COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..38972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(105..797) product dihydromethanopterin reductase (acceptor) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876991.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(817..2088) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene glyA CDS complement(2321..2986) product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876108.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(3030..5006) product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene hdrA CDS complement(5238..5675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(6199..7140) product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876995.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene radA CDS complement(7156..9168) product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876997.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(9275..11122) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877158.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(11132..11578) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877157.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene nuoE CDS 11667..12413 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene fdhD CDS complement(12474..13067) product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061311.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene hxlB CDS 13163..14014 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061082.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 14124..15056 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877153.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 15064..16365 product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene thiC CDS 16392..17975 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene lysS CDS 17975..18463 product UGSC family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 18470..19543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(19776..21116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(21641..22150) product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880262.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(22169..24484) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330373.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene nrdD CDS 24838..26094 product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene hacA CDS 26108..26587 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 26594..27601 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061040.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 27613..28818 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061297.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 28908..29324 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877002.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene ribH CDS 29333..30274 product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877003.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(30255..31964) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 32190..33194 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061041.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene purE CDS 33213..34478 product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(34475..35479) product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877007.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene amrS CDS complement(35482..36489) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877008.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene thiL CDS complement(36486..36917) product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene cfbA CDS complement(36889..37287) product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061298.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 37506..38381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 sequence002 source 1..34367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 443..1801 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 2295..2633 product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060937.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 2646..3410 product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 3407..4186 product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 4143..4574 product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060934.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(4563..6140) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene serA CDS 6255..7004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(7001..7948) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876598.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 7976..9235 product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 9496..10806 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene ppcA tRNA 11193..11267 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 11299..11373 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 11406..12524 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296134.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(12521..12682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(12679..13116) product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876580.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 13168..13500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876581.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 13512..13955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(13996..14385) product DUF22 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(14385..15026) product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876584.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(15064..16455) product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(16452..18212) product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(18209..18529) product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876587.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(18526..19653) product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876588.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(19672..20292) product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876589.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(20297..20785) product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876590.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(20792..22783) product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060932.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(22795..23109) product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060933.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene ahaH CDS complement(23225..24034) product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876593.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(24045..24887) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876594.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(24884..25792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(25789..27114) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876596.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 27240..27491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 27600..28613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(28907..29254) product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876571.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(29251..29547) product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(29797..30060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 note possible pseudo, frameshifted CDS complement(30160..30483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 note possible pseudo, frameshifted CDS complement(30609..31142) product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060923.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(31168..31536) product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024120.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(31577..32218) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909445.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(32571..32918) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892103.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(32928..33374) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876531.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(33390..34124) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 sequence003 source 1..32693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1648..2208 product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060754.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 2177..2608 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875788.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 2636..3841 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 3855..4415 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 4402..4965 product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875785.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene cbiT CDS 4962..5708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875784.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 5810..6022 product pseudomurein-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060751.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(6012..6554) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(6607..8085) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene guaB CDS complement(8095..8808) product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(9144..10277) product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875779.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(10319..11017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(11880..13505) product pseudomurein-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892405.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(13914..14870) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(14885..15865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 16487..16756 product energy-converting NiFe hydrogenase A subunit EhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene ehaA CDS 16790..17815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876041.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 17815..18705 product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 18734..19642 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876043.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 19655..21472 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876050.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 21493..21885 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876052.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 21914..23326 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060813.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene asnB CDS 23326..23538 product Asp-tRNA(Asn) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876054.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene gatC CDS 23557..24036 product allosteric regulator of homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 24067..25083 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876056.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 25062..26273 product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 26270..27862 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene pyrG CDS complement(28086..28265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 28480..29022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 29059..29499 product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060817.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 29512..30303 product DUF2101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 30484..30897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 30894..31280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 31277..31696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 31703..32353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 sequence004 source 1..32405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 185..634 product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876791.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene mcrD CDS 635..1231 product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876790.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene mcrC CDS 1233..1991 product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060982.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene mcrG CDS 2009..3664 product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876788.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene mcrA CDS 3778..4659 product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene mtrE CDS 4663..5358 product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870362.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene mtrD CDS 5359..6168 product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876785.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene mtrC CDS 6178..6492 product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876784.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 6505..7224 product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876783.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene mtrA CDS 7239..7460 product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876782.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene mtrF CDS 7461..7706 product tetrahydromethanopterin S-methyltransferase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876781.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene mtrG CDS 7731..8666 product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene mtrH CDS 8772..9722 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060981.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 9724..10155 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 10260..11744 product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 11684..12340 product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 12330..12596 product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876775.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(12602..13834) product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(13816..14571) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene sufC CDS complement(14610..15098) product FeGP cofactor biosynthesis protein HcgF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876772.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(15095..15742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876771.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(15730..16434) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876770.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(16431..17186) product SAM-dependent methyltransferase HcgC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876769.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(17183..17647) product DUF3236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(17654..18676) product 5,10-methenyltetrahydromethanopterin hydrogenase cofactor biosynthesis protein HmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene hmdB CDS complement(18772..19806) product 5,10-methenyltetrahydromethanopterin hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene hmd CDS 20023..21540 product 5,10-methenyltetrahydromethanopterin hydrogenase cofactor biosynthesis protein HmdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876761.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene hmdC CDS 21682..22110 product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 22132..23061 product F420-non-reducing hydrogenase subunit MvhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene mvhG CDS 23062..24480 product F420-non-reducing hydrogenase subunit MvhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876758.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene mvhA CDS 24503..25744 product polyferredoxin protein MvhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876757.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene mvhB CDS complement(25764..27038) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060972.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene pyrC CDS 27244..28179 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876750.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 28170..28883 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(28880..31417) product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861603.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene mngB CDS complement(31419..32210) product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene mpgP sequence005 source 1..32105 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 231..782 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 792..1184 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875792.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 1263..2921 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876096.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 3132..3356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 3476..4447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(4444..5685) product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(5724..6584) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330368.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(6689..7888) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876398.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 8114..8368 product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392945.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 8340..10070 product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 tRNA 10097..10170 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(10171..10593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(11595..12179) product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251184.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(12311..13054) product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 13181..15361 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060894.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(15347..15967) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(15964..16410) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(16403..17686) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene aroA CDS complement(17693..20314) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene valS CDS 20399..20752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 20776..23505 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876111.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 23502..23927 product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876110.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 23938..24435 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(24511..24912) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876967.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 25253..25594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 25618..26994 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 29263..29499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 29666..29863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 29878..30117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 30871..31476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 31486..31728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875718.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 sequence006 source 1..29938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..1235) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060827.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(1276..2070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 2282..2437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(2849..3535) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060828.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(3559..4407) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(4509..7007) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876131.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 7151..7669 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545049.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(7666..8157) product PsbP-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750442.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(8154..8651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(8621..10261) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875997.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 10602..12620 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876258.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 12720..13028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876260.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 13042..13989 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393479.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 14010..14762 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 14773..15516 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 15521..15793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 15823..15990 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061197.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 15997..17178 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061196.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(17170..17430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 17639..17806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(18010..18747) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892471.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 18796..19251 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(19264..19896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 19988..20971 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892473.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(21129..22550) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene argH CDS complement(22565..22717) product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875907.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(22714..23019) product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875906.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(22997..23506) product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875905.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(23508..23690) product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875904.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(23687..24238) product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875903.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene rpoE CDS complement(24260..24790) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(24818..25174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875901.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(25199..26425) product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875900.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene eif2g CDS complement(26448..26828) product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(26849..28630) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875898.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene infB CDS complement(28636..29094) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene ndk CDS complement(29104..29271) product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875896.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(29284..29490) product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875895.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(29505..29876) product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061194.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene rpl7ae sequence007 source 1..27409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 109..378 product Gar1/Naf1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876519.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 375..1313 product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(1321..3075) product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876517.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(3081..4037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876516.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 4280..4630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(4619..4810) product DUF2116 family Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876513.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(4829..5503) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876512.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene pyrH CDS 5607..6827 product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene prf1 CDS complement(6923..7528) product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876509.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(7541..8497) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(8494..9363) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876507.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene hemC CDS complement(9392..10705) product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485764.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene cfbE CDS complement(10718..11566) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(11566..12426) product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(12439..12879) product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060917.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 13003..13392 product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene eif5A CDS 13493..14275 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876501.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene speB CDS 14291..15514 product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 15520..17139 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876499.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene ade CDS complement(17096..17770) product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876496.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(17776..18234) product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876495.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 18317..18865 product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 18862..19866 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876493.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(19895..20362) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485814.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(20304..21335) product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876491.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(21347..21910) product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(21933..23294) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876489.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 23536..25086 product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876488.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 25083..25469 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876487.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 25479..26669 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 sequence008 source 1..25401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(964..1611) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene hypB CDS complement(1614..1985) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060898.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene hypA CDS 2035..2958 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876421.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(2955..4850) product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876422.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene lonB CDS complement(4951..5709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 5785..7299 product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061247.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene cobQ CDS complement(7288..8487) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(8516..8710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 8736..9776 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831398.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(9771..10016) product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 10378..12021 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876408.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene pheT CDS complement(12033..12443) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876409.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(12458..13591) product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876410.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(13608..15350) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876080.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene uvrC CDS 15454..17400 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330366.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene uvrB CDS 17416..18789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 assembly_gap 18850..18859 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18979..20415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 20856..22220 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 22244..23803 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147188.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 sequence009 source 1..25111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(69..1127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877072.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(1105..2193) product oligosaccharide repeat unit polymerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877071.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(2204..3547) product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene cfbB CDS complement(4100..4264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 4365..5477 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061302.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(5480..5803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877067.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(5800..6576) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(6698..8524) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877065.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 8738..10216 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750458.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene hcp CDS 10222..10542 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(10537..11784) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 11880..13532 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061057.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene ilvD CDS 13601..14023 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877058.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 14005..15723 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877057.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene argS CDS complement(15732..16631) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877056.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene argF CDS complement(16647..17960) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061056.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene purD CDS 18090..19814 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 19814..20311 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061054.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene ilvN CDS 20332..21318 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene ilvC CDS 21333..22331 product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061052.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(22323..22514) product LSM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877050.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(22585..23358) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878442.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene surE CDS 23487..24221 product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061050.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(24238..24891) product NPXTG-anchored protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877043.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 tRNA complement(25013..25086) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 sequence010 source 1..23889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 499..1326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 1508..2560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 note possible pseudo, frameshifted CDS 2455..3432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 note possible pseudo, frameshifted CDS 3570..4616 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876696.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene hypD CDS 4626..5315 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 5303..6607 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876694.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 6640..7632 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061273.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 7655..8167 product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876692.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 8167..9306 product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876691.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene pscS CDS complement(9303..9710) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 tRNA complement(9747..9835) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(9881..10189) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene rpsJ CDS complement(10227..11468) product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene tuf CDS complement(11568..13760) product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060960.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(13771..14331) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876682.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene rpsG CDS complement(14337..14762) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(14778..15209) product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(15215..15511) product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876679.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(15512..16672) product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876678.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene rpoA2 CDS complement(16693..19839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(19861..21666) product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876676.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene rpoB CDS complement(21686..23230) product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060959.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(23259..23492) product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876674.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 tRNA complement(23536..23609) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(23615..23690) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 sequence011 source 1..21858 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 238..312 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 314..389 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(396..1673) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(1734..2378) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876460.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(2378..2998) product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876461.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(3017..3508) product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876462.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene hacB CDS complement(3501..4490) product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876463.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(4502..5986) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060907.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 6124..6639 product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060908.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(6636..7661) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876467.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(7667..8635) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876468.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(8632..9921) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(9934..11238) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene wecB CDS complement(11254..12582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(12650..13459) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene truA CDS 13549..14454 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876474.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 14906..16204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 16260..16976 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060911.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene hisA CDS 16992..17447 product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876477.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 17460..18470 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene argC CDS 18501..19001 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 19013..19849 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870766.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 19846..21048 product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876482.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 21059..21523 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene pyrI sequence012 source 1..21574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..871 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877430.1:roadblock/LC7 domain-containing protein locus_tag LOCUS_03330 CDS 914..1369 product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061315.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(1364..3316) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene acs CDS 3386..4981 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877210.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(5077..6207) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(6228..6920) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(6925..8025) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877195.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene hisC CDS complement(8025..8492) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(8711..9976) product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(9976..11319) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877198.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene glmM CDS complement(11322..12551) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877199.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(12573..13169) product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(13297..13884) product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877201.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(13997..14320) product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877202.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(14360..14923) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197538709.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(14920..15705) product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877204.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene mtnP CDS complement(15711..17159) product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061099.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(17193..17648) product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(17868..18998) product ORC1-type DNA replication protein Cdc6-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877207.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene cdc6-2 CDS complement(19005..19736) product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877208.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 19852..21006 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(21025..21414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 sequence013 source 1..20631 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 423..1100 product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875769.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene cbiM CDS 1102..1386 product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870602.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 1542..2165 product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene cbiQ CDS 2218..3087 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060749.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 3042..3545 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061180.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene ribC CDS 3608..4318 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892786.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 4330..4662 product DUF2304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 4781..4966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(5015..6874) product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876346.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene gatE CDS complement(6881..8188) product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene gatD CDS complement(8178..9620) product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(9610..10662) product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060884.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene vorB CDS complement(10667..10894) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(10895..12574) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(12588..13136) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 assembly_gap 13253..13262 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14722..16836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 misc_feature complement(17128..>20631) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158296324.1:cobaltochelatase subunit CobN locus_tag LOCUS_03710 sequence014 source 1..20481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..944 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875668.1:preprotein translocase subunit SecY locus_tag LOCUS_03720 CDS 973..1527 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 1539..2102 product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 2116..2382 product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875671.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 2379..2900 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 2897..3121 product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875673.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 3139..4107 product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060731.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 tRNA 4167..4254 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 4376..4828 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875675.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 4844..5362 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875676.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene rpsD CDS 5374..5775 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 5777..6562 product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 6576..6941 product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875679.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 6955..7377 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867656.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene rplM CDS 7393..7806 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 7851..8018 product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875681.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 8179..8346 product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828720.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 8420..9673 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene eno CDS 9679..10275 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene rpsB CDS 10285..11118 product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene amrB CDS 11140..12102 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene mvk CDS 12203..12997 product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 12994..14052 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene fni CDS 14049..15398 product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875689.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 15400..16386 product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene idsA CDS 16395..18065 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875691.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene gltX CDS 18085..19317 product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(19322..20209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 sequence015 source 1..20008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1066 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876374.1:glycosyltransferase family 4 protein locus_tag LOCUS_03990 CDS 1079..2518 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 2512..2934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876372.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 2931..4187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 4203..4559 product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(4556..5011) product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 5362..6594 product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876367.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(6664..7389) product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 7435..8028 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876365.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 8059..9195 product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 9186..10220 product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876363.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 10211..11698 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876362.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 11695..12162 product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876361.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene cgi121 CDS complement(12146..13111) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876360.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(13101..14288) product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061240.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 14331..14768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(14780..15148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(15148..16143) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(16207..17133) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060888.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene guaA CDS complement(17133..17693) product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060887.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 17907..18989 product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869937.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene trm14 sequence016 source 1..18640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(72..1265) product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(1494..2795) product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 2917..3945 product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892670.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 3942..4589 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 4592..5398 product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877090.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 5500..7035 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877091.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 7049..8245 product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877092.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 8686..8958 product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061063.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene albA CDS complement(9058..10263) product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(10273..11433) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877096.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(11435..12454) product DrrA-related ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877097.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(12459..12836) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485784.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 12938..13693 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877099.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(13708..14502) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877103.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 14711..15178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(15611..16597) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene ala CDS 16674..18053 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene gatA sequence017 source 1..18429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(15..527) product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485739.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(537..1127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 1320..1895 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 1915..3573 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 3557..6058 product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060872.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 7258..7599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(7596..10013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(10039..10746) product 2-amino-5-formylamino-6-ribosylaminopyrimidin-4(3H)-one 5'-monophosphate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene arfB CDS complement(10728..11204) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 11890..12126 product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 12176..12358 product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876286.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 12359..13198 product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 13223..14590 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060868.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene purF CDS 14622..15809 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060867.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 15819..16295 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 16313..17125 product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene cfbC CDS complement(17114..17497) product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060865.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 17599..18039 product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061234.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 sequence018 source 1..18111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 85..477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(474..1139) product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876839.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(1176..2294) product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876838.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 2323..3225 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060992.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 3241..4032 product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 4039..5058 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876835.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(5066..5902) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250632.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 6072..6458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 note possible pseudo, frameshifted CDS 6461..7969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 note possible pseudo, frameshifted CDS 7966..11181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 note possible pseudo, frameshifted CDS 11278..13014 product DNA polymerase PolB subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876832.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene polB1 CDS complement(12995..13549) product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene comE CDS complement(13557..14048) product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene comD CDS complement(14054..15076) product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876829.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene comC CDS complement(15102..16130) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene purM CDS complement(16144..18051) product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 sequence019 source 1..17967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(62..871) product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875643.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(1059..1736) product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892753.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 1814..3295 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877513.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 3296..4267 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(4273..5289) product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene rtcA CDS complement(5295..6461) product TIGR03576 family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877510.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(6485..6982) product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877509.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(7130..7894) product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(7875..8435) product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485798.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(8525..8959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 9033..10361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(10358..10645) product DUF5379 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 10750..12696 product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061171.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene rqcH CDS complement(12693..12980) product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877501.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(12964..13332) product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(13344..13964) product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(13976..14671) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877498.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(14668..15702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 15949..16125 product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061337.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(16122..16667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061169.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 16803..16985 product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061337.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 17005..17175 product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750464.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(17351..17749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 sequence020 source 1..17817 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..557 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_115892607.1:radical SAM protein locus_tag LOCUS_04940 CDS 571..1434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877252.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(1443..3113) product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061109.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 3330..4379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(4376..5668) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892604.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 5776..6018 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(6015..6518) product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061113.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 6622..7977 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene trpE CDS 7974..8561 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877264.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 8571..9368 product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877265.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 9361..10023 product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 10020..11198 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene trpB CDS 11195..12001 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750470.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene trpA CDS 12002..13087 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877269.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene trpD tRNA complement(13069..13142) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(13190..13750) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877270.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(13751..14047) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061319.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(14129..15043) product DUF5591 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061115.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(15045..16496) product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877273.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(16522..16998) product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877275.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(17020..17547) product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877276.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene tfe sequence021 source 1..16285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(71..355) product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877314.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(352..1005) product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877315.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene cbiM CDS complement(1200..1835) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876045.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(1825..2583) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060810.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(2596..3717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 note possible pseudo, internal stop codon CDS complement(3945..4958) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876038.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(4965..6134) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876037.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(6153..6584) product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876036.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(6581..6982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(6979..7257) product DUF2104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876034.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(7259..7498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(7509..8381) product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876032.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(8395..8610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(8617..9288) product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060807.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(9303..9980) product EhaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060806.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(9985..10482) product DUF2106 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(10479..10760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(10757..11014) product DUF2108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892391.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(11011..11256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(11265..11765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061212.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(12171..14654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(14668..15825) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(15838..15993) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065133.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 tRNA 16198..16282 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 sequence022 source 1..15408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1234..2208) product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 2419..3198 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061072.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 3212..3523 product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 3528..6377 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061305.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene leuS CDS complement(6365..7126) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(7138..8001) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877116.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene hisG CDS 8085..9380 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(9383..11032) product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 11117..12712 product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877111.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene sepS CDS 12712..13326 product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930841.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 13323..13718 product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877110.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 13724..14413 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877109.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene ribB misc_feature complement(14408..>15408) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061066.1:AAA family ATPase locus_tag LOCUS_05490 sequence023 source 1..15357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 828..1538 product DUF2162 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261160.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 1556..2236 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876309.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 2247..2534 product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060878.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 2536..3222 product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 3229..4053 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876306.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(4042..4245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892228.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 4384..5265 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876304.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene pdxS CDS complement(5324..5662) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(5676..6899) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 7966..8232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 8330..9625 product DNA primase large subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876225.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene priL CDS 9588..10562 product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene priS CDS complement(10559..11929) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876223.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene cca CDS complement(11932..12489) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene thpR CDS complement(12499..13419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(13444..14568) product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060849.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 misc_feature complement(14805..>15357) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876218.1:2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase locus_tag LOCUS_05660 sequence024 source 1..15067 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1743 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877454.1:indolepyruvate ferredoxin oxidoreductase subunit alpha locus_tag LOCUS_05670 CDS 1740..2327 product indolepyruvate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene iorB CDS complement(2316..2747) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(2763..4061) product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877457.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 4183..5760 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 5953..6186 product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877461.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 6343..6888 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877462.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene pyrE CDS 6998..7633 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877389.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 7591..9057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 9075..10481 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(10473..11255) product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061142.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(11359..12273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 12692..13288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 note possible pseudo, internal stop codon CDS 13395..13745 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876396.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 13756..14751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 sequence025 source 1..14556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(810..1094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(1410..7766) product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876353.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(7812..14507) product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876355.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 sequence026 source 1..14451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(121..921) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(929..2314) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875803.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene recJ CDS complement(2316..2600) product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(2607..3380) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875805.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(3380..4096) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060761.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene cobA CDS complement(4100..4762) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875807.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene purQ CDS complement(4765..5016) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene purS CDS complement(5013..5777) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875809.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 5913..7733 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875810.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene glmS CDS complement(7853..8284) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875801.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(8295..9590) product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060759.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(9699..11468) product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877524.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(11472..12344) product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877523.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(12367..13629) product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877521.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(13633..14265) product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877520.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 sequence027 source 1..13519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(690..2165) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061103.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene serB CDS complement(2165..2710) product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877235.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 2966..3484 product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene cyaB CDS 3518..4693 product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877238.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 4703..5962 product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061104.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene hacA CDS 5980..6510 product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 6531..7517 product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877241.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene fen CDS complement(7486..9432) product IGHMBP2 family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(9493..10104) product DUF2119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061105.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(10101..11354) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877244.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene ahcY misc_feature complement(11414..>13519) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061106.1:CDC48 family AAA ATPase locus_tag LOCUS_06100 sequence028 source 1..13006 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..520 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876624.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 564..1409 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060939.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 1402..1821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(1818..2834) product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876621.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene larE CDS complement(2842..3423) product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(3440..4666) product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(4675..5256) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(5294..6349) product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876616.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(6333..7487) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 7657..8655 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485766.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 8681..9622 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876611.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 9649..9840 product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876610.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 9852..11261 product lactaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870928.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 11281..12219 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876607.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(12260..12979) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 sequence029 source 1..12990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1633..2163) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061167.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene yjjX CDS complement(2168..2629) product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 3645..4226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 4223..5338 product guanitoxin biosynthesis PLP-dependent (S)-gamma-hydroxy-L-arginine cyclodehydratase GntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061335.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene gntC CDS 5346..6224 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(6230..6700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061165.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 tRNA complement(6737..6822) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 6879..7058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(7135..7581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(7747..8082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(8175..8582) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877486.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(8563..9483) product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877485.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(9588..10235) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(10294..10818) product DUF2096 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877483.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(10815..11081) product DUF749 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(11188..12105) product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877481.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene hdrB misc_feature complement(12125..>12990) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052261191.1:CoB--CoM heterodisulfide reductase subunit C locus_tag LOCUS_06410 sequence030 source 1..12900 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(173..739) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(764..1546) product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(1561..1857) product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876635.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene eif1A CDS 2023..3246 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(3224..4009) product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene cobK CDS complement(4006..6510) product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060943.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(6507..6914) product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 6976..7365 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene rimI CDS 7378..8460 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060942.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene carA CDS 8472..11648 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene carB CDS 11724..12878 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876625.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 sequence031 source 1..12539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(922..1311) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877189.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(1420..3075) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061094.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(3117..4388) product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877184.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene thiC CDS 4437..4835 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061093.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(4841..5656) product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(5661..6692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485789.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 6819..7157 product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876157.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 7154..7804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(7876..8352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876599.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 8709..9068 product DUF5518 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 9141..9647 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877376.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 9654..10268 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877375.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene rrmJ CDS complement(10261..10695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061140.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 sequence032 source 1..12460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 30..329 product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876811.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(326..1405) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(1417..1704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 2523..3668 product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(3659..4345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876815.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 4548..5237 product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 5631..6371 product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 6413..6877 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060987.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 6899..7888 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876818.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 7905..8579 product DUF2100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876819.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 8657..9634 product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876820.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene mptA CDS 9618..10058 product DUF2120 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061284.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 10059..11138 product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876822.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene cofG CDS complement(11133..11687) product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876823.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 misc_feature complement(11701..>12460) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060988.1:class I SAM-dependent methyltransferase family protein locus_tag LOCUS_06800 sequence033 source 1..12247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 136..1287 product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(1314..2936) product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene thsA CDS 3082..3660 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(3662..4180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892171.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(4774..5820) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene asd CDS complement(5826..6647) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene dapB CDS complement(6661..7554) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene dapA CDS complement(7551..8771) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(8786..8977) product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876438.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(8980..9276) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869744.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(9283..10140) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061249.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(10243..10404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 10602..10871 product MJ0307 family thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 10879..11970 product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876443.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene cbiD sequence034 source 1..12221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1954..2076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 tRNA complement(2392..2464) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 2705..2878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 3446..4456 product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(4869..5207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 5366..7147 product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876090.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 7161..10709 product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750440.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 11418..12026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 sequence035 source 1..11922 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 417..824 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876949.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(798..1970) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(2007..2516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(2516..3454) product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876955.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(3460..4284) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061292.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene hisF tRNA 4547..4624 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(4832..5584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 5496..5750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(5981..6673) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876960.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene cobI CDS 6738..8456 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876959.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(8523..10148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 note possible pseudo, frameshifted CDS complement(10145..11341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 note possible pseudo, frameshifted CDS 11464..11712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 sequence036 source 1..11753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(30..1328) product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061087.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(1352..2164) product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877167.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(2161..3873) product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877166.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(3886..4281) product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877165.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(4278..4526) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(4541..5593) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061086.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(5593..6048) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061085.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(6156..8810) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061084.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene fdhF CDS 8887..9570 product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877160.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene mobB CDS 9564..10508 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene moaA misc_feature complement(10505..>11753) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052261150.1:pseudomurein-binding repeat-containing protein locus_tag LOCUS_07240 sequence037 source 1..11719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 110..391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(701..1564) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 1728..2543 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877413.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 2651..3169 product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877408.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 3278..3889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 3990..4739 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877405.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 4736..7315 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877404.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(7293..7976) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877403.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(7969..8979) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene rfbB CDS complement(8989..9549) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877392.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene rfbC CDS complement(9554..10423) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene rfbA CDS complement(10420..11253) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene rfbD sequence038 source 1..11703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(151..1221) product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 1309..2928 product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 2947..3507 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877036.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 3504..3905 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061047.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 3871..5226 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 5228..6400 product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 6471..8675 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877027.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 8680..9411 product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061045.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 9420..10334 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene pyrB CDS complement(10336..11424) product ORC1-type DNA replication protein Cdc6-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene cdc6-1 sequence039 source 1..11641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 151..1722 product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 1746..2687 product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877348.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 2662..2862 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 2867..3730 product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 3820..4602 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877353.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 4639..4833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877354.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(4835..6121) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892544.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(6327..7394) product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870054.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(7529..8491) product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene mer CDS complement(8863..9897) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(9928..11490) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750460.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 sequence040 source 1..11380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 85..654 product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene hpt CDS 656..1645 product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene dph2 CDS 1596..1736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 1736..2308 product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 2325..2588 product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 2585..3184 product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 3194..3622 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876928.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 3693..4007 product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 4033..4410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 4479..5213 product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876925.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene pcn CDS 5231..5851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 5968..6246 product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876923.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 6262..6441 product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876922.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 6451..7230 product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061020.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 7406..8179 product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 8186..9349 product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876918.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 tRNA complement(9514..9588) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(9615..9690) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(9748..10479) product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(10476..10964) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061019.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 sequence041 source 1..11053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(81..1175) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485757.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(1181..1651) product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485809.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene hycI CDS complement(1648..2421) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876377.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(2418..2840) product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876378.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene nikR CDS 3103..3492 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 3507..3974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457324.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(3978..5507) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876381.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(5521..6441) product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876382.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(6438..7412) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060891.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene hemB CDS complement(7423..8250) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876384.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(8234..8899) product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 8960..9625 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 9638..10741 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061243.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene aroC sequence042 source 1..10402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 291..1343 product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876249.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 1344..1784 product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876248.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 1798..2460 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060856.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene rpiA CDS complement(2863..3660) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485751.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(3671..4414) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876244.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(4427..5269) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 5355..5762 product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(5759..6517) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876241.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene cobM CDS complement(6531..6785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(6814..7296) product methyl-coenzyme M reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 7486..7842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876236.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 7845..8336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 8643..8855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 note possible pseudo, frameshifted CDS 8858..10033 product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060852.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 sequence043 source 1..10328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(38..643) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060758.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(660..1307) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875798.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(1311..1826) product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(1833..2993) product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875796.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(2995..3156) product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(3439..4113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876163.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(4401..4889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876397.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(4996..5373) product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876395.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(5386..5958) product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060893.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(5955..7796) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876393.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(7820..9862) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 sequence044 source 1..10103 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 7..1500 product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876638.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene top6B CDS 1493..2551 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 2649..3662 product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876640.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 3673..3939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 note possible pseudo, frameshifted CDS 3939..4517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 note possible pseudo, frameshifted CDS 4575..5696 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(5794..6714) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060949.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene hemA CDS complement(6973..7599) product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060950.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(7604..8083) product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876645.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(8119..9714) product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060951.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene atwA sequence045 source 1..10002 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 166..804 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 806..1810 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877288.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 1853..2164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 2255..4957 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877290.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene alaS CDS 4960..6201 product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877291.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 6217..7362 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene thiI CDS 7434..8531 product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877293.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene fbp CDS complement(8545..9195) product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250893.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(9195..9851) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877296.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 sequence046 source 1..9629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 307..1512 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061035.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 1548..4670 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876987.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene ileS CDS 4683..6824 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876986.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene purL CDS 6852..7421 product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876985.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 7512..9209 product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061091.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 9216..9506 product DUF2097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061090.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 sequence047 source 1..9593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 413..1420 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496555.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 1457..2806 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene gatB CDS 2823..3062 product DUF504 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876898.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 3064..3873 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876899.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 3863..4156 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876900.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene hisE CDS complement(4157..4927) product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene larB CDS 4994..7291 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496588.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene hypF CDS complement(7286..7753) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876905.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 7853..8368 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876906.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 sequence048 source 1..9310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 258..776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 855..1832 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene galE CDS 2054..2308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 3196..5172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876271.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 5188..6444 product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(6416..7273) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene galU CDS complement(7285..7839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 tRNA 7970..8055 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 sequence049 source 1..9306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(457..732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(767..1138) product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876316.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(1105..1398) product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(1398..1766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(1866..1997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(1999..2268) product 50S ribosomal protein L37Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876320.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene rpl37A CDS complement(2270..3085) product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876321.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene rrp42 CDS complement(3088..3813) product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876322.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene rrp41 CDS complement(3810..4508) product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876323.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene rrp4 CDS complement(4560..5258) product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876324.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(5261..6010) product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876325.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene psmA CDS complement(6080..6448) product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876326.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(6462..7166) product ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876327.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(7163..7564) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061237.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(7561..8100) product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(8281..8604) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060879.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 misc_feature complement(8643..>9306) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876331.1:SPFH domain-containing protein locus_tag LOCUS_08710 sequence050 source 1..9301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 58..1335 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene hisS CDS 1419..1718 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene hisI CDS 1725..3551 product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 3566..4312 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485719.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 4324..4992 product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene npdG CDS 5004..5570 product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene hxlB CDS 5584..6090 product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene endA CDS 6104..7207 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875890.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 7204..7806 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892541.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 7811..9019 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061193.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene thrC sequence051 source 1..9217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(277..1602) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(1635..2219) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877014.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(2230..3285) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene cobJ CDS complement(3296..3787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892718.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 4033..5424 product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877017.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 5453..6025 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892716.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(6037..6285) product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(6363..7337) product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877020.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(7355..8245) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene cbiB CDS 8339..8809 product DUF2299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 sequence052 source 1..9097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(153..428) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 535..831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(938..1264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(1935..3350) product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933616.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene bchE CDS complement(3365..3553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 3642..4046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 4490..5533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 6473..7756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 note possible pseudo, frameshifted CDS 7768..8952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 note possible pseudo, frameshifted sequence053 source 1..8979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 235..1146 product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877429.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene nadA CDS complement(1149..2252) product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877428.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 2382..2789 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061150.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(2792..3232) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(3259..3537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892859.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(3540..4514) product alpha/beta fold hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877422.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(4516..4731) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877421.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 4815..5156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485797.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(5143..6507) product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061146.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 6567..7337 product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061145.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene nucS CDS complement(7321..8415) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 sequence054 source 1..8883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 24..1226 product MnmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 1214..3160 product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060763.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene tgtA CDS 3157..3504 product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 3506..4249 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990915.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 4265..5290 product Zc3h12a-like ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060764.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 5292..6497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060765.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 6576..6806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 6847..8037 product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330363.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene argJ sequence055 source 1..8804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..1260 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296321.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 1277..2875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 2978..3916 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060800.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 3932..4810 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 4828..5820 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 5839..7041 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876015.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 tRNA complement(7022..7096) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(7087..7881) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876389.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 misc_feature complement(7927..>8804) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876390.1:DUF2121 family protein locus_tag LOCUS_09270 sequence056 source 1..8804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(94..312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 410..1084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 1120..1680 product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 1696..2019 product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 2040..2843 product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060983.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 2840..3223 product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876799.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 3231..4109 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876798.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 4106..4402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 note possible pseudo, frameshifted CDS 4374..4991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 note possible pseudo, frameshifted CDS 4988..6190 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(6183..7475) product methyl-coenzyme M reductase glutamine C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(7472..8722) product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene mmp10 sequence057 source 1..8775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193330362.1:phosphate ABC transporter substrate-binding protein locus_tag LOCUS_09400 CDS 888..1763 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene pstC CDS 1765..2625 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877336.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene pstA CDS 2628..3380 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene pstB CDS 3407..4066 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877340.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene phoU CDS complement(4130..4969) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877341.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(4986..5417) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877342.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(5429..5911) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(5928..6794) product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene porB CDS complement(6795..7946) product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene porA CDS complement(7960..8202) product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869765.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene porD CDS complement(8209..8739) product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892553.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene porC sequence058 source 1..8500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 44..781 product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330364.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(767..1381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1585..3336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(3350..4030) product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875848.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(4044..4706) product DNA polymerase PolB subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875847.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene polB2 CDS complement(4718..5101) product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 5365..6375 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene hypE CDS 6393..6785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 6782..7381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 note possible pseudo, frameshifted CDS complement(7385..7975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877047.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(7976..8290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877046.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 sequence059 source 1..8377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..1025) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 1153..1782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 1784..2854 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 2866..3495 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876654.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene rnhB CDS 3497..4336 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876653.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 4353..4748 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876652.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 4763..5368 product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876651.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene purO CDS 5396..6151 product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene cofE CDS 6138..7076 product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060952.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene cofD CDS 7073..7825 product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876648.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 sequence060 source 1..8271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..1021 product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876722.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(1296..1772) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876721.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1792..3141) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(3155..5098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(5095..5355) product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876719.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(5359..6753) product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876718.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene kaiC CDS 6888..7826 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876717.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 sequence061 source 1..8172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(221..502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(791..979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(987..1160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 1265..2152 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060745.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 2163..3053 product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 3126..3626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(3610..4254) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060747.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene pyrF CDS 4419..5441 product tRNA (guanine(9)-/adenine(9)-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249377.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene trm10 CDS complement(5559..5783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 note possible pseudo, frameshifted CDS 6549..6800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 note possible pseudo, internal stop codon, frameshifted CDS 7035..8165 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 sequence062 source 1..7835 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(18..464) product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877470.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(468..830) product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877469.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(832..1263) product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061162.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(1238..2782) product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061161.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(2795..3784) product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(3804..4922) product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869557.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(4929..5435) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877464.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 5774..6301 product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 6504..6980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(6977..7378) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877399.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene tsaA sequence063 source 1..7739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721980.1:molecular chaperone DnaK locus_tag LOCUS_10010 CDS 750..1874 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876908.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene dnaJ tRNA complement(2226..2302) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(2641..3102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876909.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(3104..3529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876910.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 3628..4527 product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061017.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene map CDS 4618..4827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 4832..5371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 5393..5914 product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 5916..6155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(6183..7028) product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene frhB misc_feature complement(7042..>7739) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876913.1:coenzyme F420 hydrogenase subunit gamma locus_tag LOCUS_10110 sequence064 source 1..7692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(370..1191) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060996.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(1208..2047) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060997.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(2073..3014) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(3115..3936) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876849.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(3929..4492) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876850.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(4505..5197) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060998.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(5194..5685) product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060999.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(5692..6255) product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061000.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(6255..6623) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876854.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 sequence065 source 1..7625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 33..305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 293..781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 817..1086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061001.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1083..1739) product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876859.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1747..1989) product energy-converting hydrogenase B subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061002.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(2013..2996) product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876861.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(3002..4120) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061003.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(4140..4586) product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876863.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(4598..5092) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061004.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(5108..6457) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061005.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(6473..6709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876866.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(6721..7170) product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876867.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(7173..7451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061006.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 sequence066 source 1..7555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..753 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene hypB CDS 775..1803 product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485760.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 tRNA complement(1803..1877) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 1942..2421 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 2479..3558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 3562..4023 product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876415.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 4025..4330 product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876414.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 4532..5290 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876413.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 5265..5915 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061245.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 5921..6883 product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876411.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene mch sequence067 source 1..7067 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 317..520 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 513..1640 product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 1654..2508 product 2-oxoglutarate synthase subunit KorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876665.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene korB CDS 2514..3077 product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060957.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 3074..4177 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876667.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene sucC CDS complement(4181..5266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876668.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(5282..6112) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(6127..7044) product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene twy1 sequence068 source 1..7066 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 144..674 product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(667..852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 note possible pseudo, frameshifted CDS complement(1237..1542) product DUF2098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(1558..1833) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892157.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1873..2943 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876451.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 2961..4574 product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 4584..5267 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060904.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene deoC CDS 5442..5795 product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(5776..6906) product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene cofH sequence069 source 1..6848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..715 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879016.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 766..2328 product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870892.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 2342..3022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 3034..3267 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061061.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 3233..3808 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061060.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene hisB CDS complement(4382..5764) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(5803..6633) product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 sequence070 source 1..6831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(456..635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(753..1883) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877283.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene ftsZ CDS complement(2198..2761) product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877282.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 2858..3634 product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene comA CDS 3634..4410 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877280.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 4429..5130 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402640.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 5205..5885 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 5892..6725 product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877277.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 sequence071 source 1..6775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(524..1822) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1887..2462 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene tmk CDS complement(2464..2658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(2669..3625) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(3631..4677) product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877370.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(4695..5111) product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877371.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 misc_feature complement(5130..>6775) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877372.1:minichromosome maintenance protein MCM locus_tag LOCUS_10810 sequence072 source 1..6502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1041..1943) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 2021..3235 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876981.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 3248..4405 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061033.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(4432..4716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(4731..5042) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(5047..5763) product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876976.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 sequence073 source 1..6488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 361..843 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084126250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 840..1865 product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1922..2815 product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061010.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene fhcD CDS complement(2812..4761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 4852..6366 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876880.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 sequence074 source 1..6461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 39..896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 960..3473 product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877231.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(3470..3847) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877230.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 3921..5009 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 5021..5800 product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 5806..6363 product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 sequence075 source 1..6455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 65..1078 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875644.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene rpl3p CDS 1080..1871 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene rpl4p CDS 1877..2137 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060727.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 2162..2872 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 2896..3306 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene rpsS CDS 3323..3784 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene rplV CDS 3789..4475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 4482..4676 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875651.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene rpmC CDS 4689..4994 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875652.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene yciH CDS 4991..5272 product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 5286..5606 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875654.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 5608..6006 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875655.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 6118..6390 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875656.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene rplX sequence076 source 1..6434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(52..789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 833..1090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(1138..1791) product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876521.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(1796..2086) product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876522.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 2290..2691 product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 2720..3862 product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876524.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene dnaG CDS 3873..5378 product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876525.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 5419..6315 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 sequence077 source 1..6396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 212..754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 851..1642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060818.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 1646..2326 product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(2323..2721) product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876072.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(2737..3270) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060819.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(3282..4031) product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 4130..4327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876075.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 4334..5362 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060820.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(5367..6092) product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876078.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 sequence078 source 1..6200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 22..1518 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061157.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1484..2212 product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877451.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 2303..3349 product DUF1512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877450.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 3352..3960 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061156.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene dcd CDS 3963..5705 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061155.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene glyS sequence079 source 1..6099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1015 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877132.1:Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit locus_tag LOCUS_11340 CDS 1008..2015 product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877133.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 2022..2618 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene hisH CDS 2627..3982 product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061078.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 3972..4406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 repeat_region 4678..>6099 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatcccattttggtctgattttaac sequence080 source 1..6095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 122..973 product ATP-dependent RNA/DNA ligase MthRnl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060995.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene mthRnl CDS 989..1810 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060994.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene pheA CDS 1878..2453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 2483..3007 product PsbP-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876842.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(3204..3398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 4418..4918 product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060993.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 4929..6065 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876840.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene coaBC sequence081 source 1..6045 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(869..1411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 1487..2155 product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene comB CDS 2171..3328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 3332..3544 product DUF1922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876808.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 3551..5146 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876809.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(5130..5972) product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876810.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 sequence082 source 1..5926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(14..169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(182..748) product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061121.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene pgsA CDS 819..1436 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 1433..2140 product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877300.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene radB CDS 2409..3455 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877301.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(3634..5325) product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061122.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(5562..5771) product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 sequence083 source 1..5729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876948.1:diaminopimelate decarboxylase locus_tag LOCUS_11590 CDS 1020..1883 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876947.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene dapF CDS complement(1875..2462) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061290.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(2459..2662) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876941.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(2735..3094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 note possible pseudo, frameshifted CDS complement(3138..3962) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876939.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene rsmA CDS complement(3962..4552) product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(4578..4913) product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061025.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(4920..5210) product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876936.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 sequence084 source 1..5540 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(504..941) product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875667.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(958..1413) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875666.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene rpmD CDS complement(1427..2071) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192961070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene rpsE CDS complement(2068..2649) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875664.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(2664..3110) product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875663.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(3150..3476) product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875662.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(3481..4014) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(4031..4423) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060728.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(4441..4584) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295326.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(4591..5100) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875658.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 sequence085 source 1..5448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 86..403 product DUF4064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876159.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 411..824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876158.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 992..2014 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876254.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(2009..2752) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene thiD CDS complement(2759..3436) product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876252.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene cofC CDS complement(3459..4139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876251.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(4154..5431) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060857.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene proS sequence086 source 1..5448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(163..789) product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 903..2090 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 2126..4843 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061075.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 sequence087 source 1..5127 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 157..1713 product DUF530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1769..2221 product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060850.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 2228..3190 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060851.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(3170..4045) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(4042..4722) product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(4738..5055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 sequence088 source 1..4954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 28..813 product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877313.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene cbiQ CDS 1332..2084 product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877180.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 2139..3467 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877179.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene glnA CDS complement(3490..4614) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 sequence089 source 1..4939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 298..447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 940..1926 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060741.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 2223..2372 product TIGR04165 family Cys-rich peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750434.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 3186..3512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(3521..3871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 4017..4238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(4239..4787) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 sequence090 source 1..4856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(306..995) product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875831.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1009..1926) product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1927..2493) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875829.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene pdxT CDS complement(2714..3697) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875827.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(3724..4281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 sequence091 source 1..4805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 54..1286 product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877471.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 1296..1862 product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877472.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 1856..2716 product FeMo cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877473.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene nifB CDS 2732..3661 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061163.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene mtnA CDS complement(3658..4674) product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877475.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 sequence092 source 1..4713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(246..431) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061279.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 707..2419 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876731.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene oadA CDS complement(2420..3091) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene queC CDS complement(3098..4294) product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060969.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene larC CDS complement(4305..4679) product MJ1244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060970.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 sequence093 source 1..4424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 note possible pseudo, frameshifted CDS complement(293..1441) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(1438..2097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(2175..2411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060734.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(2506..2883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875725.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(3027..3221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 note possible pseudo, frameshifted CDS complement(3893..4078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 note possible pseudo, frameshifted CDS complement(4075..4317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 note possible pseudo, internal stop codon, frameshifted sequence094 source 1..4231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 565..1176 product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875869.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(1200..2459) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875867.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene hemL CDS complement(2456..3085) product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 misc_feature complement(3098..>4231) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875865.1:aspartate--tRNA(Asn) ligase locus_tag LOCUS_12310 sequence095 source 1..4077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(871..1284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(2111..2308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 2355..2645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 sequence096 source 1..4057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(931..1884) product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060778.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(1891..2736) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 2841..3503 product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875882.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 sequence097 source 1..4001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..965 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024418.1:50S ribosomal protein L11 methyltransferase locus_tag LOCUS_12380 CDS complement(962..2203) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892580.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(2211..2480) product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(2700..2861) product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877306.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(2864..3508) product delta 1-pyrroline-5-carboxylate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061123.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(3558..3896) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene pth2 sequence098 source 1..3955 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(756..1811) product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061107.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1911..2282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892608.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(2223..2627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 sequence099 source 1..3851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 112..267 product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868637.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 294..539 product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 552..1214 product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877219.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 1230..1460 product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061100.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene rpl18a CDS 1466..1909 product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877217.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene pfdA CDS 1910..2956 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877216.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene ftsY CDS 2977..3651 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 3620..3799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 sequence100 source 1..3838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1239 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060774.1:cyclic 2,3-diphosphoglycerate synthase locus_tag LOCUS_12550 CDS 1261..1788 product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875861.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 2341..3558 product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060773.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 sequence101 source 1..3752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 95..979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 985..1719 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876736.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene cobS CDS 1727..2257 product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061280.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 2254..2889 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene upp CDS complement(2882..3376) product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669045.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 sequence102 source 1..3566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 25..1134 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1148..1804 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 1807..2364 product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876336.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene afpA CDS complement(2366..2668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 misc_feature complement(2679..>3566) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876813.1:type II CAAX endopeptidase family protein locus_tag LOCUS_12670 sequence103 source 1..3552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 376..1674 product DUF515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876659.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 1693..2646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060954.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 sequence104 source 1..3402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 332..1231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 1266..2003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 2084..2770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877379.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 sequence105 source 1..3283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 100..258 product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013294958.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 276..1625 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877146.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene purB misc_feature complement(1649..>3283) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877144.1:heavy metal translocating P-type ATPase locus_tag LOCUS_12750 sequence106 source 1..3269 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(213..1709) product energy conserving hydrogenase EhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876870.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene ehbF CDS complement(1727..2083) product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(2080..2313) product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869936.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(2306..2578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(2585..2842) product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876874.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(2855..3166) product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876875.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 sequence107 source 1..3176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 347..652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(684..2099) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 sequence108 source 1..3103 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1022..1285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 note possible pseudo, internal stop codon, frameshifted CDS complement(1216..1929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 note possible pseudo, internal stop codon, frameshifted CDS complement(2214..2357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 note possible pseudo, internal stop codon, frameshifted tRNA complement(2389..2460) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 sequence109 source 1..3095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 91..2103 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867221.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene ppsA sequence110 source 1..3014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 84..1055 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060919.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 1069..1299 product MTH895/ArsE family thioredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060920.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 1314..1508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1511..2269 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061259.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 sequence111 source 1..2998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 142..756 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876891.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(753..1430) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1463..2845) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061013.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 sequence112 source 1..2937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..648 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875745.1:tributyrin esterase locus_tag LOCUS_12950 CDS 662..2524 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(2570..2824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 sequence113 source 1..2903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 74..544 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943324.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene moaC CDS 541..2622 product ATP-dependent DNA helicase Hel308 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876445.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene hel308 sequence114 source 1..2886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(75..911) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene nadC CDS 984..1904 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061333.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene rnz CDS 1882..2613 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877432.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 sequence115 source 1..2863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(317..2377) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485824.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 sequence116 source 1..2792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1837..2682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 sequence117 source 1..2681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 292..966 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876672.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene tpiA CDS 989..2209 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene pgk tRNA 2283..2356 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 2371..2447 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 2461..2535 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 sequence118 source 1..2602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..519 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061152.1:DUF2226 domain-containing protein locus_tag LOCUS_13070 CDS 544..1323 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1348..2187 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061153.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 sequence119 source 1..2591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 97..170 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 530..1702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1603..2094) product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(2178..2387) product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 sequence120 source 1..2570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(221..1198) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060797.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 1298..1519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1654..2418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 note possible pseudo, frameshifted sequence121 source 1..2547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(543..1376) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977503.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1426..2346) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene ilvE sequence122 source 1..2454 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 111..584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 596..1180 product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060967.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 1177..1959 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 sequence123 source 1..2356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(652..1008) product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1121..2182 product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877439.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 sequence124 source 1..2335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(959..2290) product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876934.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 sequence125 source 1..2316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 226..501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 note possible pseudo, frameshifted CDS 520..804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 911..2008 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 sequence126 source 1..2293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(249..1493) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877138.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene truD CDS complement(1695..2051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 sequence127 source 1..2288 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1063..1284) product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876745.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 1507..1989 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene rplJ sequence128 source 1..2276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..536 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876008.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 536..1498 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876007.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 sequence129 source 1..2223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875832.1:Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain locus_tag LOCUS_13330 CDS 561..2063 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875833.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 sequence130 source 1..2215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 266..472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 480..1277 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871156.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(1466..2191) product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 sequence131 source 1..2182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 389..1279 product PhoU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877330.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 misc_feature complement(1328..>2182) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876593.1:citryl-CoA lyase locus_tag LOCUS_13390 sequence132 source 1..2148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 72..251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(272..973) product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 misc_feature complement(963..>2148) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875834.1:MFS transporter locus_tag LOCUS_13420 sequence133 source 1..2141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 142..1233 product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060989.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 assembly_gap 1417..1425 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1482..2021 product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene psmB sequence134 source 1..2114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(250..717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 632..1174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1177..1941) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061277.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 sequence135 source 1..1958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence136 source 1..1915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(218..694) product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876914.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene frhD CDS complement(698..1915) product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061018.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene frhA sequence137 source 1..1887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1212 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061138.1:endonuclease MutS2 locus_tag LOCUS_13500 rRNA complement(1417..1533) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence138 source 1..1783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1226..>1783) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876746.1:serine--tRNA ligase locus_tag LOCUS_13510 sequence139 source 1..1725 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 83..823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(815..1375) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877478.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 sequence140 source 1..1592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence141 source 1..1569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(496..1221) product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875870.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene mtxX sequence142 source 1..1551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1347..1550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 sequence143 source 1..1551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(711..1490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 sequence144 source 1..1503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(611..1177) product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 sequence145 source 1..1476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 113..550 product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877224.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 568..903 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877223.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 sequence146 source 1..1452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence147 source 1..1440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 101..445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(452..1006) product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 sequence148 source 1..1427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..871 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875715.1:pseudomurein-binding repeat-containing protein locus_tag LOCUS_13630 sequence149 source 1..1392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4..789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 sequence150 source 1..1388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 71..562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060860.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 misc_feature complement(606..>1388) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065939.1:Xaa-Pro peptidase family protein locus_tag LOCUS_13660 sequence151 source 1..1316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(86..757) product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060848.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(839..1276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 sequence152 source 1..1285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 12..87 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 238..1278 product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 sequence153 source 1..1167 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(604..1167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060844.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 sequence154 source 1..1147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence155 source 1..1088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence156 source 1..1073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 308..883 product DUF483 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875875.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 sequence157 source 1..961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence158 source 1..927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence159 source 1..879 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(15..>879) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877192.1:phosphoglucosamine mutase locus_tag LOCUS_13720 sequence160 source 1..878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 50..123 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 128..205 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 248..332 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 356..431 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 sequence161 source 1..833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence162 source 1..768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..581 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228547.1:acetate--CoA ligase locus_tag LOCUS_13730 sequence163 source 1..662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence164 source 1..624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence165 source 1..587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@