>Feature sequence001 112 1407 gene locus_tag LOCUS_00010 112 1407 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024335.1 protein_id gnl|my_center|LOCUS_00010 1409 2065 gene locus_tag LOCUS_00020 1409 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2525 2079 gene locus_tag LOCUS_00030 2525 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020949.1 protein_id gnl|my_center|LOCUS_00030 3049 2549 gene locus_tag LOCUS_00040 3049 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048170305.1 protein_id gnl|my_center|LOCUS_00040 3187 3795 gene locus_tag LOCUS_00050 gene hisH 3187 3795 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020951.1 protein_id gnl|my_center|LOCUS_00050 3804 5132 gene locus_tag LOCUS_00060 3804 5132 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066157.1 protein_id gnl|my_center|LOCUS_00060 6475 5162 gene locus_tag LOCUS_00070 6475 5162 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 protein_id gnl|my_center|LOCUS_00070 7259 6489 gene locus_tag LOCUS_00080 7259 6489 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_00080 7620 9743 gene locus_tag LOCUS_00090 7620 9743 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_00090 10396 9785 gene locus_tag LOCUS_00100 10396 9785 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020957.1 protein_id gnl|my_center|LOCUS_00100 10909 10466 gene locus_tag LOCUS_00110 10909 10466 CDS product NOB1 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066159.1 protein_id gnl|my_center|LOCUS_00110 11078 11857 gene locus_tag LOCUS_00120 11078 11857 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023442.1 protein_id gnl|my_center|LOCUS_00120 13143 11860 gene locus_tag LOCUS_00130 13143 11860 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 protein_id gnl|my_center|LOCUS_00130 13246 14226 gene locus_tag LOCUS_00140 13246 14226 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 protein_id gnl|my_center|LOCUS_00140 14294 14914 gene locus_tag LOCUS_00150 gene purN 14294 14914 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_00150 14938 16173 gene locus_tag LOCUS_00160 gene glyA 14938 16173 CDS product bifunctional serine hydroxymethyltransferase/L-allo-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023436.1 protein_id gnl|my_center|LOCUS_00160 16186 17058 gene locus_tag LOCUS_00170 16186 17058 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023435.1 protein_id gnl|my_center|LOCUS_00170 17107 18342 gene locus_tag LOCUS_00180 gene folP 17107 18342 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065738.1 protein_id gnl|my_center|LOCUS_00180 18339 18953 gene locus_tag LOCUS_00190 18339 18953 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023431.1 protein_id gnl|my_center|LOCUS_00190 19602 23114 gene locus_tag LOCUS_00200 19602 23114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23888 24706 gene locus_tag LOCUS_00210 23888 24706 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021186.1 protein_id gnl|my_center|LOCUS_00210 25331 25167 gene locus_tag LOCUS_00220 25331 25167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25688 25434 gene locus_tag LOCUS_00230 25688 25434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25663 26007 gene locus_tag LOCUS_00240 25663 26007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26259 26074 gene locus_tag LOCUS_00250 26259 26074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27026 26295 gene locus_tag LOCUS_00260 27026 26295 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022003.1 protein_id gnl|my_center|LOCUS_00260 27480 27968 gene locus_tag LOCUS_00270 27480 27968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28402 28214 gene locus_tag LOCUS_00280 28402 28214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28587 28871 gene locus_tag LOCUS_00290 28587 28871 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023978.1 protein_id gnl|my_center|LOCUS_00290 28878 30068 gene locus_tag LOCUS_00300 28878 30068 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023979.1 protein_id gnl|my_center|LOCUS_00300 30085 30459 gene locus_tag LOCUS_00310 gene crcB 30085 30459 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066568.1 protein_id gnl|my_center|LOCUS_00310 30453 30821 gene locus_tag LOCUS_00320 gene crcB 30453 30821 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065899.1 protein_id gnl|my_center|LOCUS_00320 30846 31169 gene locus_tag LOCUS_00330 30846 31169 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023831.1 protein_id gnl|my_center|LOCUS_00330 31453 31193 gene locus_tag LOCUS_00340 31453 31193 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020250.1 protein_id gnl|my_center|LOCUS_00340 32302 31601 gene locus_tag LOCUS_00350 32302 31601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902413.1 protein_id gnl|my_center|LOCUS_00350 32981 32436 gene locus_tag LOCUS_00360 32981 32436 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064835.1 protein_id gnl|my_center|LOCUS_00360 33229 33747 gene locus_tag LOCUS_00370 33229 33747 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_00370 33780 34388 gene locus_tag LOCUS_00380 33780 34388 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_00380 34857 36065 gene locus_tag LOCUS_00390 34857 36065 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020233.1 protein_id gnl|my_center|LOCUS_00390 36180 37478 gene locus_tag LOCUS_00400 36180 37478 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_00400 37510 38988 gene locus_tag LOCUS_00410 37510 38988 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_00410 39563 39024 gene locus_tag LOCUS_00420 39563 39024 CDS product DUF531 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020296.1 protein_id gnl|my_center|LOCUS_00420 40011 39532 gene locus_tag LOCUS_00430 40011 39532 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020297.1 protein_id gnl|my_center|LOCUS_00430 40795 39989 gene locus_tag LOCUS_00440 gene larE 40795 39989 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020298.1 protein_id gnl|my_center|LOCUS_00440 40894 42234 gene locus_tag LOCUS_00450 gene glmM 40894 42234 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020299.1 protein_id gnl|my_center|LOCUS_00450 42832 42242 gene locus_tag LOCUS_00460 42832 42242 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024150.1 protein_id gnl|my_center|LOCUS_00460 44178 42886 gene locus_tag LOCUS_00470 44178 42886 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048136943.1 protein_id gnl|my_center|LOCUS_00470 44262 44744 gene locus_tag LOCUS_00480 44262 44744 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065943.1 protein_id gnl|my_center|LOCUS_00480 44764 45588 gene locus_tag LOCUS_00490 gene proC 44764 45588 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_00490 45712 46107 gene locus_tag LOCUS_00500 45712 46107 CDS product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023991.1 protein_id gnl|my_center|LOCUS_00500 46658 46104 gene locus_tag LOCUS_00510 46658 46104 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023990.1 protein_id gnl|my_center|LOCUS_00510 46796 46671 gene locus_tag LOCUS_00520 46796 46671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 47210 46893 gene locus_tag LOCUS_00530 47210 46893 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066569.1 protein_id gnl|my_center|LOCUS_00530 47625 48731 gene locus_tag LOCUS_00540 47625 48731 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_00540 48750 49205 gene locus_tag LOCUS_00550 48750 49205 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_00550 49224 50075 gene locus_tag LOCUS_00560 49224 50075 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_00560 50128 50808 gene locus_tag LOCUS_00570 50128 50808 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_00570 50906 51376 gene locus_tag LOCUS_00580 50906 51376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 51403 52053 gene locus_tag LOCUS_00590 51403 52053 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024137.1 protein_id gnl|my_center|LOCUS_00590 52811 52086 gene locus_tag LOCUS_00600 52811 52086 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 protein_id gnl|my_center|LOCUS_00600 53607 52801 gene locus_tag LOCUS_00610 gene cobJ 53607 52801 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024141.1 protein_id gnl|my_center|LOCUS_00610 53929 53576 gene locus_tag LOCUS_00620 53929 53576 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990686.1 protein_id gnl|my_center|LOCUS_00620 54321 53926 gene locus_tag LOCUS_00630 54321 53926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 55166 54435 gene locus_tag LOCUS_00640 55166 54435 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024142.1 protein_id gnl|my_center|LOCUS_00640 55793 55182 gene locus_tag LOCUS_00650 55793 55182 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024143.1 protein_id gnl|my_center|LOCUS_00650 56358 55807 gene locus_tag LOCUS_00660 gene cbiT 56358 55807 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024144.1 protein_id gnl|my_center|LOCUS_00660 56479 57957 gene locus_tag LOCUS_00670 56479 57957 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023184.1 protein_id gnl|my_center|LOCUS_00670 58419 57982 gene locus_tag LOCUS_00680 58419 57982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 58610 59668 gene locus_tag LOCUS_00690 gene trpD 58610 59668 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_00690 59655 60308 gene locus_tag LOCUS_00700 59655 60308 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_00700 60301 61893 gene locus_tag LOCUS_00710 gene trpE 60301 61893 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022927.1 protein_id gnl|my_center|LOCUS_00710 61871 62458 gene locus_tag LOCUS_00720 61871 62458 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022926.1 protein_id gnl|my_center|LOCUS_00720 62483 63034 gene locus_tag LOCUS_00730 62483 63034 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023634.1 protein_id gnl|my_center|LOCUS_00730 >Feature sequence002 486 85 gene locus_tag LOCUS_00740 486 85 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066143.1 protein_id gnl|my_center|LOCUS_00740 1567 815 gene locus_tag LOCUS_00750 1567 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 2016 1609 gene locus_tag LOCUS_00760 2016 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 3672 2032 gene locus_tag LOCUS_00770 3672 2032 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_00770 4662 3685 gene locus_tag LOCUS_00780 4662 3685 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064821.1 protein_id gnl|my_center|LOCUS_00780 6440 4728 gene locus_tag LOCUS_00790 6440 4728 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020198.1 protein_id gnl|my_center|LOCUS_00790 7348 6437 gene locus_tag LOCUS_00800 7348 6437 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020197.1 protein_id gnl|my_center|LOCUS_00800 7542 7910 gene locus_tag LOCUS_00810 7542 7910 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020196.1 protein_id gnl|my_center|LOCUS_00810 8651 7887 gene locus_tag LOCUS_00820 8651 7887 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020194.1 protein_id gnl|my_center|LOCUS_00820 9331 8870 gene locus_tag LOCUS_00830 9331 8870 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020192.1 protein_id gnl|my_center|LOCUS_00830 10652 9453 gene locus_tag LOCUS_00840 10652 9453 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_00840 10781 11758 gene locus_tag LOCUS_00850 10781 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 11904 13283 gene locus_tag LOCUS_00860 11904 13283 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_00860 13299 14300 gene locus_tag LOCUS_00870 gene purM 13299 14300 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_00870 14310 14591 gene locus_tag LOCUS_00880 14310 14591 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020185.1 protein_id gnl|my_center|LOCUS_00880 15163 14597 gene locus_tag LOCUS_00890 15163 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 protein_id gnl|my_center|LOCUS_00890 15366 16412 gene locus_tag LOCUS_00900 15366 16412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 17418 16462 gene locus_tag LOCUS_00910 gene mtrH 17418 16462 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020327.1 protein_id gnl|my_center|LOCUS_00910 17661 17431 gene locus_tag LOCUS_00920 gene mtrG 17661 17431 CDS product tetrahydromethanopterin S-methyltransferase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020328.1 protein_id gnl|my_center|LOCUS_00920 17894 17661 gene locus_tag LOCUS_00930 gene mtrF 17894 17661 CDS product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020329.1 protein_id gnl|my_center|LOCUS_00930 18621 17896 gene locus_tag LOCUS_00940 gene mtrA 18621 17896 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020330.1 protein_id gnl|my_center|LOCUS_00940 18946 18623 gene locus_tag LOCUS_00950 18946 18623 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020331.1 protein_id gnl|my_center|LOCUS_00950 19770 18943 gene locus_tag LOCUS_00960 gene mtrC 19770 18943 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020332.1 protein_id gnl|my_center|LOCUS_00960 20524 19772 gene locus_tag LOCUS_00970 gene mtrD 20524 19772 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 protein_id gnl|my_center|LOCUS_00970 21426 20521 gene locus_tag LOCUS_00980 gene mtrE 21426 20521 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020334.1 protein_id gnl|my_center|LOCUS_00980 21800 22612 gene locus_tag LOCUS_00990 21800 22612 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020335.1 protein_id gnl|my_center|LOCUS_00990 23035 22586 gene locus_tag LOCUS_01000 23035 22586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 23131 23598 gene locus_tag LOCUS_01010 23131 23598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 23867 23595 gene locus_tag LOCUS_01020 23867 23595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 23966 24394 gene locus_tag LOCUS_01030 23966 24394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 24455 24739 gene locus_tag LOCUS_01040 24455 24739 CDS product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066074.1 protein_id gnl|my_center|LOCUS_01040 24938 24765 gene locus_tag LOCUS_01050 24938 24765 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064803.1 protein_id gnl|my_center|LOCUS_01050 26092 25070 gene locus_tag LOCUS_01060 26092 25070 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064802.1 protein_id gnl|my_center|LOCUS_01060 26269 28095 gene locus_tag LOCUS_01070 26269 28095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 28257 29009 gene locus_tag LOCUS_01080 28257 29009 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902268.1 protein_id gnl|my_center|LOCUS_01080 29648 29013 gene locus_tag LOCUS_01090 gene radB 29648 29013 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 protein_id gnl|my_center|LOCUS_01090 30060 30311 gene locus_tag LOCUS_01100 30060 30311 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064801.1 protein_id gnl|my_center|LOCUS_01100 30328 32712 gene locus_tag LOCUS_01110 gene nrdD 30328 32712 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020131.1 protein_id gnl|my_center|LOCUS_01110 32723 33508 gene locus_tag LOCUS_01120 32723 33508 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020130.1 protein_id gnl|my_center|LOCUS_01120 33673 34665 gene locus_tag LOCUS_01130 gene thiL 33673 34665 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_01130 34715 38413 gene locus_tag LOCUS_01140 34715 38413 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020127.1 protein_id gnl|my_center|LOCUS_01140 38953 38432 gene locus_tag LOCUS_01150 38953 38432 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_01150 39099 40106 gene locus_tag LOCUS_01160 39099 40106 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_01160 40155 40982 gene locus_tag LOCUS_01170 40155 40982 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_01170 40982 41749 gene locus_tag LOCUS_01180 40982 41749 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_01180 42204 41773 gene locus_tag LOCUS_01190 42204 41773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020121.1 protein_id gnl|my_center|LOCUS_01190 43099 42263 gene locus_tag LOCUS_01200 43099 42263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020214.1 protein_id gnl|my_center|LOCUS_01200 44825 43023 gene locus_tag LOCUS_01210 44825 43023 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937606.1 protein_id gnl|my_center|LOCUS_01210 45151 47205 gene locus_tag LOCUS_01220 45151 47205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 47333 47737 gene locus_tag LOCUS_01230 47333 47737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 48838 47999 gene locus_tag LOCUS_01240 48838 47999 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024128.1 protein_id gnl|my_center|LOCUS_01240 49230 48895 gene locus_tag LOCUS_01250 49230 48895 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024127.1 protein_id gnl|my_center|LOCUS_01250 50285 49302 gene locus_tag LOCUS_01260 50285 49302 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020218.1 protein_id gnl|my_center|LOCUS_01260 51030 50320 gene locus_tag LOCUS_01270 51030 50320 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_01270 51170 51508 gene locus_tag LOCUS_01280 51170 51508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01280 51423 51683 gene locus_tag LOCUS_01290 51423 51683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01290 51813 52454 gene locus_tag LOCUS_01300 51813 52454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01300 52479 52865 gene locus_tag LOCUS_01310 52479 52865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 53115 53360 gene locus_tag LOCUS_01320 53115 53360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 53372 53767 gene locus_tag LOCUS_01330 53372 53767 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065940.1 protein_id gnl|my_center|LOCUS_01330 53818 54663 gene locus_tag LOCUS_01340 53818 54663 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024124.1 protein_id gnl|my_center|LOCUS_01340 54665 55552 gene locus_tag LOCUS_01350 54665 55552 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024123.1 protein_id gnl|my_center|LOCUS_01350 55727 55915 gene locus_tag LOCUS_01360 55727 55915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 56589 55954 gene locus_tag LOCUS_01370 56589 55954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 56872 57255 gene locus_tag LOCUS_01380 56872 57255 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066044.1 protein_id gnl|my_center|LOCUS_01380 57339 58292 gene locus_tag LOCUS_01390 57339 58292 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020082.1 protein_id gnl|my_center|LOCUS_01390 58657 59406 gene locus_tag LOCUS_01400 58657 59406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_01400 59418 60233 gene locus_tag LOCUS_01410 59418 60233 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_01410 60594 60271 gene locus_tag LOCUS_01420 60594 60271 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065092.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence003 171 551 gene locus_tag LOCUS_01430 171 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 1883 789 gene locus_tag LOCUS_01440 1883 789 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_01440 2863 1883 gene locus_tag LOCUS_01450 2863 1883 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248640.1 protein_id gnl|my_center|LOCUS_01450 4380 2938 gene locus_tag LOCUS_01460 4380 2938 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022613.1 protein_id gnl|my_center|LOCUS_01460 4499 5029 gene locus_tag LOCUS_01470 4499 5029 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_01470 5367 6074 gene locus_tag LOCUS_01480 5367 6074 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932199.1 protein_id gnl|my_center|LOCUS_01480 6811 6113 gene locus_tag LOCUS_01490 6811 6113 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024089.1 protein_id gnl|my_center|LOCUS_01490 7269 8129 gene locus_tag LOCUS_01500 7269 8129 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023811.1 protein_id gnl|my_center|LOCUS_01500 8345 8524 gene locus_tag LOCUS_01510 8345 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 8524 10107 gene locus_tag LOCUS_01520 8524 10107 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021335.1 protein_id gnl|my_center|LOCUS_01520 10285 10410 gene locus_tag LOCUS_01530 10285 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 10410 12002 gene locus_tag LOCUS_01540 10410 12002 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021335.1 protein_id gnl|my_center|LOCUS_01540 12951 12274 gene locus_tag LOCUS_01550 12951 12274 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021328.1 protein_id gnl|my_center|LOCUS_01550 13045 14196 gene locus_tag LOCUS_01560 13045 14196 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990783.1 protein_id gnl|my_center|LOCUS_01560 14306 14689 gene locus_tag LOCUS_01570 14306 14689 CDS product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 protein_id gnl|my_center|LOCUS_01570 15609 15896 gene locus_tag LOCUS_01580 15609 15896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 17614 16202 gene locus_tag LOCUS_01590 17614 16202 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006194892.1 protein_id gnl|my_center|LOCUS_01590 17851 18411 gene locus_tag LOCUS_01600 17851 18411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 18654 18582 gene locus_tag LOCUS_t00010 18654 18582 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19270 18758 gene locus_tag LOCUS_01610 19270 18758 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024074.1 protein_id gnl|my_center|LOCUS_01610 19614 19303 gene locus_tag LOCUS_01620 19614 19303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 21104 19668 gene locus_tag LOCUS_01630 21104 19668 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485823.1 protein_id gnl|my_center|LOCUS_01630 21467 21871 gene locus_tag LOCUS_01640 21467 21871 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022524.1 protein_id gnl|my_center|LOCUS_01640 21980 22267 gene locus_tag LOCUS_01650 21980 22267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065924.1 protein_id gnl|my_center|LOCUS_01650 23285 22308 gene locus_tag LOCUS_01660 23285 22308 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_01660 24251 23319 gene locus_tag LOCUS_01670 gene nifB 24251 23319 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024080.1 protein_id gnl|my_center|LOCUS_01670 24673 24335 gene locus_tag LOCUS_01680 gene queD 24673 24335 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065925.1 protein_id gnl|my_center|LOCUS_01680 25392 24673 gene locus_tag LOCUS_01690 25392 24673 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024082.1 protein_id gnl|my_center|LOCUS_01690 25946 25389 gene locus_tag LOCUS_01700 25946 25389 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024083.1 protein_id gnl|my_center|LOCUS_01700 26696 25962 gene locus_tag LOCUS_01710 gene queC 26696 25962 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024084.1 protein_id gnl|my_center|LOCUS_01710 26876 27358 gene locus_tag LOCUS_01720 26876 27358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 27477 28448 gene locus_tag LOCUS_01730 27477 28448 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023996.1 protein_id gnl|my_center|LOCUS_01730 28518 28757 gene locus_tag LOCUS_01740 28518 28757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 29416 28829 gene locus_tag LOCUS_01750 29416 28829 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_01750 31100 29592 gene locus_tag LOCUS_01760 gene serS 31100 29592 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876746.1 protein_id gnl|my_center|LOCUS_01760 31348 32298 gene locus_tag LOCUS_01770 31348 32298 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 protein_id gnl|my_center|LOCUS_01770 32282 32875 gene locus_tag LOCUS_01780 32282 32875 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023502.1 protein_id gnl|my_center|LOCUS_01780 33116 33253 gene locus_tag LOCUS_01790 33116 33253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 33551 33306 gene locus_tag LOCUS_01800 33551 33306 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023356.1 protein_id gnl|my_center|LOCUS_01800 34893 33562 gene locus_tag LOCUS_01810 34893 33562 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023357.1 protein_id gnl|my_center|LOCUS_01810 36097 34904 gene locus_tag LOCUS_01820 36097 34904 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022964.1 protein_id gnl|my_center|LOCUS_01820 37395 36097 gene locus_tag LOCUS_01830 gene glmM 37395 36097 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065583.1 protein_id gnl|my_center|LOCUS_01830 39242 37413 gene locus_tag LOCUS_01840 gene glmS 39242 37413 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022962.1 protein_id gnl|my_center|LOCUS_01840 40467 39253 gene locus_tag LOCUS_01850 40467 39253 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_01850 41157 40699 gene locus_tag LOCUS_01860 41157 40699 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020987.1 protein_id gnl|my_center|LOCUS_01860 42496 41333 gene locus_tag LOCUS_01870 42496 41333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 43044 42535 gene locus_tag LOCUS_01880 43044 42535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 43603 43004 gene locus_tag LOCUS_01890 43603 43004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 44113 43625 gene locus_tag LOCUS_01900 44113 43625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 45351 44110 gene locus_tag LOCUS_01910 gene hisS 45351 44110 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020981.1 protein_id gnl|my_center|LOCUS_01910 45561 46865 gene locus_tag LOCUS_01920 45561 46865 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065635.1 protein_id gnl|my_center|LOCUS_01920 47127 49349 gene locus_tag LOCUS_01930 47127 49349 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_01930 49363 50643 gene locus_tag LOCUS_01940 gene hisD 49363 50643 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 protein_id gnl|my_center|LOCUS_01940 50745 51146 gene locus_tag LOCUS_01950 50745 51146 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024057.1 protein_id gnl|my_center|LOCUS_01950 51238 52059 gene locus_tag LOCUS_01960 gene cobA 51238 52059 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_01960 52061 52864 gene locus_tag LOCUS_01970 52061 52864 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022973.1 protein_id gnl|my_center|LOCUS_01970 52967 54175 gene locus_tag LOCUS_01980 gene ahbC 52967 54175 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_01980 54730 54380 gene locus_tag LOCUS_01990 54730 54380 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868764.1 protein_id gnl|my_center|LOCUS_01990 55361 55062 gene locus_tag LOCUS_02000 55361 55062 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_02000 >Feature sequence004 112 531 gene locus_tag LOCUS_02010 112 531 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021822.1 protein_id gnl|my_center|LOCUS_02010 1676 534 gene locus_tag LOCUS_02020 1676 534 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_02020 2106 1702 gene locus_tag LOCUS_02030 gene ribH 2106 1702 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021820.1 protein_id gnl|my_center|LOCUS_02030 2620 2150 gene locus_tag LOCUS_02040 gene ribC 2620 2150 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021819.1 protein_id gnl|my_center|LOCUS_02040 3785 2634 gene locus_tag LOCUS_02050 3785 2634 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065228.1 protein_id gnl|my_center|LOCUS_02050 4487 3927 gene locus_tag LOCUS_02060 4487 3927 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021817.1 protein_id gnl|my_center|LOCUS_02060 4987 4544 gene locus_tag LOCUS_02070 4987 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020487.1 protein_id gnl|my_center|LOCUS_02070 5933 5058 gene locus_tag LOCUS_02080 5933 5058 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_02080 5854 6039 gene locus_tag LOCUS_02090 5854 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 6604 6077 gene locus_tag LOCUS_02100 6604 6077 CDS product TIGR00267 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876200.1 protein_id gnl|my_center|LOCUS_02100 6765 7640 gene locus_tag LOCUS_02110 6765 7640 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023289.1 protein_id gnl|my_center|LOCUS_02110 7656 7844 gene locus_tag LOCUS_02120 7656 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 7976 8983 gene locus_tag LOCUS_02130 7976 8983 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023275.1 protein_id gnl|my_center|LOCUS_02130 8995 9798 gene locus_tag LOCUS_02140 8995 9798 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_02140 9800 10630 gene locus_tag LOCUS_02150 9800 10630 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023273.1 protein_id gnl|my_center|LOCUS_02150 10762 11931 gene locus_tag LOCUS_02160 10762 11931 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023272.1 protein_id gnl|my_center|LOCUS_02160 12515 11952 gene locus_tag LOCUS_02170 12515 11952 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065830.1 protein_id gnl|my_center|LOCUS_02170 13071 12637 gene locus_tag LOCUS_02180 13071 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023756.1 protein_id gnl|my_center|LOCUS_02180 13648 13055 gene locus_tag LOCUS_02190 13648 13055 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990667.1 protein_id gnl|my_center|LOCUS_02190 13908 13693 gene locus_tag LOCUS_02200 13908 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 14281 16695 gene locus_tag LOCUS_02210 gene cdhA 14281 16695 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021051.1 protein_id gnl|my_center|LOCUS_02210 16695 17204 gene locus_tag LOCUS_02220 gene cdhB 16695 17204 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023759.1 protein_id gnl|my_center|LOCUS_02220 17236 18669 gene locus_tag LOCUS_02230 gene cdhC 17236 18669 CDS product CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023760.1 protein_id gnl|my_center|LOCUS_02230 18682 19434 gene locus_tag LOCUS_02240 18682 19434 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023761.1 protein_id gnl|my_center|LOCUS_02240 19463 20800 gene locus_tag LOCUS_02250 gene cdhD 19463 20800 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023762.1 protein_id gnl|my_center|LOCUS_02250 20803 22212 gene locus_tag LOCUS_02260 gene acsC 20803 22212 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021046.1 protein_id gnl|my_center|LOCUS_02260 22423 22773 gene locus_tag LOCUS_02270 22423 22773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 23024 24088 gene locus_tag LOCUS_02280 23024 24088 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023369.1 protein_id gnl|my_center|LOCUS_02280 24194 25267 gene locus_tag LOCUS_02290 24194 25267 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023765.1 protein_id gnl|my_center|LOCUS_02290 25272 26435 gene locus_tag LOCUS_02300 25272 26435 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023766.1 protein_id gnl|my_center|LOCUS_02300 26530 27024 gene locus_tag LOCUS_02310 26530 27024 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066543.1 protein_id gnl|my_center|LOCUS_02310 27026 27532 gene locus_tag LOCUS_02320 27026 27532 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023768.1 protein_id gnl|my_center|LOCUS_02320 27681 28313 gene locus_tag LOCUS_02330 gene psmB 27681 28313 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_02330 28412 30322 gene locus_tag LOCUS_02340 28412 30322 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_02340 30970 30329 gene locus_tag LOCUS_02350 30970 30329 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020502.1 protein_id gnl|my_center|LOCUS_02350 31347 32912 gene locus_tag LOCUS_02360 31347 32912 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870275.1 protein_id gnl|my_center|LOCUS_02360 32909 34081 gene locus_tag LOCUS_02370 32909 34081 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870274.1 protein_id gnl|my_center|LOCUS_02370 34078 37182 gene locus_tag LOCUS_02380 34078 37182 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870273.1 protein_id gnl|my_center|LOCUS_02380 38722 37811 gene locus_tag LOCUS_02390 38722 37811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 39316 40476 gene locus_tag LOCUS_02400 gene ftsZ 39316 40476 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_02400 40572 42053 gene locus_tag LOCUS_02410 40572 42053 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023773.1 protein_id gnl|my_center|LOCUS_02410 42062 42523 gene locus_tag LOCUS_02420 42062 42523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023774.1 protein_id gnl|my_center|LOCUS_02420 42694 44715 gene locus_tag LOCUS_02430 42694 44715 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_02430 >Feature sequence005 1366 2289 gene locus_tag LOCUS_02440 1366 2289 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_02440 2930 2352 gene locus_tag LOCUS_02450 2930 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020871.1 protein_id gnl|my_center|LOCUS_02450 3052 3402 gene locus_tag LOCUS_02460 3052 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023839.1 protein_id gnl|my_center|LOCUS_02460 4287 3409 gene locus_tag LOCUS_02470 4287 3409 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064919.1 protein_id gnl|my_center|LOCUS_02470 5581 4280 gene locus_tag LOCUS_02480 5581 4280 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020639.1 protein_id gnl|my_center|LOCUS_02480 5760 6206 gene locus_tag LOCUS_02490 5760 6206 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021802.1 protein_id gnl|my_center|LOCUS_02490 6434 6649 gene locus_tag LOCUS_02500 6434 6649 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020717.1 protein_id gnl|my_center|LOCUS_02500 7174 6668 gene locus_tag LOCUS_02510 7174 6668 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_02510 8096 7176 gene locus_tag LOCUS_02520 8096 7176 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064944.1 protein_id gnl|my_center|LOCUS_02520 8596 8258 gene locus_tag LOCUS_02530 8596 8258 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020712.1 protein_id gnl|my_center|LOCUS_02530 9402 8593 gene locus_tag LOCUS_02540 9402 8593 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020711.1 protein_id gnl|my_center|LOCUS_02540 9986 9399 gene locus_tag LOCUS_02550 9986 9399 CDS product electron transport complex protein RnfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064941.1 protein_id gnl|my_center|LOCUS_02550 10602 9988 gene locus_tag LOCUS_02560 10602 9988 CDS product RnfABCDGE type electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064940.1 protein_id gnl|my_center|LOCUS_02560 11185 10607 gene locus_tag LOCUS_02570 11185 10607 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_02570 12194 11172 gene locus_tag LOCUS_02580 12194 11172 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020707.1 protein_id gnl|my_center|LOCUS_02580 13547 12195 gene locus_tag LOCUS_02590 13547 12195 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860093.1 protein_id gnl|my_center|LOCUS_02590 15096 13561 gene locus_tag LOCUS_02600 15096 13561 CDS product methanogenesis multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064939.1 protein_id gnl|my_center|LOCUS_02600 15536 15102 gene locus_tag LOCUS_02610 15536 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 15690 16655 gene locus_tag LOCUS_02620 15690 16655 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_02620 17226 16681 gene locus_tag LOCUS_02630 gene thpR 17226 16681 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066123.1 protein_id gnl|my_center|LOCUS_02630 17343 18275 gene locus_tag LOCUS_02640 17343 18275 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064938.1 protein_id gnl|my_center|LOCUS_02640 18917 18345 gene locus_tag LOCUS_02650 18917 18345 CDS product acetate uptake transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024272.1 protein_id gnl|my_center|LOCUS_02650 20430 19420 gene locus_tag LOCUS_02660 20430 19420 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020699.1 protein_id gnl|my_center|LOCUS_02660 22516 20537 gene locus_tag LOCUS_02670 gene rqcH 22516 20537 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020698.1 protein_id gnl|my_center|LOCUS_02670 22635 23804 gene locus_tag LOCUS_02680 gene priS 22635 23804 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_02680 23797 24537 gene locus_tag LOCUS_02690 23797 24537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064936.1 protein_id gnl|my_center|LOCUS_02690 24552 24830 gene locus_tag LOCUS_02700 24552 24830 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020693.1 protein_id gnl|my_center|LOCUS_02700 25033 25830 gene locus_tag LOCUS_02710 25033 25830 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_02710 25998 26777 gene locus_tag LOCUS_02720 25998 26777 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020689.1 protein_id gnl|my_center|LOCUS_02720 26782 28026 gene locus_tag LOCUS_02730 26782 28026 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020688.1 protein_id gnl|my_center|LOCUS_02730 28859 28644 gene locus_tag LOCUS_02740 28859 28644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 29077 30543 gene locus_tag LOCUS_02750 29077 30543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 30546 30767 gene locus_tag LOCUS_02760 30546 30767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 31137 31526 gene locus_tag LOCUS_02770 31137 31526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 31780 31490 gene locus_tag LOCUS_02780 31780 31490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 32993 31857 gene locus_tag LOCUS_02790 32993 31857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 34683 33313 gene locus_tag LOCUS_02800 gene cca 34683 33313 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 protein_id gnl|my_center|LOCUS_02800 35085 36197 gene locus_tag LOCUS_02810 35085 36197 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048110.1 protein_id gnl|my_center|LOCUS_02810 36202 37416 gene locus_tag LOCUS_02820 36202 37416 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024330.1 protein_id gnl|my_center|LOCUS_02820 37428 37844 gene locus_tag LOCUS_02830 37428 37844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 37846 38247 gene locus_tag LOCUS_02840 37846 38247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 38213 39292 gene locus_tag LOCUS_02850 gene cap8G 38213 39292 CDS product type 8 capsular polysaccharide synthesis protein Cap8G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413171.1 protein_id gnl|my_center|LOCUS_02850 39285 40271 gene locus_tag LOCUS_02860 39285 40271 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932614.1 protein_id gnl|my_center|LOCUS_02860 40273 41127 gene locus_tag LOCUS_02870 40273 41127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 41132 42358 gene locus_tag LOCUS_02880 41132 42358 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597462.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence006 288 1829 gene locus_tag LOCUS_02890 288 1829 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023176.1 protein_id gnl|my_center|LOCUS_02890 1826 2353 gene locus_tag LOCUS_02900 1826 2353 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023175.1 protein_id gnl|my_center|LOCUS_02900 2749 2462 gene locus_tag LOCUS_02910 2749 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 3125 3619 gene locus_tag LOCUS_02920 3125 3619 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021795.1 protein_id gnl|my_center|LOCUS_02920 4338 3616 gene locus_tag LOCUS_02930 4338 3616 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_02930 5017 4325 gene locus_tag LOCUS_02940 5017 4325 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020831.1 protein_id gnl|my_center|LOCUS_02940 5941 5165 gene locus_tag LOCUS_02950 5941 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 6264 6500 gene locus_tag LOCUS_02960 6264 6500 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023631.1 protein_id gnl|my_center|LOCUS_02960 6615 7361 gene locus_tag LOCUS_02970 6615 7361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024285.1 protein_id gnl|my_center|LOCUS_02970 7340 8566 gene locus_tag LOCUS_02980 7340 8566 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 protein_id gnl|my_center|LOCUS_02980 8698 9561 gene locus_tag LOCUS_02990 8698 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023787.1 protein_id gnl|my_center|LOCUS_02990 9821 10177 gene locus_tag LOCUS_03000 gene rpl7ae 9821 10177 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021535.1 protein_id gnl|my_center|LOCUS_03000 10198 10413 gene locus_tag LOCUS_03010 10198 10413 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065141.1 protein_id gnl|my_center|LOCUS_03010 10419 10607 gene locus_tag LOCUS_03020 10419 10607 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021537.1 protein_id gnl|my_center|LOCUS_03020 10620 11069 gene locus_tag LOCUS_03030 gene ndk 10620 11069 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065142.1 protein_id gnl|my_center|LOCUS_03030 11186 12961 gene locus_tag LOCUS_03040 gene infB 11186 12961 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065143.1 protein_id gnl|my_center|LOCUS_03040 13041 13433 gene locus_tag LOCUS_03050 13041 13433 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021540.1 protein_id gnl|my_center|LOCUS_03050 14219 13503 gene locus_tag LOCUS_03060 14219 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 14935 14231 gene locus_tag LOCUS_03070 14935 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 15433 17784 gene locus_tag LOCUS_03080 15433 17784 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209617549.1 protein_id gnl|my_center|LOCUS_03080 17781 18896 gene locus_tag LOCUS_03090 17781 18896 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020343.1 protein_id gnl|my_center|LOCUS_03090 18893 19978 gene locus_tag LOCUS_03100 18893 19978 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064850.1 protein_id gnl|my_center|LOCUS_03100 20648 20241 gene locus_tag LOCUS_03110 20648 20241 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065151.1 protein_id gnl|my_center|LOCUS_03110 21574 20759 gene locus_tag LOCUS_03120 21574 20759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 22328 21732 gene locus_tag LOCUS_03130 gene pdxT 22328 21732 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021577.1 protein_id gnl|my_center|LOCUS_03130 23246 22350 gene locus_tag LOCUS_03140 gene pdxS 23246 22350 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065155.1 protein_id gnl|my_center|LOCUS_03140 25826 23328 gene locus_tag LOCUS_03150 gene gyrA 25826 23328 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_03150 27741 25837 gene locus_tag LOCUS_03160 gene gyrB 27741 25837 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_03160 29434 28454 gene locus_tag LOCUS_03170 gene ala 29434 28454 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_03170 30319 29528 gene locus_tag LOCUS_03180 30319 29528 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024254.1 protein_id gnl|my_center|LOCUS_03180 30825 30415 gene locus_tag LOCUS_03190 30825 30415 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021483.1 protein_id gnl|my_center|LOCUS_03190 32881 30842 gene locus_tag LOCUS_03200 32881 30842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 33201 33845 gene locus_tag LOCUS_03210 33201 33845 CDS product methyltransferase cognate corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065003.1 protein_id gnl|my_center|LOCUS_03210 33858 35258 gene locus_tag LOCUS_03220 gene mtbB 33858 35258 CDS product dimethylamine methyltransferase MtbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:O93661 transl_except (pos:34920..34922,aa:Pyl) note codon on position 355 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_03220 35370 36827 gene locus_tag LOCUS_03230 35370 36827 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065402.1 protein_id gnl|my_center|LOCUS_03230 36964 37605 gene locus_tag LOCUS_03240 36964 37605 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020384.1 protein_id gnl|my_center|LOCUS_03240 40354 37664 gene locus_tag LOCUS_03250 40354 37664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 40677 40955 gene locus_tag LOCUS_03260 40677 40955 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065040.1 protein_id gnl|my_center|LOCUS_03260 41633 41082 gene locus_tag LOCUS_03270 41633 41082 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021127.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence007 143 901 gene locus_tag LOCUS_03280 143 901 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066032.1 protein_id gnl|my_center|LOCUS_03280 945 1589 gene locus_tag LOCUS_03290 945 1589 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024487.1 protein_id gnl|my_center|LOCUS_03290 1586 3460 gene locus_tag LOCUS_03300 1586 3460 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024488.1 protein_id gnl|my_center|LOCUS_03300 4244 3504 gene locus_tag LOCUS_03310 4244 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 4808 4254 gene locus_tag LOCUS_03320 4808 4254 CDS product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989719.1 protein_id gnl|my_center|LOCUS_03320 6202 5261 gene locus_tag LOCUS_03330 6202 5261 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066036.1 protein_id gnl|my_center|LOCUS_03330 7697 6315 gene locus_tag LOCUS_03340 7697 6315 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_03340 7799 9634 gene locus_tag LOCUS_03350 gene arcS 7799 9634 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_03350 9651 10172 gene locus_tag LOCUS_03360 gene rimI 9651 10172 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_03360 10491 10192 gene locus_tag LOCUS_03370 10491 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 12025 10694 gene locus_tag LOCUS_03380 12025 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 12666 14042 gene locus_tag LOCUS_03390 12666 14042 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024504.1 protein_id gnl|my_center|LOCUS_03390 14039 15034 gene locus_tag LOCUS_03400 gene rtcA 14039 15034 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024505.1 protein_id gnl|my_center|LOCUS_03400 15684 15049 gene locus_tag LOCUS_03410 15684 15049 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024506.1 protein_id gnl|my_center|LOCUS_03410 15884 17011 gene locus_tag LOCUS_03420 15884 17011 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024513.1 protein_id gnl|my_center|LOCUS_03420 17150 17758 gene locus_tag LOCUS_03430 17150 17758 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024515.1 protein_id gnl|my_center|LOCUS_03430 17801 18589 gene locus_tag LOCUS_03440 17801 18589 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024516.1 protein_id gnl|my_center|LOCUS_03440 18687 19676 gene locus_tag LOCUS_03450 18687 19676 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048168954.1 protein_id gnl|my_center|LOCUS_03450 19721 20569 gene locus_tag LOCUS_03460 19721 20569 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024518.1 protein_id gnl|my_center|LOCUS_03460 20606 21382 gene locus_tag LOCUS_03470 20606 21382 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589511.1 protein_id gnl|my_center|LOCUS_03470 21366 22550 gene locus_tag LOCUS_03480 21366 22550 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024521.1 protein_id gnl|my_center|LOCUS_03480 22601 23638 gene locus_tag LOCUS_03490 22601 23638 CDS product translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024522.1 protein_id gnl|my_center|LOCUS_03490 24142 23639 gene locus_tag LOCUS_03500 24142 23639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 24898 24155 gene locus_tag LOCUS_03510 24898 24155 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868075.1 protein_id gnl|my_center|LOCUS_03510 25095 25997 gene locus_tag LOCUS_03520 25095 25997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 27028 26000 gene locus_tag LOCUS_03530 27028 26000 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020113.1 protein_id gnl|my_center|LOCUS_03530 27442 27122 gene locus_tag LOCUS_03540 27442 27122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 29453 27537 gene locus_tag LOCUS_03550 29453 27537 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020337.1 protein_id gnl|my_center|LOCUS_03550 29695 30978 gene locus_tag LOCUS_03560 29695 30978 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020753.1 protein_id gnl|my_center|LOCUS_03560 30965 32770 gene locus_tag LOCUS_03570 30965 32770 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990744.1 protein_id gnl|my_center|LOCUS_03570 32906 32982 gene locus_tag LOCUS_t00020 32906 32982 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 33090 33269 gene locus_tag LOCUS_03580 33090 33269 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020114.1 protein_id gnl|my_center|LOCUS_03580 34059 33286 gene locus_tag LOCUS_03590 34059 33286 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_03590 34514 34056 gene locus_tag LOCUS_03600 34514 34056 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066042.1 protein_id gnl|my_center|LOCUS_03600 35053 34511 gene locus_tag LOCUS_03610 35053 34511 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024528.1 protein_id gnl|my_center|LOCUS_03610 35284 36255 gene locus_tag LOCUS_03620 gene dusB 35284 36255 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020094.1 protein_id gnl|my_center|LOCUS_03620 36490 37038 gene locus_tag LOCUS_03630 36490 37038 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_03630 37035 37295 gene locus_tag LOCUS_03640 gene porD 37035 37295 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020092.1 protein_id gnl|my_center|LOCUS_03640 37295 38509 gene locus_tag LOCUS_03650 gene porA 37295 38509 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_03650 38506 39378 gene locus_tag LOCUS_03660 gene porB 38506 39378 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_03660 39461 40114 gene locus_tag LOCUS_03670 gene nth 39461 40114 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065874.1 protein_id gnl|my_center|LOCUS_03670 40861 40139 gene locus_tag LOCUS_03680 40861 40139 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065257.1 protein_id gnl|my_center|LOCUS_03680 >Feature sequence008 1135 617 gene locus_tag LOCUS_03690 1135 617 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065785.1 protein_id gnl|my_center|LOCUS_03690 2176 1148 gene locus_tag LOCUS_03700 gene fpoF 2176 1148 CDS product F420H2 dehydrogenase subunit FpoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023636.1 protein_id gnl|my_center|LOCUS_03700 3171 2191 gene locus_tag LOCUS_03710 gene mer 3171 2191 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_03710 3564 3803 gene locus_tag LOCUS_03720 3564 3803 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023639.1 protein_id gnl|my_center|LOCUS_03720 3809 4030 gene locus_tag LOCUS_03730 3809 4030 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065787.1 protein_id gnl|my_center|LOCUS_03730 4059 4424 gene locus_tag LOCUS_03740 4059 4424 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023090.1 protein_id gnl|my_center|LOCUS_03740 4518 5240 gene locus_tag LOCUS_03750 4518 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03750 5206 5937 gene locus_tag LOCUS_03760 5206 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03760 5980 6171 gene locus_tag LOCUS_03770 5980 6171 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020483.1 protein_id gnl|my_center|LOCUS_03770 6208 6852 gene locus_tag LOCUS_03780 6208 6852 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065789.1 protein_id gnl|my_center|LOCUS_03780 6842 7540 gene locus_tag LOCUS_03790 6842 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 7530 8120 gene locus_tag LOCUS_03800 gene afpA 7530 8120 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023646.1 protein_id gnl|my_center|LOCUS_03800 8924 8106 gene locus_tag LOCUS_03810 8924 8106 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616091.1 protein_id gnl|my_center|LOCUS_03810 10031 8928 gene locus_tag LOCUS_03820 10031 8928 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065345.1 protein_id gnl|my_center|LOCUS_03820 10342 10833 gene locus_tag LOCUS_03830 10342 10833 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023647.1 protein_id gnl|my_center|LOCUS_03830 10846 12048 gene locus_tag LOCUS_03840 10846 12048 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065790.1 protein_id gnl|my_center|LOCUS_03840 12096 12371 gene locus_tag LOCUS_03850 12096 12371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 12548 13006 gene locus_tag LOCUS_03860 12548 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 13224 13442 gene locus_tag LOCUS_03870 13224 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 13443 16124 gene locus_tag LOCUS_03880 13443 16124 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_03880 17032 16199 gene locus_tag LOCUS_03890 17032 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 17814 19397 gene locus_tag LOCUS_03900 17814 19397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 19853 19488 gene locus_tag LOCUS_03910 19853 19488 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021008.1 protein_id gnl|my_center|LOCUS_03910 20166 21722 gene locus_tag LOCUS_03920 20166 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 22199 22558 gene locus_tag LOCUS_03930 22199 22558 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065894.1 protein_id gnl|my_center|LOCUS_03930 22974 22552 gene locus_tag LOCUS_03940 gene nikR 22974 22552 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 protein_id gnl|my_center|LOCUS_03940 23133 23846 gene locus_tag LOCUS_03950 23133 23846 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065889.1 protein_id gnl|my_center|LOCUS_03950 23866 25359 gene locus_tag LOCUS_03960 23866 25359 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022909.1 protein_id gnl|my_center|LOCUS_03960 26040 25348 gene locus_tag LOCUS_03970 26040 25348 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022879.1 protein_id gnl|my_center|LOCUS_03970 27074 26037 gene locus_tag LOCUS_03980 27074 26037 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022880.1 protein_id gnl|my_center|LOCUS_03980 28270 27170 gene locus_tag LOCUS_03990 28270 27170 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_03990 28200 28382 gene locus_tag LOCUS_04000 28200 28382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 28752 28390 gene locus_tag LOCUS_04010 28752 28390 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023952.1 protein_id gnl|my_center|LOCUS_04010 29140 28769 gene locus_tag LOCUS_04020 gene nifU 29140 28769 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_04020 30303 29140 gene locus_tag LOCUS_04030 gene nifS 30303 29140 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_04030 30714 30406 gene locus_tag LOCUS_04040 gene yciH 30714 30406 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023951.1 protein_id gnl|my_center|LOCUS_04040 30791 31144 gene locus_tag LOCUS_04050 30791 31144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 32066 31341 gene locus_tag LOCUS_04060 32066 31341 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_04060 33524 32190 gene locus_tag LOCUS_04070 33524 32190 CDS product ADP-dependent glucokinase/phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023476.1 protein_id gnl|my_center|LOCUS_04070 35015 33537 gene locus_tag LOCUS_04080 gene pfkC 35015 33537 CDS product ADP-specific phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023477.1 protein_id gnl|my_center|LOCUS_04080 36231 35047 gene locus_tag LOCUS_04090 gene argJ 36231 35047 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023478.1 protein_id gnl|my_center|LOCUS_04090 36701 36228 gene locus_tag LOCUS_04100 36701 36228 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_04100 37746 36733 gene locus_tag LOCUS_04110 gene argC 37746 36733 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 protein_id gnl|my_center|LOCUS_04110 >Feature sequence009 <1 1456 gene locus_tag LOCUS_04120 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020921.1:putative cobaltochelatase 1859 1512 gene locus_tag LOCUS_04130 1859 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2082 1924 gene locus_tag LOCUS_04140 2082 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 2857 2555 gene locus_tag LOCUS_04150 2857 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4255 2984 gene locus_tag LOCUS_04160 4255 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 5458 4268 gene locus_tag LOCUS_04170 5458 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 6237 5482 gene locus_tag LOCUS_04180 6237 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 7289 6240 gene locus_tag LOCUS_04190 7289 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 8360 7635 gene locus_tag LOCUS_04200 8360 7635 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020911.1 protein_id gnl|my_center|LOCUS_04200 9313 8357 gene locus_tag LOCUS_04210 9313 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 12991 9323 gene locus_tag LOCUS_04220 gene cobN 12991 9323 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870959.1 protein_id gnl|my_center|LOCUS_04220 13772 12993 gene locus_tag LOCUS_04230 13772 12993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_04230 14806 13766 gene locus_tag LOCUS_04240 14806 13766 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_04240 15981 14806 gene locus_tag LOCUS_04250 15981 14806 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_04250 16415 15978 gene locus_tag LOCUS_04260 16415 15978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 16708 17355 gene locus_tag LOCUS_04270 16708 17355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 17355 17939 gene locus_tag LOCUS_04280 17355 17939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 18052 19668 gene locus_tag LOCUS_04290 18052 19668 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289232.1 protein_id gnl|my_center|LOCUS_04290 19675 21504 gene locus_tag LOCUS_04300 19675 21504 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_04300 21553 21963 gene locus_tag LOCUS_04310 21553 21963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 21960 23096 gene locus_tag LOCUS_04320 21960 23096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 23175 23738 gene locus_tag LOCUS_04330 23175 23738 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020400.1 protein_id gnl|my_center|LOCUS_04330 24088 23813 gene locus_tag LOCUS_04340 24088 23813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 24366 24545 gene locus_tag LOCUS_04350 24366 24545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 25371 24589 gene locus_tag LOCUS_04360 25371 24589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_04360 26440 25364 gene locus_tag LOCUS_04370 26440 25364 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868388.1 protein_id gnl|my_center|LOCUS_04370 27450 26449 gene locus_tag LOCUS_04380 27450 26449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 27888 28541 gene locus_tag LOCUS_04390 27888 28541 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020282.1 protein_id gnl|my_center|LOCUS_04390 28542 29039 gene locus_tag LOCUS_04400 28542 29039 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020282.1 protein_id gnl|my_center|LOCUS_04400 29118 29843 gene locus_tag LOCUS_04410 29118 29843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 30932 30084 gene locus_tag LOCUS_04420 30932 30084 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964682.1 protein_id gnl|my_center|LOCUS_04420 34981 31238 gene locus_tag LOCUS_04430 gene cobN 34981 31238 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932109.1 protein_id gnl|my_center|LOCUS_04430 36946 35054 gene locus_tag LOCUS_04440 36946 35054 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812409.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence010 90 296 gene locus_tag LOCUS_04450 90 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 715 353 gene locus_tag LOCUS_04460 715 353 CDS product F420H2 dehydrogenase subunit FpoO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021521.1 protein_id gnl|my_center|LOCUS_04460 2171 729 gene locus_tag LOCUS_04470 gene fpoN 2171 729 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_04470 3665 2175 gene locus_tag LOCUS_04480 gene fpoM 3665 2175 CDS product F(420)H(2) dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_04480 5681 3666 gene locus_tag LOCUS_04490 gene fpoL 5681 3666 CDS product F420H2 dehydrogenase subunit FpoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021518.1 protein_id gnl|my_center|LOCUS_04490 5986 5684 gene locus_tag LOCUS_04500 gene fpoK 5986 5684 CDS product F420H2 dehydrogenase subunit FpoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589525.1 protein_id gnl|my_center|LOCUS_04500 6294 5983 gene locus_tag LOCUS_04510 gene fpoJ 6294 5983 CDS product F420H2 dehydrogenase subunit FpoJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140882.1 protein_id gnl|my_center|LOCUS_04510 6562 6275 gene locus_tag LOCUS_04520 6562 6275 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140880.1 protein_id gnl|my_center|LOCUS_04520 6990 6547 gene locus_tag LOCUS_04530 gene fpoI 6990 6547 CDS product F420H2 dehydrogenase subunit FpoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021514.1 protein_id gnl|my_center|LOCUS_04530 8020 6995 gene locus_tag LOCUS_04540 gene fpoH 8020 6995 CDS product F420H2 dehydrogenase subunit FpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065137.1 protein_id gnl|my_center|LOCUS_04540 9150 8026 gene locus_tag LOCUS_04550 gene fpoD 9150 8026 CDS product F420H2 dehydrogenase subunit FpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021512.1 protein_id gnl|my_center|LOCUS_04550 9636 9160 gene locus_tag LOCUS_04560 gene fpoC 9636 9160 CDS product F420H2 dehydrogenase subunit FpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021511.1 protein_id gnl|my_center|LOCUS_04560 10197 9646 gene locus_tag LOCUS_04570 gene fpoB 10197 9646 CDS product F(420)H(2) dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021510.1 protein_id gnl|my_center|LOCUS_04570 10577 10185 gene locus_tag LOCUS_04580 gene fpoA 10577 10185 CDS product F420H2 dehydrogenase subunit FpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021509.1 protein_id gnl|my_center|LOCUS_04580 11450 10947 gene locus_tag LOCUS_04590 11450 10947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 11900 11481 gene locus_tag LOCUS_04600 11900 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 12468 12019 gene locus_tag LOCUS_04610 12468 12019 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903000.1 protein_id gnl|my_center|LOCUS_04610 12828 14126 gene locus_tag LOCUS_04620 12828 14126 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021506.1 protein_id gnl|my_center|LOCUS_04620 14163 15152 gene locus_tag LOCUS_04630 gene cofG 14163 15152 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755891.1 protein_id gnl|my_center|LOCUS_04630 15253 16392 gene locus_tag LOCUS_04640 gene cofH 15253 16392 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021504.1 protein_id gnl|my_center|LOCUS_04640 16373 17449 gene locus_tag LOCUS_04650 gene cofH 16373 17449 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021503.1 protein_id gnl|my_center|LOCUS_04650 17450 18103 gene locus_tag LOCUS_04660 gene cofC 17450 18103 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021502.1 protein_id gnl|my_center|LOCUS_04660 18100 18351 gene locus_tag LOCUS_04670 18100 18351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 18348 19556 gene locus_tag LOCUS_04680 18348 19556 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_04680 21036 19603 gene locus_tag LOCUS_04690 21036 19603 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_04690 22381 21047 gene locus_tag LOCUS_04700 gene trkA 22381 21047 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021494.1 protein_id gnl|my_center|LOCUS_04700 23698 22520 gene locus_tag LOCUS_04710 gene dnaJ 23698 22520 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021493.1 protein_id gnl|my_center|LOCUS_04710 25671 23821 gene locus_tag LOCUS_04720 gene dnaK 25671 23821 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021492.1 protein_id gnl|my_center|LOCUS_04720 26372 25770 gene locus_tag LOCUS_04730 gene grpE 26372 25770 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021491.1 protein_id gnl|my_center|LOCUS_04730 26894 26484 gene locus_tag LOCUS_04740 26894 26484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 27010 27927 gene locus_tag LOCUS_04750 27010 27927 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 protein_id gnl|my_center|LOCUS_04750 27924 28919 gene locus_tag LOCUS_04760 27924 28919 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_04760 28948 29598 gene locus_tag LOCUS_04770 28948 29598 CDS product amino acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021487.1 protein_id gnl|my_center|LOCUS_04770 29857 30126 gene locus_tag LOCUS_04780 29857 30126 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021485.1 protein_id gnl|my_center|LOCUS_04780 30156 30228 gene locus_tag LOCUS_t00030 30156 30228 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 30710 30444 gene locus_tag LOCUS_04790 30710 30444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 30911 31501 gene locus_tag LOCUS_04800 30911 31501 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020793.1 protein_id gnl|my_center|LOCUS_04800 31550 31765 gene locus_tag LOCUS_04810 31550 31765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 33177 31795 gene locus_tag LOCUS_04820 33177 31795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 33453 33199 gene locus_tag LOCUS_04830 33453 33199 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021387.1 protein_id gnl|my_center|LOCUS_04830 33589 34284 gene locus_tag LOCUS_04840 33589 34284 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121737.1 protein_id gnl|my_center|LOCUS_04840 35027 34293 gene locus_tag LOCUS_04850 35027 34293 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_04850 35420 35034 gene locus_tag LOCUS_04860 35420 35034 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065229.1 protein_id gnl|my_center|LOCUS_04860 36924 35422 gene locus_tag LOCUS_04870 36924 35422 CDS product L-aspartate semialdehyde sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021823.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence011 985 257 gene locus_tag LOCUS_04880 gene npdG 985 257 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_04880 1323 1111 gene locus_tag LOCUS_04890 1323 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 1757 1551 gene locus_tag LOCUS_04900 1757 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065120.1 protein_id gnl|my_center|LOCUS_04900 2094 3227 gene locus_tag LOCUS_04910 2094 3227 CDS product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020738.1 protein_id gnl|my_center|LOCUS_04910 3224 4198 gene locus_tag LOCUS_04920 3224 4198 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_04920 4300 4788 gene locus_tag LOCUS_04930 4300 4788 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020740.1 protein_id gnl|my_center|LOCUS_04930 5456 4785 gene locus_tag LOCUS_04940 5456 4785 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_04940 6996 5752 gene locus_tag LOCUS_04950 gene hflX 6996 5752 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755955.1 protein_id gnl|my_center|LOCUS_04950 7414 6953 gene locus_tag LOCUS_04960 7414 6953 CDS product DUF2209 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023531.1 protein_id gnl|my_center|LOCUS_04960 8491 7424 gene locus_tag LOCUS_04970 gene endA 8491 7424 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_04970 10295 8748 gene locus_tag LOCUS_04980 10295 8748 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021977.1 protein_id gnl|my_center|LOCUS_04980 11202 10282 gene locus_tag LOCUS_04990 11202 10282 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021976.1 protein_id gnl|my_center|LOCUS_04990 11938 11249 gene locus_tag LOCUS_05000 gene radC 11938 11249 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_05000 12101 12934 gene locus_tag LOCUS_05010 12101 12934 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065273.1 protein_id gnl|my_center|LOCUS_05010 13375 12959 gene locus_tag LOCUS_05020 13375 12959 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020677.1 protein_id gnl|my_center|LOCUS_05020 13551 13826 gene locus_tag LOCUS_05030 gene groES 13551 13826 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020678.1 protein_id gnl|my_center|LOCUS_05030 13890 15500 gene locus_tag LOCUS_05040 gene groL 13890 15500 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020679.1 protein_id gnl|my_center|LOCUS_05040 15564 16025 gene locus_tag LOCUS_05050 15564 16025 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020192.1 protein_id gnl|my_center|LOCUS_05050 16214 18868 gene locus_tag LOCUS_05060 gene clpB 16214 18868 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_05060 19033 19719 gene locus_tag LOCUS_05070 19033 19719 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064997.1 protein_id gnl|my_center|LOCUS_05070 20126 21316 gene locus_tag LOCUS_05080 20126 21316 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978596.1 protein_id gnl|my_center|LOCUS_05080 21329 21697 gene locus_tag LOCUS_05090 21329 21697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 22519 21815 gene locus_tag LOCUS_05100 22519 21815 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024122.1 protein_id gnl|my_center|LOCUS_05100 22754 22542 gene locus_tag LOCUS_05110 22754 22542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 23364 22963 gene locus_tag LOCUS_05120 gene cfbA 23364 22963 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023539.1 protein_id gnl|my_center|LOCUS_05120 24323 23496 gene locus_tag LOCUS_05130 gene fdhD 24323 23496 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851178.1 protein_id gnl|my_center|LOCUS_05130 25627 24320 gene locus_tag LOCUS_05140 25627 24320 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020367.1 protein_id gnl|my_center|LOCUS_05140 26027 25629 gene locus_tag LOCUS_05150 26027 25629 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024065.1 protein_id gnl|my_center|LOCUS_05150 26838 26029 gene locus_tag LOCUS_05160 26838 26029 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020365.1 protein_id gnl|my_center|LOCUS_05160 28597 26843 gene locus_tag LOCUS_05170 28597 26843 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020364.1 protein_id gnl|my_center|LOCUS_05170 29622 28600 gene locus_tag LOCUS_05180 29622 28600 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024062.1 protein_id gnl|my_center|LOCUS_05180 30078 30968 gene locus_tag LOCUS_05190 30078 30968 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021396.1 protein_id gnl|my_center|LOCUS_05190 30965 31252 gene locus_tag LOCUS_05200 30965 31252 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021395.1 protein_id gnl|my_center|LOCUS_05200 31262 31657 gene locus_tag LOCUS_05210 31262 31657 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021394.1 protein_id gnl|my_center|LOCUS_05210 32548 31685 gene locus_tag LOCUS_05220 32548 31685 CDS product methanogen output domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990584.1 protein_id gnl|my_center|LOCUS_05220 32978 32715 gene locus_tag LOCUS_05230 32978 32715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence012 18 587 gene locus_tag LOCUS_05240 18 587 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024463.1 protein_id gnl|my_center|LOCUS_05240 1925 606 gene locus_tag LOCUS_05250 1925 606 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_05250 2277 2152 gene locus_tag LOCUS_05260 2277 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05260 2616 2278 gene locus_tag LOCUS_05270 2616 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05270 2868 2791 gene locus_tag LOCUS_t00040 2868 2791 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3003 3428 gene locus_tag LOCUS_05280 3003 3428 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066022.1 protein_id gnl|my_center|LOCUS_05280 3450 4208 gene locus_tag LOCUS_05290 3450 4208 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065998.1 protein_id gnl|my_center|LOCUS_05290 5326 4244 gene locus_tag LOCUS_05300 gene dinB 5326 4244 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172312.1 protein_id gnl|my_center|LOCUS_05300 5459 5746 gene locus_tag LOCUS_05310 5459 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065999.1 protein_id gnl|my_center|LOCUS_05310 5946 6140 gene locus_tag LOCUS_05320 5946 6140 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024348.1 protein_id gnl|my_center|LOCUS_05320 6160 7035 gene locus_tag LOCUS_05330 gene dapA 6160 7035 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_05330 7032 7832 gene locus_tag LOCUS_05340 gene dapB 7032 7832 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024350.1 protein_id gnl|my_center|LOCUS_05340 8383 7895 gene locus_tag LOCUS_05350 gene pyrI 8383 7895 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024377.1 protein_id gnl|my_center|LOCUS_05350 9276 8380 gene locus_tag LOCUS_05360 gene pyrB 9276 8380 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024378.1 protein_id gnl|my_center|LOCUS_05360 9827 9372 gene locus_tag LOCUS_05370 9827 9372 CDS product DUF5788 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024379.1 protein_id gnl|my_center|LOCUS_05370 10068 11219 gene locus_tag LOCUS_05380 10068 11219 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860554.1 protein_id gnl|my_center|LOCUS_05380 11221 11988 gene locus_tag LOCUS_05390 11221 11988 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023041.1 protein_id gnl|my_center|LOCUS_05390 12040 12168 gene locus_tag LOCUS_05400 12040 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 14255 12189 gene locus_tag LOCUS_05410 gene recQ 14255 12189 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066602.1 protein_id gnl|my_center|LOCUS_05410 14434 15348 gene locus_tag LOCUS_05420 gene guaA 14434 15348 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024387.1 protein_id gnl|my_center|LOCUS_05420 15349 16389 gene locus_tag LOCUS_05430 15349 16389 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066004.1 protein_id gnl|my_center|LOCUS_05430 17292 16396 gene locus_tag LOCUS_05440 gene argB 17292 16396 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024391.1 protein_id gnl|my_center|LOCUS_05440 17741 17451 gene locus_tag LOCUS_05450 17741 17451 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024392.1 protein_id gnl|my_center|LOCUS_05450 18030 18977 gene locus_tag LOCUS_05460 gene mptA 18030 18977 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 protein_id gnl|my_center|LOCUS_05460 19028 19342 gene locus_tag LOCUS_05470 19028 19342 CDS product DUF2098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496408.1 protein_id gnl|my_center|LOCUS_05470 20316 19375 gene locus_tag LOCUS_05480 20316 19375 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065056.1 protein_id gnl|my_center|LOCUS_05480 20432 21655 gene locus_tag LOCUS_05490 20432 21655 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065055.1 protein_id gnl|my_center|LOCUS_05490 21652 22101 gene locus_tag LOCUS_05500 21652 22101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 22555 22103 gene locus_tag LOCUS_05510 22555 22103 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024219.1 protein_id gnl|my_center|LOCUS_05510 22673 22598 gene locus_tag LOCUS_t00050 22673 22598 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22899 23381 gene locus_tag LOCUS_05520 22899 23381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 24363 23467 gene locus_tag LOCUS_05530 gene hdrB 24363 23467 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024119.1 protein_id gnl|my_center|LOCUS_05530 24865 24377 gene locus_tag LOCUS_05540 gene hdrC 24865 24377 CDS product CoB--CoM heterodisulfide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024118.1 protein_id gnl|my_center|LOCUS_05540 25014 26351 gene locus_tag LOCUS_05550 gene glnA 25014 26351 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024100.1 protein_id gnl|my_center|LOCUS_05550 26537 27589 gene locus_tag LOCUS_05560 26537 27589 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065933.1 protein_id gnl|my_center|LOCUS_05560 27586 29097 gene locus_tag LOCUS_05570 27586 29097 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024102.1 protein_id gnl|my_center|LOCUS_05570 29100 29840 gene locus_tag LOCUS_05580 29100 29840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024103.1 protein_id gnl|my_center|LOCUS_05580 29846 30868 gene locus_tag LOCUS_05590 29846 30868 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024104.1 protein_id gnl|my_center|LOCUS_05590 31558 31052 gene locus_tag LOCUS_05600 31558 31052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 32886 31558 gene locus_tag LOCUS_05610 gene glnA 32886 31558 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence013 1490 1696 gene locus_tag LOCUS_05620 1490 1696 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876887.1 protein_id gnl|my_center|LOCUS_05620 2458 1940 gene locus_tag LOCUS_05630 2458 1940 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 protein_id gnl|my_center|LOCUS_05630 3722 2514 gene locus_tag LOCUS_05640 gene pncB 3722 2514 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022501.1 protein_id gnl|my_center|LOCUS_05640 4127 4285 gene locus_tag LOCUS_05650 4127 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 4319 5065 gene locus_tag LOCUS_05660 4319 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 5153 5989 gene locus_tag LOCUS_05670 5153 5989 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021378.1 protein_id gnl|my_center|LOCUS_05670 6809 6030 gene locus_tag LOCUS_05680 6809 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 7018 7416 gene locus_tag LOCUS_05690 7018 7416 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066143.1 protein_id gnl|my_center|LOCUS_05690 7748 8596 gene locus_tag LOCUS_05700 7748 8596 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172618.1 protein_id gnl|my_center|LOCUS_05700 9961 8780 gene locus_tag LOCUS_05710 9961 8780 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022128.1 protein_id gnl|my_center|LOCUS_05710 13247 10017 gene locus_tag LOCUS_05720 gene carB 13247 10017 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022129.1 protein_id gnl|my_center|LOCUS_05720 14344 13247 gene locus_tag LOCUS_05730 gene carA 14344 13247 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022130.1 protein_id gnl|my_center|LOCUS_05730 15518 14460 gene locus_tag LOCUS_05740 15518 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 17440 15527 gene locus_tag LOCUS_05750 gene gatE 17440 15527 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022814.1 protein_id gnl|my_center|LOCUS_05750 18837 17506 gene locus_tag LOCUS_05760 18837 17506 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022819.1 protein_id gnl|my_center|LOCUS_05760 21187 18827 gene locus_tag LOCUS_05770 gene hdrA2 21187 18827 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022820.1 protein_id gnl|my_center|LOCUS_05770 21652 22203 gene locus_tag LOCUS_05780 21652 22203 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066263.1 protein_id gnl|my_center|LOCUS_05780 22242 23045 gene locus_tag LOCUS_05790 22242 23045 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021773.1 protein_id gnl|my_center|LOCUS_05790 23441 24109 gene locus_tag LOCUS_05800 23441 24109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 24393 26003 gene locus_tag LOCUS_05810 gene hcp 24393 26003 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047923.1 protein_id gnl|my_center|LOCUS_05810 26020 26358 gene locus_tag LOCUS_05820 26020 26358 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_05820 26681 27364 gene locus_tag LOCUS_05830 26681 27364 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870604.1 protein_id gnl|my_center|LOCUS_05830 27462 27971 gene locus_tag LOCUS_05840 27462 27971 CDS product DUF6141 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093726791.1 protein_id gnl|my_center|LOCUS_05840 28120 28299 gene locus_tag LOCUS_05850 28120 28299 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064556.1 protein_id gnl|my_center|LOCUS_05850 28909 28517 gene locus_tag LOCUS_05860 28909 28517 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023127.1 protein_id gnl|my_center|LOCUS_05860 29169 29669 gene locus_tag LOCUS_05870 29169 29669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 30023 31219 gene locus_tag LOCUS_05880 30023 31219 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879245.1 protein_id gnl|my_center|LOCUS_05880 31229 31567 gene locus_tag LOCUS_05890 gene glnK1 31229 31567 CDS product P-II family nitrogen regulator GlnK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869551.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence014 277 480 gene locus_tag LOCUS_05900 277 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 586 888 gene locus_tag LOCUS_05910 586 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065761.1 protein_id gnl|my_center|LOCUS_05910 1116 973 gene locus_tag LOCUS_05920 1116 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 2130 1534 gene locus_tag LOCUS_05930 2130 1534 CDS product sarcinarray family MAST domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065049.1 protein_id gnl|my_center|LOCUS_05930 6158 2142 gene locus_tag LOCUS_05940 6158 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021179.1 protein_id gnl|my_center|LOCUS_05940 6455 7258 gene locus_tag LOCUS_05950 gene pheA 6455 7258 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066451.1 protein_id gnl|my_center|LOCUS_05950 7300 8184 gene locus_tag LOCUS_05960 7300 8184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860288.1 protein_id gnl|my_center|LOCUS_05960 8233 9207 gene locus_tag LOCUS_05970 8233 9207 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023086.1 protein_id gnl|my_center|LOCUS_05970 9223 10101 gene locus_tag LOCUS_05980 9223 10101 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023085.1 protein_id gnl|my_center|LOCUS_05980 10103 11971 gene locus_tag LOCUS_05990 10103 11971 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023084.1 protein_id gnl|my_center|LOCUS_05990 11971 14421 gene locus_tag LOCUS_06000 11971 14421 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023083.1 protein_id gnl|my_center|LOCUS_06000 14691 15314 gene locus_tag LOCUS_06010 14691 15314 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065157.1 protein_id gnl|my_center|LOCUS_06010 15420 16331 gene locus_tag LOCUS_06020 15420 16331 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878482.1 protein_id gnl|my_center|LOCUS_06020 16370 17497 gene locus_tag LOCUS_06030 16370 17497 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878481.1 protein_id gnl|my_center|LOCUS_06030 17516 18172 gene locus_tag LOCUS_06040 17516 18172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878480.1 protein_id gnl|my_center|LOCUS_06040 18154 18771 gene locus_tag LOCUS_06050 18154 18771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878479.1 protein_id gnl|my_center|LOCUS_06050 18958 19335 gene locus_tag LOCUS_06060 18958 19335 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065981.1 protein_id gnl|my_center|LOCUS_06060 19366 19980 gene locus_tag LOCUS_06070 19366 19980 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589510.1 protein_id gnl|my_center|LOCUS_06070 20256 20717 gene locus_tag LOCUS_06080 20256 20717 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918349.1 protein_id gnl|my_center|LOCUS_06080 21855 20758 gene locus_tag LOCUS_06090 21855 20758 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020307.1 protein_id gnl|my_center|LOCUS_06090 22235 22438 gene locus_tag LOCUS_06100 22235 22438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065096.1 protein_id gnl|my_center|LOCUS_06100 25405 22625 gene locus_tag LOCUS_06110 gene acnA 25405 22625 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020308.1 protein_id gnl|my_center|LOCUS_06110 25859 25683 gene locus_tag LOCUS_06120 25859 25683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065717.1 protein_id gnl|my_center|LOCUS_06120 28392 26680 gene locus_tag LOCUS_06130 gene glgP 28392 26680 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584150.1 protein_id gnl|my_center|LOCUS_06130 29434 29258 gene locus_tag LOCUS_06140 29434 29258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 29382 30452 gene locus_tag LOCUS_06150 gene larA 29382 30452 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence015 1695 445 gene locus_tag LOCUS_06160 1695 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 1951 1878 gene locus_tag LOCUS_t00060 1951 1878 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2073 3254 gene locus_tag LOCUS_06170 2073 3254 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024280.1 protein_id gnl|my_center|LOCUS_06170 3286 3960 gene locus_tag LOCUS_06180 3286 3960 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024281.1 protein_id gnl|my_center|LOCUS_06180 4239 4664 gene locus_tag LOCUS_06190 4239 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 4784 6061 gene locus_tag LOCUS_06200 4784 6061 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023956.1 protein_id gnl|my_center|LOCUS_06200 6064 6804 gene locus_tag LOCUS_06210 6064 6804 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023957.1 protein_id gnl|my_center|LOCUS_06210 7672 6845 gene locus_tag LOCUS_06220 7672 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 8586 7795 gene locus_tag LOCUS_06230 8586 7795 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545091.1 protein_id gnl|my_center|LOCUS_06230 9506 8589 gene locus_tag LOCUS_06240 9506 8589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_06240 9606 10013 gene locus_tag LOCUS_06250 9606 10013 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338938.1 protein_id gnl|my_center|LOCUS_06250 10313 10020 gene locus_tag LOCUS_06260 10313 10020 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022869.1 protein_id gnl|my_center|LOCUS_06260 10585 10370 gene locus_tag LOCUS_06270 10585 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 11152 10694 gene locus_tag LOCUS_06280 11152 10694 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065558.1 protein_id gnl|my_center|LOCUS_06280 11481 11405 gene locus_tag LOCUS_t00070 11481 11405 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12269 11499 gene locus_tag LOCUS_06290 gene ribB 12269 11499 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020597.1 protein_id gnl|my_center|LOCUS_06290 12945 12271 gene locus_tag LOCUS_06300 12945 12271 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169713.1 protein_id gnl|my_center|LOCUS_06300 13536 13105 gene locus_tag LOCUS_06310 13536 13105 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_06310 14288 15034 gene locus_tag LOCUS_06320 14288 15034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 15340 16494 gene locus_tag LOCUS_06330 15340 16494 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_06330 16525 17415 gene locus_tag LOCUS_06340 gene map 16525 17415 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 protein_id gnl|my_center|LOCUS_06340 17427 18200 gene locus_tag LOCUS_06350 17427 18200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990719.1 protein_id gnl|my_center|LOCUS_06350 18234 18521 gene locus_tag LOCUS_06360 18234 18521 CDS product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066065.1 protein_id gnl|my_center|LOCUS_06360 18640 19557 gene locus_tag LOCUS_06370 18640 19557 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_06370 20030 19569 gene locus_tag LOCUS_06380 20030 19569 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065868.1 protein_id gnl|my_center|LOCUS_06380 20982 20047 gene locus_tag LOCUS_06390 20982 20047 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023887.1 protein_id gnl|my_center|LOCUS_06390 21580 20966 gene locus_tag LOCUS_06400 21580 20966 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023888.1 protein_id gnl|my_center|LOCUS_06400 22827 21586 gene locus_tag LOCUS_06410 22827 21586 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023889.1 protein_id gnl|my_center|LOCUS_06410 23276 22824 gene locus_tag LOCUS_06420 23276 22824 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066559.1 protein_id gnl|my_center|LOCUS_06420 23717 23286 gene locus_tag LOCUS_06430 23717 23286 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065869.1 protein_id gnl|my_center|LOCUS_06430 25279 23714 gene locus_tag LOCUS_06440 25279 23714 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023892.1 protein_id gnl|my_center|LOCUS_06440 26921 25308 gene locus_tag LOCUS_06450 gene atwA 26921 25308 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023893.1 protein_id gnl|my_center|LOCUS_06450 27986 27162 gene locus_tag LOCUS_06460 27986 27162 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023894.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence016 578 354 gene locus_tag LOCUS_06470 578 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 821 1333 gene locus_tag LOCUS_06480 821 1333 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020492.1 protein_id gnl|my_center|LOCUS_06480 1386 2177 gene locus_tag LOCUS_06490 1386 2177 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_06490 2692 4446 gene locus_tag LOCUS_06500 gene glyS 2692 4446 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020156.1 protein_id gnl|my_center|LOCUS_06500 4534 6810 gene locus_tag LOCUS_06510 4534 6810 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878955.1 protein_id gnl|my_center|LOCUS_06510 7342 6842 gene locus_tag LOCUS_06520 7342 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 7453 7722 gene locus_tag LOCUS_06530 7453 7722 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_06530 7908 8540 gene locus_tag LOCUS_06540 7908 8540 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020150.1 protein_id gnl|my_center|LOCUS_06540 8586 10205 gene locus_tag LOCUS_06550 gene sepS 8586 10205 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020149.1 protein_id gnl|my_center|LOCUS_06550 10202 10888 gene locus_tag LOCUS_06560 10202 10888 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320172.1 protein_id gnl|my_center|LOCUS_06560 11432 11031 gene locus_tag LOCUS_06570 11432 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 12171 11425 gene locus_tag LOCUS_06580 12171 11425 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066594.1 protein_id gnl|my_center|LOCUS_06580 12269 12850 gene locus_tag LOCUS_06590 12269 12850 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024295.1 protein_id gnl|my_center|LOCUS_06590 13078 12866 gene locus_tag LOCUS_06600 13078 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 13948 13124 gene locus_tag LOCUS_06610 13948 13124 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065986.1 protein_id gnl|my_center|LOCUS_06610 14153 14863 gene locus_tag LOCUS_06620 gene serB 14153 14863 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024307.1 protein_id gnl|my_center|LOCUS_06620 14903 15760 gene locus_tag LOCUS_06630 14903 15760 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024306.1 protein_id gnl|my_center|LOCUS_06630 16981 15809 gene locus_tag LOCUS_06640 16981 15809 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024301.1 protein_id gnl|my_center|LOCUS_06640 18153 16978 gene locus_tag LOCUS_06650 18153 16978 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024300.1 protein_id gnl|my_center|LOCUS_06650 19091 18147 gene locus_tag LOCUS_06660 19091 18147 CDS product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065984.1 protein_id gnl|my_center|LOCUS_06660 20602 19145 gene locus_tag LOCUS_06670 gene tgtA 20602 19145 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024298.1 protein_id gnl|my_center|LOCUS_06670 20861 20746 gene locus_tag LOCUS_r00010 20861 20746 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 20961 20890 gene locus_tag LOCUS_t00080 20961 20890 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 23968 21067 gene locus_tag LOCUS_r00020 23968 21067 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 24177 24105 gene locus_tag LOCUS_t00090 24177 24105 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25734 24266 gene locus_tag LOCUS_r00030 25734 24266 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 26308 27819 gene locus_tag LOCUS_06680 26308 27819 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024485.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence017 232 47 gene locus_tag LOCUS_06690 232 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 329 1969 gene locus_tag LOCUS_06700 gene thsB 329 1969 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024292.1 protein_id gnl|my_center|LOCUS_06700 2092 2646 gene locus_tag LOCUS_06710 2092 2646 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_06710 2650 3465 gene locus_tag LOCUS_06720 2650 3465 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024221.1 protein_id gnl|my_center|LOCUS_06720 3450 4277 gene locus_tag LOCUS_06730 3450 4277 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024222.1 protein_id gnl|my_center|LOCUS_06730 4270 5040 gene locus_tag LOCUS_06740 4270 5040 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024223.1 protein_id gnl|my_center|LOCUS_06740 5068 5424 gene locus_tag LOCUS_06750 5068 5424 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118828336.1 protein_id gnl|my_center|LOCUS_06750 5421 6557 gene locus_tag LOCUS_06760 5421 6557 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_06760 7118 6573 gene locus_tag LOCUS_06770 7118 6573 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020341.1 protein_id gnl|my_center|LOCUS_06770 7332 7129 gene locus_tag LOCUS_06780 7332 7129 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066331.1 protein_id gnl|my_center|LOCUS_06780 7740 7354 gene locus_tag LOCUS_06790 7740 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022256.1 protein_id gnl|my_center|LOCUS_06790 8999 7881 gene locus_tag LOCUS_06800 8999 7881 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023799.1 protein_id gnl|my_center|LOCUS_06800 9679 9011 gene locus_tag LOCUS_06810 gene modB 9679 9011 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021257.1 protein_id gnl|my_center|LOCUS_06810 10000 9755 gene locus_tag LOCUS_06820 10000 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 10560 9931 gene locus_tag LOCUS_06830 10560 9931 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927097.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06830 11444 10620 gene locus_tag LOCUS_06840 gene modA 11444 10620 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022259.1 protein_id gnl|my_center|LOCUS_06840 11963 13249 gene locus_tag LOCUS_06850 gene eno 11963 13249 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317534.1 protein_id gnl|my_center|LOCUS_06850 13299 14033 gene locus_tag LOCUS_06860 13299 14033 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975024.1 protein_id gnl|my_center|LOCUS_06860 13997 14179 gene locus_tag LOCUS_06870 13997 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 16090 14222 gene locus_tag LOCUS_06880 16090 14222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 16579 16238 gene locus_tag LOCUS_06890 16579 16238 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023831.1 protein_id gnl|my_center|LOCUS_06890 16974 16576 gene locus_tag LOCUS_06900 gene crcB 16974 16576 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023830.1 protein_id gnl|my_center|LOCUS_06900 17548 18318 gene locus_tag LOCUS_06910 17548 18318 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024199.1 protein_id gnl|my_center|LOCUS_06910 19206 18331 gene locus_tag LOCUS_06920 19206 18331 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024160.1 protein_id gnl|my_center|LOCUS_06920 19776 19456 gene locus_tag LOCUS_06930 gene rpl12p 19776 19456 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024158.1 protein_id gnl|my_center|LOCUS_06930 20875 19838 gene locus_tag LOCUS_06940 20875 19838 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024157.1 protein_id gnl|my_center|LOCUS_06940 21518 20877 gene locus_tag LOCUS_06950 21518 20877 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024156.1 protein_id gnl|my_center|LOCUS_06950 22153 21671 gene locus_tag LOCUS_06960 22153 21671 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024155.1 protein_id gnl|my_center|LOCUS_06960 22661 22200 gene locus_tag LOCUS_06970 22661 22200 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065945.1 protein_id gnl|my_center|LOCUS_06970 22883 22665 gene locus_tag LOCUS_06980 22883 22665 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024153.1 protein_id gnl|my_center|LOCUS_06980 24161 23058 gene locus_tag LOCUS_06990 gene ftsZ 24161 23058 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_06990 25618 24194 gene locus_tag LOCUS_07000 25618 24194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 26439 25615 gene locus_tag LOCUS_07010 26439 25615 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021656.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence018 221 1018 gene locus_tag LOCUS_07020 221 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 1305 1233 gene locus_tag LOCUS_t00100 1305 1233 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1443 1664 gene locus_tag LOCUS_07030 1443 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 2113 1802 gene locus_tag LOCUS_07040 gene rpsJ 2113 1802 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 protein_id gnl|my_center|LOCUS_07040 3415 2147 gene locus_tag LOCUS_07050 gene tuf 3415 2147 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 protein_id gnl|my_center|LOCUS_07050 5726 3534 gene locus_tag LOCUS_07060 5726 3534 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021278.1 protein_id gnl|my_center|LOCUS_07060 6327 5767 gene locus_tag LOCUS_07070 6327 5767 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 protein_id gnl|my_center|LOCUS_07070 6762 6334 gene locus_tag LOCUS_07080 6762 6334 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021280.1 protein_id gnl|my_center|LOCUS_07080 7243 6818 gene locus_tag LOCUS_07090 7243 6818 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021281.1 protein_id gnl|my_center|LOCUS_07090 7546 7259 gene locus_tag LOCUS_07100 7546 7259 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065070.1 protein_id gnl|my_center|LOCUS_07100 8792 7650 gene locus_tag LOCUS_07110 gene rpoA2 8792 7650 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066196.1 protein_id gnl|my_center|LOCUS_07110 11440 8795 gene locus_tag LOCUS_07120 11440 8795 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021284.1 protein_id gnl|my_center|LOCUS_07120 13267 11453 gene locus_tag LOCUS_07130 gene rpoB 13267 11453 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021285.1 protein_id gnl|my_center|LOCUS_07130 14879 13260 gene locus_tag LOCUS_07140 14879 13260 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_07140 15239 15003 gene locus_tag LOCUS_07150 15239 15003 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021287.1 protein_id gnl|my_center|LOCUS_07150 15395 15319 gene locus_tag LOCUS_t00110 15395 15319 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16853 15618 gene locus_tag LOCUS_07160 16853 15618 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021296.1 protein_id gnl|my_center|LOCUS_07160 18187 16886 gene locus_tag LOCUS_07170 18187 16886 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_07170 18834 18193 gene locus_tag LOCUS_07180 18834 18193 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021298.1 protein_id gnl|my_center|LOCUS_07180 19595 18825 gene locus_tag LOCUS_07190 19595 18825 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021299.1 protein_id gnl|my_center|LOCUS_07190 20574 19693 gene locus_tag LOCUS_07200 20574 19693 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 protein_id gnl|my_center|LOCUS_07200 21802 20579 gene locus_tag LOCUS_07210 gene coaBC 21802 20579 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065075.1 protein_id gnl|my_center|LOCUS_07210 23383 21887 gene locus_tag LOCUS_07220 23383 21887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 23586 23795 gene locus_tag LOCUS_07230 23586 23795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 24281 23799 gene locus_tag LOCUS_07240 24281 23799 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_07240 24500 26059 gene locus_tag LOCUS_07250 24500 26059 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence019 1474 350 gene locus_tag LOCUS_07260 1474 350 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256222.1 protein_id gnl|my_center|LOCUS_07260 2550 1471 gene locus_tag LOCUS_07270 2550 1471 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_07270 3743 2547 gene locus_tag LOCUS_07280 3743 2547 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_07280 5055 3871 gene locus_tag LOCUS_07290 5055 3871 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_07290 6114 5482 gene locus_tag LOCUS_07300 6114 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 6935 6111 gene locus_tag LOCUS_07310 6935 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 8886 7441 gene locus_tag LOCUS_07320 gene cobD 8886 7441 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020980.1 protein_id gnl|my_center|LOCUS_07320 13565 10131 gene locus_tag LOCUS_07330 13565 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 14982 15176 gene locus_tag LOCUS_07340 14982 15176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 16541 15261 gene locus_tag LOCUS_07350 16541 15261 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022026.1 protein_id gnl|my_center|LOCUS_07350 18742 16538 gene locus_tag LOCUS_07360 18742 16538 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200796636.1 protein_id gnl|my_center|LOCUS_07360 19211 18774 gene locus_tag LOCUS_07370 19211 18774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 19449 19186 gene locus_tag LOCUS_07380 19449 19186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 20261 19695 gene locus_tag LOCUS_07390 20261 19695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 21340 20345 gene locus_tag LOCUS_07400 21340 20345 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932107.1 protein_id gnl|my_center|LOCUS_07400 22654 21455 gene locus_tag LOCUS_07410 22654 21455 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_07410 23420 22977 gene locus_tag LOCUS_07420 23420 22977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 24539 23517 gene locus_tag LOCUS_07430 24539 23517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 <25941 24744 gene locus_tag LOCUS_07440 <25941 24744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545223.1:restriction endonuclease subunit M >Feature sequence020 555 1565 gene locus_tag LOCUS_07450 555 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990594.1 protein_id gnl|my_center|LOCUS_07450 1562 2512 gene locus_tag LOCUS_07460 1562 2512 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990819.1 protein_id gnl|my_center|LOCUS_07460 2865 3011 gene locus_tag LOCUS_07470 2865 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3024 3761 gene locus_tag LOCUS_07480 3024 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3783 5114 gene locus_tag LOCUS_07490 3783 5114 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021144.1 protein_id gnl|my_center|LOCUS_07490 5121 6359 gene locus_tag LOCUS_07500 5121 6359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023110.1 protein_id gnl|my_center|LOCUS_07500 6409 7371 gene locus_tag LOCUS_07510 6409 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 7713 8024 gene locus_tag LOCUS_07520 7713 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 8179 8568 gene locus_tag LOCUS_07530 8179 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 8565 8813 gene locus_tag LOCUS_07540 8565 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 8826 9179 gene locus_tag LOCUS_07550 8826 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 9176 9751 gene locus_tag LOCUS_07560 9176 9751 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065212.1 protein_id gnl|my_center|LOCUS_07560 10665 9871 gene locus_tag LOCUS_07570 10665 9871 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948613.1 protein_id gnl|my_center|LOCUS_07570 11439 11101 gene locus_tag LOCUS_07580 11439 11101 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024093.1 protein_id gnl|my_center|LOCUS_07580 12854 11445 gene locus_tag LOCUS_07590 12854 11445 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024092.1 protein_id gnl|my_center|LOCUS_07590 13133 14101 gene locus_tag LOCUS_07600 13133 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 15087 14107 gene locus_tag LOCUS_07610 15087 14107 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065980.1 protein_id gnl|my_center|LOCUS_07610 15381 15656 gene locus_tag LOCUS_07620 15381 15656 CDS product DUF3303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065897.1 protein_id gnl|my_center|LOCUS_07620 16317 15712 gene locus_tag LOCUS_07630 16317 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 16726 16364 gene locus_tag LOCUS_07640 16726 16364 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065462.1 protein_id gnl|my_center|LOCUS_07640 18615 16891 gene locus_tag LOCUS_07650 18615 16891 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065860.1 protein_id gnl|my_center|LOCUS_07650 19421 18678 gene locus_tag LOCUS_07660 19421 18678 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 protein_id gnl|my_center|LOCUS_07660 19567 19421 gene locus_tag LOCUS_07670 19567 19421 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065861.1 protein_id gnl|my_center|LOCUS_07670 21092 19659 gene locus_tag LOCUS_07680 gene gatB 21092 19659 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024400.1 protein_id gnl|my_center|LOCUS_07680 22519 21092 gene locus_tag LOCUS_07690 gene gatA 22519 21092 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066007.1 protein_id gnl|my_center|LOCUS_07690 22810 22529 gene locus_tag LOCUS_07700 gene gatC 22810 22529 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024398.1 protein_id gnl|my_center|LOCUS_07700 22969 23661 gene locus_tag LOCUS_07710 22969 23661 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065091.1 protein_id gnl|my_center|LOCUS_07710 24808 23651 gene locus_tag LOCUS_07720 24808 23651 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066363.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence021 241 537 gene locus_tag LOCUS_07730 241 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 1523 540 gene locus_tag LOCUS_07740 1523 540 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022381.1 protein_id gnl|my_center|LOCUS_07740 2442 3956 gene locus_tag LOCUS_07750 2442 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 4202 6049 gene locus_tag LOCUS_07760 4202 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 8064 6052 gene locus_tag LOCUS_07770 8064 6052 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_07770 10021 8051 gene locus_tag LOCUS_07780 10021 8051 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065886.1 protein_id gnl|my_center|LOCUS_07780 10827 10018 gene locus_tag LOCUS_07790 10827 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065887.1 protein_id gnl|my_center|LOCUS_07790 12068 10863 gene locus_tag LOCUS_07800 12068 10863 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_07800 13195 12071 gene locus_tag LOCUS_07810 13195 12071 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990904.1 protein_id gnl|my_center|LOCUS_07810 13348 15174 gene locus_tag LOCUS_07820 13348 15174 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023586.1 protein_id gnl|my_center|LOCUS_07820 15216 16196 gene locus_tag LOCUS_07830 15216 16196 CDS product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023587.1 protein_id gnl|my_center|LOCUS_07830 16221 17387 gene locus_tag LOCUS_07840 16221 17387 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065771.1 protein_id gnl|my_center|LOCUS_07840 17565 17419 gene locus_tag LOCUS_07850 17565 17419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 18314 17574 gene locus_tag LOCUS_07860 18314 17574 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022780.1 protein_id gnl|my_center|LOCUS_07860 18461 19204 gene locus_tag LOCUS_07870 18461 19204 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868075.1 protein_id gnl|my_center|LOCUS_07870 19220 19720 gene locus_tag LOCUS_07880 19220 19720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 19873 22200 gene locus_tag LOCUS_07890 19873 22200 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023330.1 protein_id gnl|my_center|LOCUS_07890 22383 23957 gene locus_tag LOCUS_07900 22383 23957 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022533.1 protein_id gnl|my_center|LOCUS_07900 23959 25227 gene locus_tag LOCUS_07910 23959 25227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence022 218 517 gene locus_tag LOCUS_07920 gene hisE 218 517 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021409.1 protein_id gnl|my_center|LOCUS_07920 1430 555 gene locus_tag LOCUS_07930 1430 555 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021408.1 protein_id gnl|my_center|LOCUS_07930 1583 2554 gene locus_tag LOCUS_07940 1583 2554 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 protein_id gnl|my_center|LOCUS_07940 3684 2569 gene locus_tag LOCUS_07950 3684 2569 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 protein_id gnl|my_center|LOCUS_07950 4311 3697 gene locus_tag LOCUS_07960 gene hxlB 4311 3697 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065105.1 protein_id gnl|my_center|LOCUS_07960 4838 4347 gene locus_tag LOCUS_07970 4838 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065104.1 protein_id gnl|my_center|LOCUS_07970 5232 4870 gene locus_tag LOCUS_07980 5232 4870 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021399.1 protein_id gnl|my_center|LOCUS_07980 5873 5238 gene locus_tag LOCUS_07990 5873 5238 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021398.1 protein_id gnl|my_center|LOCUS_07990 6899 5973 gene locus_tag LOCUS_08000 6899 5973 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021397.1 protein_id gnl|my_center|LOCUS_08000 7653 8315 gene locus_tag LOCUS_08010 7653 8315 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064852.1 protein_id gnl|my_center|LOCUS_08010 8324 8671 gene locus_tag LOCUS_08020 8324 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 8916 8668 gene locus_tag LOCUS_08030 8916 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 9051 8965 gene locus_tag LOCUS_t00120 9051 8965 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9557 9796 gene locus_tag LOCUS_08040 9557 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 11178 9805 gene locus_tag LOCUS_08050 11178 9805 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004068250.1 protein_id gnl|my_center|LOCUS_08050 11330 12460 gene locus_tag LOCUS_08060 11330 12460 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_08060 12465 13625 gene locus_tag LOCUS_08070 12465 13625 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021210.1 protein_id gnl|my_center|LOCUS_08070 13622 14698 gene locus_tag LOCUS_08080 13622 14698 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021199.1 protein_id gnl|my_center|LOCUS_08080 16080 17069 gene locus_tag LOCUS_08090 16080 17069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 18081 17302 gene locus_tag LOCUS_08100 18081 17302 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_08100 18527 19678 gene locus_tag LOCUS_08110 18527 19678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 19822 20388 gene locus_tag LOCUS_08120 19822 20388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 20735 23446 gene locus_tag LOCUS_08130 20735 23446 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064990.1 protein_id gnl|my_center|LOCUS_08130 24118 23447 gene locus_tag LOCUS_08140 gene phoU 24118 23447 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020935.1 protein_id gnl|my_center|LOCUS_08140 24707 24111 gene locus_tag LOCUS_08150 gene pstB 24707 24111 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence023 1171 1338 gene locus_tag LOCUS_08160 1171 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1610 1693 gene locus_tag LOCUS_t00130 1610 1693 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1982 2830 gene locus_tag LOCUS_08170 1982 2830 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065423.1 protein_id gnl|my_center|LOCUS_08170 2817 3395 gene locus_tag LOCUS_08180 2817 3395 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022469.1 protein_id gnl|my_center|LOCUS_08180 4374 3388 gene locus_tag LOCUS_08190 4374 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08190 5300 4377 gene locus_tag LOCUS_08200 5300 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08200 7197 5293 gene locus_tag LOCUS_08210 7197 5293 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878496.1 protein_id gnl|my_center|LOCUS_08210 8018 7209 gene locus_tag LOCUS_08220 gene minD 8018 7209 CDS product cell division ATPase MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867687.1 protein_id gnl|my_center|LOCUS_08220 8172 8681 gene locus_tag LOCUS_08230 8172 8681 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_08230 8710 9165 gene locus_tag LOCUS_08240 8710 9165 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_08240 9982 9209 gene locus_tag LOCUS_08250 gene xth 9982 9209 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_08250 10329 10688 gene locus_tag LOCUS_08260 10329 10688 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021041.1 protein_id gnl|my_center|LOCUS_08260 10681 11355 gene locus_tag LOCUS_08270 10681 11355 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_08270 11394 11891 gene locus_tag LOCUS_08280 11394 11891 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_08280 12043 13482 gene locus_tag LOCUS_08290 12043 13482 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_08290 13965 17111 gene locus_tag LOCUS_08300 13965 17111 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022778.1 protein_id gnl|my_center|LOCUS_08300 17232 18584 gene locus_tag LOCUS_08310 gene purB 17232 18584 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066555.1 protein_id gnl|my_center|LOCUS_08310 19906 18611 gene locus_tag LOCUS_08320 19906 18611 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_08320 20263 22494 gene locus_tag LOCUS_08330 20263 22494 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024448.1 protein_id gnl|my_center|LOCUS_08330 22548 23258 gene locus_tag LOCUS_08340 22548 23258 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_08340 23571 23329 gene locus_tag LOCUS_08350 23571 23329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 23651 24013 gene locus_tag LOCUS_08360 23651 24013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 <24586 24064 gene locus_tag LOCUS_08370 <24586 24064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932922.1:alpha/beta hydrolase >Feature sequence024 314 2038 gene locus_tag LOCUS_08380 314 2038 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_08380 2038 2895 gene locus_tag LOCUS_08390 2038 2895 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023015.1 protein_id gnl|my_center|LOCUS_08390 3536 2943 gene locus_tag LOCUS_08400 3536 2943 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021454.1 protein_id gnl|my_center|LOCUS_08400 4348 3536 gene locus_tag LOCUS_08410 gene rsmA 4348 3536 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_08410 4960 4364 gene locus_tag LOCUS_08420 4960 4364 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065124.1 protein_id gnl|my_center|LOCUS_08420 5404 5051 gene locus_tag LOCUS_08430 5404 5051 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 protein_id gnl|my_center|LOCUS_08430 5837 5550 gene locus_tag LOCUS_08440 5837 5550 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021460.1 protein_id gnl|my_center|LOCUS_08440 7173 5881 gene locus_tag LOCUS_08450 7173 5881 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_08450 7842 7237 gene locus_tag LOCUS_08460 gene trmY 7842 7237 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_08460 9282 7930 gene locus_tag LOCUS_08470 gene thiD 9282 7930 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023132.1 protein_id gnl|my_center|LOCUS_08470 9559 9774 gene locus_tag LOCUS_08480 9559 9774 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023130.1 protein_id gnl|my_center|LOCUS_08480 10076 11491 gene locus_tag LOCUS_08490 gene purF 10076 11491 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_08490 11682 11611 gene locus_tag LOCUS_t00140 11682 11611 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12590 11811 gene locus_tag LOCUS_08500 12590 11811 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022803.1 protein_id gnl|my_center|LOCUS_08500 13442 13526 gene locus_tag LOCUS_t00150 13442 13526 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13744 14028 gene locus_tag LOCUS_08510 13744 14028 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_08510 14859 17432 gene locus_tag LOCUS_08520 14859 17432 CDS product disaggregatase related repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860211.1 protein_id gnl|my_center|LOCUS_08520 17720 18289 gene locus_tag LOCUS_08530 17720 18289 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990665.1 protein_id gnl|my_center|LOCUS_08530 19528 18395 gene locus_tag LOCUS_08540 19528 18395 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021066.1 protein_id gnl|my_center|LOCUS_08540 20402 19662 gene locus_tag LOCUS_08550 gene fabG 20402 19662 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_08550 21383 20415 gene locus_tag LOCUS_08560 gene nadE 21383 20415 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065780.1 protein_id gnl|my_center|LOCUS_08560 22484 21468 gene locus_tag LOCUS_08570 22484 21468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023621.1 protein_id gnl|my_center|LOCUS_08570 23943 22450 gene locus_tag LOCUS_08580 23943 22450 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065781.1 protein_id gnl|my_center|LOCUS_08580 24193 23948 gene locus_tag LOCUS_08590 24193 23948 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021062.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence025 117 2717 gene locus_tag LOCUS_08600 117 2717 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022991.1 protein_id gnl|my_center|LOCUS_08600 2807 3292 gene locus_tag LOCUS_08610 2807 3292 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023779.1 protein_id gnl|my_center|LOCUS_08610 3421 3801 gene locus_tag LOCUS_08620 gene sepF 3421 3801 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023780.1 protein_id gnl|my_center|LOCUS_08620 3798 4433 gene locus_tag LOCUS_08630 3798 4433 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023781.1 protein_id gnl|my_center|LOCUS_08630 4474 5229 gene locus_tag LOCUS_08640 4474 5229 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_08640 5293 5475 gene locus_tag LOCUS_08650 5293 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 5610 7046 gene locus_tag LOCUS_08660 gene proS 5610 7046 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023782.1 protein_id gnl|my_center|LOCUS_08660 7097 8161 gene locus_tag LOCUS_08670 7097 8161 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023783.1 protein_id gnl|my_center|LOCUS_08670 8365 8180 gene locus_tag LOCUS_08680 8365 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 9211 10224 gene locus_tag LOCUS_08690 9211 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 10392 10982 gene locus_tag LOCUS_08700 10392 10982 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021787.1 protein_id gnl|my_center|LOCUS_08700 10979 11434 gene locus_tag LOCUS_08710 10979 11434 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755897.1 protein_id gnl|my_center|LOCUS_08710 11427 12155 gene locus_tag LOCUS_08720 11427 12155 CDS product RNase P subunit p30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289302.1 protein_id gnl|my_center|LOCUS_08720 12152 12517 gene locus_tag LOCUS_08730 12152 12517 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021784.1 protein_id gnl|my_center|LOCUS_08730 12579 13364 gene locus_tag LOCUS_08740 gene psmA 12579 13364 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_08740 13423 14115 gene locus_tag LOCUS_08750 13423 14115 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021781.1 protein_id gnl|my_center|LOCUS_08750 14127 14942 gene locus_tag LOCUS_08760 gene rrp4 14127 14942 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_08760 14932 16008 gene locus_tag LOCUS_08770 14932 16008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 16005 16787 gene locus_tag LOCUS_08780 gene rrp42 16005 16787 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021779.1 protein_id gnl|my_center|LOCUS_08780 16846 17136 gene locus_tag LOCUS_08790 16846 17136 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021778.1 protein_id gnl|my_center|LOCUS_08790 17392 17742 gene locus_tag LOCUS_08800 17392 17742 CDS product rRNA maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021745.1 protein_id gnl|my_center|LOCUS_08800 17752 18006 gene locus_tag LOCUS_08810 17752 18006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 18055 18408 gene locus_tag LOCUS_08820 18055 18408 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023749.1 protein_id gnl|my_center|LOCUS_08820 18471 19448 gene locus_tag LOCUS_08830 18471 19448 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023750.1 protein_id gnl|my_center|LOCUS_08830 19478 20782 gene locus_tag LOCUS_08840 19478 20782 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_08840 20828 21265 gene locus_tag LOCUS_08850 20828 21265 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023752.1 protein_id gnl|my_center|LOCUS_08850 21347 21703 gene locus_tag LOCUS_08860 21347 21703 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065829.1 protein_id gnl|my_center|LOCUS_08860 21725 22711 gene locus_tag LOCUS_08870 21725 22711 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023754.1 protein_id gnl|my_center|LOCUS_08870 22902 24506 gene locus_tag LOCUS_08880 22902 24506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence026 2267 852 gene locus_tag LOCUS_08890 2267 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2375 2839 gene locus_tag LOCUS_08900 2375 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2841 3461 gene locus_tag LOCUS_08910 2841 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064284.1 protein_id gnl|my_center|LOCUS_08910 3478 4344 gene locus_tag LOCUS_08920 3478 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 4341 4811 gene locus_tag LOCUS_08930 4341 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4813 5601 gene locus_tag LOCUS_08940 4813 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 5613 7073 gene locus_tag LOCUS_08950 5613 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 7493 8059 gene locus_tag LOCUS_08960 7493 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 8166 10289 gene locus_tag LOCUS_08970 8166 10289 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066079.1 protein_id gnl|my_center|LOCUS_08970 10373 10792 gene locus_tag LOCUS_08980 10373 10792 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020395.1 protein_id gnl|my_center|LOCUS_08980 10881 11576 gene locus_tag LOCUS_08990 10881 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 11659 12627 gene locus_tag LOCUS_09000 11659 12627 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064863.1 protein_id gnl|my_center|LOCUS_09000 12629 13657 gene locus_tag LOCUS_09010 12629 13657 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020398.1 protein_id gnl|my_center|LOCUS_09010 13723 14442 gene locus_tag LOCUS_09020 13723 14442 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020399.1 protein_id gnl|my_center|LOCUS_09020 14976 16490 gene locus_tag LOCUS_09030 14976 16490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 17109 16531 gene locus_tag LOCUS_09040 17109 16531 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876572.1 protein_id gnl|my_center|LOCUS_09040 17971 17162 gene locus_tag LOCUS_09050 gene truA 17971 17162 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020266.1 protein_id gnl|my_center|LOCUS_09050 18914 17988 gene locus_tag LOCUS_09060 18914 17988 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020265.1 protein_id gnl|my_center|LOCUS_09060 19046 20113 gene locus_tag LOCUS_09070 19046 20113 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 protein_id gnl|my_center|LOCUS_09070 20157 21557 gene locus_tag LOCUS_09080 20157 21557 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066384.1 protein_id gnl|my_center|LOCUS_09080 21674 22963 gene locus_tag LOCUS_09090 21674 22963 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_09090 23158 23640 gene locus_tag LOCUS_09100 23158 23640 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020260.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence027 739 95 gene locus_tag LOCUS_09110 739 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 957 1133 gene locus_tag LOCUS_09120 957 1133 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024079.1 protein_id gnl|my_center|LOCUS_09120 1435 1554 gene locus_tag LOCUS_09130 1435 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1848 2264 gene locus_tag LOCUS_09140 1848 2264 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021864.1 protein_id gnl|my_center|LOCUS_09140 2336 4726 gene locus_tag LOCUS_09150 gene lon 2336 4726 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021863.1 protein_id gnl|my_center|LOCUS_09150 5896 5234 gene locus_tag LOCUS_09160 5896 5234 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020542.1 protein_id gnl|my_center|LOCUS_09160 6213 7307 gene locus_tag LOCUS_09170 6213 7307 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021442.1 protein_id gnl|my_center|LOCUS_09170 7981 7289 gene locus_tag LOCUS_09180 7981 7289 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065832.1 protein_id gnl|my_center|LOCUS_09180 8801 8019 gene locus_tag LOCUS_09190 8801 8019 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065281.1 protein_id gnl|my_center|LOCUS_09190 8800 8958 gene locus_tag LOCUS_09200 8800 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 9039 9704 gene locus_tag LOCUS_09210 9039 9704 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021999.1 protein_id gnl|my_center|LOCUS_09210 10072 10302 gene locus_tag LOCUS_09220 10072 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 12007 10358 gene locus_tag LOCUS_09230 gene thsA 12007 10358 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021686.1 protein_id gnl|my_center|LOCUS_09230 12165 12965 gene locus_tag LOCUS_09240 gene dph5 12165 12965 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_09240 13084 14778 gene locus_tag LOCUS_09250 13084 14778 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_09250 14790 15071 gene locus_tag LOCUS_09260 14790 15071 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066211.1 protein_id gnl|my_center|LOCUS_09260 15113 15454 gene locus_tag LOCUS_09270 15113 15454 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021390.1 protein_id gnl|my_center|LOCUS_09270 15469 16362 gene locus_tag LOCUS_09280 15469 16362 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021391.1 protein_id gnl|my_center|LOCUS_09280 16625 16482 gene locus_tag LOCUS_09290 16625 16482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 17204 16824 gene locus_tag LOCUS_09300 17204 16824 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869593.1 protein_id gnl|my_center|LOCUS_09300 17785 20940 gene locus_tag LOCUS_09310 17785 20940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 22360 21188 gene locus_tag LOCUS_09320 22360 21188 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020503.1 protein_id gnl|my_center|LOCUS_09320 23504 22515 gene locus_tag LOCUS_09330 23504 22515 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860082.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence028 1714 545 gene locus_tag LOCUS_09340 1714 545 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064950.1 protein_id gnl|my_center|LOCUS_09340 2556 1939 gene locus_tag LOCUS_09350 2556 1939 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020735.1 protein_id gnl|my_center|LOCUS_09350 3187 2549 gene locus_tag LOCUS_09360 3187 2549 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020734.1 protein_id gnl|my_center|LOCUS_09360 4492 3245 gene locus_tag LOCUS_09370 4492 3245 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_09370 5285 4494 gene locus_tag LOCUS_09380 5285 4494 CDS product disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064949.1 protein_id gnl|my_center|LOCUS_09380 6156 5497 gene locus_tag LOCUS_09390 6156 5497 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066452.1 protein_id gnl|my_center|LOCUS_09390 6748 6470 gene locus_tag LOCUS_09400 6748 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060862.1 protein_id gnl|my_center|LOCUS_09400 7329 6928 gene locus_tag LOCUS_09410 7329 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 9159 7645 gene locus_tag LOCUS_09420 9159 7645 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_09420 10362 9241 gene locus_tag LOCUS_09430 10362 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 12420 10486 gene locus_tag LOCUS_09440 12420 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 12728 12495 gene locus_tag LOCUS_09450 12728 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 12762 14354 gene locus_tag LOCUS_09460 12762 14354 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080443.1 protein_id gnl|my_center|LOCUS_09460 14695 15411 gene locus_tag LOCUS_09470 14695 15411 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022371.1 protein_id gnl|my_center|LOCUS_09470 15841 15461 gene locus_tag LOCUS_09480 15841 15461 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021003.1 protein_id gnl|my_center|LOCUS_09480 16041 17735 gene locus_tag LOCUS_09490 16041 17735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 19908 17887 gene locus_tag LOCUS_09500 gene mprF 19908 17887 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022655.1 protein_id gnl|my_center|LOCUS_09500 20609 21637 gene locus_tag LOCUS_09510 gene mtaA 20609 21637 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020823.1 protein_id gnl|my_center|LOCUS_09510 22227 23006 gene locus_tag LOCUS_09520 22227 23006 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021200.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence029 <1 932 gene locus_tag LOCUS_09530 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860057.1:alpha/beta hydrolase 1099 968 gene locus_tag LOCUS_09540 1099 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1259 1972 gene locus_tag LOCUS_09550 1259 1972 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021381.1 protein_id gnl|my_center|LOCUS_09550 1975 3165 gene locus_tag LOCUS_09560 1975 3165 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_09560 3682 3194 gene locus_tag LOCUS_09570 3682 3194 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021413.1 protein_id gnl|my_center|LOCUS_09570 3934 5289 gene locus_tag LOCUS_09580 3934 5289 CDS product isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024145.1 protein_id gnl|my_center|LOCUS_09580 6441 5413 gene locus_tag LOCUS_09590 6441 5413 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024146.1 protein_id gnl|my_center|LOCUS_09590 6536 7378 gene locus_tag LOCUS_09600 6536 7378 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024147.1 protein_id gnl|my_center|LOCUS_09600 8706 7387 gene locus_tag LOCUS_09610 8706 7387 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004069588.1 protein_id gnl|my_center|LOCUS_09610 9230 11551 gene locus_tag LOCUS_09620 9230 11551 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021792.1 protein_id gnl|my_center|LOCUS_09620 12276 11752 gene locus_tag LOCUS_09630 12276 11752 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023689.1 protein_id gnl|my_center|LOCUS_09630 13363 12353 gene locus_tag LOCUS_09640 gene ilvC 13363 12353 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023690.1 protein_id gnl|my_center|LOCUS_09640 13870 13385 gene locus_tag LOCUS_09650 gene ilvN 13870 13385 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_09650 15558 13867 gene locus_tag LOCUS_09660 15558 13867 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_09660 17107 15608 gene locus_tag LOCUS_09670 17107 15608 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 protein_id gnl|my_center|LOCUS_09670 18321 17266 gene locus_tag LOCUS_09680 18321 17266 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_09680 18639 19679 gene locus_tag LOCUS_09690 18639 19679 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_09690 19698 20687 gene locus_tag LOCUS_09700 19698 20687 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065409.1 protein_id gnl|my_center|LOCUS_09700 20736 21866 gene locus_tag LOCUS_09710 20736 21866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence030 270 533 gene locus_tag LOCUS_09720 270 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 530 1600 gene locus_tag LOCUS_09730 530 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1590 2870 gene locus_tag LOCUS_09740 1590 2870 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257684.1 protein_id gnl|my_center|LOCUS_09740 2870 3832 gene locus_tag LOCUS_09750 2870 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3972 4163 gene locus_tag LOCUS_09760 3972 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 4348 4563 gene locus_tag LOCUS_09770 4348 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 4740 7976 gene locus_tag LOCUS_09780 4740 7976 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_09780 9454 7973 gene locus_tag LOCUS_09790 gene cfbB 9454 7973 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_09790 10254 9460 gene locus_tag LOCUS_09800 gene cfbC 10254 9460 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023535.1 protein_id gnl|my_center|LOCUS_09800 11390 10272 gene locus_tag LOCUS_09810 gene cfbD 11390 10272 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023536.1 protein_id gnl|my_center|LOCUS_09810 12950 11541 gene locus_tag LOCUS_09820 gene cfbE 12950 11541 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023538.1 protein_id gnl|my_center|LOCUS_09820 13692 13069 gene locus_tag LOCUS_09830 13692 13069 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023591.1 protein_id gnl|my_center|LOCUS_09830 14234 13785 gene locus_tag LOCUS_09840 14234 13785 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_09840 15332 14265 gene locus_tag LOCUS_09850 15332 14265 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_09850 15506 16357 gene locus_tag LOCUS_09860 15506 16357 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066525.1 protein_id gnl|my_center|LOCUS_09860 16363 16977 gene locus_tag LOCUS_09870 16363 16977 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066526.1 protein_id gnl|my_center|LOCUS_09870 17054 18211 gene locus_tag LOCUS_09880 17054 18211 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023596.1 protein_id gnl|my_center|LOCUS_09880 18597 19823 gene locus_tag LOCUS_09890 18597 19823 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066527.1 protein_id gnl|my_center|LOCUS_09890 19820 20188 gene locus_tag LOCUS_09900 19820 20188 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023598.1 protein_id gnl|my_center|LOCUS_09900 20270 20842 gene locus_tag LOCUS_09910 20270 20842 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023599.1 protein_id gnl|my_center|LOCUS_09910 20845 21030 gene locus_tag LOCUS_09920 20845 21030 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023600.1 protein_id gnl|my_center|LOCUS_09920 21031 21612 gene locus_tag LOCUS_09930 21031 21612 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_09930 21602 21925 gene locus_tag LOCUS_09940 21602 21925 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023602.1 protein_id gnl|my_center|LOCUS_09940 21936 22085 gene locus_tag LOCUS_09950 21936 22085 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011032551.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence031 2205 922 gene locus_tag LOCUS_09960 2205 922 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_09960 3158 2208 gene locus_tag LOCUS_09970 3158 2208 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990845.1 protein_id gnl|my_center|LOCUS_09970 4259 3159 gene locus_tag LOCUS_09980 4259 3159 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289085.1 protein_id gnl|my_center|LOCUS_09980 5177 4287 gene locus_tag LOCUS_09990 5177 4287 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_09990 6304 5828 gene locus_tag LOCUS_10000 6304 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 7072 6527 gene locus_tag LOCUS_10010 7072 6527 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990773.1 protein_id gnl|my_center|LOCUS_10010 7720 7226 gene locus_tag LOCUS_10020 7720 7226 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990773.1 protein_id gnl|my_center|LOCUS_10020 8732 8022 gene locus_tag LOCUS_10030 8732 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 9430 8777 gene locus_tag LOCUS_10040 9430 8777 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020502.1 protein_id gnl|my_center|LOCUS_10040 9618 10448 gene locus_tag LOCUS_10050 9618 10448 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967671.1 protein_id gnl|my_center|LOCUS_10050 10458 13886 gene locus_tag LOCUS_10060 10458 13886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 14048 14341 gene locus_tag LOCUS_10070 14048 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 14698 14429 gene locus_tag LOCUS_10080 14698 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 15378 15007 gene locus_tag LOCUS_10090 15378 15007 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066255.1 protein_id gnl|my_center|LOCUS_10090 15790 15437 gene locus_tag LOCUS_10100 15790 15437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023582.1 protein_id gnl|my_center|LOCUS_10100 16367 16786 gene locus_tag LOCUS_10110 16367 16786 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_10110 17688 16840 gene locus_tag LOCUS_10120 17688 16840 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022219.1 protein_id gnl|my_center|LOCUS_10120 19031 17730 gene locus_tag LOCUS_10130 19031 17730 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022225.1 protein_id gnl|my_center|LOCUS_10130 19579 20565 gene locus_tag LOCUS_10140 19579 20565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 20659 21129 gene locus_tag LOCUS_10150 20659 21129 CDS product DUF5788 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024379.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence032 361 277 gene locus_tag LOCUS_t00160 361 277 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1369 347 gene locus_tag LOCUS_10160 1369 347 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021133.1 protein_id gnl|my_center|LOCUS_10160 1904 1356 gene locus_tag LOCUS_10170 1904 1356 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021132.1 protein_id gnl|my_center|LOCUS_10170 2530 1904 gene locus_tag LOCUS_10180 2530 1904 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021131.1 protein_id gnl|my_center|LOCUS_10180 3190 2540 gene locus_tag LOCUS_10190 3190 2540 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021125.1 protein_id gnl|my_center|LOCUS_10190 4688 3204 gene locus_tag LOCUS_10200 gene secY 4688 3204 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_10200 5266 4838 gene locus_tag LOCUS_10210 5266 4838 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_10210 5732 5271 gene locus_tag LOCUS_10220 5732 5271 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021122.1 protein_id gnl|my_center|LOCUS_10220 6372 5734 gene locus_tag LOCUS_10230 6372 5734 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021121.1 protein_id gnl|my_center|LOCUS_10230 6902 6381 gene locus_tag LOCUS_10240 6902 6381 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021120.1 protein_id gnl|my_center|LOCUS_10240 7407 6943 gene locus_tag LOCUS_10250 7407 6943 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_10250 7852 7409 gene locus_tag LOCUS_10260 7852 7409 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066173.1 protein_id gnl|my_center|LOCUS_10260 8395 7862 gene locus_tag LOCUS_10270 gene rpl6p 8395 7862 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021117.1 protein_id gnl|my_center|LOCUS_10270 8802 8410 gene locus_tag LOCUS_10280 8802 8410 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021116.1 protein_id gnl|my_center|LOCUS_10280 8966 8814 gene locus_tag LOCUS_10290 8966 8814 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021115.1 protein_id gnl|my_center|LOCUS_10290 9476 8967 gene locus_tag LOCUS_10300 9476 8967 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021114.1 protein_id gnl|my_center|LOCUS_10300 10182 9469 gene locus_tag LOCUS_10310 10182 9469 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021113.1 protein_id gnl|my_center|LOCUS_10310 10544 10191 gene locus_tag LOCUS_10320 gene rplX 10544 10191 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065039.1 protein_id gnl|my_center|LOCUS_10320 10953 10555 gene locus_tag LOCUS_10330 gene rpl14p 10953 10555 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 protein_id gnl|my_center|LOCUS_10330 11279 10950 gene locus_tag LOCUS_10340 11279 10950 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021110.1 protein_id gnl|my_center|LOCUS_10340 11596 11285 gene locus_tag LOCUS_10350 11596 11285 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021109.1 protein_id gnl|my_center|LOCUS_10350 11801 11598 gene locus_tag LOCUS_10360 gene rpmC 11801 11598 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021108.1 protein_id gnl|my_center|LOCUS_10360 12720 11806 gene locus_tag LOCUS_10370 12720 11806 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021107.1 protein_id gnl|my_center|LOCUS_10370 13175 12720 gene locus_tag LOCUS_10380 13175 12720 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021106.1 protein_id gnl|my_center|LOCUS_10380 13601 13188 gene locus_tag LOCUS_10390 13601 13188 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021105.1 protein_id gnl|my_center|LOCUS_10390 14330 13617 gene locus_tag LOCUS_10400 14330 13617 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021104.1 protein_id gnl|my_center|LOCUS_10400 14590 14342 gene locus_tag LOCUS_10410 14590 14342 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021103.1 protein_id gnl|my_center|LOCUS_10410 15354 14587 gene locus_tag LOCUS_10420 gene rpl4p 15354 14587 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021102.1 protein_id gnl|my_center|LOCUS_10420 16373 15360 gene locus_tag LOCUS_10430 gene rpl3p 16373 15360 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021101.1 protein_id gnl|my_center|LOCUS_10430 17400 16810 gene locus_tag LOCUS_10440 17400 16810 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021058.1 protein_id gnl|my_center|LOCUS_10440 19202 17397 gene locus_tag LOCUS_10450 gene iorA 19202 17397 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065029.1 protein_id gnl|my_center|LOCUS_10450 19424 20779 gene locus_tag LOCUS_10460 19424 20779 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_10460 20794 21924 gene locus_tag LOCUS_10470 gene proB 20794 21924 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023993.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence033 1818 133 gene locus_tag LOCUS_10480 1818 133 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022536.1 protein_id gnl|my_center|LOCUS_10480 2828 1833 gene locus_tag LOCUS_10490 2828 1833 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_10490 3344 2838 gene locus_tag LOCUS_10500 3344 2838 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065441.1 protein_id gnl|my_center|LOCUS_10500 3819 3592 gene locus_tag LOCUS_10510 3819 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4153 5364 gene locus_tag LOCUS_10520 4153 5364 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_10520 5369 6133 gene locus_tag LOCUS_10530 5369 6133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869614.1 protein_id gnl|my_center|LOCUS_10530 6130 6828 gene locus_tag LOCUS_10540 6130 6828 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869613.1 protein_id gnl|my_center|LOCUS_10540 6832 7458 gene locus_tag LOCUS_10550 6832 7458 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496401.1 protein_id gnl|my_center|LOCUS_10550 7488 7997 gene locus_tag LOCUS_10560 gene comD 7488 7997 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 protein_id gnl|my_center|LOCUS_10560 7991 8557 gene locus_tag LOCUS_10570 gene comE 7991 8557 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496438.1 protein_id gnl|my_center|LOCUS_10570 8852 9796 gene locus_tag LOCUS_10580 8852 9796 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022981.1 protein_id gnl|my_center|LOCUS_10580 9775 10434 gene locus_tag LOCUS_10590 9775 10434 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022982.1 protein_id gnl|my_center|LOCUS_10590 10820 10617 gene locus_tag LOCUS_10600 10820 10617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065866.1 protein_id gnl|my_center|LOCUS_10600 11799 11056 gene locus_tag LOCUS_10610 gene arsM 11799 11056 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_10610 12172 11819 gene locus_tag LOCUS_10620 12172 11819 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023684.1 protein_id gnl|my_center|LOCUS_10620 13113 12379 gene locus_tag LOCUS_10630 13113 12379 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_10630 13858 13172 gene locus_tag LOCUS_10640 gene thiE 13858 13172 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022682.1 protein_id gnl|my_center|LOCUS_10640 14664 13879 gene locus_tag LOCUS_10650 gene thiM 14664 13879 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022683.1 protein_id gnl|my_center|LOCUS_10650 15376 14741 gene locus_tag LOCUS_10660 15376 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 15566 16468 gene locus_tag LOCUS_10670 gene nadA 15566 16468 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583121.1 protein_id gnl|my_center|LOCUS_10670 16753 16559 gene locus_tag LOCUS_10680 16753 16559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 18251 16767 gene locus_tag LOCUS_10690 18251 16767 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990604.1 protein_id gnl|my_center|LOCUS_10690 19549 18254 gene locus_tag LOCUS_10700 19549 18254 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022675.1 protein_id gnl|my_center|LOCUS_10700 20919 19552 gene locus_tag LOCUS_10710 gene pscS 20919 19552 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966499.1 protein_id gnl|my_center|LOCUS_10710 21062 20991 gene locus_tag LOCUS_t00170 21062 20991 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence034 699 241 gene locus_tag LOCUS_10720 699 241 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023461.1 protein_id gnl|my_center|LOCUS_10720 949 668 gene locus_tag LOCUS_10730 949 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1079 927 gene locus_tag LOCUS_10740 1079 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1364 2341 gene locus_tag LOCUS_10750 gene radA 1364 2341 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_10750 2379 3059 gene locus_tag LOCUS_10760 2379 3059 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023459.1 protein_id gnl|my_center|LOCUS_10760 3344 3081 gene locus_tag LOCUS_10770 3344 3081 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023444.1 protein_id gnl|my_center|LOCUS_10770 5617 3380 gene locus_tag LOCUS_10780 5617 3380 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_10780 6047 6244 gene locus_tag LOCUS_10790 6047 6244 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065891.1 protein_id gnl|my_center|LOCUS_10790 8564 6417 gene locus_tag LOCUS_10800 gene purL 8564 6417 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023948.1 protein_id gnl|my_center|LOCUS_10800 8892 9497 gene locus_tag LOCUS_10810 8892 9497 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296409.1 protein_id gnl|my_center|LOCUS_10810 9509 10213 gene locus_tag LOCUS_10820 9509 10213 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296408.1 protein_id gnl|my_center|LOCUS_10820 10218 10574 gene locus_tag LOCUS_10830 10218 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 12139 10715 gene locus_tag LOCUS_10840 12139 10715 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_10840 13200 12136 gene locus_tag LOCUS_10850 13200 12136 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022859.1 protein_id gnl|my_center|LOCUS_10850 13462 13223 gene locus_tag LOCUS_10860 13462 13223 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022860.1 protein_id gnl|my_center|LOCUS_10860 15286 13616 gene locus_tag LOCUS_10870 15286 13616 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_10870 15856 15302 gene locus_tag LOCUS_10880 15856 15302 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022863.1 protein_id gnl|my_center|LOCUS_10880 16117 16347 gene locus_tag LOCUS_10890 16117 16347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 16463 17581 gene locus_tag LOCUS_10900 16463 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 18318 17605 gene locus_tag LOCUS_10910 18318 17605 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064968.1 protein_id gnl|my_center|LOCUS_10910 19321 18293 gene locus_tag LOCUS_10920 19321 18293 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020842.1 protein_id gnl|my_center|LOCUS_10920 20328 19387 gene locus_tag LOCUS_10930 20328 19387 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064969.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence035 60 1304 gene locus_tag LOCUS_10940 gene hmgA 60 1304 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065600.1 protein_id gnl|my_center|LOCUS_10940 1589 1365 gene locus_tag LOCUS_10950 1589 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2929 1586 gene locus_tag LOCUS_10960 gene hacA 2929 1586 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_10960 3372 2998 gene locus_tag LOCUS_10970 3372 2998 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023067.1 protein_id gnl|my_center|LOCUS_10970 3845 3770 gene locus_tag LOCUS_t00180 3845 3770 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4034 4107 gene locus_tag LOCUS_t00190 4034 4107 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4447 6813 gene locus_tag LOCUS_10980 4447 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 7110 7289 gene locus_tag LOCUS_10990 7110 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10990 7306 7581 gene locus_tag LOCUS_11000 7306 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11000 7702 8076 gene locus_tag LOCUS_11010 7702 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 8161 9300 gene locus_tag LOCUS_11020 8161 9300 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023078.1 protein_id gnl|my_center|LOCUS_11020 9332 10372 gene locus_tag LOCUS_11030 9332 10372 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023080.1 protein_id gnl|my_center|LOCUS_11030 12075 10396 gene locus_tag LOCUS_11040 12075 10396 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022802.1 protein_id gnl|my_center|LOCUS_11040 12204 13865 gene locus_tag LOCUS_11050 gene ilvD 12204 13865 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021805.1 protein_id gnl|my_center|LOCUS_11050 15360 14176 gene locus_tag LOCUS_11060 15360 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 15532 17007 gene locus_tag LOCUS_11070 15532 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 17830 17066 gene locus_tag LOCUS_11080 17830 17066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 18680 17835 gene locus_tag LOCUS_11090 gene mtxX 18680 17835 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065223.1 protein_id gnl|my_center|LOCUS_11090 18765 20264 gene locus_tag LOCUS_11100 18765 20264 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065226.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence036 236 1996 gene locus_tag LOCUS_11110 236 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2222 4297 gene locus_tag LOCUS_11120 gene ppk1 2222 4297 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963117.1 protein_id gnl|my_center|LOCUS_11120 4300 5196 gene locus_tag LOCUS_11130 4300 5196 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_11130 5927 5271 gene locus_tag LOCUS_11140 gene pyrF 5927 5271 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065013.1 protein_id gnl|my_center|LOCUS_11140 6900 5950 gene locus_tag LOCUS_11150 6900 5950 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_11150 7031 7870 gene locus_tag LOCUS_11160 7031 7870 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_11160 7867 10698 gene locus_tag LOCUS_11170 7867 10698 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_11170 10874 11893 gene locus_tag LOCUS_11180 gene mtaA 10874 11893 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021625.1 protein_id gnl|my_center|LOCUS_11180 13642 12251 gene locus_tag LOCUS_11190 gene mtaB 13642 12251 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021626.1 protein_id gnl|my_center|LOCUS_11190 14419 13658 gene locus_tag LOCUS_11200 gene mtaC 14419 13658 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021627.1 protein_id gnl|my_center|LOCUS_11200 16238 15147 gene locus_tag LOCUS_11210 16238 15147 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066591.1 protein_id gnl|my_center|LOCUS_11210 17886 16270 gene locus_tag LOCUS_11220 17886 16270 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024259.1 protein_id gnl|my_center|LOCUS_11220 18353 18090 gene locus_tag LOCUS_11230 18353 18090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 18847 18368 gene locus_tag LOCUS_11240 18847 18368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023398.1 protein_id gnl|my_center|LOCUS_11240 <20130 18857 gene locus_tag LOCUS_11250 <20130 18857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065727.1:ferrous iron transport protein B >Feature sequence037 2895 418 gene locus_tag LOCUS_11260 2895 418 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021427.1 protein_id gnl|my_center|LOCUS_11260 3039 3887 gene locus_tag LOCUS_11270 3039 3887 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878668.1 protein_id gnl|my_center|LOCUS_11270 4693 3896 gene locus_tag LOCUS_11280 gene mtnP 4693 3896 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021425.1 protein_id gnl|my_center|LOCUS_11280 5786 4701 gene locus_tag LOCUS_11290 5786 4701 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_11290 6503 5847 gene locus_tag LOCUS_11300 6503 5847 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_11300 9702 6526 gene locus_tag LOCUS_11310 gene ileS 9702 6526 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022402.1 protein_id gnl|my_center|LOCUS_11310 10301 9936 gene locus_tag LOCUS_11320 10301 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990763.1 protein_id gnl|my_center|LOCUS_11320 10956 10333 gene locus_tag LOCUS_11330 10956 10333 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020976.1 protein_id gnl|my_center|LOCUS_11330 11771 10944 gene locus_tag LOCUS_11340 gene cobS 11771 10944 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020977.1 protein_id gnl|my_center|LOCUS_11340 12368 11805 gene locus_tag LOCUS_11350 gene cobZ 12368 11805 CDS product alpha-ribazole phosphatase CobZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065005.1 protein_id gnl|my_center|LOCUS_11350 13375 12383 gene locus_tag LOCUS_11360 13375 12383 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020979.1 protein_id gnl|my_center|LOCUS_11360 14865 13360 gene locus_tag LOCUS_11370 gene cobD 14865 13360 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020980.1 protein_id gnl|my_center|LOCUS_11370 16476 14992 gene locus_tag LOCUS_11380 gene cobD 16476 14992 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020980.1 protein_id gnl|my_center|LOCUS_11380 16610 17413 gene locus_tag LOCUS_11390 16610 17413 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024520.1 protein_id gnl|my_center|LOCUS_11390 17481 18134 gene locus_tag LOCUS_11400 17481 18134 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_11400 18185 18709 gene locus_tag LOCUS_11410 18185 18709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065126.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence038 246 578 gene locus_tag LOCUS_11420 246 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023462.1 protein_id gnl|my_center|LOCUS_11420 578 1414 gene locus_tag LOCUS_11430 578 1414 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023463.1 protein_id gnl|my_center|LOCUS_11430 2791 1415 gene locus_tag LOCUS_11440 2791 1415 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023466.1 protein_id gnl|my_center|LOCUS_11440 3582 2788 gene locus_tag LOCUS_11450 gene cbiQ 3582 2788 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065744.1 protein_id gnl|my_center|LOCUS_11450 4042 3752 gene locus_tag LOCUS_11460 4042 3752 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023468.1 protein_id gnl|my_center|LOCUS_11460 4746 4039 gene locus_tag LOCUS_11470 4746 4039 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023469.1 protein_id gnl|my_center|LOCUS_11470 5528 4941 gene locus_tag LOCUS_11480 5528 4941 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020569.1 protein_id gnl|my_center|LOCUS_11480 6541 5525 gene locus_tag LOCUS_11490 6541 5525 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020570.1 protein_id gnl|my_center|LOCUS_11490 8406 6583 gene locus_tag LOCUS_11500 gene mutL 8406 6583 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_11500 11044 8408 gene locus_tag LOCUS_11510 gene mutS 11044 8408 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_11510 11288 11662 gene locus_tag LOCUS_11520 11288 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024352.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11520 11834 12496 gene locus_tag LOCUS_11530 11834 12496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 13852 12560 gene locus_tag LOCUS_11540 13852 12560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 14752 13934 gene locus_tag LOCUS_11550 14752 13934 CDS product Dna2/Cas4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065883.1 protein_id gnl|my_center|LOCUS_11550 14862 15623 gene locus_tag LOCUS_11560 14862 15623 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023933.1 protein_id gnl|my_center|LOCUS_11560 15654 16703 gene locus_tag LOCUS_11570 15654 16703 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023934.1 protein_id gnl|my_center|LOCUS_11570 16714 17886 gene locus_tag LOCUS_11580 16714 17886 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_11580 17892 18281 gene locus_tag LOCUS_11590 17892 18281 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_11590 18283 18813 gene locus_tag LOCUS_11600 gene cyaB 18283 18813 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023937.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence039 548 473 gene locus_tag LOCUS_t00200 548 473 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1884 646 gene locus_tag LOCUS_11610 1884 646 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_11610 3021 2851 gene locus_tag LOCUS_11620 3021 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3003 3326 gene locus_tag LOCUS_11630 3003 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 3348 3593 gene locus_tag LOCUS_11640 3348 3593 CDS product DUF131 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024011.1 protein_id gnl|my_center|LOCUS_11640 3593 3934 gene locus_tag LOCUS_11650 3593 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 4128 6110 gene locus_tag LOCUS_11660 gene uvrB 4128 6110 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_11660 6328 6402 gene locus_tag LOCUS_t00210 6328 6402 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6547 7044 gene locus_tag LOCUS_11670 6547 7044 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932797.1 protein_id gnl|my_center|LOCUS_11670 7044 8414 gene locus_tag LOCUS_11680 7044 8414 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403840.1 protein_id gnl|my_center|LOCUS_11680 8823 9287 gene locus_tag LOCUS_11690 8823 9287 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065043.1 protein_id gnl|my_center|LOCUS_11690 9307 10671 gene locus_tag LOCUS_11700 9307 10671 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_11700 10940 12085 gene locus_tag LOCUS_11710 10940 12085 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022968.1 protein_id gnl|my_center|LOCUS_11710 12134 12400 gene locus_tag LOCUS_11720 12134 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065588.1 protein_id gnl|my_center|LOCUS_11720 13325 12411 gene locus_tag LOCUS_11730 gene rnz 13325 12411 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_11730 13691 14065 gene locus_tag LOCUS_11740 13691 14065 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020961.1 protein_id gnl|my_center|LOCUS_11740 14119 14610 gene locus_tag LOCUS_11750 14119 14610 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_11750 14647 15822 gene locus_tag LOCUS_11760 14647 15822 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_11760 16567 16172 gene locus_tag LOCUS_11770 16567 16172 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020964.1 protein_id gnl|my_center|LOCUS_11770 16674 17354 gene locus_tag LOCUS_11780 16674 17354 CDS product DUF5591 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020965.1 protein_id gnl|my_center|LOCUS_11780 18129 17401 gene locus_tag LOCUS_11790 18129 17401 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_11790 18383 18751 gene locus_tag LOCUS_11800 18383 18751 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065599.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence040 1029 1763 gene locus_tag LOCUS_11810 1029 1763 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_11810 1763 2062 gene locus_tag LOCUS_11820 1763 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020635.1 protein_id gnl|my_center|LOCUS_11820 2212 3921 gene locus_tag LOCUS_11830 2212 3921 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064918.1 protein_id gnl|my_center|LOCUS_11830 4199 6457 gene locus_tag LOCUS_11840 4199 6457 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022481.1 protein_id gnl|my_center|LOCUS_11840 6470 7711 gene locus_tag LOCUS_11850 6470 7711 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022483.1 protein_id gnl|my_center|LOCUS_11850 8322 7708 gene locus_tag LOCUS_11860 8322 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 8569 9423 gene locus_tag LOCUS_11870 8569 9423 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022522.1 protein_id gnl|my_center|LOCUS_11870 9959 9450 gene locus_tag LOCUS_11880 9959 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 10572 9934 gene locus_tag LOCUS_11890 10572 9934 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_11890 10694 11245 gene locus_tag LOCUS_11900 10694 11245 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022484.1 protein_id gnl|my_center|LOCUS_11900 13219 11249 gene locus_tag LOCUS_11910 13219 11249 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990592.1 protein_id gnl|my_center|LOCUS_11910 14159 13272 gene locus_tag LOCUS_11920 14159 13272 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022486.1 protein_id gnl|my_center|LOCUS_11920 15016 14327 gene locus_tag LOCUS_11930 15016 14327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860333.1 protein_id gnl|my_center|LOCUS_11930 15365 16645 gene locus_tag LOCUS_11940 gene rbcL 15365 16645 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024428.1 protein_id gnl|my_center|LOCUS_11940 16635 17705 gene locus_tag LOCUS_11950 16635 17705 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_11950 17714 17947 gene locus_tag LOCUS_11960 17714 17947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 18452 17994 gene locus_tag LOCUS_11970 18452 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence041 1141 479 gene locus_tag LOCUS_11980 1141 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 2714 2145 gene locus_tag LOCUS_11990 2714 2145 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878592.1 protein_id gnl|my_center|LOCUS_11990 2908 2660 gene locus_tag LOCUS_12000 2908 2660 CDS product DUF5371 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064725.1 protein_id gnl|my_center|LOCUS_12000 3236 3514 gene locus_tag LOCUS_12010 3236 3514 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023169.1 protein_id gnl|my_center|LOCUS_12010 3526 4887 gene locus_tag LOCUS_12020 3526 4887 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_12020 4988 5500 gene locus_tag LOCUS_12030 4988 5500 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_12030 5878 6531 gene locus_tag LOCUS_12040 gene cbiM 5878 6531 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065876.1 protein_id gnl|my_center|LOCUS_12040 6528 6845 gene locus_tag LOCUS_12050 6528 6845 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065875.1 protein_id gnl|my_center|LOCUS_12050 7762 6953 gene locus_tag LOCUS_12060 gene cbiQ 7762 6953 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023913.1 protein_id gnl|my_center|LOCUS_12060 8627 7743 gene locus_tag LOCUS_12070 8627 7743 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023914.1 protein_id gnl|my_center|LOCUS_12070 10330 9296 gene locus_tag LOCUS_12080 gene mcrC 10330 9296 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_12080 11540 10323 gene locus_tag LOCUS_12090 11540 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 12937 11537 gene locus_tag LOCUS_12100 12937 11537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 16082 12981 gene locus_tag LOCUS_12110 16082 12981 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_12110 18045 16102 gene locus_tag LOCUS_12120 18045 16102 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197693007.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence042 520 14 gene locus_tag LOCUS_12130 520 14 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_12130 2294 678 gene locus_tag LOCUS_12140 gene pheT 2294 678 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021951.1 protein_id gnl|my_center|LOCUS_12140 3302 2391 gene locus_tag LOCUS_12150 3302 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4008 4763 gene locus_tag LOCUS_12160 4008 4763 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_12160 6868 4892 gene locus_tag LOCUS_12170 6868 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7275 9629 gene locus_tag LOCUS_12180 7275 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 9646 11901 gene locus_tag LOCUS_12190 9646 11901 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_12190 11942 12586 gene locus_tag LOCUS_12200 gene rnhB 11942 12586 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021954.1 protein_id gnl|my_center|LOCUS_12200 13292 12594 gene locus_tag LOCUS_12210 gene purQ 13292 12594 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021958.1 protein_id gnl|my_center|LOCUS_12210 13540 13292 gene locus_tag LOCUS_12220 gene purS 13540 13292 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066286.1 protein_id gnl|my_center|LOCUS_12220 14153 13602 gene locus_tag LOCUS_12230 14153 13602 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020574.1 protein_id gnl|my_center|LOCUS_12230 14439 14852 gene locus_tag LOCUS_12240 14439 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 14980 17151 gene locus_tag LOCUS_12250 14980 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 17652 17230 gene locus_tag LOCUS_12260 17652 17230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 17893 >18348 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgccataccctattttc >Feature sequence043 1474 197 gene locus_tag LOCUS_12270 1474 197 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020227.1 protein_id gnl|my_center|LOCUS_12270 1560 2267 gene locus_tag LOCUS_12280 gene alaXM 1560 2267 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022008.1 protein_id gnl|my_center|LOCUS_12280 2449 4020 gene locus_tag LOCUS_12290 gene serA 2449 4020 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_12290 4084 4563 gene locus_tag LOCUS_12300 4084 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 4563 5030 gene locus_tag LOCUS_12310 4563 5030 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020642.1 protein_id gnl|my_center|LOCUS_12310 5174 5554 gene locus_tag LOCUS_12320 5174 5554 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064921.1 protein_id gnl|my_center|LOCUS_12320 5567 5986 gene locus_tag LOCUS_12330 5567 5986 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_12330 6001 6405 gene locus_tag LOCUS_12340 6001 6405 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020646.1 protein_id gnl|my_center|LOCUS_12340 6417 6605 gene locus_tag LOCUS_12350 6417 6605 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020647.1 protein_id gnl|my_center|LOCUS_12350 6911 7096 gene locus_tag LOCUS_12360 6911 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 7101 7772 gene locus_tag LOCUS_12370 gene rpsB 7101 7772 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020649.1 protein_id gnl|my_center|LOCUS_12370 7836 8636 gene locus_tag LOCUS_12380 7836 8636 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_12380 8647 9561 gene locus_tag LOCUS_12390 8647 9561 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064922.1 protein_id gnl|my_center|LOCUS_12390 9563 10354 gene locus_tag LOCUS_12400 9563 10354 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_12400 10356 11459 gene locus_tag LOCUS_12410 gene fni 10356 11459 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 protein_id gnl|my_center|LOCUS_12410 11505 12848 gene locus_tag LOCUS_12420 11505 12848 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_12420 12873 13838 gene locus_tag LOCUS_12430 12873 13838 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066119.1 protein_id gnl|my_center|LOCUS_12430 16597 13931 gene locus_tag LOCUS_12440 gene ppdK 16597 13931 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020657.1 protein_id gnl|my_center|LOCUS_12440 17496 16684 gene locus_tag LOCUS_12450 17496 16684 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066008.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence044 348 2477 gene locus_tag LOCUS_12460 348 2477 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_12460 2510 3865 gene locus_tag LOCUS_12470 gene ftsA 2510 3865 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755965.1 protein_id gnl|my_center|LOCUS_12470 5232 4513 gene locus_tag LOCUS_12480 5232 4513 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249999.1 protein_id gnl|my_center|LOCUS_12480 6603 5332 gene locus_tag LOCUS_12490 6603 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6832 7518 gene locus_tag LOCUS_12500 6832 7518 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023187.1 protein_id gnl|my_center|LOCUS_12500 7743 7925 gene locus_tag LOCUS_12510 7743 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 8021 8875 gene locus_tag LOCUS_12520 8021 8875 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274369.1 protein_id gnl|my_center|LOCUS_12520 8905 9894 gene locus_tag LOCUS_12530 gene mptN 8905 9894 CDS product tetrahydromethanopterin:alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023202.1 protein_id gnl|my_center|LOCUS_12530 9928 10275 gene locus_tag LOCUS_12540 gene pth2 9928 10275 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023203.1 protein_id gnl|my_center|LOCUS_12540 10428 11744 gene locus_tag LOCUS_12550 gene truD 10428 11744 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_12550 13339 11741 gene locus_tag LOCUS_12560 gene pyrG 13339 11741 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023212.1 protein_id gnl|my_center|LOCUS_12560 14026 13358 gene locus_tag LOCUS_12570 14026 13358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023213.1 protein_id gnl|my_center|LOCUS_12570 14205 14038 gene locus_tag LOCUS_12580 14205 14038 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 protein_id gnl|my_center|LOCUS_12580 14336 15274 gene locus_tag LOCUS_12590 14336 15274 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023218.1 protein_id gnl|my_center|LOCUS_12590 15902 15351 gene locus_tag LOCUS_12600 15902 15351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence045 365 1483 gene locus_tag LOCUS_12610 365 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1494 2378 gene locus_tag LOCUS_12620 1494 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2462 3484 gene locus_tag LOCUS_12630 gene amrS 2462 3484 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_12630 3629 3701 gene locus_tag LOCUS_t00220 3629 3701 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3722 3796 gene locus_tag LOCUS_t00230 3722 3796 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4600 5739 gene locus_tag LOCUS_12640 4600 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 7223 6129 gene locus_tag LOCUS_12650 7223 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023039.1 protein_id gnl|my_center|LOCUS_12650 7373 8044 gene locus_tag LOCUS_12660 7373 8044 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023038.1 protein_id gnl|my_center|LOCUS_12660 9575 8196 gene locus_tag LOCUS_12670 9575 8196 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023037.1 protein_id gnl|my_center|LOCUS_12670 10492 9572 gene locus_tag LOCUS_12680 10492 9572 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023036.1 protein_id gnl|my_center|LOCUS_12680 12573 10489 gene locus_tag LOCUS_12690 12573 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 13468 12566 gene locus_tag LOCUS_12700 gene pstA 13468 12566 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023034.1 protein_id gnl|my_center|LOCUS_12700 14157 13465 gene locus_tag LOCUS_12710 14157 13465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 15477 14437 gene locus_tag LOCUS_12720 15477 14437 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023032.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence046 213 884 gene locus_tag LOCUS_12730 213 884 CDS product DUF2162 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024305.1 protein_id gnl|my_center|LOCUS_12730 886 1509 gene locus_tag LOCUS_12740 886 1509 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013194697.1 protein_id gnl|my_center|LOCUS_12740 1506 1868 gene locus_tag LOCUS_12750 1506 1868 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020403.1 protein_id gnl|my_center|LOCUS_12750 1976 7120 gene locus_tag LOCUS_12760 1976 7120 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020404.1 protein_id gnl|my_center|LOCUS_12760 8188 7277 gene locus_tag LOCUS_12770 8188 7277 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967479.1 protein_id gnl|my_center|LOCUS_12770 8562 12551 gene locus_tag LOCUS_12780 8562 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 12675 14990 gene locus_tag LOCUS_12790 12675 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence047 259 185 gene locus_tag LOCUS_t00240 259 185 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 528 1409 gene locus_tag LOCUS_12800 gene ilvE 528 1409 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065968.1 protein_id gnl|my_center|LOCUS_12800 1515 1769 gene locus_tag LOCUS_12810 1515 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1775 3691 gene locus_tag LOCUS_12820 1775 3691 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024230.1 protein_id gnl|my_center|LOCUS_12820 5821 4055 gene locus_tag LOCUS_12830 5821 4055 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_12830 6263 5859 gene locus_tag LOCUS_12840 6263 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990637.1 protein_id gnl|my_center|LOCUS_12840 7348 6353 gene locus_tag LOCUS_12850 7348 6353 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066456.1 protein_id gnl|my_center|LOCUS_12850 7698 7429 gene locus_tag LOCUS_12860 gene trxA 7698 7429 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065637.1 protein_id gnl|my_center|LOCUS_12860 8690 7902 gene locus_tag LOCUS_12870 8690 7902 CDS product nicotinate-nucleotide pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064859.1 protein_id gnl|my_center|LOCUS_12870 9097 9573 gene locus_tag LOCUS_12880 9097 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 10096 9674 gene locus_tag LOCUS_12890 10096 9674 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942952.1 protein_id gnl|my_center|LOCUS_12890 11027 10146 gene locus_tag LOCUS_12900 11027 10146 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066039.1 protein_id gnl|my_center|LOCUS_12900 11050 11262 gene locus_tag LOCUS_12910 11050 11262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 11437 11910 gene locus_tag LOCUS_12920 11437 11910 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949083.1 protein_id gnl|my_center|LOCUS_12920 12997 11948 gene locus_tag LOCUS_12930 gene sppA 12997 11948 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065885.1 protein_id gnl|my_center|LOCUS_12930 13153 15198 gene locus_tag LOCUS_12940 gene metG 13153 15198 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065884.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence048 840 163 gene locus_tag LOCUS_12950 840 163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984863.1 protein_id gnl|my_center|LOCUS_12950 1948 833 gene locus_tag LOCUS_12960 1948 833 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020431.1 protein_id gnl|my_center|LOCUS_12960 3017 1941 gene locus_tag LOCUS_12970 3017 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020430.1 protein_id gnl|my_center|LOCUS_12970 3753 3025 gene locus_tag LOCUS_12980 gene pyrH 3753 3025 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020429.1 protein_id gnl|my_center|LOCUS_12980 4481 3750 gene locus_tag LOCUS_12990 4481 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 5540 4509 gene locus_tag LOCUS_13000 gene asd 5540 4509 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020482.1 protein_id gnl|my_center|LOCUS_13000 5771 5595 gene locus_tag LOCUS_13010 5771 5595 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024079.1 protein_id gnl|my_center|LOCUS_13010 6001 6468 gene locus_tag LOCUS_13020 6001 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6470 7081 gene locus_tag LOCUS_13030 6470 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 7069 7959 gene locus_tag LOCUS_13040 7069 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 7959 8432 gene locus_tag LOCUS_13050 7959 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 8452 9228 gene locus_tag LOCUS_13060 8452 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 9246 10700 gene locus_tag LOCUS_13070 9246 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 11455 11778 gene locus_tag LOCUS_13080 11455 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 11904 12215 gene locus_tag LOCUS_13090 11904 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023897.1 protein_id gnl|my_center|LOCUS_13090 12231 13247 gene locus_tag LOCUS_13100 gene fen 12231 13247 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023899.1 protein_id gnl|my_center|LOCUS_13100 14791 13244 gene locus_tag LOCUS_13110 gene gpmI 14791 13244 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065873.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence049 957 685 gene locus_tag LOCUS_13120 957 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1109 1606 gene locus_tag LOCUS_13130 1109 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2345 1629 gene locus_tag LOCUS_13140 2345 1629 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_13140 2602 3390 gene locus_tag LOCUS_13150 2602 3390 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065799.1 protein_id gnl|my_center|LOCUS_13150 3390 4766 gene locus_tag LOCUS_13160 gene gltA 3390 4766 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_13160 5123 6835 gene locus_tag LOCUS_13170 5123 6835 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022843.1 protein_id gnl|my_center|LOCUS_13170 6900 7967 gene locus_tag LOCUS_13180 6900 7967 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022844.1 protein_id gnl|my_center|LOCUS_13180 8079 9983 gene locus_tag LOCUS_13190 8079 9983 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022845.1 protein_id gnl|my_center|LOCUS_13190 10006 10290 gene locus_tag LOCUS_13200 10006 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 10360 11529 gene locus_tag LOCUS_13210 gene thiI 10360 11529 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021480.1 protein_id gnl|my_center|LOCUS_13210 12581 12114 gene locus_tag LOCUS_13220 12581 12114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 12850 14634 gene locus_tag LOCUS_13230 12850 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence050 <1 645 gene locus_tag LOCUS_13240 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein 870 1511 gene locus_tag LOCUS_13250 870 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2825 1554 gene locus_tag LOCUS_13260 2825 1554 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 protein_id gnl|my_center|LOCUS_13260 4205 3072 gene locus_tag LOCUS_13270 4205 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064972.1 protein_id gnl|my_center|LOCUS_13270 5242 4283 gene locus_tag LOCUS_13280 5242 4283 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020859.1 protein_id gnl|my_center|LOCUS_13280 6028 5297 gene locus_tag LOCUS_13290 6028 5297 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_13290 6302 6036 gene locus_tag LOCUS_13300 6302 6036 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020862.1 protein_id gnl|my_center|LOCUS_13300 7314 6358 gene locus_tag LOCUS_13310 gene mdh 7314 6358 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020863.1 protein_id gnl|my_center|LOCUS_13310 7477 8235 gene locus_tag LOCUS_13320 7477 8235 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020864.1 protein_id gnl|my_center|LOCUS_13320 8366 10141 gene locus_tag LOCUS_13330 gene uvrC 8366 10141 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_13330 10232 10963 gene locus_tag LOCUS_13340 10232 10963 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_13340 11051 11806 gene locus_tag LOCUS_13350 11051 11806 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020866.1 protein_id gnl|my_center|LOCUS_13350 13211 11811 gene locus_tag LOCUS_13360 13211 11811 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_13360 13718 13221 gene locus_tag LOCUS_13370 13718 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020868.1 protein_id gnl|my_center|LOCUS_13370 13795 13989 gene locus_tag LOCUS_13380 13795 13989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 14600 14202 gene locus_tag LOCUS_13390 14600 14202 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066143.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence051 186 551 gene locus_tag LOCUS_13400 gene mnhG 186 551 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024439.1 protein_id gnl|my_center|LOCUS_13400 2531 1299 gene locus_tag LOCUS_13410 gene mmp10 2531 1299 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024424.1 protein_id gnl|my_center|LOCUS_13410 2930 4231 gene locus_tag LOCUS_13420 gene mcrB 2930 4231 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024423.1 protein_id gnl|my_center|LOCUS_13420 4273 4758 gene locus_tag LOCUS_13430 gene mcrD 4273 4758 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024422.1 protein_id gnl|my_center|LOCUS_13430 4763 5374 gene locus_tag LOCUS_13440 gene mcrC 4763 5374 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024421.1 protein_id gnl|my_center|LOCUS_13440 5377 6126 gene locus_tag LOCUS_13450 gene mcrG 5377 6126 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024420.1 protein_id gnl|my_center|LOCUS_13450 6141 7859 gene locus_tag LOCUS_13460 gene mcrA 6141 7859 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024419.1 protein_id gnl|my_center|LOCUS_13460 8027 10078 gene locus_tag LOCUS_13470 8027 10078 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024274.1 protein_id gnl|my_center|LOCUS_13470 11380 10097 gene locus_tag LOCUS_13480 gene aroA 11380 10097 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_13480 11484 11933 gene locus_tag LOCUS_13490 11484 11933 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088388.1 protein_id gnl|my_center|LOCUS_13490 12791 11937 gene locus_tag LOCUS_13500 gene htpX 12791 11937 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024415.1 protein_id gnl|my_center|LOCUS_13500 13205 12936 gene locus_tag LOCUS_13510 13205 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 14509 13202 gene locus_tag LOCUS_13520 14509 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence052 189 521 gene locus_tag LOCUS_13530 gene msrB 189 521 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_13530 554 1438 gene locus_tag LOCUS_13540 554 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2014 1610 gene locus_tag LOCUS_13550 2014 1610 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022051.1 protein_id gnl|my_center|LOCUS_13550 3377 2172 gene locus_tag LOCUS_13560 3377 2172 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_13560 4484 5296 gene locus_tag LOCUS_13570 4484 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 5387 6805 gene locus_tag LOCUS_13580 5387 6805 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020067.1 protein_id gnl|my_center|LOCUS_13580 7746 6850 gene locus_tag LOCUS_13590 gene fhcD 7746 6850 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020069.1 protein_id gnl|my_center|LOCUS_13590 10026 7927 gene locus_tag LOCUS_13600 10026 7927 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_13600 11977 10073 gene locus_tag LOCUS_13610 gene cooS 11977 10073 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021329.1 protein_id gnl|my_center|LOCUS_13610 12964 12110 gene locus_tag LOCUS_13620 12964 12110 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_13620 14066 12969 gene locus_tag LOCUS_13630 gene dinB 14066 12969 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066563.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence053 1759 641 gene locus_tag LOCUS_13640 1759 641 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_13640 2599 1844 gene locus_tag LOCUS_13650 2599 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3908 2586 gene locus_tag LOCUS_13660 3908 2586 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860184.1 protein_id gnl|my_center|LOCUS_13660 4861 3905 gene locus_tag LOCUS_13670 4861 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 5864 4926 gene locus_tag LOCUS_13680 5864 4926 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_13680 7569 5866 gene locus_tag LOCUS_13690 7569 5866 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084529509.1 protein_id gnl|my_center|LOCUS_13690 8246 9157 gene locus_tag LOCUS_13700 8246 9157 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_13700 10610 9180 gene locus_tag LOCUS_13710 10610 9180 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062390429.1 protein_id gnl|my_center|LOCUS_13710 11564 10632 gene locus_tag LOCUS_13720 11564 10632 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024326.1 protein_id gnl|my_center|LOCUS_13720 12646 11561 gene locus_tag LOCUS_13730 12646 11561 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_13730 13355 12690 gene locus_tag LOCUS_13740 13355 12690 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_13740 <13987 13439 gene locus_tag LOCUS_13750 <13987 13439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024315.1:metal-dependent hydrolase >Feature sequence054 1091 876 gene locus_tag LOCUS_13760 1091 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1382 2830 gene locus_tag LOCUS_13770 1382 2830 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066243.1 protein_id gnl|my_center|LOCUS_13770 4459 3230 gene locus_tag LOCUS_13780 4459 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 5531 4482 gene locus_tag LOCUS_13790 5531 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485789.1 protein_id gnl|my_center|LOCUS_13790 5918 6667 gene locus_tag LOCUS_13800 5918 6667 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064856.1 protein_id gnl|my_center|LOCUS_13800 6903 7205 gene locus_tag LOCUS_13810 6903 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 7254 7739 gene locus_tag LOCUS_13820 7254 7739 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870270.1 protein_id gnl|my_center|LOCUS_13820 7924 7839 gene locus_tag LOCUS_t00250 7924 7839 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8008 8766 gene locus_tag LOCUS_13830 8008 8766 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_13830 9409 8867 gene locus_tag LOCUS_13840 9409 8867 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021659.1 protein_id gnl|my_center|LOCUS_13840 9682 12108 gene locus_tag LOCUS_13850 gene ppsA 9682 12108 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023333.1 protein_id gnl|my_center|LOCUS_13850 12221 13249 gene locus_tag LOCUS_13860 12221 13249 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202490.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence055 25 462 gene locus_tag LOCUS_13870 25 462 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447334.1 protein_id gnl|my_center|LOCUS_13870 479 1135 gene locus_tag LOCUS_13880 479 1135 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121094.1 protein_id gnl|my_center|LOCUS_13880 1132 1902 gene locus_tag LOCUS_13890 gene fetB 1132 1902 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012390.1 protein_id gnl|my_center|LOCUS_13890 2206 2673 gene locus_tag LOCUS_13900 2206 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3299 4033 gene locus_tag LOCUS_13910 3299 4033 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932495.1 protein_id gnl|my_center|LOCUS_13910 5062 4058 gene locus_tag LOCUS_13920 5062 4058 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020436.1 protein_id gnl|my_center|LOCUS_13920 5229 5660 gene locus_tag LOCUS_13930 5229 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 5746 6645 gene locus_tag LOCUS_13940 5746 6645 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_13940 6731 8098 gene locus_tag LOCUS_13950 6731 8098 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021373.1 protein_id gnl|my_center|LOCUS_13950 8262 9896 gene locus_tag LOCUS_13960 8262 9896 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_13960 9815 9997 gene locus_tag LOCUS_13970 9815 9997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 11419 10316 gene locus_tag LOCUS_13980 11419 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 12908 11928 gene locus_tag LOCUS_13990 12908 11928 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 protein_id gnl|my_center|LOCUS_13990 13533 13300 gene locus_tag LOCUS_14000 13533 13300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence056 1846 704 gene locus_tag LOCUS_14010 1846 704 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016781.1 protein_id gnl|my_center|LOCUS_14010 2514 1948 gene locus_tag LOCUS_14020 2514 1948 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020400.1 protein_id gnl|my_center|LOCUS_14020 3651 2641 gene locus_tag LOCUS_14030 3651 2641 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015945.1 protein_id gnl|my_center|LOCUS_14030 4849 3695 gene locus_tag LOCUS_14040 4849 3695 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_14040 6538 5117 gene locus_tag LOCUS_14050 6538 5117 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023126.1 protein_id gnl|my_center|LOCUS_14050 7124 7531 gene locus_tag LOCUS_14060 7124 7531 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_14060 8479 7583 gene locus_tag LOCUS_14070 8479 7583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902476.1 protein_id gnl|my_center|LOCUS_14070 9258 9088 gene locus_tag LOCUS_14080 9258 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 9690 9481 gene locus_tag LOCUS_14090 9690 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 9998 10375 gene locus_tag LOCUS_14100 9998 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 10368 11474 gene locus_tag LOCUS_14110 10368 11474 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892491.1 protein_id gnl|my_center|LOCUS_14110 11471 13267 gene locus_tag LOCUS_14120 11471 13267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence057 1033 374 gene locus_tag LOCUS_14130 1033 374 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_14130 2310 1033 gene locus_tag LOCUS_14140 2310 1033 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020223.1 protein_id gnl|my_center|LOCUS_14140 2445 3008 gene locus_tag LOCUS_14150 2445 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3211 3363 gene locus_tag LOCUS_14160 3211 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3404 4588 gene locus_tag LOCUS_14170 3404 4588 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020294.1 protein_id gnl|my_center|LOCUS_14170 5149 6264 gene locus_tag LOCUS_14180 5149 6264 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020144.1 protein_id gnl|my_center|LOCUS_14180 7983 6331 gene locus_tag LOCUS_14190 gene thsB 7983 6331 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_14190 8334 8161 gene locus_tag LOCUS_14200 8334 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 8558 9283 gene locus_tag LOCUS_14210 8558 9283 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023983.1 protein_id gnl|my_center|LOCUS_14210 10414 9308 gene locus_tag LOCUS_14220 10414 9308 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020300.1 protein_id gnl|my_center|LOCUS_14220 10859 10455 gene locus_tag LOCUS_14230 10859 10455 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_14230 12034 10856 gene locus_tag LOCUS_14240 12034 10856 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_14240 13302 12043 gene locus_tag LOCUS_14250 13302 12043 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence058 924 139 gene locus_tag LOCUS_14260 gene flaB3 924 139 CDS product flagellin B3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248995.1 protein_id gnl|my_center|LOCUS_14260 1761 955 gene locus_tag LOCUS_14270 1761 955 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870406.1 protein_id gnl|my_center|LOCUS_14270 1957 2826 gene locus_tag LOCUS_14280 1957 2826 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022932.1 protein_id gnl|my_center|LOCUS_14280 2751 2936 gene locus_tag LOCUS_14290 2751 2936 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023998.1 protein_id gnl|my_center|LOCUS_14290 3033 4232 gene locus_tag LOCUS_14300 gene trpB 3033 4232 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022931.1 protein_id gnl|my_center|LOCUS_14300 4229 5008 gene locus_tag LOCUS_14310 gene trpA 4229 5008 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_14310 6166 5051 gene locus_tag LOCUS_14320 gene ftsY 6166 5051 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024000.1 protein_id gnl|my_center|LOCUS_14320 6634 6200 gene locus_tag LOCUS_14330 gene pfdA 6634 6200 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249956.1 protein_id gnl|my_center|LOCUS_14330 6814 6638 gene locus_tag LOCUS_14340 gene rpl18a 6814 6638 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024002.1 protein_id gnl|my_center|LOCUS_14340 7521 6844 gene locus_tag LOCUS_14350 7521 6844 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024003.1 protein_id gnl|my_center|LOCUS_14350 7828 7562 gene locus_tag LOCUS_14360 7828 7562 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024004.1 protein_id gnl|my_center|LOCUS_14360 8712 8116 gene locus_tag LOCUS_14370 8712 8116 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024006.1 protein_id gnl|my_center|LOCUS_14370 9073 8723 gene locus_tag LOCUS_14380 9073 8723 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_14380 9588 9139 gene locus_tag LOCUS_14390 9588 9139 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024008.1 protein_id gnl|my_center|LOCUS_14390 10992 9721 gene locus_tag LOCUS_14400 10992 9721 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024009.1 protein_id gnl|my_center|LOCUS_14400 11196 11038 gene locus_tag LOCUS_14410 11196 11038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 11813 11466 gene locus_tag LOCUS_14420 11813 11466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 12323 13248 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgaaaagacgacccgcgaaaatagggtatggcaac >Feature sequence059 1520 258 gene locus_tag LOCUS_14430 gene lysA 1520 258 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_14430 1720 2172 gene locus_tag LOCUS_14440 1720 2172 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023960.1 protein_id gnl|my_center|LOCUS_14440 2358 2179 gene locus_tag LOCUS_14450 2358 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2987 2370 gene locus_tag LOCUS_14460 2987 2370 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024048.1 protein_id gnl|my_center|LOCUS_14460 4388 3006 gene locus_tag LOCUS_14470 4388 3006 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_14470 6126 4390 gene locus_tag LOCUS_14480 6126 4390 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 protein_id gnl|my_center|LOCUS_14480 6419 6117 gene locus_tag LOCUS_14490 6419 6117 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_14490 7498 6419 gene locus_tag LOCUS_14500 7498 6419 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024044.1 protein_id gnl|my_center|LOCUS_14500 8057 7506 gene locus_tag LOCUS_14510 8057 7506 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024043.1 protein_id gnl|my_center|LOCUS_14510 8341 8108 gene locus_tag LOCUS_14520 8341 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024042.1 protein_id gnl|my_center|LOCUS_14520 10292 8346 gene locus_tag LOCUS_14530 10292 8346 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_14530 10611 10285 gene locus_tag LOCUS_14540 10611 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 11981 10791 gene locus_tag LOCUS_14550 11981 10791 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065913.1 protein_id gnl|my_center|LOCUS_14550 12875 12012 gene locus_tag LOCUS_14560 12875 12012 CDS product geranylfarnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024038.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence060 421 131 gene locus_tag LOCUS_14570 421 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1428 418 gene locus_tag LOCUS_14580 gene cas1 1428 418 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_14580 2983 1433 gene locus_tag LOCUS_14590 2983 1433 CDS product TIGR02710 family CRISPR-associated CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259218.1 protein_id gnl|my_center|LOCUS_14590 4001 2958 gene locus_tag LOCUS_14600 4001 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 4503 4012 gene locus_tag LOCUS_14610 4503 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092693868.1 protein_id gnl|my_center|LOCUS_14610 5831 4500 gene locus_tag LOCUS_14620 5831 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 6573 5824 gene locus_tag LOCUS_14630 gene csm3 6573 5824 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582983.1 protein_id gnl|my_center|LOCUS_14630 7103 6576 gene locus_tag LOCUS_14640 7103 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 7615 7103 gene locus_tag LOCUS_14650 7615 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 8751 7612 gene locus_tag LOCUS_14660 8751 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 9422 8748 gene locus_tag LOCUS_14670 9422 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 11767 9419 gene locus_tag LOCUS_14680 11767 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 12566 11784 gene locus_tag LOCUS_14690 12566 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence061 3544 320 gene locus_tag LOCUS_14700 3544 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3849 5192 gene locus_tag LOCUS_14710 gene thrC 3849 5192 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_14710 6581 5283 gene locus_tag LOCUS_14720 6581 5283 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_14720 7055 7657 gene locus_tag LOCUS_14730 7055 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 7676 7984 gene locus_tag LOCUS_14740 7676 7984 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022421.1 protein_id gnl|my_center|LOCUS_14740 9099 8005 gene locus_tag LOCUS_14750 9099 8005 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_14750 10286 9177 gene locus_tag LOCUS_14760 10286 9177 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065160.1 protein_id gnl|my_center|LOCUS_14760 12155 10287 gene locus_tag LOCUS_14770 12155 10287 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_14770 12473 12240 gene locus_tag LOCUS_14780 12473 12240 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021598.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence062 148 717 gene locus_tag LOCUS_14790 148 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1445 735 gene locus_tag LOCUS_14800 1445 735 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249999.1 protein_id gnl|my_center|LOCUS_14800 1615 2022 gene locus_tag LOCUS_14810 1615 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2027 2758 gene locus_tag LOCUS_14820 2027 2758 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320034.1 protein_id gnl|my_center|LOCUS_14820 3485 2763 gene locus_tag LOCUS_14830 3485 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3711 3854 gene locus_tag LOCUS_14840 3711 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3835 4077 gene locus_tag LOCUS_14850 3835 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 4801 4379 gene locus_tag LOCUS_14860 4801 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4992 6269 gene locus_tag LOCUS_14870 gene thiC 4992 6269 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021793.1 protein_id gnl|my_center|LOCUS_14870 6384 7025 gene locus_tag LOCUS_14880 6384 7025 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023336.1 protein_id gnl|my_center|LOCUS_14880 9693 7111 gene locus_tag LOCUS_14890 9693 7111 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023471.1 protein_id gnl|my_center|LOCUS_14890 10694 9819 gene locus_tag LOCUS_14900 10694 9819 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064408.1 protein_id gnl|my_center|LOCUS_14900 11401 10691 gene locus_tag LOCUS_14910 11401 10691 CDS product DUF432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021723.1 protein_id gnl|my_center|LOCUS_14910 12534 11443 gene locus_tag LOCUS_14920 gene corA 12534 11443 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence063 90 488 gene locus_tag LOCUS_14930 90 488 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_14930 709 634 gene locus_tag LOCUS_t00260 709 634 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 949 761 gene locus_tag LOCUS_14940 949 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1502 1044 gene locus_tag LOCUS_14950 1502 1044 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023470.1 protein_id gnl|my_center|LOCUS_14950 1671 2297 gene locus_tag LOCUS_14960 1671 2297 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066030.1 protein_id gnl|my_center|LOCUS_14960 2414 3664 gene locus_tag LOCUS_14970 gene thiC 2414 3664 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020319.1 protein_id gnl|my_center|LOCUS_14970 3809 5005 gene locus_tag LOCUS_14980 3809 5005 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 protein_id gnl|my_center|LOCUS_14980 5057 5716 gene locus_tag LOCUS_14990 gene tpiA 5057 5716 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024480.1 protein_id gnl|my_center|LOCUS_14990 6037 5729 gene locus_tag LOCUS_15000 6037 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 7453 6146 gene locus_tag LOCUS_15010 7453 6146 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024468.1 protein_id gnl|my_center|LOCUS_15010 8271 7450 gene locus_tag LOCUS_15020 8271 7450 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024467.1 protein_id gnl|my_center|LOCUS_15020 8972 8268 gene locus_tag LOCUS_15030 gene aroD 8972 8268 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_15030 10126 8984 gene locus_tag LOCUS_15040 10126 8984 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024465.1 protein_id gnl|my_center|LOCUS_15040 10939 10142 gene locus_tag LOCUS_15050 10939 10142 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_15050 12443 11076 gene locus_tag LOCUS_15060 12443 11076 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244012.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence064 1528 242 gene locus_tag LOCUS_15070 1528 242 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589524.1 protein_id gnl|my_center|LOCUS_15070 2296 1580 gene locus_tag LOCUS_15080 2296 1580 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065106.1 protein_id gnl|my_center|LOCUS_15080 4235 2805 gene locus_tag LOCUS_15090 4235 2805 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065053.1 protein_id gnl|my_center|LOCUS_15090 4404 5861 gene locus_tag LOCUS_15100 4404 5861 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 protein_id gnl|my_center|LOCUS_15100 5858 6043 gene locus_tag LOCUS_15110 5858 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065052.1 protein_id gnl|my_center|LOCUS_15110 6058 6537 gene locus_tag LOCUS_15120 gene moaC 6058 6537 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066185.1 protein_id gnl|my_center|LOCUS_15120 6703 7551 gene locus_tag LOCUS_15130 6703 7551 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 protein_id gnl|my_center|LOCUS_15130 7575 7808 gene locus_tag LOCUS_15140 7575 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 7865 8587 gene locus_tag LOCUS_15150 7865 8587 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_15150 8568 9347 gene locus_tag LOCUS_15160 8568 9347 CDS product C15orf41 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065051.1 protein_id gnl|my_center|LOCUS_15160 9582 9313 gene locus_tag LOCUS_15170 9582 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 10015 11607 gene locus_tag LOCUS_15180 gene lysS 10015 11607 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066108.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence065 907 269 gene locus_tag LOCUS_15190 907 269 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990902.1 protein_id gnl|my_center|LOCUS_15190 2346 1060 gene locus_tag LOCUS_15200 gene thiC 2346 1060 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024209.1 protein_id gnl|my_center|LOCUS_15200 3556 2636 gene locus_tag LOCUS_15210 gene aglJ 3556 2636 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024210.1 protein_id gnl|my_center|LOCUS_15210 4131 3580 gene locus_tag LOCUS_15220 4131 3580 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024211.1 protein_id gnl|my_center|LOCUS_15220 5372 4218 gene locus_tag LOCUS_15230 gene scpB 5372 4218 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065962.1 protein_id gnl|my_center|LOCUS_15230 6228 5350 gene locus_tag LOCUS_15240 6228 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 9746 6225 gene locus_tag LOCUS_15250 gene smc 9746 6225 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_15250 10549 9782 gene locus_tag LOCUS_15260 10549 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 <11495 10661 gene locus_tag LOCUS_15270 <11495 10661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021188.1:DNA double-strand break repair ATPase Rad50 >Feature sequence066 136 63 gene locus_tag LOCUS_t00270 136 63 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 206 757 gene locus_tag LOCUS_15280 206 757 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020321.1 protein_id gnl|my_center|LOCUS_15280 1020 1445 gene locus_tag LOCUS_15290 1020 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1492 1932 gene locus_tag LOCUS_15300 1492 1932 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_15300 2047 3507 gene locus_tag LOCUS_15310 2047 3507 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020324.1 protein_id gnl|my_center|LOCUS_15310 3755 4279 gene locus_tag LOCUS_15320 3755 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020180.1 protein_id gnl|my_center|LOCUS_15320 4416 5246 gene locus_tag LOCUS_15330 4416 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 5700 5557 gene locus_tag LOCUS_15340 5700 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 5699 6856 gene locus_tag LOCUS_15350 5699 6856 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066055.1 protein_id gnl|my_center|LOCUS_15350 6843 7925 gene locus_tag LOCUS_15360 gene hisC 6843 7925 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_15360 8295 7936 gene locus_tag LOCUS_15370 8295 7936 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 protein_id gnl|my_center|LOCUS_15370 8392 8688 gene locus_tag LOCUS_15380 8392 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 8695 8886 gene locus_tag LOCUS_15390 8695 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 9316 8984 gene locus_tag LOCUS_15400 9316 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 9639 9328 gene locus_tag LOCUS_15410 9639 9328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 10513 9779 gene locus_tag LOCUS_15420 10513 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15420 10476 10751 gene locus_tag LOCUS_15430 10476 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence067 <1 614 gene locus_tag LOCUS_15440 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066558.1:matrixin family metalloprotease 954 1337 gene locus_tag LOCUS_15450 954 1337 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023881.1 protein_id gnl|my_center|LOCUS_15450 1401 2270 gene locus_tag LOCUS_15460 gene speB 1401 2270 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_15460 2924 4000 gene locus_tag LOCUS_15470 2924 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 5571 4087 gene locus_tag LOCUS_15480 5571 4087 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065134.1 protein_id gnl|my_center|LOCUS_15480 5756 6673 gene locus_tag LOCUS_15490 5756 6673 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023329.1 protein_id gnl|my_center|LOCUS_15490 8820 6934 gene locus_tag LOCUS_15500 gene acs 8820 6934 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_15500 9477 9127 gene locus_tag LOCUS_15510 9477 9127 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064993.1 protein_id gnl|my_center|LOCUS_15510 9827 9507 gene locus_tag LOCUS_15520 9827 9507 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020942.1 protein_id gnl|my_center|LOCUS_15520 10539 9955 gene locus_tag LOCUS_15530 10539 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence068 337 1815 gene locus_tag LOCUS_15540 gene argH 337 1815 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_15540 1843 3099 gene locus_tag LOCUS_15550 gene gatD 1843 3099 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_15550 3176 4504 gene locus_tag LOCUS_15560 gene aspS 3176 4504 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021688.1 protein_id gnl|my_center|LOCUS_15560 4518 5219 gene locus_tag LOCUS_15570 gene rpiA 4518 5219 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_15570 6438 5233 gene locus_tag LOCUS_15580 6438 5233 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_15580 7057 6500 gene locus_tag LOCUS_15590 7057 6500 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066220.1 protein_id gnl|my_center|LOCUS_15590 7680 7054 gene locus_tag LOCUS_15600 7680 7054 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021452.1 protein_id gnl|my_center|LOCUS_15600 7812 7886 gene locus_tag LOCUS_t00280 7812 7886 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10349 8130 gene locus_tag LOCUS_15610 10349 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence069 656 1744 gene locus_tag LOCUS_15620 gene ahbD 656 1744 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_15620 1728 2183 gene locus_tag LOCUS_15630 1728 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 2204 2668 gene locus_tag LOCUS_15640 gene ahbB 2204 2668 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 protein_id gnl|my_center|LOCUS_15640 2705 3376 gene locus_tag LOCUS_15650 2705 3376 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020625.1 protein_id gnl|my_center|LOCUS_15650 3440 4720 gene locus_tag LOCUS_15660 gene hemA 3440 4720 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_15660 4725 5699 gene locus_tag LOCUS_15670 gene hemB 4725 5699 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020627.1 protein_id gnl|my_center|LOCUS_15670 5717 6982 gene locus_tag LOCUS_15680 gene hemL 5717 6982 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_15680 6995 7915 gene locus_tag LOCUS_15690 gene hemC 6995 7915 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020631.1 protein_id gnl|my_center|LOCUS_15690 7932 8834 gene locus_tag LOCUS_15700 7932 8834 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066118.1 protein_id gnl|my_center|LOCUS_15700 8834 9616 gene locus_tag LOCUS_15710 8834 9616 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence070 542 222 gene locus_tag LOCUS_15720 542 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 871 1122 gene locus_tag LOCUS_15730 871 1122 CDS product Gar1/Naf1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020658.1 protein_id gnl|my_center|LOCUS_15730 1236 2249 gene locus_tag LOCUS_15740 1236 2249 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_15740 2320 2943 gene locus_tag LOCUS_15750 2320 2943 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064923.1 protein_id gnl|my_center|LOCUS_15750 2940 3950 gene locus_tag LOCUS_15760 2940 3950 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020662.1 protein_id gnl|my_center|LOCUS_15760 3993 4064 gene locus_tag LOCUS_t00290 3993 4064 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4247 4441 gene locus_tag LOCUS_15770 4247 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 5114 5782 gene locus_tag LOCUS_15780 5114 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5967 6725 gene locus_tag LOCUS_15790 gene sfsA 5967 6725 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877131.1 protein_id gnl|my_center|LOCUS_15790 7656 6907 gene locus_tag LOCUS_15800 7656 6907 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250964.1 protein_id gnl|my_center|LOCUS_15800 9525 7852 gene locus_tag LOCUS_15810 9525 7852 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022420.1 protein_id gnl|my_center|LOCUS_15810 <10527 9635 gene locus_tag LOCUS_15820 <10527 9635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990595.1:CHASE4 domain-containing protein >Feature sequence071 1231 353 gene locus_tag LOCUS_15830 gene htpX 1231 353 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_15830 2605 1292 gene locus_tag LOCUS_15840 2605 1292 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064814.1 protein_id gnl|my_center|LOCUS_15840 2831 3604 gene locus_tag LOCUS_15850 gene moaA 2831 3604 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020164.1 protein_id gnl|my_center|LOCUS_15850 3619 3768 gene locus_tag LOCUS_15860 3619 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 4559 3774 gene locus_tag LOCUS_15870 gene surE 4559 3774 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_15870 5079 4666 gene locus_tag LOCUS_15880 5079 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 5457 5182 gene locus_tag LOCUS_15890 5457 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 5707 8481 gene locus_tag LOCUS_15900 gene alaS 5707 8481 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_15900 9994 8552 gene locus_tag LOCUS_15910 9994 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence072 322 1176 gene locus_tag LOCUS_15920 322 1176 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_15920 1946 1182 gene locus_tag LOCUS_15930 1946 1182 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066008.1 protein_id gnl|my_center|LOCUS_15930 2362 1973 gene locus_tag LOCUS_15940 gene tsaA 2362 1973 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064869.1 protein_id gnl|my_center|LOCUS_15940 3061 2453 gene locus_tag LOCUS_15950 3061 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022949.1 protein_id gnl|my_center|LOCUS_15950 3258 4307 gene locus_tag LOCUS_15960 3258 4307 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_15960 4458 4967 gene locus_tag LOCUS_15970 4458 4967 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022953.1 protein_id gnl|my_center|LOCUS_15970 4964 5752 gene locus_tag LOCUS_15980 4964 5752 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589532.1 protein_id gnl|my_center|LOCUS_15980 5769 6305 gene locus_tag LOCUS_15990 5769 6305 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022955.1 protein_id gnl|my_center|LOCUS_15990 6539 6306 gene locus_tag LOCUS_16000 6539 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022956.1 protein_id gnl|my_center|LOCUS_16000 7203 6637 gene locus_tag LOCUS_16010 7203 6637 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022957.1 protein_id gnl|my_center|LOCUS_16010 8451 7204 gene locus_tag LOCUS_16020 8451 7204 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022958.1 protein_id gnl|my_center|LOCUS_16020 <10340 8646 gene locus_tag LOCUS_16030 <10340 8646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404984.1:amino acid permease >Feature sequence073 668 3 gene locus_tag LOCUS_16040 668 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1054 3828 gene locus_tag LOCUS_16050 1054 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3864 5543 gene locus_tag LOCUS_16060 3864 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 7968 5854 gene locus_tag LOCUS_16070 7968 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 9131 7965 gene locus_tag LOCUS_16080 9131 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 10067 9138 gene locus_tag LOCUS_16090 10067 9138 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110188582.1 protein_id gnl|my_center|LOCUS_16090 10000 10188 gene locus_tag LOCUS_16100 10000 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence074 354 1067 gene locus_tag LOCUS_16110 354 1067 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_16110 1152 3242 gene locus_tag LOCUS_16120 1152 3242 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_16120 3253 3546 gene locus_tag LOCUS_16130 3253 3546 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020725.1 protein_id gnl|my_center|LOCUS_16130 3607 4239 gene locus_tag LOCUS_16140 3607 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066125.1 protein_id gnl|my_center|LOCUS_16140 4236 5156 gene locus_tag LOCUS_16150 4236 5156 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020723.1 protein_id gnl|my_center|LOCUS_16150 5743 5165 gene locus_tag LOCUS_16160 5743 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 6717 5740 gene locus_tag LOCUS_16170 6717 5740 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_16170 8237 6747 gene locus_tag LOCUS_16180 8237 6747 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 protein_id gnl|my_center|LOCUS_16180 9975 8248 gene locus_tag LOCUS_16190 gene oadA 9975 8248 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020719.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence075 192 710 gene locus_tag LOCUS_16200 192 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3009 688 gene locus_tag LOCUS_16210 3009 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 4429 3119 gene locus_tag LOCUS_16220 4429 3119 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_16220 5770 4430 gene locus_tag LOCUS_16230 5770 4430 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990640.1 protein_id gnl|my_center|LOCUS_16230 7685 5787 gene locus_tag LOCUS_16240 gene lonB 7685 5787 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023222.1 protein_id gnl|my_center|LOCUS_16240 7838 8278 gene locus_tag LOCUS_16250 7838 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023229.1 protein_id gnl|my_center|LOCUS_16250 8598 8671 gene locus_tag LOCUS_t00300 8598 8671 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8740 8816 gene locus_tag LOCUS_t00310 8740 8816 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8825 8896 gene locus_tag LOCUS_t00320 8825 8896 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9956 9042 gene locus_tag LOCUS_16260 9956 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence076 1660 152 gene locus_tag LOCUS_16270 1660 152 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024395.1 protein_id gnl|my_center|LOCUS_16270 2089 1694 gene locus_tag LOCUS_16280 2089 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2327 3343 gene locus_tag LOCUS_16290 2327 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 3804 4055 gene locus_tag LOCUS_16300 gene copZ 3804 4055 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542561.1 protein_id gnl|my_center|LOCUS_16300 4067 6838 gene locus_tag LOCUS_16310 4067 6838 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021360.1 protein_id gnl|my_center|LOCUS_16310 6852 7082 gene locus_tag LOCUS_16320 6852 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 7552 7477 gene locus_tag LOCUS_t00330 7552 7477 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7981 7619 gene locus_tag LOCUS_16330 7981 7619 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589516.1 protein_id gnl|my_center|LOCUS_16330 8245 8021 gene locus_tag LOCUS_16340 8245 8021 CDS product Sm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021429.1 protein_id gnl|my_center|LOCUS_16340 8737 8360 gene locus_tag LOCUS_16350 8737 8360 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021428.1 protein_id gnl|my_center|LOCUS_16350 8853 9302 gene locus_tag LOCUS_16360 8853 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence077 794 1867 gene locus_tag LOCUS_16370 794 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2216 2013 gene locus_tag LOCUS_16380 2216 2013 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876887.1 protein_id gnl|my_center|LOCUS_16380 3141 2428 gene locus_tag LOCUS_16390 3141 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3696 3160 gene locus_tag LOCUS_16400 3696 3160 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024115.1 protein_id gnl|my_center|LOCUS_16400 4354 3716 gene locus_tag LOCUS_16410 4354 3716 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020851.1 protein_id gnl|my_center|LOCUS_16410 5533 4364 gene locus_tag LOCUS_16420 5533 4364 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020852.1 protein_id gnl|my_center|LOCUS_16420 5965 5546 gene locus_tag LOCUS_16430 5965 5546 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020853.1 protein_id gnl|my_center|LOCUS_16430 6215 5970 gene locus_tag LOCUS_16440 6215 5970 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020854.1 protein_id gnl|my_center|LOCUS_16440 7083 6268 gene locus_tag LOCUS_16450 7083 6268 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860293.1 protein_id gnl|my_center|LOCUS_16450 8479 7139 gene locus_tag LOCUS_16460 8479 7139 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065684.1 protein_id gnl|my_center|LOCUS_16460 9812 8679 gene locus_tag LOCUS_16470 9812 8679 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065833.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence078 749 111 gene locus_tag LOCUS_16480 749 111 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248985.1 protein_id gnl|my_center|LOCUS_16480 1396 746 gene locus_tag LOCUS_16490 1396 746 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065077.1 protein_id gnl|my_center|LOCUS_16490 1535 1825 gene locus_tag LOCUS_16500 1535 1825 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869817.1 protein_id gnl|my_center|LOCUS_16500 2610 1840 gene locus_tag LOCUS_16510 2610 1840 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021309.1 protein_id gnl|my_center|LOCUS_16510 3253 2621 gene locus_tag LOCUS_16520 3253 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 6251 3363 gene locus_tag LOCUS_16530 gene leuS 6251 3363 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 protein_id gnl|my_center|LOCUS_16530 6443 6952 gene locus_tag LOCUS_16540 gene cgi121 6443 6952 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021174.1 protein_id gnl|my_center|LOCUS_16540 7061 8152 gene locus_tag LOCUS_16550 gene glpX 7061 8152 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021176.1 protein_id gnl|my_center|LOCUS_16550 8214 9455 gene locus_tag LOCUS_16560 8214 9455 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021177.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence079 87 14 gene locus_tag LOCUS_t00340 87 14 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 939 157 gene locus_tag LOCUS_16570 939 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2304 1147 gene locus_tag LOCUS_16580 gene pscS 2304 1147 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020767.1 protein_id gnl|my_center|LOCUS_16580 2908 2333 gene locus_tag LOCUS_16590 2908 2333 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_16590 3298 3020 gene locus_tag LOCUS_16600 3298 3020 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020766.1 protein_id gnl|my_center|LOCUS_16600 4052 3339 gene locus_tag LOCUS_16610 4052 3339 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020765.1 protein_id gnl|my_center|LOCUS_16610 4805 4203 gene locus_tag LOCUS_16620 4805 4203 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_16620 5815 4823 gene locus_tag LOCUS_16630 gene dph2 5815 4823 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_16630 6374 5805 gene locus_tag LOCUS_16640 gene hpt 6374 5805 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020762.1 protein_id gnl|my_center|LOCUS_16640 7463 6540 gene locus_tag LOCUS_16650 gene cofD 7463 6540 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066127.1 protein_id gnl|my_center|LOCUS_16650 7540 8736 gene locus_tag LOCUS_16660 7540 8736 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_16660 8739 9089 gene locus_tag LOCUS_16670 8739 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020757.1 protein_id gnl|my_center|LOCUS_16670 9095 9646 gene locus_tag LOCUS_16680 9095 9646 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_16680 9766 9843 gene locus_tag LOCUS_t00350 9766 9843 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence080 4574 1527 gene locus_tag LOCUS_16690 4574 1527 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024289.1 protein_id gnl|my_center|LOCUS_16690 4746 6185 gene locus_tag LOCUS_16700 gene pyk 4746 6185 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_16700 6661 6188 gene locus_tag LOCUS_16710 gene msrA 6661 6188 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021447.1 protein_id gnl|my_center|LOCUS_16710 6815 7822 gene locus_tag LOCUS_16720 6815 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 8808 7828 gene locus_tag LOCUS_16730 8808 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870163.1 protein_id gnl|my_center|LOCUS_16730 9169 8801 gene locus_tag LOCUS_16740 9169 8801 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023097.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence081 1200 1646 gene locus_tag LOCUS_16750 1200 1646 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_16750 1660 2220 gene locus_tag LOCUS_16760 1660 2220 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021137.1 protein_id gnl|my_center|LOCUS_16760 2233 2613 gene locus_tag LOCUS_16770 2233 2613 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 protein_id gnl|my_center|LOCUS_16770 2644 3438 gene locus_tag LOCUS_16780 2644 3438 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_16780 3493 3580 gene locus_tag LOCUS_t00360 3493 3580 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3757 4176 gene locus_tag LOCUS_16790 3757 4176 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942952.1 protein_id gnl|my_center|LOCUS_16790 4395 6884 gene locus_tag LOCUS_16800 4395 6884 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065792.1 protein_id gnl|my_center|LOCUS_16800 6940 7440 gene locus_tag LOCUS_16810 gene hacB 6940 7440 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065791.1 protein_id gnl|my_center|LOCUS_16810 7437 8303 gene locus_tag LOCUS_16820 7437 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023654.1 protein_id gnl|my_center|LOCUS_16820 8300 9298 gene locus_tag LOCUS_16830 8300 9298 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023652.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence082 1815 91 gene locus_tag LOCUS_16840 gene polX 1815 91 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_16840 2537 1860 gene locus_tag LOCUS_16850 2537 1860 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024310.1 protein_id gnl|my_center|LOCUS_16850 2615 5260 gene locus_tag LOCUS_16860 2615 5260 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545920.1 protein_id gnl|my_center|LOCUS_16860 5484 6098 gene locus_tag LOCUS_16870 gene tmk 5484 6098 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_16870 6422 6171 gene locus_tag LOCUS_16880 6422 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 7165 6455 gene locus_tag LOCUS_16890 7165 6455 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024313.1 protein_id gnl|my_center|LOCUS_16890 7213 7911 gene locus_tag LOCUS_16900 7213 7911 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_16900 8140 9096 gene locus_tag LOCUS_16910 8140 9096 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_16910 9229 9471 gene locus_tag LOCUS_16920 9229 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence083 170 517 gene locus_tag LOCUS_16930 170 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2226 523 gene locus_tag LOCUS_16940 gene argS 2226 523 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_16940 3484 2240 gene locus_tag LOCUS_16950 gene prf1 3484 2240 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020101.1 protein_id gnl|my_center|LOCUS_16950 4360 3611 gene locus_tag LOCUS_16960 4360 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4613 4750 gene locus_tag LOCUS_16970 4613 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 5163 6410 gene locus_tag LOCUS_16980 5163 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 7468 6698 gene locus_tag LOCUS_16990 7468 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 9413 7773 gene locus_tag LOCUS_17000 9413 7773 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020208.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence084 522 262 gene locus_tag LOCUS_17010 522 262 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545162.1 protein_id gnl|my_center|LOCUS_17010 1416 634 gene locus_tag LOCUS_17020 1416 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1931 1620 gene locus_tag LOCUS_17030 1931 1620 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023626.1 protein_id gnl|my_center|LOCUS_17030 3020 2049 gene locus_tag LOCUS_17040 3020 2049 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_17040 5340 3400 gene locus_tag LOCUS_17050 5340 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021319.1 protein_id gnl|my_center|LOCUS_17050 7822 5330 gene locus_tag LOCUS_17060 7822 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 <9315 8376 gene locus_tag LOCUS_17070 <9315 8376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257005.1:GDP-mannose 4,6-dehydratase >Feature sequence085 180 536 gene locus_tag LOCUS_17080 180 536 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064788.1 protein_id gnl|my_center|LOCUS_17080 539 1633 gene locus_tag LOCUS_17090 539 1633 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020074.1 protein_id gnl|my_center|LOCUS_17090 1673 3760 gene locus_tag LOCUS_17100 1673 3760 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870052.1 protein_id gnl|my_center|LOCUS_17100 3780 4394 gene locus_tag LOCUS_17110 3780 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 4444 5265 gene locus_tag LOCUS_17120 4444 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 5298 5915 gene locus_tag LOCUS_17130 5298 5915 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020071.1 protein_id gnl|my_center|LOCUS_17130 5935 6408 gene locus_tag LOCUS_17140 5935 6408 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020070.1 protein_id gnl|my_center|LOCUS_17140 6458 7462 gene locus_tag LOCUS_17150 6458 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 7798 8424 gene locus_tag LOCUS_17160 7798 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 8435 9040 gene locus_tag LOCUS_17170 8435 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence086 727 365 gene locus_tag LOCUS_17180 727 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1490 717 gene locus_tag LOCUS_17190 1490 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1652 2464 gene locus_tag LOCUS_17200 1652 2464 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870406.1 protein_id gnl|my_center|LOCUS_17200 2491 3273 gene locus_tag LOCUS_17210 gene flaB3 2491 3273 CDS product flagellin B3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248995.1 protein_id gnl|my_center|LOCUS_17210 3419 4156 gene locus_tag LOCUS_17220 3419 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 4190 5131 gene locus_tag LOCUS_17230 4190 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 5153 7093 gene locus_tag LOCUS_17240 5153 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 7118 8182 gene locus_tag LOCUS_17250 7118 8182 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence087 248 1381 gene locus_tag LOCUS_17260 248 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1388 2389 gene locus_tag LOCUS_17270 1388 2389 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_17270 2392 2970 gene locus_tag LOCUS_17280 2392 2970 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878428.1 protein_id gnl|my_center|LOCUS_17280 3073 4143 gene locus_tag LOCUS_17290 3073 4143 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_17290 4143 5147 gene locus_tag LOCUS_17300 4143 5147 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_17300 6146 5277 gene locus_tag LOCUS_17310 gene galU 6146 5277 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065994.1 protein_id gnl|my_center|LOCUS_17310 7408 6158 gene locus_tag LOCUS_17320 7408 6158 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860339.1 protein_id gnl|my_center|LOCUS_17320 7878 7603 gene locus_tag LOCUS_17330 7878 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence088 274 3702 gene locus_tag LOCUS_17340 274 3702 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024425.1 protein_id gnl|my_center|LOCUS_17340 4539 3811 gene locus_tag LOCUS_17350 4539 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4674 5864 gene locus_tag LOCUS_17360 4674 5864 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_17360 5971 6894 gene locus_tag LOCUS_17370 5971 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 7524 6895 gene locus_tag LOCUS_17380 gene engB 7524 6895 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022535.1 protein_id gnl|my_center|LOCUS_17380 8556 7543 gene locus_tag LOCUS_17390 8556 7543 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065440.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence089 <1 670 gene locus_tag LOCUS_17400 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000103771.1:bile acid:sodium symporter 886 2976 gene locus_tag LOCUS_17410 886 2976 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878706.1 protein_id gnl|my_center|LOCUS_17410 3044 4117 gene locus_tag LOCUS_17420 3044 4117 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259751.1 protein_id gnl|my_center|LOCUS_17420 4794 4657 gene locus_tag LOCUS_17430 4794 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 5479 4910 gene locus_tag LOCUS_17440 5479 4910 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023516.1 protein_id gnl|my_center|LOCUS_17440 6550 5516 gene locus_tag LOCUS_17450 6550 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250153.1 protein_id gnl|my_center|LOCUS_17450 7076 6540 gene locus_tag LOCUS_17460 7076 6540 CDS product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250154.1 protein_id gnl|my_center|LOCUS_17460 8153 7395 gene locus_tag LOCUS_17470 8153 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 8377 8162 gene locus_tag LOCUS_17480 8377 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence090 2190 142 gene locus_tag LOCUS_17490 2190 142 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_17490 3442 2342 gene locus_tag LOCUS_17500 gene aroC 3442 2342 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_17500 4387 3488 gene locus_tag LOCUS_17510 4387 3488 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_17510 4596 5357 gene locus_tag LOCUS_17520 4596 5357 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088944.1 protein_id gnl|my_center|LOCUS_17520 7116 5773 gene locus_tag LOCUS_17530 7116 5773 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021968.1 protein_id gnl|my_center|LOCUS_17530 7353 8198 gene locus_tag LOCUS_17540 7353 8198 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_17540 8578 8207 gene locus_tag LOCUS_17550 8578 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence091 <1 853 gene locus_tag LOCUS_17560 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986854.1:response regulator transcription factor 2074 1028 gene locus_tag LOCUS_17570 2074 1028 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064837.1 protein_id gnl|my_center|LOCUS_17570 2221 3510 gene locus_tag LOCUS_17580 2221 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 3500 3931 gene locus_tag LOCUS_17590 3500 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 4015 4512 gene locus_tag LOCUS_17600 4015 4512 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902674.1 protein_id gnl|my_center|LOCUS_17600 4528 5223 gene locus_tag LOCUS_17610 4528 5223 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496652.1 protein_id gnl|my_center|LOCUS_17610 5240 6898 gene locus_tag LOCUS_17620 5240 6898 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496653.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence092 818 135 gene locus_tag LOCUS_17630 818 135 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675715.1 protein_id gnl|my_center|LOCUS_17630 1089 3425 gene locus_tag LOCUS_17640 1089 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 4613 3435 gene locus_tag LOCUS_17650 4613 3435 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021091.1 protein_id gnl|my_center|LOCUS_17650 5768 4716 gene locus_tag LOCUS_17660 5768 4716 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024332.1 protein_id gnl|my_center|LOCUS_17660 6835 5768 gene locus_tag LOCUS_17670 gene wecB 6835 5768 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_17670 7921 6845 gene locus_tag LOCUS_17680 7921 6845 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021093.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence093 254 910 gene locus_tag LOCUS_17690 254 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 984 1349 gene locus_tag LOCUS_17700 984 1349 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022005.1 protein_id gnl|my_center|LOCUS_17700 1982 1371 gene locus_tag LOCUS_17710 1982 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2834 2013 gene locus_tag LOCUS_17720 2834 2013 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020797.1 protein_id gnl|my_center|LOCUS_17720 3558 5339 gene locus_tag LOCUS_17730 3558 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020427.1 protein_id gnl|my_center|LOCUS_17730 5398 5952 gene locus_tag LOCUS_17740 5398 5952 CDS product DUF111 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990917.1 protein_id gnl|my_center|LOCUS_17740 6000 6794 gene locus_tag LOCUS_17750 gene larB 6000 6794 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_17750 6791 7990 gene locus_tag LOCUS_17760 gene larC 6791 7990 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence094 58 852 gene locus_tag LOCUS_17770 58 852 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878499.1 protein_id gnl|my_center|LOCUS_17770 1353 1811 gene locus_tag LOCUS_17780 1353 1811 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022827.1 protein_id gnl|my_center|LOCUS_17780 1827 3077 gene locus_tag LOCUS_17790 1827 3077 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065549.1 protein_id gnl|my_center|LOCUS_17790 3077 3481 gene locus_tag LOCUS_17800 3077 3481 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065550.1 protein_id gnl|my_center|LOCUS_17800 3502 3930 gene locus_tag LOCUS_17810 3502 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 4576 5067 gene locus_tag LOCUS_17820 4576 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 5184 5483 gene locus_tag LOCUS_17830 5184 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064198.1 protein_id gnl|my_center|LOCUS_17830 5603 6328 gene locus_tag LOCUS_17840 5603 6328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_17840 6318 6992 gene locus_tag LOCUS_17850 6318 6992 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_17850 7060 7764 gene locus_tag LOCUS_17860 7060 7764 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065117.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence095 344 1642 gene locus_tag LOCUS_17870 344 1642 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021464.1 protein_id gnl|my_center|LOCUS_17870 1667 3139 gene locus_tag LOCUS_17880 gene pap 1667 3139 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065389.1 protein_id gnl|my_center|LOCUS_17880 4013 3513 gene locus_tag LOCUS_17890 4013 3513 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020079.1 protein_id gnl|my_center|LOCUS_17890 7258 4031 gene locus_tag LOCUS_17900 7258 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence096 82 1890 gene locus_tag LOCUS_17910 82 1890 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209617549.1 protein_id gnl|my_center|LOCUS_17910 1887 2996 gene locus_tag LOCUS_17920 1887 2996 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064850.1 protein_id gnl|my_center|LOCUS_17920 3020 3799 gene locus_tag LOCUS_17930 3020 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3855 5360 gene locus_tag LOCUS_17940 3855 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5495 6823 gene locus_tag LOCUS_17950 5495 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064846.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence097 100 594 gene locus_tag LOCUS_17960 100 594 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436147.1 protein_id gnl|my_center|LOCUS_17960 939 1763 gene locus_tag LOCUS_17970 939 1763 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860106.1 protein_id gnl|my_center|LOCUS_17970 2051 2776 gene locus_tag LOCUS_17980 2051 2776 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021948.1 protein_id gnl|my_center|LOCUS_17980 3571 3870 gene locus_tag LOCUS_17990 3571 3870 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259332.1 protein_id gnl|my_center|LOCUS_17990 3857 4054 gene locus_tag LOCUS_18000 3857 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 4680 4429 gene locus_tag LOCUS_18010 4680 4429 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022120.1 protein_id gnl|my_center|LOCUS_18010 5304 5477 gene locus_tag LOCUS_18020 5304 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 5474 5836 gene locus_tag LOCUS_18030 5474 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence098 179 1942 gene locus_tag LOCUS_18040 179 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2701 2090 gene locus_tag LOCUS_18050 2701 2090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 protein_id gnl|my_center|LOCUS_18050 3668 2691 gene locus_tag LOCUS_18060 3668 2691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021908.1 protein_id gnl|my_center|LOCUS_18060 4579 3722 gene locus_tag LOCUS_18070 4579 3722 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021909.1 protein_id gnl|my_center|LOCUS_18070 5565 4576 gene locus_tag LOCUS_18080 5565 4576 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_18080 <7236 5696 gene locus_tag LOCUS_18090 <7236 5696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021912.1:ABC transporter substrate-binding protein >Feature sequence099 60 2018 gene locus_tag LOCUS_18100 60 2018 CDS product DUF2341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064883.1 protein_id gnl|my_center|LOCUS_18100 3690 2041 gene locus_tag LOCUS_18110 3690 2041 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021438.1 protein_id gnl|my_center|LOCUS_18110 4123 3713 gene locus_tag LOCUS_18120 4123 3713 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_18120 4716 4138 gene locus_tag LOCUS_18130 4716 4138 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021440.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence100 1080 454 gene locus_tag LOCUS_18140 1080 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 3830 1074 gene locus_tag LOCUS_18150 3830 1074 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_18150 5412 6227 gene locus_tag LOCUS_18160 5412 6227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_18160 6751 6209 gene locus_tag LOCUS_18170 gene msrA 6751 6209 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence101 344 1270 gene locus_tag LOCUS_18180 344 1270 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023905.1 protein_id gnl|my_center|LOCUS_18180 1978 1280 gene locus_tag LOCUS_18190 1978 1280 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173813.1 protein_id gnl|my_center|LOCUS_18190 3845 2229 gene locus_tag LOCUS_18200 gene purH 3845 2229 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023907.1 protein_id gnl|my_center|LOCUS_18200 5828 3924 gene locus_tag LOCUS_18210 5828 3924 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250266.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence102 1318 482 gene locus_tag LOCUS_18220 1318 482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065941.1 protein_id gnl|my_center|LOCUS_18220 2246 1302 gene locus_tag LOCUS_18230 2246 1302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024132.1 protein_id gnl|my_center|LOCUS_18230 3024 2281 gene locus_tag LOCUS_18240 3024 2281 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990902.1 protein_id gnl|my_center|LOCUS_18240 4656 3079 gene locus_tag LOCUS_18250 4656 3079 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990685.1 protein_id gnl|my_center|LOCUS_18250 5717 4809 gene locus_tag LOCUS_18260 5717 4809 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024135.1 protein_id gnl|my_center|LOCUS_18260 6642 5710 gene locus_tag LOCUS_18270 6642 5710 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020923.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence103 2452 791 gene locus_tag LOCUS_18280 2452 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 3240 2470 gene locus_tag LOCUS_18290 3240 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 4270 3272 gene locus_tag LOCUS_18300 4270 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 4689 4348 gene locus_tag LOCUS_18310 4689 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 5670 4699 gene locus_tag LOCUS_18320 5670 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 6303 5716 gene locus_tag LOCUS_18330 6303 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence104 1794 274 gene locus_tag LOCUS_18340 1794 274 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_18340 2619 2395 gene locus_tag LOCUS_18350 2619 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 5983 2678 gene locus_tag LOCUS_18360 5983 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 6357 5980 gene locus_tag LOCUS_18370 6357 5980 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence105 287 832 gene locus_tag LOCUS_18380 287 832 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024447.1 protein_id gnl|my_center|LOCUS_18380 1116 934 gene locus_tag LOCUS_18390 1116 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1181 3340 gene locus_tag LOCUS_18400 1181 3340 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024445.1 protein_id gnl|my_center|LOCUS_18400 3337 3753 gene locus_tag LOCUS_18410 3337 3753 CDS product monovalent cation/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024444.1 protein_id gnl|my_center|LOCUS_18410 3750 4166 gene locus_tag LOCUS_18420 3750 4166 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024443.1 protein_id gnl|my_center|LOCUS_18420 4163 5701 gene locus_tag LOCUS_18430 4163 5701 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066018.1 protein_id gnl|my_center|LOCUS_18430 5698 6192 gene locus_tag LOCUS_18440 5698 6192 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024441.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence106 401 219 gene locus_tag LOCUS_18450 401 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 901 707 gene locus_tag LOCUS_18460 901 707 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_18460 1323 919 gene locus_tag LOCUS_18470 1323 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1936 1772 gene locus_tag LOCUS_18480 1936 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2258 2171 gene locus_tag LOCUS_t00370 2258 2171 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3102 2353 gene locus_tag LOCUS_18490 3102 2353 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022767.1 protein_id gnl|my_center|LOCUS_18490 5372 3279 gene locus_tag LOCUS_18500 5372 3279 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948168.1 protein_id gnl|my_center|LOCUS_18500 6237 5590 gene locus_tag LOCUS_18510 6237 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence107 513 890 gene locus_tag LOCUS_18520 513 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1010 2383 gene locus_tag LOCUS_18530 1010 2383 CDS product IS5-like element ISLca2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568911.1 protein_id gnl|my_center|LOCUS_18530 2355 2573 gene locus_tag LOCUS_18540 2355 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 3040 2756 gene locus_tag LOCUS_18550 3040 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18550 3122 3724 gene locus_tag LOCUS_18560 3122 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3721 4488 gene locus_tag LOCUS_18570 gene istB 3721 4488 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_18570 5226 4573 gene locus_tag LOCUS_18580 5226 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 5765 5388 gene locus_tag LOCUS_18590 5765 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence108 3 290 gene locus_tag LOCUS_18600 3 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 658 4089 gene locus_tag LOCUS_18610 658 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 4419 4347 gene locus_tag LOCUS_t00380 4419 4347 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5931 4735 gene locus_tag LOCUS_18620 5931 4735 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020274.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence109 1540 644 gene locus_tag LOCUS_18630 1540 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2978 1608 gene locus_tag LOCUS_18640 2978 1608 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_18640 3349 4239 gene locus_tag LOCUS_18650 3349 4239 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_18650 4261 5160 gene locus_tag LOCUS_18660 gene pstC 4261 5160 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_18660 5157 6014 gene locus_tag LOCUS_18670 gene pstA 5157 6014 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990843.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence110 377 721 gene locus_tag LOCUS_18680 377 721 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023848.1 protein_id gnl|my_center|LOCUS_18680 2325 850 gene locus_tag LOCUS_18690 2325 850 CDS product DUF2193 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065108.1 protein_id gnl|my_center|LOCUS_18690 3077 2697 gene locus_tag LOCUS_18700 3077 2697 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_18700 3348 3112 gene locus_tag LOCUS_18710 3348 3112 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_18710 4088 3399 gene locus_tag LOCUS_18720 4088 3399 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_18720 5005 4109 gene locus_tag LOCUS_18730 5005 4109 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023833.1 protein_id gnl|my_center|LOCUS_18730 5339 5653 gene locus_tag LOCUS_18740 5339 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023845.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence111 1585 317 gene locus_tag LOCUS_18750 1585 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2347 1613 gene locus_tag LOCUS_18760 2347 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 4255 3383 gene locus_tag LOCUS_18770 gene hisG 4255 3383 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_18770 4426 4977 gene locus_tag LOCUS_18780 4426 4977 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941521.1 protein_id gnl|my_center|LOCUS_18780 5272 5478 gene locus_tag LOCUS_18790 5272 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence112 439 143 gene locus_tag LOCUS_18800 439 143 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990605.1 protein_id gnl|my_center|LOCUS_18800 854 2428 gene locus_tag LOCUS_18810 854 2428 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860105.1 protein_id gnl|my_center|LOCUS_18810 2629 4338 gene locus_tag LOCUS_18820 2629 4338 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021096.1 protein_id gnl|my_center|LOCUS_18820 4332 5108 gene locus_tag LOCUS_18830 4332 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021095.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence113 166 864 gene locus_tag LOCUS_18840 166 864 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021673.1 protein_id gnl|my_center|LOCUS_18840 1285 2562 gene locus_tag LOCUS_18850 gene eno 1285 2562 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065179.1 protein_id gnl|my_center|LOCUS_18850 2611 3237 gene locus_tag LOCUS_18860 2611 3237 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_18860 3317 4486 gene locus_tag LOCUS_18870 3317 4486 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022460.1 protein_id gnl|my_center|LOCUS_18870 4639 5085 gene locus_tag LOCUS_18880 4639 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence114 434 1654 gene locus_tag LOCUS_18890 434 1654 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_18890 1822 3429 gene locus_tag LOCUS_18900 gene ade 1822 3429 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_18900 3604 4830 gene locus_tag LOCUS_18910 3604 4830 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020830.1 protein_id gnl|my_center|LOCUS_18910 5203 4862 gene locus_tag LOCUS_18920 5203 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065385.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence115 156 1562 gene locus_tag LOCUS_18930 156 1562 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_18930 2054 2869 gene locus_tag LOCUS_18940 2054 2869 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_18940 2971 3891 gene locus_tag LOCUS_18950 gene nadA 2971 3891 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_18950 3902 4750 gene locus_tag LOCUS_18960 3902 4750 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020999.1 protein_id gnl|my_center|LOCUS_18960 <5280 4751 gene locus_tag LOCUS_18970 <5280 4751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021000.1:methionine adenosyltransferase >Feature sequence116 620 81 gene locus_tag LOCUS_18980 gene pyrE 620 81 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023240.1 protein_id gnl|my_center|LOCUS_18980 1184 657 gene locus_tag LOCUS_18990 1184 657 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023239.1 protein_id gnl|my_center|LOCUS_18990 1427 2461 gene locus_tag LOCUS_19000 1427 2461 CDS product cytochrome c-type biogenesis CcmF C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065666.1 protein_id gnl|my_center|LOCUS_19000 2747 3523 gene locus_tag LOCUS_19010 2747 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3821 3549 gene locus_tag LOCUS_19020 3821 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 5025 3805 gene locus_tag LOCUS_19030 gene xseA 5025 3805 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438130.1 protein_id gnl|my_center|LOCUS_19030 4979 5143 gene locus_tag LOCUS_19040 4979 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence117 1158 352 gene locus_tag LOCUS_19050 gene artA 1158 352 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064816.1 protein_id gnl|my_center|LOCUS_19050 1220 1636 gene locus_tag LOCUS_19060 1220 1636 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020172.1 protein_id gnl|my_center|LOCUS_19060 1614 1928 gene locus_tag LOCUS_19070 1614 1928 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020171.1 protein_id gnl|my_center|LOCUS_19070 2032 2769 gene locus_tag LOCUS_19080 2032 2769 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_19080 2773 3789 gene locus_tag LOCUS_19090 gene priL 2773 3789 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_19090 3976 4674 gene locus_tag LOCUS_19100 3976 4674 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_19100 4671 4949 gene locus_tag LOCUS_19110 4671 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021475.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence118 <1 1361 gene locus_tag LOCUS_19120 <1 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066190.1:PGF-pre-PGF domain-containing protein 1395 2411 gene locus_tag LOCUS_19130 1395 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19130 2412 2984 gene locus_tag LOCUS_19140 2412 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19140 2977 3531 gene locus_tag LOCUS_19150 2977 3531 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023613.1 protein_id gnl|my_center|LOCUS_19150 3537 4130 gene locus_tag LOCUS_19160 3537 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023614.1 protein_id gnl|my_center|LOCUS_19160 5036 4158 gene locus_tag LOCUS_19170 gene flaB1 5036 4158 CDS product flagellin B1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248993.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence119 359 685 gene locus_tag LOCUS_19180 359 685 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065388.1 protein_id gnl|my_center|LOCUS_19180 810 1100 gene locus_tag LOCUS_19190 810 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1154 1227 gene locus_tag LOCUS_t00390 1154 1227 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1950 1816 gene locus_tag LOCUS_19200 1950 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1958 2383 gene locus_tag LOCUS_19210 1958 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 4033 2654 gene locus_tag LOCUS_19220 gene mtaB 4033 2654 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020506.1 protein_id gnl|my_center|LOCUS_19220 4811 4047 gene locus_tag LOCUS_19230 gene mtaC 4811 4047 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020507.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence120 1223 459 gene locus_tag LOCUS_19240 1223 459 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878025.1 protein_id gnl|my_center|LOCUS_19240 1327 1689 gene locus_tag LOCUS_19250 gene hisI 1327 1689 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020946.1 protein_id gnl|my_center|LOCUS_19250 1736 3574 gene locus_tag LOCUS_19260 1736 3574 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020947.1 protein_id gnl|my_center|LOCUS_19260 3687 4337 gene locus_tag LOCUS_19270 3687 4337 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020594.1 protein_id gnl|my_center|LOCUS_19270 4304 4972 gene locus_tag LOCUS_19280 4304 4972 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020593.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence121 365 1789 gene locus_tag LOCUS_19290 365 1789 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021657.1 protein_id gnl|my_center|LOCUS_19290 2050 2226 gene locus_tag LOCUS_19300 2050 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065866.1 protein_id gnl|my_center|LOCUS_19300 2418 3053 gene locus_tag LOCUS_19310 2418 3053 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023336.1 protein_id gnl|my_center|LOCUS_19310 3888 3085 gene locus_tag LOCUS_19320 gene cofE 3888 3085 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 protein_id gnl|my_center|LOCUS_19320 4774 3893 gene locus_tag LOCUS_19330 4774 3893 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023430.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence122 220 1218 gene locus_tag LOCUS_19340 220 1218 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021671.1 protein_id gnl|my_center|LOCUS_19340 1227 2405 gene locus_tag LOCUS_19350 1227 2405 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022687.1 protein_id gnl|my_center|LOCUS_19350 2766 2449 gene locus_tag LOCUS_19360 2766 2449 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_19360 3418 2822 gene locus_tag LOCUS_19370 3418 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19370 4018 3590 gene locus_tag LOCUS_19380 4018 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19380 <4928 4030 gene locus_tag LOCUS_19390 <4928 4030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065859.1:ABC transporter permease >Feature sequence123 1733 2890 gene locus_tag LOCUS_19400 1733 2890 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065191.1 protein_id gnl|my_center|LOCUS_19400 3897 2917 gene locus_tag LOCUS_19410 3897 2917 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_19410 4754 4314 gene locus_tag LOCUS_19420 4754 4314 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023217.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence124 296 51 gene locus_tag LOCUS_19430 296 51 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020585.1 protein_id gnl|my_center|LOCUS_19430 757 323 gene locus_tag LOCUS_19440 757 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 3201 754 gene locus_tag LOCUS_19450 3201 754 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020587.1 protein_id gnl|my_center|LOCUS_19450 3584 3288 gene locus_tag LOCUS_19460 3584 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4546 3581 gene locus_tag LOCUS_19470 4546 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990714.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence125 216 2372 gene locus_tag LOCUS_19480 216 2372 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020139.1 protein_id gnl|my_center|LOCUS_19480 2922 2347 gene locus_tag LOCUS_19490 gene hisB 2922 2347 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 protein_id gnl|my_center|LOCUS_19490 3739 2996 gene locus_tag LOCUS_19500 gene hisA 3739 2996 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020276.1 protein_id gnl|my_center|LOCUS_19500 4603 3749 gene locus_tag LOCUS_19510 gene hisG 4603 3749 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020275.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence126 1289 126 gene locus_tag LOCUS_19520 1289 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2183 3133 gene locus_tag LOCUS_19530 2183 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 3724 3311 gene locus_tag LOCUS_19540 3724 3311 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence127 323 1012 gene locus_tag LOCUS_19550 323 1012 CDS product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021471.1 protein_id gnl|my_center|LOCUS_19550 1785 1039 gene locus_tag LOCUS_19560 1785 1039 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021472.1 protein_id gnl|my_center|LOCUS_19560 1899 2927 gene locus_tag LOCUS_19570 1899 2927 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022056.1 protein_id gnl|my_center|LOCUS_19570 4317 3337 gene locus_tag LOCUS_19580 gene mch 4317 3337 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021714.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence128 1 555 gene locus_tag LOCUS_19590 1 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 562 1230 gene locus_tag LOCUS_19600 562 1230 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552494.1 protein_id gnl|my_center|LOCUS_19600 1227 1904 gene locus_tag LOCUS_19610 1227 1904 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705262.1 protein_id gnl|my_center|LOCUS_19610 1920 2693 gene locus_tag LOCUS_19620 1920 2693 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206438.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence129 1041 553 gene locus_tag LOCUS_19630 1041 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1359 1273 gene locus_tag LOCUS_t00400 1359 1273 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2347 1442 gene locus_tag LOCUS_19640 gene argF 2347 1442 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 protein_id gnl|my_center|LOCUS_19640 3684 2377 gene locus_tag LOCUS_19650 gene purD 3684 2377 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065667.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence130 <1 1185 gene locus_tag LOCUS_19660 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118066.1:ACR3 family arsenite efflux transporter 2160 1864 gene locus_tag LOCUS_19670 2160 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2872 2531 gene locus_tag LOCUS_19680 2872 2531 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065462.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence131 256 122 gene locus_tag LOCUS_19690 256 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 808 2151 gene locus_tag LOCUS_19700 808 2151 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039289.1 protein_id gnl|my_center|LOCUS_19700 2184 3377 gene locus_tag LOCUS_19710 2184 3377 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence132 2146 272 gene locus_tag LOCUS_19720 2146 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 3041 2604 gene locus_tag LOCUS_19730 3041 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065607.1 protein_id gnl|my_center|LOCUS_19730 3954 2995 gene locus_tag LOCUS_19740 3954 2995 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023027.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence133 181 636 gene locus_tag LOCUS_19750 181 636 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020591.1 protein_id gnl|my_center|LOCUS_19750 778 1389 gene locus_tag LOCUS_19760 778 1389 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064937.1 protein_id gnl|my_center|LOCUS_19760 1432 2253 gene locus_tag LOCUS_19770 gene hisF 1432 2253 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020590.1 protein_id gnl|my_center|LOCUS_19770 2348 2557 gene locus_tag LOCUS_19780 2348 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 3480 2584 gene locus_tag LOCUS_19790 3480 2584 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020666.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence134 <1 1958 gene locus_tag LOCUS_19800 <1 1958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024434.1:GAF domain-containing protein 2046 3101 gene locus_tag LOCUS_19810 2046 3101 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020485.1 protein_id gnl|my_center|LOCUS_19810 3250 3678 gene locus_tag LOCUS_19820 3250 3678 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence135 1594 74 gene locus_tag LOCUS_19830 1594 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1917 1780 gene locus_tag LOCUS_19840 1917 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1892 2308 gene locus_tag LOCUS_19850 1892 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3587 2340 gene locus_tag LOCUS_19860 3587 2340 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence136 1150 98 gene locus_tag LOCUS_19870 1150 98 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022155.1 protein_id gnl|my_center|LOCUS_19870 1320 1703 gene locus_tag LOCUS_19880 gene pssD 1320 1703 CDS product PssD/Cps14F family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065325.1 protein_id gnl|my_center|LOCUS_19880 1700 2170 gene locus_tag LOCUS_19890 gene pssE 1700 2170 CDS product PssE/Cps14G family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990828.1 protein_id gnl|my_center|LOCUS_19890 2192 3331 gene locus_tag LOCUS_19900 2192 3331 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022158.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence137 822 52 gene locus_tag LOCUS_19910 822 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842884.1 protein_id gnl|my_center|LOCUS_19910 967 1185 gene locus_tag LOCUS_19920 967 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1391 2482 gene locus_tag LOCUS_19930 1391 2482 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024231.1 protein_id gnl|my_center|LOCUS_19930 2552 2625 gene locus_tag LOCUS_t00410 2552 2625 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3207 3004 gene locus_tag LOCUS_19940 3207 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence138 478 1026 gene locus_tag LOCUS_19950 478 1026 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_19950 1125 2270 gene locus_tag LOCUS_19960 1125 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19960 2399 3058 gene locus_tag LOCUS_19970 2399 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 3295 3086 gene locus_tag LOCUS_19980 3295 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence139 1319 609 gene locus_tag LOCUS_19990 1319 609 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023677.1 protein_id gnl|my_center|LOCUS_19990 2101 1316 gene locus_tag LOCUS_20000 gene rfbD 2101 1316 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023678.1 protein_id gnl|my_center|LOCUS_20000 3051 2098 gene locus_tag LOCUS_20010 gene rfbB 3051 2098 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence140 875 249 gene locus_tag LOCUS_20020 875 249 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065150.1 protein_id gnl|my_center|LOCUS_20020 1117 1734 gene locus_tag LOCUS_20030 1117 1734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187151961.1 protein_id gnl|my_center|LOCUS_20030 1839 2966 gene locus_tag LOCUS_20040 1839 2966 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065858.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence141 559 1791 gene locus_tag LOCUS_20050 gene pgk 559 1791 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023501.1 protein_id gnl|my_center|LOCUS_20050 1829 2425 gene locus_tag LOCUS_20060 1829 2425 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023500.1 protein_id gnl|my_center|LOCUS_20060 3057 2632 gene locus_tag LOCUS_20070 3057 2632 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023482.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence142 1313 162 gene locus_tag LOCUS_20080 1313 162 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020683.1 protein_id gnl|my_center|LOCUS_20080 2345 1425 gene locus_tag LOCUS_20090 2345 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065193.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence143 159 1808 gene locus_tag LOCUS_20100 159 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1818 3047 gene locus_tag LOCUS_20110 1818 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence144 <1 639 gene locus_tag LOCUS_20120 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021201.1:ABC transporter ATP-binding protein 658 2190 gene locus_tag LOCUS_20130 658 2190 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279119.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence145 2427 1294 gene locus_tag LOCUS_20140 2427 1294 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086714.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence146 2797 194 gene locus_tag LOCUS_20150 2797 194 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162013089.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence147 2120 156 gene locus_tag LOCUS_20160 2120 156 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024088.1 protein_id gnl|my_center|LOCUS_20160 2733 2401 gene locus_tag LOCUS_20170 2733 2401 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020840.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence148 2116 449 gene locus_tag LOCUS_20180 gene sulP 2116 449 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_20180 2659 2393 gene locus_tag LOCUS_20190 2659 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence149 1663 32 gene locus_tag LOCUS_20200 1663 32 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021343.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence150 48 1856 gene locus_tag LOCUS_20210 48 1856 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990869.1 protein_id gnl|my_center|LOCUS_20210 1879 2643 gene locus_tag LOCUS_20220 gene mtaC 1879 2643 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021627.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence151 <1 1851 gene locus_tag LOCUS_20230 <1 1851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020127.1:S-layer protein domain-containing protein 1946 2599 gene locus_tag LOCUS_20240 1946 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence152 227 1690 gene locus_tag LOCUS_20250 227 1690 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860184.1 protein_id gnl|my_center|LOCUS_20250 2528 1743 gene locus_tag LOCUS_20260 2528 1743 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992747.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence153 2075 108 gene locus_tag LOCUS_20270 2075 108 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024232.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence154 <1 2423 gene locus_tag LOCUS_20280 <1 2423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022651.1:DUF3656 domain-containing protein >Feature sequence155 <1 1764 gene locus_tag LOCUS_20290 <1 1764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943938.1:excinuclease ABC subunit UvrA 2067 2324 gene locus_tag LOCUS_20300 2067 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence156 <2361 917 gene locus_tag LOCUS_20310 <2361 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010927303.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence157 454 732 gene locus_tag LOCUS_20320 gene eif1A 454 732 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064992.1 protein_id gnl|my_center|LOCUS_20320 737 1549 gene locus_tag LOCUS_20330 737 1549 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_20330 1536 2066 gene locus_tag LOCUS_20340 1536 2066 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020937.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence158 1279 605 gene locus_tag LOCUS_20350 1279 605 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403384.1 protein_id gnl|my_center|LOCUS_20350 1557 1336 gene locus_tag LOCUS_20360 1557 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 <2183 1529 gene locus_tag LOCUS_20370 <2183 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023662.1:glycosyltransferase family 2 protein >Feature sequence159 <1 876 gene locus_tag LOCUS_20380 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020259.1:isocitrate/isopropylmalate dehydrogenase family protein 1142 1699 gene locus_tag LOCUS_20390 1142 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence160 83 1543 gene locus_tag LOCUS_20400 gene bchE 83 1543 CDS product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528488.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence161 1159 923 gene locus_tag LOCUS_20410 1159 923 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023401.1 protein_id gnl|my_center|LOCUS_20410 1799 1302 gene locus_tag LOCUS_20420 1799 1302 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023392.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence162 <2000 1431 gene locus_tag LOCUS_20430 <2000 1431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002415467.1:GH25 family lysozyme >Feature sequence163 1514 798 gene locus_tag LOCUS_20440 1514 798 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021001.1 protein_id gnl|my_center|LOCUS_20440 1535 1756 gene locus_tag LOCUS_20450 1535 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence164 312 1 gene locus_tag LOCUS_20460 312 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 525 1082 gene locus_tag LOCUS_20470 525 1082 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 protein_id gnl|my_center|LOCUS_20470 1595 1744 gene locus_tag LOCUS_20480 1595 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence165 364 738 gene locus_tag LOCUS_20490 364 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1582 1043 gene locus_tag LOCUS_20500 1582 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence166 426 569 gene locus_tag LOCUS_20510 426 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1246 1374 gene locus_tag LOCUS_20520 1246 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1378 1662 gene locus_tag LOCUS_20530 1378 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence167 247 897 gene locus_tag LOCUS_20540 247 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 <1734 992 gene locus_tag LOCUS_20550 <1734 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021204.1:glycosyltransferase family 4 protein >Feature sequence168 298 756 gene locus_tag LOCUS_20560 298 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 1192 980 gene locus_tag LOCUS_20570 1192 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 1083 1313 gene locus_tag LOCUS_20580 1083 1313 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860313.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence169 1437 280 gene locus_tag LOCUS_20590 1437 280 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence170 26 304 gene locus_tag LOCUS_20600 26 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 368 736 gene locus_tag LOCUS_20610 368 736 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461119.1 protein_id gnl|my_center|LOCUS_20610 754 1122 gene locus_tag LOCUS_20620 754 1122 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943770.1 protein_id gnl|my_center|LOCUS_20620 1124 1453 gene locus_tag LOCUS_20630 1124 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20630