Feature sequence0463 1488 1024 gene locus_tag LOCUS_13740 1488 1024 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938498.1 protein_id gnl|my_center|LOCUS_13740 1993 1574 gene locus_tag LOCUS_13750 1993 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence0464 <1 1471 gene locus_tag LOCUS_13760 <1 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940490.1:flagellar biosynthesis protein FlhA >Feature sequence0465 <1 520 gene locus_tag LOCUS_13770 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338730.1:glycosyltransferase family 4 protein 600 1640 gene locus_tag LOCUS_13780 600 1640 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence0466 <1 918 gene locus_tag LOCUS_13790 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014524330.1:AI-2E family transporter >Feature sequence0467 <1 1650 gene locus_tag LOCUS_13800 <1 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086596.1:HAD-IC family P-type ATPase >Feature sequence0468 >Feature sequence0469 134 625 gene locus_tag LOCUS_13810 134 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 638 1120 gene locus_tag LOCUS_13820 638 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence0470 <1976 1167 gene locus_tag LOCUS_13830 <1976 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022655.1:bifunctional lysylphosphatidylglycerol flippase/synthetase MprF >Feature sequence0471 <1 563 gene locus_tag LOCUS_13840 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938127.1:(Fe-S)-binding protein >Feature sequence0472 <1 557 gene locus_tag LOCUS_13850 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940452.1:ribosome biogenesis GTPase Der 633 726 gene locus_tag LOCUS_t00300 633 726 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0473 322 1176 gene locus_tag LOCUS_13860 322 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1204 1710 gene locus_tag LOCUS_13870 1204 1710 CDS product YfcE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228757.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence0474 <1 914 gene locus_tag LOCUS_13880 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003355958.1:CBS domain-containing protein >Feature sequence0475 <1950 732 gene locus_tag LOCUS_13890 <1950 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869430.1:aminotransferase class III-fold pyridoxal phosphate-dependent enzyme >Feature sequence0476 70 1161 gene locus_tag LOCUS_13900 70 1161 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937388.1 protein_id gnl|my_center|LOCUS_13900 1950 1240 gene locus_tag LOCUS_13910 1950 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence0477 144 1427 gene locus_tag LOCUS_13920 144 1427 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938462.1 protein_id gnl|my_center|LOCUS_13920 1753 1535 gene locus_tag LOCUS_13930 1753 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence0478 1017 4 gene locus_tag LOCUS_13940 1017 4 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940008.1 protein_id gnl|my_center|LOCUS_13940 1941 1042 gene locus_tag LOCUS_13950 1941 1042 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940009.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence0479 1008 1472 gene locus_tag LOCUS_13960 1008 1472 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941174.1 protein_id gnl|my_center|LOCUS_13960 1472 1795 gene locus_tag LOCUS_13970 1472 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence0480 170 718 gene locus_tag LOCUS_13980 170 718 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940677.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence0481 411 575 gene locus_tag LOCUS_13990 411 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 587 1195 gene locus_tag LOCUS_14000 587 1195 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940497.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence0482 >Feature sequence0483 <1 1321 gene locus_tag LOCUS_14010 <1 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257660.1:tetratricopeptide repeat protein >Feature sequence0484 1432 44 gene locus_tag LOCUS_14020 1432 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence0485 <1920 30 gene locus_tag LOCUS_14030 <1920 30 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937484.1:thiosulfate reductase >Feature sequence0486 223 636 gene locus_tag LOCUS_14040 223 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 769 1212 gene locus_tag LOCUS_14050 769 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1222 1551 gene locus_tag LOCUS_14060 1222 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence0487 347 1828 gene locus_tag LOCUS_14070 347 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence0488 1088 165 gene locus_tag LOCUS_14080 1088 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940655.1 protein_id gnl|my_center|LOCUS_14080 1849 1121 gene locus_tag LOCUS_14090 1849 1121 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792195.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence0489 >Feature sequence0490 <1 1496 gene locus_tag LOCUS_14100 <1 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011793127.1:ATP-binding protein >Feature sequence0491 531 935 gene locus_tag LOCUS_14110 531 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1681 980 gene locus_tag LOCUS_14120 1681 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence0492 1123 122 gene locus_tag LOCUS_14130 1123 122 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943623.1 protein_id gnl|my_center|LOCUS_14130 <1890 1180 gene locus_tag LOCUS_14140 <1890 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876241.1:precorrin-4 C(11)-methyltransferase >Feature sequence0493 <1 759 gene locus_tag LOCUS_14150 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391964.1:3-oxoacyl-ACP reductase FabG 756 1763 gene locus_tag LOCUS_14160 756 1763 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence0494 <1 1075 gene locus_tag LOCUS_14170 <1 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937421.1:sigma-54 dependent transcriptional regulator <1889 1275 gene locus_tag LOCUS_14180 <1889 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940312.1:tRNA (adenine-N1)-methyltransferase >Feature sequence0495 <1 1347 gene locus_tag LOCUS_14190 <1 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940288.1:phosphate acetyltransferase >Feature sequence0496 475 1002 gene locus_tag LOCUS_14200 475 1002 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393113.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence0497 1086 817 gene locus_tag LOCUS_14210 gene rpmA 1086 817 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_14210 1417 1106 gene locus_tag LOCUS_14220 gene rplU 1417 1106 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938226.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence0498 1200 61 gene locus_tag LOCUS_14230 1200 61 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_14230 <1866 1197 gene locus_tag LOCUS_14240 <1866 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390878.1:ABC transporter ATP-binding protein >Feature sequence0499 7 1170 gene locus_tag LOCUS_14250 7 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1175 1744 gene locus_tag LOCUS_14260 1175 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence0500 1 357 gene locus_tag LOCUS_14270 1 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence0501 401 601 gene locus_tag LOCUS_14280 401 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14280 645 977 gene locus_tag LOCUS_14290 645 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 974 1549 gene locus_tag LOCUS_14300 974 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1549 1734 gene locus_tag LOCUS_14310 1549 1734 CDS product DUF2635 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937519.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence0502 721 95 gene locus_tag LOCUS_14320 721 95 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401268.1 protein_id gnl|my_center|LOCUS_14320 961 1827 gene locus_tag LOCUS_14330 961 1827 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940021.1 protein_id gnl|my_center|LOCUS_14330 1618 1533 gene locus_tag LOCUS_t00310 1618 1533 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0503 113 1435 gene locus_tag LOCUS_14340 113 1435 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938757.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence0504 344 1840 gene locus_tag LOCUS_14350 344 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence0505 <1853 144 gene locus_tag LOCUS_14360 <1853 144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937814.1:translation initiation factor IF-2 >Feature sequence0506 <1 1505 gene locus_tag LOCUS_14370 <1 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939262.1:chaperonin GroEL >Feature sequence0507 >Feature sequence0508 113 1051 gene locus_tag LOCUS_14380 gene miaA 113 1051 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938825.1 protein_id gnl|my_center|LOCUS_14380 <1846 1069 gene locus_tag LOCUS_14390 <1846 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940145.1:iron-containing alcohol dehydrogenase >Feature sequence0509 <1 885 gene locus_tag LOCUS_14400 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939625.1:glycosyltransferase 882 1673 gene locus_tag LOCUS_14410 882 1673 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937454.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence0510 <1 767 gene locus_tag LOCUS_14420 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933388.1:permease 919 1518 gene locus_tag LOCUS_14430 919 1518 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939849.1 protein_id gnl|my_center|LOCUS_14430 1551 1784 gene locus_tag LOCUS_14440 1551 1784 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence0511 >Feature sequence0512 1263 448 gene locus_tag LOCUS_14450 1263 448 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938046.1 protein_id gnl|my_center|LOCUS_14450 <1839 1300 gene locus_tag LOCUS_14460 <1839 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938277.1:substrate-binding domain-containing protein >Feature sequence0513 1402 299 gene locus_tag LOCUS_14470 gene lpxK 1402 299 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939738.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence0514 >Feature sequence0515 408 1202 gene locus_tag LOCUS_14480 gene rfbF 408 1202 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence0516 >Feature sequence0517 997 515 gene locus_tag LOCUS_14490 gene ilvN 997 515 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938672.1 protein_id gnl|my_center|LOCUS_14490 <1830 1008 gene locus_tag LOCUS_14500 <1830 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938671.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence0518 1695 511 gene locus_tag LOCUS_14510 1695 511 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938390.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence0519 441 1037 gene locus_tag LOCUS_14520 441 1037 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775967.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence0520 <1810 668 gene locus_tag LOCUS_14530 <1810 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938914.1:CTP synthase >Feature sequence0521 378 884 gene locus_tag LOCUS_14540 gene tadA 378 884 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938820.1 protein_id gnl|my_center|LOCUS_14540 1301 1068 gene locus_tag LOCUS_14550 1301 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938911.1 protein_id gnl|my_center|LOCUS_14550 <1807 1306 gene locus_tag LOCUS_14560 <1807 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938910.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence0522 1384 167 gene locus_tag LOCUS_14570 1384 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence0523 >Feature sequence0524 1033 392 gene locus_tag LOCUS_14580 1033 392 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855670.1 protein_id gnl|my_center|LOCUS_14580 <1800 1036 gene locus_tag LOCUS_14590 <1800 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939732.1:ABC transporter permease >Feature sequence0525 <1 1148 gene locus_tag LOCUS_14600 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939333.1:methionine--tRNA ligase <1800 1212 gene locus_tag LOCUS_14610 <1800 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940171.1:TlyA family rRNA (cytidine-2'-O)-methyltransferase >Feature sequence0526 <1798 1100 gene locus_tag LOCUS_14620 <1798 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940157.1:AmmeMemoRadiSam system protein B >Feature sequence0527 <1 826 gene locus_tag LOCUS_14630 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938822.1:MBL fold metallo-hydrolase 839 1438 gene locus_tag LOCUS_14640 gene rsmD 839 1438 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938823.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence0528 <1789 40 gene locus_tag LOCUS_14650 <1789 40 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937370.1:efflux RND transporter permease subunit >Feature sequence0529 607 1032 gene locus_tag LOCUS_14660 607 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1568 1128 gene locus_tag LOCUS_14670 1568 1128 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937851.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence0530 50 1468 gene locus_tag LOCUS_14680 50 1468 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938739.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence0531 519 923 gene locus_tag LOCUS_14690 519 923 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941568.1 protein_id gnl|my_center|LOCUS_14690 1377 928 gene locus_tag LOCUS_14700 1377 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence0532 933 55 gene locus_tag LOCUS_14710 gene tsaB 933 55 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938163.1 protein_id gnl|my_center|LOCUS_14710 <1776 908 gene locus_tag LOCUS_14720 <1776 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938164.1:RIP metalloprotease RseP >Feature sequence0533 1242 370 gene locus_tag LOCUS_14730 1242 370 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792788.1 protein_id gnl|my_center|LOCUS_14730 1472 1245 gene locus_tag LOCUS_14740 1472 1245 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938477.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence0534 <1 1100 gene locus_tag LOCUS_14750 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938595.1:elongation factor G >Feature sequence0535 3 170 gene locus_tag LOCUS_14760 3 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence0536 >Feature sequence0537 1096 455 gene locus_tag LOCUS_14770 1096 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence0538 <1 685 gene locus_tag LOCUS_14780 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858299.1:NAD-dependent epimerase/dehydratase >Feature sequence0539 1561 1142 gene locus_tag LOCUS_14790 1561 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence0540 <1 1080 gene locus_tag LOCUS_14800 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056091.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence0541 >Feature sequence0542 >Feature sequence0543 >Feature sequence0544 1308 205 gene locus_tag LOCUS_14810 gene arsB 1308 205 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943585.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence0545 930 1247 gene locus_tag LOCUS_14820 930 1247 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940042.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence0546 >Feature sequence0547 931 98 gene locus_tag LOCUS_14830 931 98 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940604.1 protein_id gnl|my_center|LOCUS_14830 <1736 934 gene locus_tag LOCUS_14840 <1736 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940605.1:3-methyl-2-oxobutanoate dehydrogenase subunit VorB >Feature sequence0548 >Feature sequence0549 >Feature sequence0550 <1 712 gene locus_tag LOCUS_14850 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937909.1:metalloregulator ArsR/SmtB family transcription factor >Feature sequence0551 925 98 gene locus_tag LOCUS_14860 925 98 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940604.1 protein_id gnl|my_center|LOCUS_14860 <1717 927 gene locus_tag LOCUS_14870 <1717 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940605.1:3-methyl-2-oxobutanoate dehydrogenase subunit VorB >Feature sequence0552 823 170 gene locus_tag LOCUS_14880 823 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14880 1007 1279 gene locus_tag LOCUS_14890 1007 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1297 1632 gene locus_tag LOCUS_14900 1297 1632 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294592.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence0553 <1 1214 gene locus_tag LOCUS_14910 <1 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056069.1:ABC transporter ATP-binding protein >Feature sequence0554 >Feature sequence0555 1598 363 gene locus_tag LOCUS_14920 1598 363 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence0556 455 288 gene locus_tag LOCUS_14930 455 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1207 476 gene locus_tag LOCUS_14940 1207 476 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939585.1 protein_id gnl|my_center|LOCUS_14940 <1710 1210 gene locus_tag LOCUS_14950 <1710 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004551489.1:enoyl-CoA hydratase >Feature sequence0557 757 458 gene locus_tag LOCUS_14960 757 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1363 761 gene locus_tag LOCUS_14970 gene rimM 1363 761 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938138.1 protein_id gnl|my_center|LOCUS_14970 1602 1369 gene locus_tag LOCUS_14980 1602 1369 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence0558 1590 772 gene locus_tag LOCUS_14990 1590 772 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937628.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence0559 <1689 451 gene locus_tag LOCUS_15000 <1689 451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938757.1:glycosyltransferase family 9 protein >Feature sequence0560 <1 592 gene locus_tag LOCUS_15010 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938761.1:DegQ family serine endoprotease 642 1538 gene locus_tag LOCUS_15020 gene ispE 642 1538 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938867.1 protein_id gnl|my_center|LOCUS_15020 1518 1592 gene locus_tag LOCUS_t00320 1518 1592 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0561 <1 1177 gene locus_tag LOCUS_15030 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931784.1:glycoside hydrolase family 3 protein 1159 1455 gene locus_tag LOCUS_15040 1159 1455 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937746.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence0562 596 114 gene locus_tag LOCUS_15050 gene rimP 596 114 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_15050 940 865 gene locus_tag LOCUS_t00330 940 865 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0563 607 77 gene locus_tag LOCUS_15060 607 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 909 1538 gene locus_tag LOCUS_15070 909 1538 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792177.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence0564 947 159 gene locus_tag LOCUS_15080 gene mazG 947 159 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938482.1 protein_id gnl|my_center|LOCUS_15080 1614 1033 gene locus_tag LOCUS_15090 1614 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence0565 1155 691 gene locus_tag LOCUS_15100 1155 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence0566 174 249 gene locus_tag LOCUS_t00340 174 249 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 <1674 396 gene locus_tag LOCUS_15110 <1674 396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937806.1:selenocysteine-specific translation elongation factor >Feature sequence0567 <1 1182 gene locus_tag LOCUS_15120 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939733.1:DNA repair protein RecN >Feature sequence0568 >Feature sequence0569 <1655 710 gene locus_tag LOCUS_15130 <1655 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937763.1:DHH family phosphoesterase >Feature sequence0570 <1 1048 gene locus_tag LOCUS_15140 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938141.1:signal recognition particle protein 1082 1372 gene locus_tag LOCUS_15150 gene rpsP 1082 1372 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938140.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence0571 >Feature sequence0572 207 1631 gene locus_tag LOCUS_15160 207 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence0573 134 715 gene locus_tag LOCUS_15170 134 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence0574 171 617 gene locus_tag LOCUS_15180 171 617 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939079.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence0575 <1 1362 gene locus_tag LOCUS_15190 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705434.1:phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) >Feature sequence0576 812 375 gene locus_tag LOCUS_15200 gene trxC 812 375 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_15200 1511 990 gene locus_tag LOCUS_15210 gene dtd 1511 990 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938745.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence0577 339 1289 gene locus_tag LOCUS_15220 339 1289 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence0578 1618 848 gene locus_tag LOCUS_15230 1618 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence0579 1 552 gene locus_tag LOCUS_15240 1 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 571 1152 gene locus_tag LOCUS_15250 571 1152 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence0580 254 517 gene locus_tag LOCUS_15260 254 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 <1620 686 gene locus_tag LOCUS_15270 <1620 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928851.1:PAS domain-containing protein >Feature sequence0581 >Feature sequence0582 <1 935 gene locus_tag LOCUS_15280 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813874.1:peptidylprolyl isomerase >Feature sequence0583 >Feature sequence0584 <1 893 gene locus_tag LOCUS_15290 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937897.1:ArgP/LysG family DNA-binding transcriptional regulator >Feature sequence0585 431 1423 gene locus_tag LOCUS_15300 431 1423 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence0586 1094 453 gene locus_tag LOCUS_15310 gene hisH 1094 453 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence0587 <1 1130 gene locus_tag LOCUS_15320 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294622.1:response regulator >Feature sequence0588 864 598 gene locus_tag LOCUS_15330 864 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1378 1001 gene locus_tag LOCUS_15340 1378 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence0589 305 1285 gene locus_tag LOCUS_15350 305 1285 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence0590 >Feature sequence0591 368 159 gene locus_tag LOCUS_15360 368 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1098 472 gene locus_tag LOCUS_15370 1098 472 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940031.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence0592 <1 747 gene locus_tag LOCUS_15380 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937568.1:response regulator <1599 845 gene locus_tag LOCUS_15390 <1599 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940306.1:aminotransferase class IV >Feature sequence0593 <1595 857 gene locus_tag LOCUS_15400 <1595 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938500.1:beta-ketoacyl-ACP synthase II >Feature sequence0594 166 690 gene locus_tag LOCUS_15410 166 690 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938827.1 protein_id gnl|my_center|LOCUS_15410 <1594 819 gene locus_tag LOCUS_15420 <1594 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937958.1:PHP domain-containing protein >Feature sequence0595 1198 1410 gene locus_tag LOCUS_15430 1198 1410 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081411.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence0596 <1 613 gene locus_tag LOCUS_15440 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140949.1:MBOAT family protein 603 1550 gene locus_tag LOCUS_15450 603 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence0597 369 644 gene locus_tag LOCUS_15460 369 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence0598 <1590 198 gene locus_tag LOCUS_15470 <1590 198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940078.1:formate dehydrogenase-N subunit alpha >Feature sequence0599 613 1530 gene locus_tag LOCUS_15480 613 1530 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937953.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence0600 >Feature sequence0601 <1 1446 gene locus_tag LOCUS_15490 <1 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938723.1:pitrilysin family protein >Feature sequence0602 <1582 856 gene locus_tag LOCUS_15500 <1582 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940176.1:peptide chain release factor N(5)-glutamine methyltransferase >Feature sequence0603 >Feature sequence0604 >Feature sequence0605 >Feature sequence0606 >Feature sequence0607 <1560 314 gene locus_tag LOCUS_15510 <1560 314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943854.1:TIGR03960 family B12-binding radical SAM protein >Feature sequence0608 85 960 gene locus_tag LOCUS_15520 gene metF 85 960 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938296.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence0609 >Feature sequence0610 <1560 461 gene locus_tag LOCUS_15530 <1560 461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011793045.1:PEP/pyruvate-binding domain-containing protein >Feature sequence0611 75 1547 gene locus_tag LOCUS_15540 75 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence0612 <1 1444 gene locus_tag LOCUS_15550 <1 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939536.1:DUF3880 domain-containing protein >Feature sequence0613 953 141 gene locus_tag LOCUS_15560 953 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 <1551 1015 gene locus_tag LOCUS_15570 <1551 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266520.1:alpha/beta hydrolase >Feature sequence0614 >Feature sequence0615 >Feature sequence0616 >Feature sequence0617 454 1050 gene locus_tag LOCUS_15580 454 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence0618 <1 762 gene locus_tag LOCUS_15590 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792128.1:methyl-accepting chemotaxis protein <1535 847 gene locus_tag LOCUS_15600 <1535 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938516.1:nitroreductase family protein >Feature sequence0619 >Feature sequence0620 <1533 243 gene locus_tag LOCUS_15610 <1533 243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938870.1:cysteine--tRNA ligase >Feature sequence0621 <1 1039 gene locus_tag LOCUS_15620 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937472.1:amidophosphoribosyltransferase >Feature sequence0622 789 394 gene locus_tag LOCUS_15630 789 394 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938923.1 protein_id gnl|my_center|LOCUS_15630 <1531 895 gene locus_tag LOCUS_15640 <1531 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938922.1:RNase adapter RapZ >Feature sequence0623 >Feature sequence0624 863 1249 gene locus_tag LOCUS_15650 863 1249 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788735.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence0625 580 1017 gene locus_tag LOCUS_15660 580 1017 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880208.1 protein_id gnl|my_center|LOCUS_15660 1253 1459 gene locus_tag LOCUS_15670 1253 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence0626 >Feature sequence0627 130 777 gene locus_tag LOCUS_15680 130 777 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence0628 855 22 gene locus_tag LOCUS_15690 gene ccsA 855 22 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792376.1 protein_id gnl|my_center|LOCUS_15690 <1526 842 gene locus_tag LOCUS_15700 <1526 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938756.1:bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase >Feature sequence0629 219 1427 gene locus_tag LOCUS_15710 gene mnmA 219 1427 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938108.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence0630 115 516 gene locus_tag LOCUS_15720 115 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15720 >Feature sequence0631 >Feature sequence0632 <1 535 gene locus_tag LOCUS_15730 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938109.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA 544 933 gene locus_tag LOCUS_15740 544 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1430 1023 gene locus_tag LOCUS_15750 1430 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence0633 341 832 gene locus_tag LOCUS_15760 gene rpsE 341 832 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_15760 865 1038 gene locus_tag LOCUS_15770 gene rpmD 865 1038 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938616.1 protein_id gnl|my_center|LOCUS_15770 1035 1481 gene locus_tag LOCUS_15780 gene rplO 1035 1481 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938617.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence0634 <1517 484 gene locus_tag LOCUS_15790 <1517 484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940143.1:L-seryl-tRNA(Sec) selenium transferase >Feature sequence0635 294 995 gene locus_tag LOCUS_15800 294 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939407.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence0636 1153 245 gene locus_tag LOCUS_15810 1153 245 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938577.1 protein_id gnl|my_center|LOCUS_15810 1512 1156 gene locus_tag LOCUS_15820 1512 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence0637 488 799 gene locus_tag LOCUS_15830 488 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 834 1298 gene locus_tag LOCUS_15840 gene rpiB 834 1298 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938871.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence0638 1085 72 gene locus_tag LOCUS_15850 1085 72 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence0639 <1 868 gene locus_tag LOCUS_15860 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533584.1:type II secretion system secretin GspD >Feature sequence0640 227 538 gene locus_tag LOCUS_15870 227 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 556 1416 gene locus_tag LOCUS_15880 556 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence0641 <1 934 gene locus_tag LOCUS_15890 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392739.1:molybdopterin-dependent oxidoreductase 931 1404 gene locus_tag LOCUS_15900 931 1404 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence0642 535 1095 gene locus_tag LOCUS_15910 535 1095 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940335.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence0643 <1500 944 gene locus_tag LOCUS_15920 <1500 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939193.1:UDP-glucose/GDP-mannose dehydrogenase family protein >Feature sequence0644 <1498 653 gene locus_tag LOCUS_15930 <1498 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940375.1:peptide chain release factor 3 >Feature sequence0645 >Feature sequence0646 3 194 gene locus_tag LOCUS_15940 3 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 204 650 gene locus_tag LOCUS_15950 gene tolR 204 650 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_15950 <1493 701 gene locus_tag LOCUS_15960 <1493 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792785.1:ABC transporter substrate-binding protein >Feature sequence0647 412 2 gene locus_tag LOCUS_15970 412 2 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939377.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence0648 >Feature sequence0649 >Feature sequence0650 >Feature sequence0651 <1 521 gene locus_tag LOCUS_15980 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975555.1:transcription-repair coupling factor >Feature sequence0652 <1470 375 gene locus_tag LOCUS_15990 <1470 375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937580.1:response regulator >Feature sequence0653 3 494 gene locus_tag LOCUS_16000 3 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1135 743 gene locus_tag LOCUS_16010 1135 743 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938134.1 protein_id gnl|my_center|LOCUS_16010 1470 1111 gene locus_tag LOCUS_16020 1470 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence0654 >Feature sequence0655 268 1170 gene locus_tag LOCUS_16030 268 1170 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_16030 1468 1241 gene locus_tag LOCUS_16040 1468 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence0656 <1468 17 gene locus_tag LOCUS_16050 <1468 17 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791517.1:methyl-accepting chemotaxis protein >Feature sequence0657 1201 368 gene locus_tag LOCUS_16060 1201 368 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939671.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence0658 1380 1467 gene locus_tag LOCUS_t00350 1380 1467 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0659 >Feature sequence0660 >Feature sequence0661 43 612 gene locus_tag LOCUS_16070 gene rimM 43 612 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938138.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence0662 949 206 gene locus_tag LOCUS_16080 gene fabG 949 206 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938502.1 protein_id gnl|my_center|LOCUS_16080 1463 1053 gene locus_tag LOCUS_16090 1463 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence0663 99 1019 gene locus_tag LOCUS_16100 99 1019 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792441.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence0664 <1452 89 gene locus_tag LOCUS_16110 <1452 89 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939066.1:cation-efflux pump >Feature sequence0665 <1449 680 gene locus_tag LOCUS_16120 <1449 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011787371.1:catalase >Feature sequence0666 <1 923 gene locus_tag LOCUS_16130 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939391.1:sigma-54 dependent transcriptional regulator >Feature sequence0667 >Feature sequence0668 1191 16 gene locus_tag LOCUS_16140 1191 16 CDS product SEL1-like repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947086.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence0669 1317 649 gene locus_tag LOCUS_16150 1317 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence0670 375 13 gene locus_tag LOCUS_16160 375 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 936 1346 gene locus_tag LOCUS_16170 936 1346 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939712.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence0671 >Feature sequence0672 <1431 93 gene locus_tag LOCUS_16180 <1431 93 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943931.1:DUF4139 domain-containing protein >Feature sequence0673 <1426 240 gene locus_tag LOCUS_16190 <1426 240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940197.1:response regulator >Feature sequence0674 <1 967 gene locus_tag LOCUS_16200 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938716.1:FAD-dependent oxidoreductase >Feature sequence0675 >Feature sequence0676 1 924 gene locus_tag LOCUS_16210 1 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1323 988 gene locus_tag LOCUS_16220 1323 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence0677 >Feature sequence0678 >Feature sequence0679 <1418 694 gene locus_tag LOCUS_16230 <1418 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003316351.1:fructose-bisphosphate aldolase class II >Feature sequence0680 1190 603 gene locus_tag LOCUS_16240 gene hisB 1190 603 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938339.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence0681 <1 1017 gene locus_tag LOCUS_16250 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081428990.1:4-hydroxythreonine-4-phosphate dehydrogenase PdxA >Feature sequence0682 453 995 gene locus_tag LOCUS_16260 453 995 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence0683 300 674 gene locus_tag LOCUS_16270 gene crcB 300 674 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938890.1 protein_id gnl|my_center|LOCUS_16270 739 1101 gene locus_tag LOCUS_16280 739 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence0684 <1410 353 gene locus_tag LOCUS_16290 <1410 353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083283.1:glycerol dehydrogenase >Feature sequence0685 1185 613 gene locus_tag LOCUS_16300 1185 613 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence0686 1409 1002 gene locus_tag LOCUS_16310 1409 1002 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence0687 <1405 294 gene locus_tag LOCUS_16320 <1405 294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938041.1:MFS transporter >Feature sequence0688 1016 516 gene locus_tag LOCUS_16330 gene rimI 1016 516 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938967.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence0689 239 778 gene locus_tag LOCUS_16340 239 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence0690 506 147 gene locus_tag LOCUS_16350 506 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence0691 <1395 613 gene locus_tag LOCUS_16360 <1395 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930772.1:8-amino-7-oxononanoate synthase >Feature sequence0692 >Feature sequence0693 527 1129 gene locus_tag LOCUS_16370 gene clpP 527 1129 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938630.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence0694 1384 458 gene locus_tag LOCUS_16380 1384 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence0695 147 1175 gene locus_tag LOCUS_16390 147 1175 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939731.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence0696 2 769 gene locus_tag LOCUS_16400 gene pssA 2 769 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940239.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence0697 <1 690 gene locus_tag LOCUS_16410 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582635.1:DUF362 domain-containing protein >Feature sequence0698 <1380 470 gene locus_tag LOCUS_16420 <1380 470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791710.1:ABC transporter permease subunit >Feature sequence0699 >Feature sequence0700 >Feature sequence0701 861 103 gene locus_tag LOCUS_16430 861 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence0702 <1 528 gene locus_tag LOCUS_16440 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940459.1:glycosyltransferase family 4 protein >Feature sequence0703 1270 458 gene locus_tag LOCUS_16450 1270 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16450 >Feature sequence0704 >Feature sequence0705 <1357 626 gene locus_tag LOCUS_16460 <1357 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938711.1:ATP-binding protein >Feature sequence0706 233 1024 gene locus_tag LOCUS_16470 233 1024 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792876.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence0707 803 261 gene locus_tag LOCUS_16480 803 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937937.1 protein_id gnl|my_center|LOCUS_16480 <1352 813 gene locus_tag LOCUS_16490 <1352 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937471.1:KpsF/GutQ family sugar-phosphate isomerase >Feature sequence0708 >Feature sequence0709 <1 580 gene locus_tag LOCUS_16500 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030805.1:3-keto-5-aminohexanoate cleavage protein >Feature sequence0710 <1 835 gene locus_tag LOCUS_16510 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940470.1:FAD-dependent oxidoreductase 838 1329 gene locus_tag LOCUS_16520 838 1329 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986893.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence0711 982 194 gene locus_tag LOCUS_16530 982 194 CDS product tRNA 2-thiocytidine biosynthesis TtcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940499.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence0712 353 637 gene locus_tag LOCUS_16540 gene gatC 353 637 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938110.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence0713 <1350 787 gene locus_tag LOCUS_16550 <1350 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938367.1:ABC transporter permease >Feature sequence0714 >Feature sequence0715 <1 504 gene locus_tag LOCUS_16560 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965179.1:substrate-binding domain-containing protein >Feature sequence0716 2 841 gene locus_tag LOCUS_16570 2 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence0717 391 14 gene locus_tag LOCUS_16580 391 14 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_16580 618 388 gene locus_tag LOCUS_16590 618 388 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence0718 <1 875 gene locus_tag LOCUS_16600 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_115168614.1:rhamnan synthesis F family protein 1263 964 gene locus_tag LOCUS_16610 1263 964 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965739.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence0719 >Feature sequence0720 <1 617 gene locus_tag LOCUS_16620 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002733687.1:transketolase C-terminal domain-containing protein >Feature sequence0721 >Feature sequence0722 1340 279 gene locus_tag LOCUS_16630 gene rimO 1340 279 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940409.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence0723 879 792 gene locus_tag LOCUS_t00360 879 792 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0724 1151 693 gene locus_tag LOCUS_16640 gene dut 1151 693 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791926.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence0725 >Feature sequence0726 1 540 gene locus_tag LOCUS_16650 1 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 550 1089 gene locus_tag LOCUS_16660 550 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937937.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence0727 14 169 gene locus_tag LOCUS_16670 14 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 173 853 gene locus_tag LOCUS_16680 173 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937838.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence0728 >Feature sequence0729 >Feature sequence0730 <1 765 gene locus_tag LOCUS_16690 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941750.1:DUF362 domain-containing protein >Feature sequence0731 309 947 gene locus_tag LOCUS_16700 309 947 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940315.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence0732 891 172 gene locus_tag LOCUS_16710 gene pyrF 891 172 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039203.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence0733 314 490 gene locus_tag LOCUS_16720 314 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1229 603 gene locus_tag LOCUS_16730 1229 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence0734 >Feature sequence0735 76 1116 gene locus_tag LOCUS_16740 76 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence0736 >Feature sequence0737 >Feature sequence0738 508 963 gene locus_tag LOCUS_16750 508 963 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545501.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence0739 615 1286 gene locus_tag LOCUS_16760 615 1286 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence0740 >Feature sequence0741 <1 1133 gene locus_tag LOCUS_16770 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967804.1:NADH-quinone oxidoreductase subunit M >Feature sequence0742 882 427 gene locus_tag LOCUS_16780 882 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence0743 17 1309 gene locus_tag LOCUS_16790 17 1309 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence0744 >Feature sequence0745 >Feature sequence0746 964 212 gene locus_tag LOCUS_16800 964 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence0747 932 180 gene locus_tag LOCUS_16810 932 180 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938974.1 protein_id gnl|my_center|LOCUS_16810 1295 987 gene locus_tag LOCUS_16820 1295 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence0748 77 430 gene locus_tag LOCUS_16830 77 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence0749 <1 902 gene locus_tag LOCUS_16840 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938287.1:carbohydrate kinase family protein >Feature sequence0750 739 92 gene locus_tag LOCUS_16850 739 92 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938961.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence0751 >Feature sequence0752 1197 409 gene locus_tag LOCUS_16860 1197 409 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618819.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence0753 <1 665 gene locus_tag LOCUS_16870 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044976.1:PilZ domain-containing protein >Feature sequence0754 >Feature sequence0755 >Feature sequence0756 >Feature sequence0757 <1290 719 gene locus_tag LOCUS_16880 <1290 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038132.1:tol-pal system protein YbgF >Feature sequence0758 >Feature sequence0759 183 758 gene locus_tag LOCUS_16890 183 758 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197538709.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence0760 40 1197 gene locus_tag LOCUS_16900 40 1197 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939090.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence0761 248 460 gene locus_tag LOCUS_16910 248 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence0762 41 586 gene locus_tag LOCUS_16920 41 586 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938916.1 protein_id gnl|my_center|LOCUS_16920 587 1186 gene locus_tag LOCUS_16930 587 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence0763 >Feature sequence0764 >Feature sequence0765 >Feature sequence0766 628 338 gene locus_tag LOCUS_16940 628 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940224.1 protein_id gnl|my_center|LOCUS_16940 1281 748 gene locus_tag LOCUS_16950 1281 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence0767 1169 177 gene locus_tag LOCUS_16960 gene galE 1169 177 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence0768 1279 239 gene locus_tag LOCUS_16970 1279 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence0769 <1 1213 gene locus_tag LOCUS_16980 <1 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937772.1:anthranilate synthase component I family protein >Feature sequence0770 >Feature sequence0771 544 762 gene locus_tag LOCUS_16990 544 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence0772 962 285 gene locus_tag LOCUS_17000 962 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence0773 1022 642 gene locus_tag LOCUS_17010 1022 642 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939195.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence0774 1 765 gene locus_tag LOCUS_17020 gene pstC 1 765 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791822.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence0775 94 1 gene locus_tag LOCUS_t00370 94 1 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 946 164 gene locus_tag LOCUS_17030 946 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence0776 >Feature sequence0777 1155 217 gene locus_tag LOCUS_17040 gene prmC 1155 217 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940176.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence0778 <1 1079 gene locus_tag LOCUS_17050 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940219.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence0779 40 942 gene locus_tag LOCUS_17060 40 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence0780 >Feature sequence0781 <1 688 gene locus_tag LOCUS_17070 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940160.1:amidohydrolase family protein >Feature sequence0782 1258 452 gene locus_tag LOCUS_17080 1258 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence0783 803 525 gene locus_tag LOCUS_17090 803 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence0784 212 901 gene locus_tag LOCUS_17100 212 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence0785 <1 906 gene locus_tag LOCUS_17110 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965828.1:YncE family protein >Feature sequence0786 416 763 gene locus_tag LOCUS_17120 416 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence0787 <1260 458 gene locus_tag LOCUS_17130 <1260 458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939521.1:Tex family protein >Feature sequence0788 <1260 633 gene locus_tag LOCUS_17140 <1260 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943449.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0789 >Feature sequence0790 640 59 gene locus_tag LOCUS_17150 640 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence0791 <1 528 gene locus_tag LOCUS_17160 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937795.1:phosphoribosylamine--glycine ligase 541 1053 gene locus_tag LOCUS_17170 gene purE 541 1053 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937794.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence0792 93 1040 gene locus_tag LOCUS_17180 93 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence0793 >Feature sequence0794 <1 823 gene locus_tag LOCUS_17190 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939704.1:EAL domain-containing protein >Feature sequence0795 714 1217 gene locus_tag LOCUS_17200 714 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence0796 141 644 gene locus_tag LOCUS_17210 141 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence0797 <1248 567 gene locus_tag LOCUS_17220 <1248 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939886.1:sodium:calcium antiporter >Feature sequence0798 <1246 109 gene locus_tag LOCUS_17230 <1246 109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294689.1:TrmH family RNA methyltransferase >Feature sequence0799 1105 605 gene locus_tag LOCUS_17240 1105 605 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940002.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence0800 >Feature sequence0801 940 134 gene locus_tag LOCUS_17250 940 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence0802 <1235 512 gene locus_tag LOCUS_17260 <1235 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939928.1:7-cyano-7-deazaguanine synthase QueC >Feature sequence0803 >Feature sequence0804 >Feature sequence0805 >Feature sequence0806 <1230 606 gene locus_tag LOCUS_17270 <1230 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392360.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence0807 >Feature sequence0808 >Feature sequence0809 1104 421 gene locus_tag LOCUS_17280 1104 421 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545242.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence0810 43 720 gene locus_tag LOCUS_17290 43 720 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844912.1 protein_id gnl|my_center|LOCUS_17290 757 996 gene locus_tag LOCUS_17300 757 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence0811 51 350 gene locus_tag LOCUS_17310 51 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 350 733 gene locus_tag LOCUS_17320 350 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 654 926 gene locus_tag LOCUS_17330 654 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence0812 242 1204 gene locus_tag LOCUS_17340 242 1204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257499.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence0813 >Feature sequence0814 60 965 gene locus_tag LOCUS_17350 60 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence0815 993 841 gene locus_tag LOCUS_17360 993 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence0816 >Feature sequence0817 <1 1098 gene locus_tag LOCUS_17370 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969400.1:response regulator >Feature sequence0818 >Feature sequence0819 1134 538 gene locus_tag LOCUS_17380 1134 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence0820 >Feature sequence0821 >Feature sequence0822 646 5 gene locus_tag LOCUS_17390 646 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 <1230 643 gene locus_tag LOCUS_17400 <1230 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938027.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence0823 <1230 367 gene locus_tag LOCUS_17410 <1230 367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010992744.1:glycosyltransferase >Feature sequence0824 >Feature sequence0825 <1230 349 gene locus_tag LOCUS_17420 <1230 349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938951.1:LPS export ABC transporter permease LptF >Feature sequence0826 >Feature sequence0827 949 365 gene locus_tag LOCUS_17430 949 365 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940315.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence0828 >Feature sequence0829 >Feature sequence0830 <1221 649 gene locus_tag LOCUS_17440 <1221 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940579.1:FtsX-like permease family protein >Feature sequence0831 958 578 gene locus_tag LOCUS_17450 958 578 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939195.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence0832 >Feature sequence0833 <1 766 gene locus_tag LOCUS_17460 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791822.1:phosphate ABC transporter permease subunit PstC >Feature sequence0834 835 539 gene locus_tag LOCUS_17470 835 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17470 >Feature sequence0835 1002 88 gene locus_tag LOCUS_17480 gene ftsX 1002 88 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211505.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence0836 <1208 369 gene locus_tag LOCUS_17490 <1208 369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014524287.1:NlpC/P60 family N-terminal domain-containing protein >Feature sequence0837 >Feature sequence0838 <1203 573 gene locus_tag LOCUS_17500 <1203 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937579.1:PAS domain S-box protein >Feature sequence0839 2 961 gene locus_tag LOCUS_17510 2 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence0840 >Feature sequence0841 <1 581 gene locus_tag LOCUS_17520 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940373.1:3-deoxy-manno-octulosonate cytidylyltransferase >Feature sequence0842 >Feature sequence0843 907 491 gene locus_tag LOCUS_17530 907 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence0844 >Feature sequence0845 >Feature sequence0846 118 618 gene locus_tag LOCUS_17540 118 618 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938668.1 protein_id gnl|my_center|LOCUS_17540 624 920 gene locus_tag LOCUS_17550 624 920 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338499.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence0847 >Feature sequence0848 >Feature sequence0849 >Feature sequence0850 <1200 480 gene locus_tag LOCUS_17560 <1200 480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000432947.1:radical SAM protein >Feature sequence0851 <1 777 gene locus_tag LOCUS_17570 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225996812.1:alpha/beta hydrolase 913 1200 gene locus_tag LOCUS_17580 913 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence0852 >Feature sequence0853 1198 644 gene locus_tag LOCUS_17590 1198 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence0854 1191 862 gene locus_tag LOCUS_17600 1191 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence0855 >Feature sequence0856 >Feature sequence0857 1057 326 gene locus_tag LOCUS_17610 1057 326 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence0858 <1186 586 gene locus_tag LOCUS_17620 <1186 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544964.1:Ni/Fe hydrogenase subunit alpha >Feature sequence0859 1042 320 gene locus_tag LOCUS_17630 1042 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence0860 218 451 gene locus_tag LOCUS_17640 218 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938911.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence0861 1049 456 gene locus_tag LOCUS_17650 1049 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence0862 >Feature sequence0863 >Feature sequence0864 >Feature sequence0865 479 554 gene locus_tag LOCUS_t00380 479 554 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0866 >Feature sequence0867 >Feature sequence0868 >Feature sequence0869 >Feature sequence0870 <1 1062 gene locus_tag LOCUS_17660 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938704.1:phosphomethylpyrimidine synthase ThiC >Feature sequence0871 <1170 578 gene locus_tag LOCUS_17670 <1170 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462061.1:MBL fold metallo-hydrolase >Feature sequence0872 <1 653 gene locus_tag LOCUS_17680 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838671.1:ATP-binding cassette domain-containing protein >Feature sequence0873 >Feature sequence0874 532 197 gene locus_tag LOCUS_17690 532 197 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939230.1 protein_id gnl|my_center|LOCUS_17690 942 529 gene locus_tag LOCUS_17700 942 529 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016728.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence0875 259 1164 gene locus_tag LOCUS_17710 259 1164 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence0876 1169 204 gene locus_tag LOCUS_17720 gene clpX 1169 204 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938631.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence0877 311 745 gene locus_tag LOCUS_17730 311 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence0878 <1170 306 gene locus_tag LOCUS_17740 <1170 306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937953.1:sirohydrochlorin cobaltochelatase >Feature sequence0879 1170 61 gene locus_tag LOCUS_17750 1170 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence0880 >Feature sequence0881 >Feature sequence0882 961 257 gene locus_tag LOCUS_17760 961 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence0883 <1 895 gene locus_tag LOCUS_17770 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868851.1:phosphate ABC transporter substrate-binding protein >Feature sequence0884 <1160 598 gene locus_tag LOCUS_17780 <1160 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942380.1:ABC transporter substrate-binding protein >Feature sequence0885 313 1053 gene locus_tag LOCUS_17790 313 1053 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence0886 1074 592 gene locus_tag LOCUS_17800 1074 592 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940310.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence0887 >Feature sequence0888 338 739 gene locus_tag LOCUS_17810 338 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence0889 <1154 285 gene locus_tag LOCUS_17820 <1154 285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791440.1:threonine synthase >Feature sequence0890 >Feature sequence0891 <1 616 gene locus_tag LOCUS_17830 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792756.1:aldehyde ferredoxin oxidoreductase N-terminal domain-containing protein >Feature sequence0892 <1151 273 gene locus_tag LOCUS_17840 <1151 273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937749.1:PhoH family protein >Feature sequence0893 >Feature sequence0894 >Feature sequence0895 >Feature sequence0896 >Feature sequence0897 <1141 319 gene locus_tag LOCUS_17850 <1141 319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939719.1:pantoate--beta-alanine ligase >Feature sequence0898 >Feature sequence0899 <1 596 gene locus_tag LOCUS_17860 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943098.1:YihY/virulence factor BrkB family protein >Feature sequence0900 <1140 154 gene locus_tag LOCUS_17870 <1140 154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792378.1:tRNA lysidine(34) synthetase TilS >Feature sequence0901 474 920 gene locus_tag LOCUS_17880 474 920 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596824.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence0902 >Feature sequence0903 >Feature sequence0904 335 682 gene locus_tag LOCUS_17890 335 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 993 679 gene locus_tag LOCUS_17900 993 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence0905 >Feature sequence0906 292 62 gene locus_tag LOCUS_17910 292 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 <1140 465 gene locus_tag LOCUS_17920 <1140 465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064856.1:SIMPL domain-containing protein >Feature sequence0907 <1 652 gene locus_tag LOCUS_17930 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003099549.1:N-acetylmuramate alpha-1-phosphate uridylyltransferase >Feature sequence0908 >Feature sequence0909 >Feature sequence0910 <1 683 gene locus_tag LOCUS_17940 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969489.1:aspartate aminotransferase family protein >Feature sequence0911 <1140 229 gene locus_tag LOCUS_17950 <1140 229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942411.1:exodeoxyribonuclease VII large subunit >Feature sequence0912 >Feature sequence0913 >Feature sequence0914 >Feature sequence0915 >Feature sequence0916 >Feature sequence0917 >Feature sequence0918 389 553 gene locus_tag LOCUS_17960 389 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence0919 >Feature sequence0920 822 184 gene locus_tag LOCUS_17970 822 184 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence0921 <1 810 gene locus_tag LOCUS_17980 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014524287.1:NlpC/P60 family N-terminal domain-containing protein >Feature sequence0922 >Feature sequence0923 >Feature sequence0924 578 973 gene locus_tag LOCUS_17990 578 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence0925 >Feature sequence0926 >Feature sequence0927 <1111 191 gene locus_tag LOCUS_18000 <1111 191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937404.1:glycosyltransferase >Feature sequence0928 >Feature sequence0929 >Feature sequence0930 >Feature sequence0931 931 617 gene locus_tag LOCUS_18010 gene porD 931 617 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082458.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence0932 >Feature sequence0933 1 675 gene locus_tag LOCUS_18020 1 675 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence0934 <1110 147 gene locus_tag LOCUS_18030 <1110 147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085074.1:FIST N-terminal domain-containing protein >Feature sequence0935 698 237 gene locus_tag LOCUS_18040 698 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence0936 929 120 gene locus_tag LOCUS_18050 929 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence0937 >Feature sequence0938 1109 711 gene locus_tag LOCUS_18060 1109 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence0939 295 759 gene locus_tag LOCUS_18070 295 759 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943767.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence0940 380 168 gene locus_tag LOCUS_18080 380 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence0941 <1 523 gene locus_tag LOCUS_18090 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939841.1:ferrous iron transport protein B >Feature sequence0942 31 1029 gene locus_tag LOCUS_18100 31 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence0943 >Feature sequence0944 >Feature sequence0945 >Feature sequence0946 >Feature sequence0947 835 146 gene locus_tag LOCUS_18110 835 146 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792872.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence0948 >Feature sequence0949 >Feature sequence0950 >Feature sequence0951 1018 317 gene locus_tag LOCUS_18120 1018 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence0952 >Feature sequence0953 486 875 gene locus_tag LOCUS_18130 486 875 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792460.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence0954 >Feature sequence0955 362 171 gene locus_tag LOCUS_18140 362 171 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869521.1 protein_id gnl|my_center|LOCUS_18140 <1107 426 gene locus_tag LOCUS_18150 <1107 426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937957.1:peptidase U32 family protein >Feature sequence0956 >Feature sequence0957 >Feature sequence0958 189 884 gene locus_tag LOCUS_18160 189 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence0959 >Feature sequence0960 >Feature sequence0961 >Feature sequence0962 1086 127 gene locus_tag LOCUS_18170 1086 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence0963 132 56 gene locus_tag LOCUS_t00390 132 56 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 920 189 gene locus_tag LOCUS_18180 920 189 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938751.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence0964 >Feature sequence0965 396 145 gene locus_tag LOCUS_18190 396 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18190 <1080 396 gene locus_tag LOCUS_18200 <1080 396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204974.1:MdtB/MuxB family multidrug efflux RND transporter permease subunit note possible pseudo, frameshifted >Feature sequence0966 157 459 gene locus_tag LOCUS_18210 157 459 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932932.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence0967 >Feature sequence0968 >Feature sequence0969 <1080 150 gene locus_tag LOCUS_18220 <1080 150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940672.1:DUF1786 family protein >Feature sequence0970 >Feature sequence0971 >Feature sequence0972 403 690 gene locus_tag LOCUS_18230 403 690 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938198.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence0973 288 986 gene locus_tag LOCUS_18240 288 986 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence0974 >Feature sequence0975 >Feature sequence0976 >Feature sequence0977 204 776 gene locus_tag LOCUS_18250 gene amrA 204 776 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_18250 891 963 gene locus_tag LOCUS_t00400 891 963 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 982 1059 gene locus_tag LOCUS_t00410 982 1059 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0978 1039 476 gene locus_tag LOCUS_18260 1039 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence0979 >Feature sequence0980 >Feature sequence0981 >Feature sequence0982 >Feature sequence0983 >Feature sequence0984 84 947 gene locus_tag LOCUS_18270 84 947 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088174.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence0985 1079 648 gene locus_tag LOCUS_18280 1079 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence0986 116 982 gene locus_tag LOCUS_18290 116 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence0987 352 921 gene locus_tag LOCUS_18300 352 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence0988 >Feature sequence0989 >Feature sequence0990 >Feature sequence0991 >Feature sequence0992 >Feature sequence0993 439 95 gene locus_tag LOCUS_18310 439 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 716 1036 gene locus_tag LOCUS_18320 716 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence0994 >Feature sequence0995 96 965 gene locus_tag LOCUS_18330 96 965 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940003.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence0996 >Feature sequence0997 <1 507 gene locus_tag LOCUS_18340 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937699.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence0998 >Feature sequence0999 <1062 295 gene locus_tag LOCUS_18350 <1062 295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939213.1:isoleucine--tRNA ligase >Feature sequence1000 >Feature sequence1001 >Feature sequence1002 >Feature sequence1003 >Feature sequence1004 <1055 334 gene locus_tag LOCUS_18360 <1055 334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939216.1:tol-pal system protein YbgF >Feature sequence1005 >Feature sequence1006 >Feature sequence1007 >Feature sequence1008 >Feature sequence1009 >Feature sequence1010 >Feature sequence1011 >Feature sequence1012 <1 596 gene locus_tag LOCUS_18370 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948835.1:YdiU family protein >Feature sequence1013 <1 896 gene locus_tag LOCUS_18380 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005768681.1:CoA transferase subunit A >Feature sequence1014 >Feature sequence1015 >Feature sequence1016 >Feature sequence1017 >Feature sequence1018 >Feature sequence1019 >Feature sequence1020 >Feature sequence1021 869 51 gene locus_tag LOCUS_18390 869 51 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938046.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence1022 >Feature sequence1023 86 772 gene locus_tag LOCUS_18400 gene ccsA 86 772 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence1024 <1050 190 gene locus_tag LOCUS_18410 <1050 190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940529.1:cytochrome ubiquinol oxidase subunit I >Feature sequence1025 580 164 gene locus_tag LOCUS_18420 580 164 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence1026 >Feature sequence1027 >Feature sequence1028 665 471 gene locus_tag LOCUS_18430 665 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence1029 >Feature sequence1030 <1031 374 gene locus_tag LOCUS_18440 <1031 374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938748.1:C4-type zinc ribbon domain-containing protein >Feature sequence1031 439 816 gene locus_tag LOCUS_18450 439 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence1032 >Feature sequence1033 >Feature sequence1034 >Feature sequence1035 828 250 gene locus_tag LOCUS_18460 828 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence1036 >Feature sequence1037 192 749 gene locus_tag LOCUS_18470 192 749 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence1038 <1020 129 gene locus_tag LOCUS_18480 <1020 129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937617.1:FliI/YscN family ATPase >Feature sequence1039 <1020 228 gene locus_tag LOCUS_18490 <1020 228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939912.1:molecular chaperone HtpG >Feature sequence1040 >Feature sequence1041 >Feature sequence1042 <1020 114 gene locus_tag LOCUS_18500 <1020 114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125097.1:proton-conducting transporter membrane subunit >Feature sequence1043 >Feature sequence1044 <1 797 gene locus_tag LOCUS_18510 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004184205.1:diguanylate cyclase >Feature sequence1045 >Feature sequence1046 828 34 gene locus_tag LOCUS_18520 828 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence1047 925 14 gene locus_tag LOCUS_18530 925 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence1048 >Feature sequence1049 <1020 410 gene locus_tag LOCUS_18540 <1020 410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038826.1:glycosyltransferase family 2 protein >Feature sequence1050 150 869 gene locus_tag LOCUS_18550 150 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence1051 665 357 gene locus_tag LOCUS_18560 665 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence1052 >Feature sequence1053 <1020 464 gene locus_tag LOCUS_18570 <1020 464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143274355.1:branched-chain amino acid ABC transporter permease >Feature sequence1054 >Feature sequence1055 286 681 gene locus_tag LOCUS_18580 286 681 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937569.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence1056 <1020 501 gene locus_tag LOCUS_18590 <1020 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015839.1:DMT family transporter >Feature sequence1057 >Feature sequence1058 >Feature sequence1059 67 288 gene locus_tag LOCUS_18600 67 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 <1019 386 gene locus_tag LOCUS_18610 <1019 386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937798.1:N-acetyl-gamma-glutamyl-phosphate reductase >Feature sequence1060 207 590 gene locus_tag LOCUS_18620 207 590 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940222.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence1061 462 313 gene locus_tag LOCUS_18630 462 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence1062 <1012 170 gene locus_tag LOCUS_18640 <1012 170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937579.1:PAS domain S-box protein >Feature sequence1063 435 127 gene locus_tag LOCUS_18650 435 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence1064 >Feature sequence1065 >Feature sequence1066 >Feature sequence1067 1005 490 gene locus_tag LOCUS_18660 1005 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence1068 >Feature sequence1069 >Feature sequence1070 >Feature sequence1071 735 85 gene locus_tag LOCUS_18670 735 85 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence1072 >Feature sequence1073 >Feature sequence1074 >Feature sequence1075 <1001 288 gene locus_tag LOCUS_18680 <1001 288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792128.1:methyl-accepting chemotaxis protein