>Feature sequence001 797 105 gene locus_tag LOCUS_00010 797 105 CDS product dihydromethanopterin reductase (acceptor) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876991.1 protein_id gnl|my_center|LOCUS_00010 2088 817 gene locus_tag LOCUS_00020 gene glyA 2088 817 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_00020 2986 2321 gene locus_tag LOCUS_00030 2986 2321 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876108.1 protein_id gnl|my_center|LOCUS_00030 5006 3030 gene locus_tag LOCUS_00040 gene hdrA 5006 3030 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_00040 5675 5238 gene locus_tag LOCUS_00050 5675 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7140 6199 gene locus_tag LOCUS_00060 gene radA 7140 6199 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876995.1 protein_id gnl|my_center|LOCUS_00060 9168 7156 gene locus_tag LOCUS_00070 9168 7156 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876997.1 protein_id gnl|my_center|LOCUS_00070 11122 9275 gene locus_tag LOCUS_00080 11122 9275 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877158.1 protein_id gnl|my_center|LOCUS_00080 11578 11132 gene locus_tag LOCUS_00090 gene nuoE 11578 11132 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877157.1 protein_id gnl|my_center|LOCUS_00090 11667 12413 gene locus_tag LOCUS_00100 gene fdhD 11667 12413 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877156.1 protein_id gnl|my_center|LOCUS_00100 13067 12474 gene locus_tag LOCUS_00110 gene hxlB 13067 12474 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061311.1 protein_id gnl|my_center|LOCUS_00110 13163 14014 gene locus_tag LOCUS_00120 13163 14014 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061082.1 protein_id gnl|my_center|LOCUS_00120 14124 15056 gene locus_tag LOCUS_00130 14124 15056 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877153.1 protein_id gnl|my_center|LOCUS_00130 15064 16365 gene locus_tag LOCUS_00140 gene thiC 15064 16365 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877152.1 protein_id gnl|my_center|LOCUS_00140 16392 17975 gene locus_tag LOCUS_00150 gene lysS 16392 17975 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 protein_id gnl|my_center|LOCUS_00150 17975 18463 gene locus_tag LOCUS_00160 17975 18463 CDS product UGSC family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877150.1 protein_id gnl|my_center|LOCUS_00160 18470 19543 gene locus_tag LOCUS_00170 18470 19543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_00170 21116 19776 gene locus_tag LOCUS_00180 21116 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22150 21641 gene locus_tag LOCUS_00190 22150 21641 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880262.1 protein_id gnl|my_center|LOCUS_00190 24484 22169 gene locus_tag LOCUS_00200 gene nrdD 24484 22169 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330373.1 protein_id gnl|my_center|LOCUS_00200 24838 26094 gene locus_tag LOCUS_00210 gene hacA 24838 26094 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_00210 26108 26587 gene locus_tag LOCUS_00220 26108 26587 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876999.1 protein_id gnl|my_center|LOCUS_00220 26594 27601 gene locus_tag LOCUS_00230 26594 27601 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061040.1 protein_id gnl|my_center|LOCUS_00230 27613 28818 gene locus_tag LOCUS_00240 27613 28818 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061297.1 protein_id gnl|my_center|LOCUS_00240 28908 29324 gene locus_tag LOCUS_00250 gene ribH 28908 29324 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877002.1 protein_id gnl|my_center|LOCUS_00250 29333 30274 gene locus_tag LOCUS_00260 29333 30274 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877003.1 protein_id gnl|my_center|LOCUS_00260 31964 30255 gene locus_tag LOCUS_00270 31964 30255 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877004.1 protein_id gnl|my_center|LOCUS_00270 32190 33194 gene locus_tag LOCUS_00280 gene purE 32190 33194 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061041.1 protein_id gnl|my_center|LOCUS_00280 33213 34478 gene locus_tag LOCUS_00290 33213 34478 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_00290 35479 34475 gene locus_tag LOCUS_00300 gene amrS 35479 34475 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877007.1 protein_id gnl|my_center|LOCUS_00300 36489 35482 gene locus_tag LOCUS_00310 gene thiL 36489 35482 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877008.1 protein_id gnl|my_center|LOCUS_00310 36917 36486 gene locus_tag LOCUS_00320 gene cfbA 36917 36486 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061042.1 protein_id gnl|my_center|LOCUS_00320 37287 36889 gene locus_tag LOCUS_00330 37287 36889 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061298.1 protein_id gnl|my_center|LOCUS_00330 37506 38381 gene locus_tag LOCUS_00340 37506 38381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877011.1 protein_id gnl|my_center|LOCUS_00340 >Feature sequence002 443 1801 gene locus_tag LOCUS_00350 443 1801 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876537.1 protein_id gnl|my_center|LOCUS_00350 2295 2633 gene locus_tag LOCUS_00360 2295 2633 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060937.1 protein_id gnl|my_center|LOCUS_00360 2646 3410 gene locus_tag LOCUS_00370 2646 3410 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_00370 3407 4186 gene locus_tag LOCUS_00380 3407 4186 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_00380 4143 4574 gene locus_tag LOCUS_00390 4143 4574 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060934.1 protein_id gnl|my_center|LOCUS_00390 6140 4563 gene locus_tag LOCUS_00400 gene serA 6140 4563 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061266.1 protein_id gnl|my_center|LOCUS_00400 6255 7004 gene locus_tag LOCUS_00410 6255 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061265.1 protein_id gnl|my_center|LOCUS_00410 7948 7001 gene locus_tag LOCUS_00420 7948 7001 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876598.1 protein_id gnl|my_center|LOCUS_00420 7976 9235 gene locus_tag LOCUS_00430 7976 9235 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 protein_id gnl|my_center|LOCUS_00430 9496 10806 gene locus_tag LOCUS_00440 gene ppcA 9496 10806 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060929.1 protein_id gnl|my_center|LOCUS_00440 11193 11267 gene locus_tag LOCUS_t00010 11193 11267 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11299 11373 gene locus_tag LOCUS_t00020 11299 11373 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11406 12524 gene locus_tag LOCUS_00450 11406 12524 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296134.1 protein_id gnl|my_center|LOCUS_00450 12682 12521 gene locus_tag LOCUS_00460 12682 12521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 13116 12679 gene locus_tag LOCUS_00470 13116 12679 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876580.1 protein_id gnl|my_center|LOCUS_00470 13168 13500 gene locus_tag LOCUS_00480 13168 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876581.1 protein_id gnl|my_center|LOCUS_00480 13512 13955 gene locus_tag LOCUS_00490 13512 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 14385 13996 gene locus_tag LOCUS_00500 14385 13996 CDS product DUF22 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876583.1 protein_id gnl|my_center|LOCUS_00500 15026 14385 gene locus_tag LOCUS_00510 15026 14385 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876584.1 protein_id gnl|my_center|LOCUS_00510 16455 15064 gene locus_tag LOCUS_00520 16455 15064 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296141.1 protein_id gnl|my_center|LOCUS_00520 18212 16452 gene locus_tag LOCUS_00530 18212 16452 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_00530 18529 18209 gene locus_tag LOCUS_00540 18529 18209 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876587.1 protein_id gnl|my_center|LOCUS_00540 19653 18526 gene locus_tag LOCUS_00550 19653 18526 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876588.1 protein_id gnl|my_center|LOCUS_00550 20292 19672 gene locus_tag LOCUS_00560 20292 19672 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876589.1 protein_id gnl|my_center|LOCUS_00560 20785 20297 gene locus_tag LOCUS_00570 20785 20297 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876590.1 protein_id gnl|my_center|LOCUS_00570 22783 20792 gene locus_tag LOCUS_00580 22783 20792 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060932.1 protein_id gnl|my_center|LOCUS_00580 23109 22795 gene locus_tag LOCUS_00590 gene ahaH 23109 22795 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060933.1 protein_id gnl|my_center|LOCUS_00590 24034 23225 gene locus_tag LOCUS_00600 24034 23225 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876593.1 protein_id gnl|my_center|LOCUS_00600 24887 24045 gene locus_tag LOCUS_00610 24887 24045 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876594.1 protein_id gnl|my_center|LOCUS_00610 25792 24884 gene locus_tag LOCUS_00620 25792 24884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 protein_id gnl|my_center|LOCUS_00620 27114 25789 gene locus_tag LOCUS_00630 27114 25789 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876596.1 protein_id gnl|my_center|LOCUS_00630 27240 27491 gene locus_tag LOCUS_00640 27240 27491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 27600 28613 gene locus_tag LOCUS_00650 27600 28613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 29254 28907 gene locus_tag LOCUS_00660 29254 28907 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876571.1 protein_id gnl|my_center|LOCUS_00660 29547 29251 gene locus_tag LOCUS_00670 29547 29251 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750452.1 protein_id gnl|my_center|LOCUS_00670 30060 29797 gene locus_tag LOCUS_00680 30060 29797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00680 30483 30160 gene locus_tag LOCUS_00690 30483 30160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00690 31142 30609 gene locus_tag LOCUS_00700 31142 30609 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060923.1 protein_id gnl|my_center|LOCUS_00700 31536 31168 gene locus_tag LOCUS_00710 31536 31168 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024120.1 protein_id gnl|my_center|LOCUS_00710 32218 31577 gene locus_tag LOCUS_00720 32218 31577 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909445.1 protein_id gnl|my_center|LOCUS_00720 32918 32571 gene locus_tag LOCUS_00730 32918 32571 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892103.1 protein_id gnl|my_center|LOCUS_00730 33374 32928 gene locus_tag LOCUS_00740 33374 32928 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876531.1 protein_id gnl|my_center|LOCUS_00740 34124 33390 gene locus_tag LOCUS_00750 34124 33390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 protein_id gnl|my_center|LOCUS_00750 >Feature sequence003 1648 2208 gene locus_tag LOCUS_00760 1648 2208 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060754.1 protein_id gnl|my_center|LOCUS_00760 2177 2608 gene locus_tag LOCUS_00770 2177 2608 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875788.1 protein_id gnl|my_center|LOCUS_00770 2636 3841 gene locus_tag LOCUS_00780 2636 3841 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875787.1 protein_id gnl|my_center|LOCUS_00780 3855 4415 gene locus_tag LOCUS_00790 3855 4415 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060752.1 protein_id gnl|my_center|LOCUS_00790 4402 4965 gene locus_tag LOCUS_00800 gene cbiT 4402 4965 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875785.1 protein_id gnl|my_center|LOCUS_00800 4962 5708 gene locus_tag LOCUS_00810 4962 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875784.1 protein_id gnl|my_center|LOCUS_00810 5810 6022 gene locus_tag LOCUS_00820 5810 6022 CDS product pseudomurein-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060751.1 protein_id gnl|my_center|LOCUS_00820 6554 6012 gene locus_tag LOCUS_00830 6554 6012 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892791.1 protein_id gnl|my_center|LOCUS_00830 8085 6607 gene locus_tag LOCUS_00840 gene guaB 8085 6607 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871141.1 protein_id gnl|my_center|LOCUS_00840 8808 8095 gene locus_tag LOCUS_00850 8808 8095 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875780.1 protein_id gnl|my_center|LOCUS_00850 10277 9144 gene locus_tag LOCUS_00860 10277 9144 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875779.1 protein_id gnl|my_center|LOCUS_00860 11017 10319 gene locus_tag LOCUS_00870 11017 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 13505 11880 gene locus_tag LOCUS_00880 13505 11880 CDS product pseudomurein-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892405.1 protein_id gnl|my_center|LOCUS_00880 14870 13914 gene locus_tag LOCUS_00890 14870 13914 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_00890 15865 14885 gene locus_tag LOCUS_00900 15865 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 16487 16756 gene locus_tag LOCUS_00910 gene ehaA 16487 16756 CDS product energy-converting NiFe hydrogenase A subunit EhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876023.1 protein_id gnl|my_center|LOCUS_00910 16790 17815 gene locus_tag LOCUS_00920 16790 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876041.1 protein_id gnl|my_center|LOCUS_00920 17815 18705 gene locus_tag LOCUS_00930 17815 18705 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876042.1 protein_id gnl|my_center|LOCUS_00930 18734 19642 gene locus_tag LOCUS_00940 18734 19642 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876043.1 protein_id gnl|my_center|LOCUS_00940 19655 21472 gene locus_tag LOCUS_00950 19655 21472 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876050.1 protein_id gnl|my_center|LOCUS_00950 21493 21885 gene locus_tag LOCUS_00960 21493 21885 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876052.1 protein_id gnl|my_center|LOCUS_00960 21914 23326 gene locus_tag LOCUS_00970 gene asnB 21914 23326 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060813.1 protein_id gnl|my_center|LOCUS_00970 23326 23538 gene locus_tag LOCUS_00980 gene gatC 23326 23538 CDS product Asp-tRNA(Asn) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876054.1 protein_id gnl|my_center|LOCUS_00980 23557 24036 gene locus_tag LOCUS_00990 23557 24036 CDS product allosteric regulator of homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060814.1 protein_id gnl|my_center|LOCUS_00990 24067 25083 gene locus_tag LOCUS_01000 24067 25083 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876056.1 protein_id gnl|my_center|LOCUS_01000 25062 26273 gene locus_tag LOCUS_01010 25062 26273 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060815.1 protein_id gnl|my_center|LOCUS_01010 26270 27862 gene locus_tag LOCUS_01020 gene pyrG 26270 27862 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876058.1 protein_id gnl|my_center|LOCUS_01020 28265 28086 gene locus_tag LOCUS_01030 28265 28086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 28480 29022 gene locus_tag LOCUS_01040 28480 29022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 29059 29499 gene locus_tag LOCUS_01050 29059 29499 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060817.1 protein_id gnl|my_center|LOCUS_01050 29512 30303 gene locus_tag LOCUS_01060 29512 30303 CDS product DUF2101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876062.1 protein_id gnl|my_center|LOCUS_01060 30484 30897 gene locus_tag LOCUS_01070 30484 30897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 30894 31280 gene locus_tag LOCUS_01080 30894 31280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 31277 31696 gene locus_tag LOCUS_01090 31277 31696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 31703 32353 gene locus_tag LOCUS_01100 31703 32353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 >Feature sequence004 185 634 gene locus_tag LOCUS_01110 gene mcrD 185 634 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876791.1 protein_id gnl|my_center|LOCUS_01110 635 1231 gene locus_tag LOCUS_01120 gene mcrC 635 1231 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876790.1 protein_id gnl|my_center|LOCUS_01120 1233 1991 gene locus_tag LOCUS_01130 gene mcrG 1233 1991 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060982.1 protein_id gnl|my_center|LOCUS_01130 2009 3664 gene locus_tag LOCUS_01140 gene mcrA 2009 3664 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876788.1 protein_id gnl|my_center|LOCUS_01140 3778 4659 gene locus_tag LOCUS_01150 gene mtrE 3778 4659 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870361.1 protein_id gnl|my_center|LOCUS_01150 4663 5358 gene locus_tag LOCUS_01160 gene mtrD 4663 5358 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870362.1 protein_id gnl|my_center|LOCUS_01160 5359 6168 gene locus_tag LOCUS_01170 gene mtrC 5359 6168 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876785.1 protein_id gnl|my_center|LOCUS_01170 6178 6492 gene locus_tag LOCUS_01180 6178 6492 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876784.1 protein_id gnl|my_center|LOCUS_01180 6505 7224 gene locus_tag LOCUS_01190 gene mtrA 6505 7224 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876783.1 protein_id gnl|my_center|LOCUS_01190 7239 7460 gene locus_tag LOCUS_01200 gene mtrF 7239 7460 CDS product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876782.1 protein_id gnl|my_center|LOCUS_01200 7461 7706 gene locus_tag LOCUS_01210 gene mtrG 7461 7706 CDS product tetrahydromethanopterin S-methyltransferase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876781.1 protein_id gnl|my_center|LOCUS_01210 7731 8666 gene locus_tag LOCUS_01220 gene mtrH 7731 8666 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_01220 8772 9722 gene locus_tag LOCUS_01230 8772 9722 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060981.1 protein_id gnl|my_center|LOCUS_01230 9724 10155 gene locus_tag LOCUS_01240 9724 10155 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060980.1 protein_id gnl|my_center|LOCUS_01240 10260 11744 gene locus_tag LOCUS_01250 10260 11744 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060979.1 protein_id gnl|my_center|LOCUS_01250 11684 12340 gene locus_tag LOCUS_01260 11684 12340 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457366.1 protein_id gnl|my_center|LOCUS_01260 12330 12596 gene locus_tag LOCUS_01270 12330 12596 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876775.1 protein_id gnl|my_center|LOCUS_01270 13834 12602 gene locus_tag LOCUS_01280 13834 12602 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876774.1 protein_id gnl|my_center|LOCUS_01280 14571 13816 gene locus_tag LOCUS_01290 gene sufC 14571 13816 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_01290 15098 14610 gene locus_tag LOCUS_01300 15098 14610 CDS product FeGP cofactor biosynthesis protein HcgF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876772.1 protein_id gnl|my_center|LOCUS_01300 15742 15095 gene locus_tag LOCUS_01310 15742 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876771.1 protein_id gnl|my_center|LOCUS_01310 16434 15730 gene locus_tag LOCUS_01320 16434 15730 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876770.1 protein_id gnl|my_center|LOCUS_01320 17186 16431 gene locus_tag LOCUS_01330 17186 16431 CDS product SAM-dependent methyltransferase HcgC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876769.1 protein_id gnl|my_center|LOCUS_01330 17647 17183 gene locus_tag LOCUS_01340 17647 17183 CDS product DUF3236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876768.1 protein_id gnl|my_center|LOCUS_01340 18676 17654 gene locus_tag LOCUS_01350 gene hmdB 18676 17654 CDS product 5,10-methenyltetrahydromethanopterin hydrogenase cofactor biosynthesis protein HmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876767.1 protein_id gnl|my_center|LOCUS_01350 19806 18772 gene locus_tag LOCUS_01360 gene hmd 19806 18772 CDS product 5,10-methenyltetrahydromethanopterin hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060977.1 protein_id gnl|my_center|LOCUS_01360 20023 21540 gene locus_tag LOCUS_01370 gene hmdC 20023 21540 CDS product 5,10-methenyltetrahydromethanopterin hydrogenase cofactor biosynthesis protein HmdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876761.1 protein_id gnl|my_center|LOCUS_01370 21682 22110 gene locus_tag LOCUS_01380 21682 22110 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_01380 22132 23061 gene locus_tag LOCUS_01390 gene mvhG 22132 23061 CDS product F420-non-reducing hydrogenase subunit MvhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876759.1 protein_id gnl|my_center|LOCUS_01390 23062 24480 gene locus_tag LOCUS_01400 gene mvhA 23062 24480 CDS product F420-non-reducing hydrogenase subunit MvhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876758.1 protein_id gnl|my_center|LOCUS_01400 24503 25744 gene locus_tag LOCUS_01410 gene mvhB 24503 25744 CDS product polyferredoxin protein MvhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876757.1 protein_id gnl|my_center|LOCUS_01410 27038 25764 gene locus_tag LOCUS_01420 gene pyrC 27038 25764 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060972.1 protein_id gnl|my_center|LOCUS_01420 27244 28179 gene locus_tag LOCUS_01430 27244 28179 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876750.1 protein_id gnl|my_center|LOCUS_01430 28170 28883 gene locus_tag LOCUS_01440 28170 28883 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876749.1 protein_id gnl|my_center|LOCUS_01440 31417 28880 gene locus_tag LOCUS_01450 gene mngB 31417 28880 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861603.1 protein_id gnl|my_center|LOCUS_01450 32210 31419 gene locus_tag LOCUS_01460 gene mpgP 32210 31419 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 protein_id gnl|my_center|LOCUS_01460 >Feature sequence005 231 782 gene locus_tag LOCUS_01470 231 782 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892795.1 protein_id gnl|my_center|LOCUS_01470 792 1184 gene locus_tag LOCUS_01480 792 1184 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875792.1 protein_id gnl|my_center|LOCUS_01480 1263 2921 gene locus_tag LOCUS_01490 1263 2921 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876096.1 protein_id gnl|my_center|LOCUS_01490 3132 3356 gene locus_tag LOCUS_01500 3132 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 3476 4447 gene locus_tag LOCUS_01510 3476 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 5685 4444 gene locus_tag LOCUS_01520 5685 4444 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876099.1 protein_id gnl|my_center|LOCUS_01520 6584 5724 gene locus_tag LOCUS_01530 6584 5724 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330368.1 protein_id gnl|my_center|LOCUS_01530 7888 6689 gene locus_tag LOCUS_01540 7888 6689 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876398.1 protein_id gnl|my_center|LOCUS_01540 8114 8368 gene locus_tag LOCUS_01550 8114 8368 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392945.1 protein_id gnl|my_center|LOCUS_01550 8340 10070 gene locus_tag LOCUS_01560 8340 10070 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_01560 10097 10170 gene locus_tag LOCUS_t00030 10097 10170 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10593 10171 gene locus_tag LOCUS_01570 10593 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 12179 11595 gene locus_tag LOCUS_01580 12179 11595 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251184.1 protein_id gnl|my_center|LOCUS_01580 13054 12311 gene locus_tag LOCUS_01590 13054 12311 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876400.1 protein_id gnl|my_center|LOCUS_01590 13181 15361 gene locus_tag LOCUS_01600 13181 15361 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060894.1 protein_id gnl|my_center|LOCUS_01600 15967 15347 gene locus_tag LOCUS_01610 15967 15347 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485759.1 protein_id gnl|my_center|LOCUS_01610 16410 15964 gene locus_tag LOCUS_01620 16410 15964 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876403.1 protein_id gnl|my_center|LOCUS_01620 17686 16403 gene locus_tag LOCUS_01630 gene aroA 17686 16403 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 protein_id gnl|my_center|LOCUS_01630 20314 17693 gene locus_tag LOCUS_01640 gene valS 20314 17693 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 protein_id gnl|my_center|LOCUS_01640 20399 20752 gene locus_tag LOCUS_01650 20399 20752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 20776 23505 gene locus_tag LOCUS_01660 20776 23505 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876111.1 protein_id gnl|my_center|LOCUS_01660 23502 23927 gene locus_tag LOCUS_01670 23502 23927 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876110.1 protein_id gnl|my_center|LOCUS_01670 23938 24435 gene locus_tag LOCUS_01680 23938 24435 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876952.1 protein_id gnl|my_center|LOCUS_01680 24912 24511 gene locus_tag LOCUS_01690 24912 24511 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876967.1 protein_id gnl|my_center|LOCUS_01690 25253 25594 gene locus_tag LOCUS_01700 25253 25594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 25618 26994 gene locus_tag LOCUS_01710 25618 26994 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_01710 29263 29499 gene locus_tag LOCUS_01720 29263 29499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 29666 29863 gene locus_tag LOCUS_01730 29666 29863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 29878 30117 gene locus_tag LOCUS_01740 29878 30117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060734.1 protein_id gnl|my_center|LOCUS_01740 30871 31476 gene locus_tag LOCUS_01750 30871 31476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 31486 31728 gene locus_tag LOCUS_01760 31486 31728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875718.1 protein_id gnl|my_center|LOCUS_01760 >Feature sequence006 1235 180 gene locus_tag LOCUS_01770 1235 180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060827.1 protein_id gnl|my_center|LOCUS_01770 2070 1276 gene locus_tag LOCUS_01780 2070 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 2282 2437 gene locus_tag LOCUS_01790 2282 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 3535 2849 gene locus_tag LOCUS_01800 3535 2849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060828.1 protein_id gnl|my_center|LOCUS_01800 4407 3559 gene locus_tag LOCUS_01810 4407 3559 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876118.1 protein_id gnl|my_center|LOCUS_01810 7007 4509 gene locus_tag LOCUS_01820 7007 4509 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876131.1 protein_id gnl|my_center|LOCUS_01820 7151 7669 gene locus_tag LOCUS_01830 7151 7669 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545049.1 protein_id gnl|my_center|LOCUS_01830 8157 7666 gene locus_tag LOCUS_01840 8157 7666 CDS product PsbP-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750442.1 protein_id gnl|my_center|LOCUS_01840 8651 8154 gene locus_tag LOCUS_01850 8651 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 10261 8621 gene locus_tag LOCUS_01860 10261 8621 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875997.1 protein_id gnl|my_center|LOCUS_01860 10602 12620 gene locus_tag LOCUS_01870 10602 12620 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876258.1 protein_id gnl|my_center|LOCUS_01870 12720 13028 gene locus_tag LOCUS_01880 12720 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876260.1 protein_id gnl|my_center|LOCUS_01880 13042 13989 gene locus_tag LOCUS_01890 13042 13989 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393479.1 protein_id gnl|my_center|LOCUS_01890 14010 14762 gene locus_tag LOCUS_01900 14010 14762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_01900 14773 15516 gene locus_tag LOCUS_01910 14773 15516 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_01910 15521 15793 gene locus_tag LOCUS_01920 15521 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 15823 15990 gene locus_tag LOCUS_01930 15823 15990 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061197.1 protein_id gnl|my_center|LOCUS_01930 15997 17178 gene locus_tag LOCUS_01940 15997 17178 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061196.1 protein_id gnl|my_center|LOCUS_01940 17430 17170 gene locus_tag LOCUS_01950 17430 17170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 17639 17806 gene locus_tag LOCUS_01960 17639 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 18747 18010 gene locus_tag LOCUS_01970 18747 18010 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892471.1 protein_id gnl|my_center|LOCUS_01970 18796 19251 gene locus_tag LOCUS_01980 18796 19251 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_01980 19896 19264 gene locus_tag LOCUS_01990 19896 19264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 19988 20971 gene locus_tag LOCUS_02000 19988 20971 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892473.1 protein_id gnl|my_center|LOCUS_02000 22550 21129 gene locus_tag LOCUS_02010 gene argH 22550 21129 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875908.1 protein_id gnl|my_center|LOCUS_02010 22717 22565 gene locus_tag LOCUS_02020 22717 22565 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875907.1 protein_id gnl|my_center|LOCUS_02020 23019 22714 gene locus_tag LOCUS_02030 23019 22714 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875906.1 protein_id gnl|my_center|LOCUS_02030 23506 22997 gene locus_tag LOCUS_02040 23506 22997 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875905.1 protein_id gnl|my_center|LOCUS_02040 23690 23508 gene locus_tag LOCUS_02050 23690 23508 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875904.1 protein_id gnl|my_center|LOCUS_02050 24238 23687 gene locus_tag LOCUS_02060 gene rpoE 24238 23687 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875903.1 protein_id gnl|my_center|LOCUS_02060 24790 24260 gene locus_tag LOCUS_02070 24790 24260 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_02070 25174 24818 gene locus_tag LOCUS_02080 25174 24818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875901.1 protein_id gnl|my_center|LOCUS_02080 26425 25199 gene locus_tag LOCUS_02090 gene eif2g 26425 25199 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875900.1 protein_id gnl|my_center|LOCUS_02090 26828 26448 gene locus_tag LOCUS_02100 26828 26448 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_02100 28630 26849 gene locus_tag LOCUS_02110 gene infB 28630 26849 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875898.1 protein_id gnl|my_center|LOCUS_02110 29094 28636 gene locus_tag LOCUS_02120 gene ndk 29094 28636 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875897.1 protein_id gnl|my_center|LOCUS_02120 29271 29104 gene locus_tag LOCUS_02130 29271 29104 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875896.1 protein_id gnl|my_center|LOCUS_02130 29490 29284 gene locus_tag LOCUS_02140 29490 29284 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875895.1 protein_id gnl|my_center|LOCUS_02140 29876 29505 gene locus_tag LOCUS_02150 gene rpl7ae 29876 29505 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061194.1 protein_id gnl|my_center|LOCUS_02150 >Feature sequence007 109 378 gene locus_tag LOCUS_02160 109 378 CDS product Gar1/Naf1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876519.1 protein_id gnl|my_center|LOCUS_02160 375 1313 gene locus_tag LOCUS_02170 375 1313 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 protein_id gnl|my_center|LOCUS_02170 3075 1321 gene locus_tag LOCUS_02180 3075 1321 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876517.1 protein_id gnl|my_center|LOCUS_02180 4037 3081 gene locus_tag LOCUS_02190 4037 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876516.1 protein_id gnl|my_center|LOCUS_02190 4280 4630 gene locus_tag LOCUS_02200 4280 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 4810 4619 gene locus_tag LOCUS_02210 4810 4619 CDS product DUF2116 family Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876513.1 protein_id gnl|my_center|LOCUS_02210 5503 4829 gene locus_tag LOCUS_02220 gene pyrH 5503 4829 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876512.1 protein_id gnl|my_center|LOCUS_02220 5607 6827 gene locus_tag LOCUS_02230 gene prf1 5607 6827 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_02230 7528 6923 gene locus_tag LOCUS_02240 7528 6923 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876509.1 protein_id gnl|my_center|LOCUS_02240 8497 7541 gene locus_tag LOCUS_02250 8497 7541 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 protein_id gnl|my_center|LOCUS_02250 9363 8494 gene locus_tag LOCUS_02260 gene hemC 9363 8494 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876507.1 protein_id gnl|my_center|LOCUS_02260 10705 9392 gene locus_tag LOCUS_02270 gene cfbE 10705 9392 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485764.1 protein_id gnl|my_center|LOCUS_02270 11566 10718 gene locus_tag LOCUS_02280 11566 10718 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_02280 12426 11566 gene locus_tag LOCUS_02290 12426 11566 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876504.1 protein_id gnl|my_center|LOCUS_02290 12879 12439 gene locus_tag LOCUS_02300 12879 12439 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060917.1 protein_id gnl|my_center|LOCUS_02300 13003 13392 gene locus_tag LOCUS_02310 gene eif5A 13003 13392 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 protein_id gnl|my_center|LOCUS_02310 13493 14275 gene locus_tag LOCUS_02320 gene speB 13493 14275 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876501.1 protein_id gnl|my_center|LOCUS_02320 14291 15514 gene locus_tag LOCUS_02330 14291 15514 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_02330 15520 17139 gene locus_tag LOCUS_02340 gene ade 15520 17139 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876499.1 protein_id gnl|my_center|LOCUS_02340 17770 17096 gene locus_tag LOCUS_02350 17770 17096 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876496.1 protein_id gnl|my_center|LOCUS_02350 18234 17776 gene locus_tag LOCUS_02360 18234 17776 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876495.1 protein_id gnl|my_center|LOCUS_02360 18317 18865 gene locus_tag LOCUS_02370 18317 18865 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876494.1 protein_id gnl|my_center|LOCUS_02370 18862 19866 gene locus_tag LOCUS_02380 18862 19866 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876493.1 protein_id gnl|my_center|LOCUS_02380 20362 19895 gene locus_tag LOCUS_02390 20362 19895 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485814.1 protein_id gnl|my_center|LOCUS_02390 21335 20304 gene locus_tag LOCUS_02400 21335 20304 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876491.1 protein_id gnl|my_center|LOCUS_02400 21910 21347 gene locus_tag LOCUS_02410 21910 21347 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_02410 23294 21933 gene locus_tag LOCUS_02420 23294 21933 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876489.1 protein_id gnl|my_center|LOCUS_02420 23536 25086 gene locus_tag LOCUS_02430 23536 25086 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876488.1 protein_id gnl|my_center|LOCUS_02430 25083 25469 gene locus_tag LOCUS_02440 25083 25469 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876487.1 protein_id gnl|my_center|LOCUS_02440 25479 26669 gene locus_tag LOCUS_02450 25479 26669 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_02450 >Feature sequence008 1611 964 gene locus_tag LOCUS_02460 gene hypB 1611 964 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_02460 1985 1614 gene locus_tag LOCUS_02470 gene hypA 1985 1614 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060898.1 protein_id gnl|my_center|LOCUS_02470 2035 2958 gene locus_tag LOCUS_02480 2035 2958 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876421.1 protein_id gnl|my_center|LOCUS_02480 4850 2955 gene locus_tag LOCUS_02490 gene lonB 4850 2955 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876422.1 protein_id gnl|my_center|LOCUS_02490 5709 4951 gene locus_tag LOCUS_02500 5709 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 5785 7299 gene locus_tag LOCUS_02510 gene cobQ 5785 7299 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061247.1 protein_id gnl|my_center|LOCUS_02510 8487 7288 gene locus_tag LOCUS_02520 8487 7288 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876425.1 protein_id gnl|my_center|LOCUS_02520 8710 8516 gene locus_tag LOCUS_02530 8710 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 8736 9776 gene locus_tag LOCUS_02540 8736 9776 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831398.1 protein_id gnl|my_center|LOCUS_02540 10016 9771 gene locus_tag LOCUS_02550 10016 9771 CDS product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876119.1 protein_id gnl|my_center|LOCUS_02550 10378 12021 gene locus_tag LOCUS_02560 gene pheT 10378 12021 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876408.1 protein_id gnl|my_center|LOCUS_02560 12443 12033 gene locus_tag LOCUS_02570 12443 12033 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876409.1 protein_id gnl|my_center|LOCUS_02570 13591 12458 gene locus_tag LOCUS_02580 13591 12458 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876410.1 protein_id gnl|my_center|LOCUS_02580 15350 13608 gene locus_tag LOCUS_02590 gene uvrC 15350 13608 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876080.1 protein_id gnl|my_center|LOCUS_02590 15454 17400 gene locus_tag LOCUS_02600 gene uvrB 15454 17400 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330366.1 protein_id gnl|my_center|LOCUS_02600 17416 18789 gene locus_tag LOCUS_02610 17416 18789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 18850 18859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18979 20415 gene locus_tag LOCUS_02620 18979 20415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 20856 22220 gene locus_tag LOCUS_02630 20856 22220 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_02630 22244 23803 gene locus_tag LOCUS_02640 22244 23803 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147188.1 protein_id gnl|my_center|LOCUS_02640 >Feature sequence009 1127 69 gene locus_tag LOCUS_02650 1127 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877072.1 protein_id gnl|my_center|LOCUS_02650 2193 1105 gene locus_tag LOCUS_02660 2193 1105 CDS product oligosaccharide repeat unit polymerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877071.1 protein_id gnl|my_center|LOCUS_02660 3547 2204 gene locus_tag LOCUS_02670 gene cfbB 3547 2204 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877070.1 protein_id gnl|my_center|LOCUS_02670 4264 4100 gene locus_tag LOCUS_02680 4264 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 4365 5477 gene locus_tag LOCUS_02690 4365 5477 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061302.1 protein_id gnl|my_center|LOCUS_02690 5803 5480 gene locus_tag LOCUS_02700 5803 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877067.1 protein_id gnl|my_center|LOCUS_02700 6576 5800 gene locus_tag LOCUS_02710 6576 5800 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_02710 8524 6698 gene locus_tag LOCUS_02720 8524 6698 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877065.1 protein_id gnl|my_center|LOCUS_02720 8738 10216 gene locus_tag LOCUS_02730 gene hcp 8738 10216 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750458.1 protein_id gnl|my_center|LOCUS_02730 10222 10542 gene locus_tag LOCUS_02740 10222 10542 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_02740 11784 10537 gene locus_tag LOCUS_02750 11784 10537 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_02750 11880 13532 gene locus_tag LOCUS_02760 gene ilvD 11880 13532 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061057.1 protein_id gnl|my_center|LOCUS_02760 13601 14023 gene locus_tag LOCUS_02770 13601 14023 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877058.1 protein_id gnl|my_center|LOCUS_02770 14005 15723 gene locus_tag LOCUS_02780 gene argS 14005 15723 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877057.1 protein_id gnl|my_center|LOCUS_02780 16631 15732 gene locus_tag LOCUS_02790 gene argF 16631 15732 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877056.1 protein_id gnl|my_center|LOCUS_02790 17960 16647 gene locus_tag LOCUS_02800 gene purD 17960 16647 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061056.1 protein_id gnl|my_center|LOCUS_02800 18090 19814 gene locus_tag LOCUS_02810 18090 19814 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_02810 19814 20311 gene locus_tag LOCUS_02820 gene ilvN 19814 20311 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061054.1 protein_id gnl|my_center|LOCUS_02820 20332 21318 gene locus_tag LOCUS_02830 gene ilvC 20332 21318 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061053.1 protein_id gnl|my_center|LOCUS_02830 21333 22331 gene locus_tag LOCUS_02840 21333 22331 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061052.1 protein_id gnl|my_center|LOCUS_02840 22514 22323 gene locus_tag LOCUS_02850 22514 22323 CDS product LSM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877050.1 protein_id gnl|my_center|LOCUS_02850 23358 22585 gene locus_tag LOCUS_02860 gene surE 23358 22585 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878442.1 protein_id gnl|my_center|LOCUS_02860 23487 24221 gene locus_tag LOCUS_02870 23487 24221 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061050.1 protein_id gnl|my_center|LOCUS_02870 24891 24238 gene locus_tag LOCUS_02880 24891 24238 CDS product NPXTG-anchored protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877043.1 protein_id gnl|my_center|LOCUS_02880 25086 25013 gene locus_tag LOCUS_t00040 25086 25013 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence010 499 1326 gene locus_tag LOCUS_02890 499 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 1508 2560 gene locus_tag LOCUS_02900 1508 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02900 2455 3432 gene locus_tag LOCUS_02910 2455 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02910 3570 4616 gene locus_tag LOCUS_02920 gene hypD 3570 4616 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876696.1 protein_id gnl|my_center|LOCUS_02920 4626 5315 gene locus_tag LOCUS_02930 4626 5315 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 protein_id gnl|my_center|LOCUS_02930 5303 6607 gene locus_tag LOCUS_02940 5303 6607 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876694.1 protein_id gnl|my_center|LOCUS_02940 6640 7632 gene locus_tag LOCUS_02950 6640 7632 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061273.1 protein_id gnl|my_center|LOCUS_02950 7655 8167 gene locus_tag LOCUS_02960 7655 8167 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876692.1 protein_id gnl|my_center|LOCUS_02960 8167 9306 gene locus_tag LOCUS_02970 gene pscS 8167 9306 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876691.1 protein_id gnl|my_center|LOCUS_02970 9710 9303 gene locus_tag LOCUS_02980 9710 9303 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060962.1 protein_id gnl|my_center|LOCUS_02980 9835 9747 gene locus_tag LOCUS_t00050 9835 9747 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10189 9881 gene locus_tag LOCUS_02990 gene rpsJ 10189 9881 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_02990 11468 10227 gene locus_tag LOCUS_03000 gene tuf 11468 10227 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876684.1 protein_id gnl|my_center|LOCUS_03000 13760 11568 gene locus_tag LOCUS_03010 13760 11568 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060960.1 protein_id gnl|my_center|LOCUS_03010 14331 13771 gene locus_tag LOCUS_03020 gene rpsG 14331 13771 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876682.1 protein_id gnl|my_center|LOCUS_03020 14762 14337 gene locus_tag LOCUS_03030 14762 14337 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_03030 15209 14778 gene locus_tag LOCUS_03040 15209 14778 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 protein_id gnl|my_center|LOCUS_03040 15511 15215 gene locus_tag LOCUS_03050 15511 15215 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876679.1 protein_id gnl|my_center|LOCUS_03050 16672 15512 gene locus_tag LOCUS_03060 gene rpoA2 16672 15512 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876678.1 protein_id gnl|my_center|LOCUS_03060 19839 16693 gene locus_tag LOCUS_03070 19839 16693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 21666 19861 gene locus_tag LOCUS_03080 gene rpoB 21666 19861 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876676.1 protein_id gnl|my_center|LOCUS_03080 23230 21686 gene locus_tag LOCUS_03090 23230 21686 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060959.1 protein_id gnl|my_center|LOCUS_03090 23492 23259 gene locus_tag LOCUS_03100 23492 23259 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876674.1 protein_id gnl|my_center|LOCUS_03100 23609 23536 gene locus_tag LOCUS_t00060 23609 23536 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 23690 23615 gene locus_tag LOCUS_t00070 23690 23615 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence011 238 312 gene locus_tag LOCUS_t00080 238 312 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 314 389 gene locus_tag LOCUS_t00090 314 389 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1673 396 gene locus_tag LOCUS_03110 1673 396 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876459.1 protein_id gnl|my_center|LOCUS_03110 2378 1734 gene locus_tag LOCUS_03120 2378 1734 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876460.1 protein_id gnl|my_center|LOCUS_03120 2998 2378 gene locus_tag LOCUS_03130 2998 2378 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876461.1 protein_id gnl|my_center|LOCUS_03130 3508 3017 gene locus_tag LOCUS_03140 gene hacB 3508 3017 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876462.1 protein_id gnl|my_center|LOCUS_03140 4490 3501 gene locus_tag LOCUS_03150 4490 3501 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876463.1 protein_id gnl|my_center|LOCUS_03150 5986 4502 gene locus_tag LOCUS_03160 5986 4502 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060907.1 protein_id gnl|my_center|LOCUS_03160 6124 6639 gene locus_tag LOCUS_03170 6124 6639 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060908.1 protein_id gnl|my_center|LOCUS_03170 7661 6636 gene locus_tag LOCUS_03180 7661 6636 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876467.1 protein_id gnl|my_center|LOCUS_03180 8635 7667 gene locus_tag LOCUS_03190 8635 7667 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876468.1 protein_id gnl|my_center|LOCUS_03190 9921 8632 gene locus_tag LOCUS_03200 9921 8632 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 protein_id gnl|my_center|LOCUS_03200 11238 9934 gene locus_tag LOCUS_03210 gene wecB 11238 9934 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_03210 12582 11254 gene locus_tag LOCUS_03220 12582 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 13459 12650 gene locus_tag LOCUS_03230 gene truA 13459 12650 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876473.1 protein_id gnl|my_center|LOCUS_03230 13549 14454 gene locus_tag LOCUS_03240 13549 14454 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876474.1 protein_id gnl|my_center|LOCUS_03240 14906 16204 gene locus_tag LOCUS_03250 14906 16204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 16260 16976 gene locus_tag LOCUS_03260 gene hisA 16260 16976 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060911.1 protein_id gnl|my_center|LOCUS_03260 16992 17447 gene locus_tag LOCUS_03270 16992 17447 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876477.1 protein_id gnl|my_center|LOCUS_03270 17460 18470 gene locus_tag LOCUS_03280 gene argC 17460 18470 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 protein_id gnl|my_center|LOCUS_03280 18501 19001 gene locus_tag LOCUS_03290 18501 19001 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060912.1 protein_id gnl|my_center|LOCUS_03290 19013 19849 gene locus_tag LOCUS_03300 19013 19849 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870766.1 protein_id gnl|my_center|LOCUS_03300 19846 21048 gene locus_tag LOCUS_03310 19846 21048 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876482.1 protein_id gnl|my_center|LOCUS_03310 21059 21523 gene locus_tag LOCUS_03320 gene pyrI 21059 21523 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence012 <1 871 gene locus_tag LOCUS_03330 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877430.1:roadblock/LC7 domain-containing protein 914 1369 gene locus_tag LOCUS_03340 914 1369 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061315.1 protein_id gnl|my_center|LOCUS_03340 3316 1364 gene locus_tag LOCUS_03350 gene acs 3316 1364 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 protein_id gnl|my_center|LOCUS_03350 3386 4981 gene locus_tag LOCUS_03360 3386 4981 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877210.1 protein_id gnl|my_center|LOCUS_03360 6207 5077 gene locus_tag LOCUS_03370 6207 5077 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892639.1 protein_id gnl|my_center|LOCUS_03370 6920 6228 gene locus_tag LOCUS_03380 6920 6228 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061096.1 protein_id gnl|my_center|LOCUS_03380 8025 6925 gene locus_tag LOCUS_03390 gene hisC 8025 6925 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877195.1 protein_id gnl|my_center|LOCUS_03390 8492 8025 gene locus_tag LOCUS_03400 8492 8025 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869802.1 protein_id gnl|my_center|LOCUS_03400 9976 8711 gene locus_tag LOCUS_03410 9976 8711 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 protein_id gnl|my_center|LOCUS_03410 11319 9976 gene locus_tag LOCUS_03420 gene glmM 11319 9976 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877198.1 protein_id gnl|my_center|LOCUS_03420 12551 11322 gene locus_tag LOCUS_03430 12551 11322 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877199.1 protein_id gnl|my_center|LOCUS_03430 13169 12573 gene locus_tag LOCUS_03440 13169 12573 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877200.1 protein_id gnl|my_center|LOCUS_03440 13884 13297 gene locus_tag LOCUS_03450 13884 13297 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877201.1 protein_id gnl|my_center|LOCUS_03450 14320 13997 gene locus_tag LOCUS_03460 14320 13997 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877202.1 protein_id gnl|my_center|LOCUS_03460 14923 14360 gene locus_tag LOCUS_03470 14923 14360 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197538709.1 protein_id gnl|my_center|LOCUS_03470 15705 14920 gene locus_tag LOCUS_03480 gene mtnP 15705 14920 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877204.1 protein_id gnl|my_center|LOCUS_03480 17159 15711 gene locus_tag LOCUS_03490 17159 15711 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061099.1 protein_id gnl|my_center|LOCUS_03490 17648 17193 gene locus_tag LOCUS_03500 17648 17193 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877206.1 protein_id gnl|my_center|LOCUS_03500 18998 17868 gene locus_tag LOCUS_03510 gene cdc6-2 18998 17868 CDS product ORC1-type DNA replication protein Cdc6-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877207.1 protein_id gnl|my_center|LOCUS_03510 19736 19005 gene locus_tag LOCUS_03520 19736 19005 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877208.1 protein_id gnl|my_center|LOCUS_03520 19852 21006 gene locus_tag LOCUS_03530 19852 21006 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 protein_id gnl|my_center|LOCUS_03530 21414 21025 gene locus_tag LOCUS_03540 21414 21025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence013 423 1100 gene locus_tag LOCUS_03550 gene cbiM 423 1100 CDS product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875769.1 protein_id gnl|my_center|LOCUS_03550 1102 1386 gene locus_tag LOCUS_03560 1102 1386 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870602.1 protein_id gnl|my_center|LOCUS_03560 1542 2165 gene locus_tag LOCUS_03570 gene cbiQ 1542 2165 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060748.1 protein_id gnl|my_center|LOCUS_03570 2218 3087 gene locus_tag LOCUS_03580 2218 3087 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060749.1 protein_id gnl|my_center|LOCUS_03580 3042 3545 gene locus_tag LOCUS_03590 gene ribC 3042 3545 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061180.1 protein_id gnl|my_center|LOCUS_03590 3608 4318 gene locus_tag LOCUS_03600 3608 4318 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892786.1 protein_id gnl|my_center|LOCUS_03600 4330 4662 gene locus_tag LOCUS_03610 4330 4662 CDS product DUF2304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875776.1 protein_id gnl|my_center|LOCUS_03610 4781 4966 gene locus_tag LOCUS_03620 4781 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 6874 5015 gene locus_tag LOCUS_03630 gene gatE 6874 5015 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876346.1 protein_id gnl|my_center|LOCUS_03630 8188 6881 gene locus_tag LOCUS_03640 gene gatD 8188 6881 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876345.1 protein_id gnl|my_center|LOCUS_03640 9620 8178 gene locus_tag LOCUS_03650 9620 8178 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_03650 10662 9610 gene locus_tag LOCUS_03660 gene vorB 10662 9610 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060884.1 protein_id gnl|my_center|LOCUS_03660 10894 10667 gene locus_tag LOCUS_03670 10894 10667 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022860.1 protein_id gnl|my_center|LOCUS_03670 12574 10895 gene locus_tag LOCUS_03680 12574 10895 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_03680 13136 12588 gene locus_tag LOCUS_03690 13136 12588 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 protein_id gnl|my_center|LOCUS_03690 13253 13262 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16836 14722 gene locus_tag LOCUS_03700 16836 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 <20631 17128 gene locus_tag LOCUS_03710 <20631 17128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158296324.1:cobaltochelatase subunit CobN >Feature sequence014 <1 944 gene locus_tag LOCUS_03720 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875668.1:preprotein translocase subunit SecY 973 1527 gene locus_tag LOCUS_03730 973 1527 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060730.1 protein_id gnl|my_center|LOCUS_03730 1539 2102 gene locus_tag LOCUS_03740 1539 2102 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875670.1 protein_id gnl|my_center|LOCUS_03740 2116 2382 gene locus_tag LOCUS_03750 2116 2382 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875671.1 protein_id gnl|my_center|LOCUS_03750 2379 2900 gene locus_tag LOCUS_03760 2379 2900 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879393.1 protein_id gnl|my_center|LOCUS_03760 2897 3121 gene locus_tag LOCUS_03770 2897 3121 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875673.1 protein_id gnl|my_center|LOCUS_03770 3139 4107 gene locus_tag LOCUS_03780 3139 4107 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060731.1 protein_id gnl|my_center|LOCUS_03780 4167 4254 gene locus_tag LOCUS_t00100 4167 4254 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4376 4828 gene locus_tag LOCUS_03790 4376 4828 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875675.1 protein_id gnl|my_center|LOCUS_03790 4844 5362 gene locus_tag LOCUS_03800 gene rpsD 4844 5362 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875676.1 protein_id gnl|my_center|LOCUS_03800 5374 5775 gene locus_tag LOCUS_03810 5374 5775 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875677.1 protein_id gnl|my_center|LOCUS_03810 5777 6562 gene locus_tag LOCUS_03820 5777 6562 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_03820 6576 6941 gene locus_tag LOCUS_03830 6576 6941 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875679.1 protein_id gnl|my_center|LOCUS_03830 6955 7377 gene locus_tag LOCUS_03840 gene rplM 6955 7377 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867656.1 protein_id gnl|my_center|LOCUS_03840 7393 7806 gene locus_tag LOCUS_03850 7393 7806 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_03850 7851 8018 gene locus_tag LOCUS_03860 7851 8018 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875681.1 protein_id gnl|my_center|LOCUS_03860 8179 8346 gene locus_tag LOCUS_03870 8179 8346 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828720.1 protein_id gnl|my_center|LOCUS_03870 8420 9673 gene locus_tag LOCUS_03880 gene eno 8420 9673 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_03880 9679 10275 gene locus_tag LOCUS_03890 gene rpsB 9679 10275 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875684.1 protein_id gnl|my_center|LOCUS_03890 10285 11118 gene locus_tag LOCUS_03900 gene amrB 10285 11118 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_03900 11140 12102 gene locus_tag LOCUS_03910 gene mvk 11140 12102 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875686.1 protein_id gnl|my_center|LOCUS_03910 12203 12997 gene locus_tag LOCUS_03920 12203 12997 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_03920 12994 14052 gene locus_tag LOCUS_03930 gene fni 12994 14052 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_03930 14049 15398 gene locus_tag LOCUS_03940 14049 15398 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875689.1 protein_id gnl|my_center|LOCUS_03940 15400 16386 gene locus_tag LOCUS_03950 gene idsA 15400 16386 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_03950 16395 18065 gene locus_tag LOCUS_03960 gene gltX 16395 18065 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875691.1 protein_id gnl|my_center|LOCUS_03960 18085 19317 gene locus_tag LOCUS_03970 18085 19317 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_03970 20209 19322 gene locus_tag LOCUS_03980 20209 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 >Feature sequence015 <1 1066 gene locus_tag LOCUS_03990 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876374.1:glycosyltransferase family 4 protein 1079 2518 gene locus_tag LOCUS_04000 1079 2518 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 protein_id gnl|my_center|LOCUS_04000 2512 2934 gene locus_tag LOCUS_04010 2512 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876372.1 protein_id gnl|my_center|LOCUS_04010 2931 4187 gene locus_tag LOCUS_04020 2931 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 4203 4559 gene locus_tag LOCUS_04030 4203 4559 CDS product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876369.1 protein_id gnl|my_center|LOCUS_04030 5011 4556 gene locus_tag LOCUS_04040 5011 4556 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 protein_id gnl|my_center|LOCUS_04040 5362 6594 gene locus_tag LOCUS_04050 5362 6594 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876367.1 protein_id gnl|my_center|LOCUS_04050 7389 6664 gene locus_tag LOCUS_04060 7389 6664 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060890.1 protein_id gnl|my_center|LOCUS_04060 7435 8028 gene locus_tag LOCUS_04070 7435 8028 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876365.1 protein_id gnl|my_center|LOCUS_04070 8059 9195 gene locus_tag LOCUS_04080 8059 9195 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876364.1 protein_id gnl|my_center|LOCUS_04080 9186 10220 gene locus_tag LOCUS_04090 9186 10220 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876363.1 protein_id gnl|my_center|LOCUS_04090 10211 11698 gene locus_tag LOCUS_04100 10211 11698 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876362.1 protein_id gnl|my_center|LOCUS_04100 11695 12162 gene locus_tag LOCUS_04110 gene cgi121 11695 12162 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876361.1 protein_id gnl|my_center|LOCUS_04110 13111 12146 gene locus_tag LOCUS_04120 13111 12146 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876360.1 protein_id gnl|my_center|LOCUS_04120 14288 13101 gene locus_tag LOCUS_04130 14288 13101 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061240.1 protein_id gnl|my_center|LOCUS_04130 14331 14768 gene locus_tag LOCUS_04140 14331 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 15148 14780 gene locus_tag LOCUS_04150 15148 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 16143 15148 gene locus_tag LOCUS_04160 16143 15148 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871181.1 protein_id gnl|my_center|LOCUS_04160 17133 16207 gene locus_tag LOCUS_04170 gene guaA 17133 16207 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060888.1 protein_id gnl|my_center|LOCUS_04170 17693 17133 gene locus_tag LOCUS_04180 17693 17133 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060887.1 protein_id gnl|my_center|LOCUS_04180 17907 18989 gene locus_tag LOCUS_04190 gene trm14 17907 18989 CDS product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869937.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence016 1265 72 gene locus_tag LOCUS_04200 1265 72 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877084.1 protein_id gnl|my_center|LOCUS_04200 2795 1494 gene locus_tag LOCUS_04210 2795 1494 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877086.1 protein_id gnl|my_center|LOCUS_04210 2917 3945 gene locus_tag LOCUS_04220 2917 3945 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892670.1 protein_id gnl|my_center|LOCUS_04220 3942 4589 gene locus_tag LOCUS_04230 3942 4589 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_04230 4592 5398 gene locus_tag LOCUS_04240 4592 5398 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877090.1 protein_id gnl|my_center|LOCUS_04240 5500 7035 gene locus_tag LOCUS_04250 5500 7035 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877091.1 protein_id gnl|my_center|LOCUS_04250 7049 8245 gene locus_tag LOCUS_04260 7049 8245 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877092.1 protein_id gnl|my_center|LOCUS_04260 8686 8958 gene locus_tag LOCUS_04270 gene albA 8686 8958 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061063.1 protein_id gnl|my_center|LOCUS_04270 10263 9058 gene locus_tag LOCUS_04280 10263 9058 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_04280 11433 10273 gene locus_tag LOCUS_04290 11433 10273 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877096.1 protein_id gnl|my_center|LOCUS_04290 12454 11435 gene locus_tag LOCUS_04300 12454 11435 CDS product DrrA-related ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877097.1 protein_id gnl|my_center|LOCUS_04300 12836 12459 gene locus_tag LOCUS_04310 12836 12459 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485784.1 protein_id gnl|my_center|LOCUS_04310 12938 13693 gene locus_tag LOCUS_04320 12938 13693 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877099.1 protein_id gnl|my_center|LOCUS_04320 14502 13708 gene locus_tag LOCUS_04330 14502 13708 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877103.1 protein_id gnl|my_center|LOCUS_04330 14711 15178 gene locus_tag LOCUS_04340 14711 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 16597 15611 gene locus_tag LOCUS_04350 gene ala 16597 15611 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061064.1 protein_id gnl|my_center|LOCUS_04350 16674 18053 gene locus_tag LOCUS_04360 gene gatA 16674 18053 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061065.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence017 527 15 gene locus_tag LOCUS_04370 527 15 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485739.1 protein_id gnl|my_center|LOCUS_04370 1127 537 gene locus_tag LOCUS_04380 1127 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 1320 1895 gene locus_tag LOCUS_04390 1320 1895 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876297.1 protein_id gnl|my_center|LOCUS_04390 1915 3573 gene locus_tag LOCUS_04400 1915 3573 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876295.1 protein_id gnl|my_center|LOCUS_04400 3557 6058 gene locus_tag LOCUS_04410 3557 6058 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060872.1 protein_id gnl|my_center|LOCUS_04410 7258 7599 gene locus_tag LOCUS_04420 7258 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 10013 7596 gene locus_tag LOCUS_04430 10013 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 10746 10039 gene locus_tag LOCUS_04440 gene arfB 10746 10039 CDS product 2-amino-5-formylamino-6-ribosylaminopyrimidin-4(3H)-one 5'-monophosphate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876289.1 protein_id gnl|my_center|LOCUS_04440 11204 10728 gene locus_tag LOCUS_04450 11204 10728 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 protein_id gnl|my_center|LOCUS_04450 11890 12126 gene locus_tag LOCUS_04460 11890 12126 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_04460 12176 12358 gene locus_tag LOCUS_04470 12176 12358 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876286.1 protein_id gnl|my_center|LOCUS_04470 12359 13198 gene locus_tag LOCUS_04480 12359 13198 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876285.1 protein_id gnl|my_center|LOCUS_04480 13223 14590 gene locus_tag LOCUS_04490 gene purF 13223 14590 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060868.1 protein_id gnl|my_center|LOCUS_04490 14622 15809 gene locus_tag LOCUS_04500 14622 15809 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060867.1 protein_id gnl|my_center|LOCUS_04500 15819 16295 gene locus_tag LOCUS_04510 15819 16295 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876282.1 protein_id gnl|my_center|LOCUS_04510 16313 17125 gene locus_tag LOCUS_04520 gene cfbC 16313 17125 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876281.1 protein_id gnl|my_center|LOCUS_04520 17497 17114 gene locus_tag LOCUS_04530 17497 17114 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060865.1 protein_id gnl|my_center|LOCUS_04530 17599 18039 gene locus_tag LOCUS_04540 17599 18039 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061234.1 protein_id gnl|my_center|LOCUS_04540 >Feature sequence018 85 477 gene locus_tag LOCUS_04550 85 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 1139 474 gene locus_tag LOCUS_04560 1139 474 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876839.1 protein_id gnl|my_center|LOCUS_04560 2294 1176 gene locus_tag LOCUS_04570 2294 1176 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876838.1 protein_id gnl|my_center|LOCUS_04570 2323 3225 gene locus_tag LOCUS_04580 2323 3225 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060992.1 protein_id gnl|my_center|LOCUS_04580 3241 4032 gene locus_tag LOCUS_04590 3241 4032 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061285.1 protein_id gnl|my_center|LOCUS_04590 4039 5058 gene locus_tag LOCUS_04600 4039 5058 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876835.1 protein_id gnl|my_center|LOCUS_04600 5902 5066 gene locus_tag LOCUS_04610 5902 5066 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250632.1 protein_id gnl|my_center|LOCUS_04610 6072 6458 gene locus_tag LOCUS_04620 6072 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04620 6461 7969 gene locus_tag LOCUS_04630 6461 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04630 7966 11181 gene locus_tag LOCUS_04640 7966 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04640 11278 13014 gene locus_tag LOCUS_04650 gene polB1 11278 13014 CDS product DNA polymerase PolB subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876832.1 protein_id gnl|my_center|LOCUS_04650 13549 12995 gene locus_tag LOCUS_04660 gene comE 13549 12995 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_04660 14048 13557 gene locus_tag LOCUS_04670 gene comD 14048 13557 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 protein_id gnl|my_center|LOCUS_04670 15076 14054 gene locus_tag LOCUS_04680 gene comC 15076 14054 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876829.1 protein_id gnl|my_center|LOCUS_04680 16130 15102 gene locus_tag LOCUS_04690 gene purM 16130 15102 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 protein_id gnl|my_center|LOCUS_04690 18051 16144 gene locus_tag LOCUS_04700 18051 16144 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_04700 >Feature sequence019 871 62 gene locus_tag LOCUS_04710 871 62 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875643.1 protein_id gnl|my_center|LOCUS_04710 1736 1059 gene locus_tag LOCUS_04720 1736 1059 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892753.1 protein_id gnl|my_center|LOCUS_04720 1814 3295 gene locus_tag LOCUS_04730 1814 3295 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877513.1 protein_id gnl|my_center|LOCUS_04730 3296 4267 gene locus_tag LOCUS_04740 3296 4267 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_04740 5289 4273 gene locus_tag LOCUS_04750 gene rtcA 5289 4273 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877511.1 protein_id gnl|my_center|LOCUS_04750 6461 5295 gene locus_tag LOCUS_04760 6461 5295 CDS product TIGR03576 family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877510.1 protein_id gnl|my_center|LOCUS_04760 6982 6485 gene locus_tag LOCUS_04770 6982 6485 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877509.1 protein_id gnl|my_center|LOCUS_04770 7894 7130 gene locus_tag LOCUS_04780 7894 7130 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 protein_id gnl|my_center|LOCUS_04780 8435 7875 gene locus_tag LOCUS_04790 8435 7875 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485798.1 protein_id gnl|my_center|LOCUS_04790 8959 8525 gene locus_tag LOCUS_04800 8959 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 9033 10361 gene locus_tag LOCUS_04810 9033 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 10645 10358 gene locus_tag LOCUS_04820 10645 10358 CDS product DUF5379 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877504.1 protein_id gnl|my_center|LOCUS_04820 10750 12696 gene locus_tag LOCUS_04830 gene rqcH 10750 12696 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061171.1 protein_id gnl|my_center|LOCUS_04830 12980 12693 gene locus_tag LOCUS_04840 12980 12693 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877501.1 protein_id gnl|my_center|LOCUS_04840 13332 12964 gene locus_tag LOCUS_04850 13332 12964 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877500.1 protein_id gnl|my_center|LOCUS_04850 13964 13344 gene locus_tag LOCUS_04860 13964 13344 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877499.1 protein_id gnl|my_center|LOCUS_04860 14671 13976 gene locus_tag LOCUS_04870 14671 13976 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877498.1 protein_id gnl|my_center|LOCUS_04870 15702 14668 gene locus_tag LOCUS_04880 15702 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 15949 16125 gene locus_tag LOCUS_04890 15949 16125 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061337.1 protein_id gnl|my_center|LOCUS_04890 16667 16122 gene locus_tag LOCUS_04900 16667 16122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061169.1 protein_id gnl|my_center|LOCUS_04900 16803 16985 gene locus_tag LOCUS_04910 16803 16985 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061337.1 protein_id gnl|my_center|LOCUS_04910 17005 17175 gene locus_tag LOCUS_04920 17005 17175 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750464.1 protein_id gnl|my_center|LOCUS_04920 17749 17351 gene locus_tag LOCUS_04930 17749 17351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence020 <1 557 gene locus_tag LOCUS_04940 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_115892607.1:radical SAM protein 571 1434 gene locus_tag LOCUS_04950 571 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877252.1 protein_id gnl|my_center|LOCUS_04950 3113 1443 gene locus_tag LOCUS_04960 3113 1443 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061109.1 protein_id gnl|my_center|LOCUS_04960 3330 4379 gene locus_tag LOCUS_04970 3330 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 5668 4376 gene locus_tag LOCUS_04980 5668 4376 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892604.1 protein_id gnl|my_center|LOCUS_04980 5776 6018 gene locus_tag LOCUS_04990 5776 6018 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877257.1 protein_id gnl|my_center|LOCUS_04990 6518 6015 gene locus_tag LOCUS_05000 6518 6015 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061113.1 protein_id gnl|my_center|LOCUS_05000 6622 7977 gene locus_tag LOCUS_05010 gene trpE 6622 7977 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_05010 7974 8561 gene locus_tag LOCUS_05020 7974 8561 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877264.1 protein_id gnl|my_center|LOCUS_05020 8571 9368 gene locus_tag LOCUS_05030 8571 9368 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877265.1 protein_id gnl|my_center|LOCUS_05030 9361 10023 gene locus_tag LOCUS_05040 9361 10023 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877266.1 protein_id gnl|my_center|LOCUS_05040 10020 11198 gene locus_tag LOCUS_05050 gene trpB 10020 11198 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877267.1 protein_id gnl|my_center|LOCUS_05050 11195 12001 gene locus_tag LOCUS_05060 gene trpA 11195 12001 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750470.1 protein_id gnl|my_center|LOCUS_05060 12002 13087 gene locus_tag LOCUS_05070 gene trpD 12002 13087 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877269.1 protein_id gnl|my_center|LOCUS_05070 13142 13069 gene locus_tag LOCUS_t00110 13142 13069 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 13750 13190 gene locus_tag LOCUS_05080 13750 13190 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877270.1 protein_id gnl|my_center|LOCUS_05080 14047 13751 gene locus_tag LOCUS_05090 14047 13751 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061319.1 protein_id gnl|my_center|LOCUS_05090 15043 14129 gene locus_tag LOCUS_05100 15043 14129 CDS product DUF5591 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061115.1 protein_id gnl|my_center|LOCUS_05100 16496 15045 gene locus_tag LOCUS_05110 16496 15045 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877273.1 protein_id gnl|my_center|LOCUS_05110 16998 16522 gene locus_tag LOCUS_05120 16998 16522 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877275.1 protein_id gnl|my_center|LOCUS_05120 17547 17020 gene locus_tag LOCUS_05130 gene tfe 17547 17020 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877276.1 protein_id gnl|my_center|LOCUS_05130 >Feature sequence021 355 71 gene locus_tag LOCUS_05140 355 71 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877314.1 protein_id gnl|my_center|LOCUS_05140 1005 352 gene locus_tag LOCUS_05150 gene cbiM 1005 352 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877315.1 protein_id gnl|my_center|LOCUS_05150 1835 1200 gene locus_tag LOCUS_05160 1835 1200 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876045.1 protein_id gnl|my_center|LOCUS_05160 2583 1825 gene locus_tag LOCUS_05170 2583 1825 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060810.1 protein_id gnl|my_center|LOCUS_05170 3717 2596 gene locus_tag LOCUS_05180 3717 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05180 4958 3945 gene locus_tag LOCUS_05190 4958 3945 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876038.1 protein_id gnl|my_center|LOCUS_05190 6134 4965 gene locus_tag LOCUS_05200 6134 4965 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876037.1 protein_id gnl|my_center|LOCUS_05200 6584 6153 gene locus_tag LOCUS_05210 6584 6153 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876036.1 protein_id gnl|my_center|LOCUS_05210 6982 6581 gene locus_tag LOCUS_05220 6982 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 7257 6979 gene locus_tag LOCUS_05230 7257 6979 CDS product DUF2104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876034.1 protein_id gnl|my_center|LOCUS_05230 7498 7259 gene locus_tag LOCUS_05240 7498 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 8381 7509 gene locus_tag LOCUS_05250 8381 7509 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876032.1 protein_id gnl|my_center|LOCUS_05250 8610 8395 gene locus_tag LOCUS_05260 8610 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 9288 8617 gene locus_tag LOCUS_05270 9288 8617 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060807.1 protein_id gnl|my_center|LOCUS_05270 9980 9303 gene locus_tag LOCUS_05280 9980 9303 CDS product EhaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060806.1 protein_id gnl|my_center|LOCUS_05280 10482 9985 gene locus_tag LOCUS_05290 10482 9985 CDS product DUF2106 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496531.1 protein_id gnl|my_center|LOCUS_05290 10760 10479 gene locus_tag LOCUS_05300 10760 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 11014 10757 gene locus_tag LOCUS_05310 11014 10757 CDS product DUF2108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892391.1 protein_id gnl|my_center|LOCUS_05310 11256 11011 gene locus_tag LOCUS_05320 11256 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 11765 11265 gene locus_tag LOCUS_05330 11765 11265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061212.1 protein_id gnl|my_center|LOCUS_05330 14654 12171 gene locus_tag LOCUS_05340 14654 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 15825 14668 gene locus_tag LOCUS_05350 15825 14668 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 protein_id gnl|my_center|LOCUS_05350 15993 15838 gene locus_tag LOCUS_05360 15993 15838 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065133.1 protein_id gnl|my_center|LOCUS_05360 16198 16282 gene locus_tag LOCUS_t00120 16198 16282 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence022 2208 1234 gene locus_tag LOCUS_05370 2208 1234 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_05370 2419 3198 gene locus_tag LOCUS_05380 2419 3198 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061072.1 protein_id gnl|my_center|LOCUS_05380 3212 3523 gene locus_tag LOCUS_05390 3212 3523 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_05390 3528 6377 gene locus_tag LOCUS_05400 gene leuS 3528 6377 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061305.1 protein_id gnl|my_center|LOCUS_05400 7126 6365 gene locus_tag LOCUS_05410 7126 6365 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 protein_id gnl|my_center|LOCUS_05410 8001 7138 gene locus_tag LOCUS_05420 gene hisG 8001 7138 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877116.1 protein_id gnl|my_center|LOCUS_05420 8085 9380 gene locus_tag LOCUS_05430 8085 9380 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_05430 11032 9383 gene locus_tag LOCUS_05440 11032 9383 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_05440 11117 12712 gene locus_tag LOCUS_05450 gene sepS 11117 12712 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877111.1 protein_id gnl|my_center|LOCUS_05450 12712 13326 gene locus_tag LOCUS_05460 12712 13326 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930841.1 protein_id gnl|my_center|LOCUS_05460 13323 13718 gene locus_tag LOCUS_05470 13323 13718 CDS product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877110.1 protein_id gnl|my_center|LOCUS_05470 13724 14413 gene locus_tag LOCUS_05480 gene ribB 13724 14413 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877109.1 protein_id gnl|my_center|LOCUS_05480 <15408 14408 gene locus_tag LOCUS_05490 <15408 14408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061066.1:AAA family ATPase >Feature sequence023 828 1538 gene locus_tag LOCUS_05500 828 1538 CDS product DUF2162 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261160.1 protein_id gnl|my_center|LOCUS_05500 1556 2236 gene locus_tag LOCUS_05510 1556 2236 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876309.1 protein_id gnl|my_center|LOCUS_05510 2247 2534 gene locus_tag LOCUS_05520 2247 2534 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060878.1 protein_id gnl|my_center|LOCUS_05520 2536 3222 gene locus_tag LOCUS_05530 2536 3222 CDS product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876307.1 protein_id gnl|my_center|LOCUS_05530 3229 4053 gene locus_tag LOCUS_05540 3229 4053 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876306.1 protein_id gnl|my_center|LOCUS_05540 4245 4042 gene locus_tag LOCUS_05550 4245 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892228.1 protein_id gnl|my_center|LOCUS_05550 4384 5265 gene locus_tag LOCUS_05560 gene pdxS 4384 5265 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876304.1 protein_id gnl|my_center|LOCUS_05560 5662 5324 gene locus_tag LOCUS_05570 5662 5324 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_05570 6899 5676 gene locus_tag LOCUS_05580 6899 5676 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060874.1 protein_id gnl|my_center|LOCUS_05580 7966 8232 gene locus_tag LOCUS_05590 7966 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 8330 9625 gene locus_tag LOCUS_05600 gene priL 8330 9625 CDS product DNA primase large subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876225.1 protein_id gnl|my_center|LOCUS_05600 9588 10562 gene locus_tag LOCUS_05610 gene priS 9588 10562 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061231.1 protein_id gnl|my_center|LOCUS_05610 11929 10559 gene locus_tag LOCUS_05620 gene cca 11929 10559 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876223.1 protein_id gnl|my_center|LOCUS_05620 12489 11932 gene locus_tag LOCUS_05630 gene thpR 12489 11932 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_05630 13419 12499 gene locus_tag LOCUS_05640 13419 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 14568 13444 gene locus_tag LOCUS_05650 14568 13444 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060849.1 protein_id gnl|my_center|LOCUS_05650 <15357 14805 gene locus_tag LOCUS_05660 <15357 14805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876218.1:2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase >Feature sequence024 <1 1743 gene locus_tag LOCUS_05670 <1 1743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877454.1:indolepyruvate ferredoxin oxidoreductase subunit alpha 1740 2327 gene locus_tag LOCUS_05680 gene iorB 1740 2327 CDS product indolepyruvate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877455.1 protein_id gnl|my_center|LOCUS_05680 2747 2316 gene locus_tag LOCUS_05690 2747 2316 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_05690 4061 2763 gene locus_tag LOCUS_05700 4061 2763 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877457.1 protein_id gnl|my_center|LOCUS_05700 4183 5760 gene locus_tag LOCUS_05710 4183 5760 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_05710 5953 6186 gene locus_tag LOCUS_05720 5953 6186 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877461.1 protein_id gnl|my_center|LOCUS_05720 6343 6888 gene locus_tag LOCUS_05730 gene pyrE 6343 6888 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877462.1 protein_id gnl|my_center|LOCUS_05730 6998 7633 gene locus_tag LOCUS_05740 6998 7633 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877389.1 protein_id gnl|my_center|LOCUS_05740 7591 9057 gene locus_tag LOCUS_05750 7591 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 9075 10481 gene locus_tag LOCUS_05760 9075 10481 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_05760 11255 10473 gene locus_tag LOCUS_05770 11255 10473 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061142.1 protein_id gnl|my_center|LOCUS_05770 12273 11359 gene locus_tag LOCUS_05780 12273 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 12692 13288 gene locus_tag LOCUS_05790 12692 13288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05790 13395 13745 gene locus_tag LOCUS_05800 13395 13745 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876396.1 protein_id gnl|my_center|LOCUS_05800 13756 14751 gene locus_tag LOCUS_05810 13756 14751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 >Feature sequence025 1094 810 gene locus_tag LOCUS_05820 1094 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 7766 1410 gene locus_tag LOCUS_05830 7766 1410 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876353.1 protein_id gnl|my_center|LOCUS_05830 14507 7812 gene locus_tag LOCUS_05840 14507 7812 CDS product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876355.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence026 921 121 gene locus_tag LOCUS_05850 921 121 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875802.1 protein_id gnl|my_center|LOCUS_05850 2314 929 gene locus_tag LOCUS_05860 gene recJ 2314 929 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875803.1 protein_id gnl|my_center|LOCUS_05860 2600 2316 gene locus_tag LOCUS_05870 2600 2316 CDS product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066074.1 protein_id gnl|my_center|LOCUS_05870 3380 2607 gene locus_tag LOCUS_05880 3380 2607 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875805.1 protein_id gnl|my_center|LOCUS_05880 4096 3380 gene locus_tag LOCUS_05890 gene cobA 4096 3380 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060761.1 protein_id gnl|my_center|LOCUS_05890 4762 4100 gene locus_tag LOCUS_05900 gene purQ 4762 4100 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875807.1 protein_id gnl|my_center|LOCUS_05900 5016 4765 gene locus_tag LOCUS_05910 gene purS 5016 4765 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875808.1 protein_id gnl|my_center|LOCUS_05910 5777 5013 gene locus_tag LOCUS_05920 5777 5013 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875809.1 protein_id gnl|my_center|LOCUS_05920 5913 7733 gene locus_tag LOCUS_05930 gene glmS 5913 7733 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875810.1 protein_id gnl|my_center|LOCUS_05930 8284 7853 gene locus_tag LOCUS_05940 8284 7853 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875801.1 protein_id gnl|my_center|LOCUS_05940 9590 8295 gene locus_tag LOCUS_05950 9590 8295 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060759.1 protein_id gnl|my_center|LOCUS_05950 11468 9699 gene locus_tag LOCUS_05960 11468 9699 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877524.1 protein_id gnl|my_center|LOCUS_05960 12344 11472 gene locus_tag LOCUS_05970 12344 11472 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877523.1 protein_id gnl|my_center|LOCUS_05970 13629 12367 gene locus_tag LOCUS_05980 13629 12367 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877521.1 protein_id gnl|my_center|LOCUS_05980 14265 13633 gene locus_tag LOCUS_05990 14265 13633 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877520.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence027 2165 690 gene locus_tag LOCUS_06000 gene serB 2165 690 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061103.1 protein_id gnl|my_center|LOCUS_06000 2710 2165 gene locus_tag LOCUS_06010 2710 2165 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877235.1 protein_id gnl|my_center|LOCUS_06010 2966 3484 gene locus_tag LOCUS_06020 gene cyaB 2966 3484 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 protein_id gnl|my_center|LOCUS_06020 3518 4693 gene locus_tag LOCUS_06030 3518 4693 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877238.1 protein_id gnl|my_center|LOCUS_06030 4703 5962 gene locus_tag LOCUS_06040 gene hacA 4703 5962 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061104.1 protein_id gnl|my_center|LOCUS_06040 5980 6510 gene locus_tag LOCUS_06050 5980 6510 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877240.1 protein_id gnl|my_center|LOCUS_06050 6531 7517 gene locus_tag LOCUS_06060 gene fen 6531 7517 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877241.1 protein_id gnl|my_center|LOCUS_06060 9432 7486 gene locus_tag LOCUS_06070 9432 7486 CDS product IGHMBP2 family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877242.1 protein_id gnl|my_center|LOCUS_06070 10104 9493 gene locus_tag LOCUS_06080 10104 9493 CDS product DUF2119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061105.1 protein_id gnl|my_center|LOCUS_06080 11354 10101 gene locus_tag LOCUS_06090 gene ahcY 11354 10101 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877244.1 protein_id gnl|my_center|LOCUS_06090 <13519 11414 gene locus_tag LOCUS_06100 <13519 11414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061106.1:CDC48 family AAA ATPase >Feature sequence028 89 520 gene locus_tag LOCUS_06110 89 520 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876624.1 protein_id gnl|my_center|LOCUS_06110 564 1409 gene locus_tag LOCUS_06120 564 1409 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060939.1 protein_id gnl|my_center|LOCUS_06120 1402 1821 gene locus_tag LOCUS_06130 1402 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876622.1 protein_id gnl|my_center|LOCUS_06130 2834 1818 gene locus_tag LOCUS_06140 gene larE 2834 1818 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876621.1 protein_id gnl|my_center|LOCUS_06140 3423 2842 gene locus_tag LOCUS_06150 3423 2842 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_06150 4666 3440 gene locus_tag LOCUS_06160 4666 3440 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_06160 5256 4675 gene locus_tag LOCUS_06170 5256 4675 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_06170 6349 5294 gene locus_tag LOCUS_06180 6349 5294 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876616.1 protein_id gnl|my_center|LOCUS_06180 7487 6333 gene locus_tag LOCUS_06190 7487 6333 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_06190 7657 8655 gene locus_tag LOCUS_06200 7657 8655 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485766.1 protein_id gnl|my_center|LOCUS_06200 8681 9622 gene locus_tag LOCUS_06210 8681 9622 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876611.1 protein_id gnl|my_center|LOCUS_06210 9649 9840 gene locus_tag LOCUS_06220 9649 9840 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876610.1 protein_id gnl|my_center|LOCUS_06220 9852 11261 gene locus_tag LOCUS_06230 9852 11261 CDS product lactaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870928.1 protein_id gnl|my_center|LOCUS_06230 11281 12219 gene locus_tag LOCUS_06240 11281 12219 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876607.1 protein_id gnl|my_center|LOCUS_06240 12979 12260 gene locus_tag LOCUS_06250 12979 12260 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060938.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence029 2163 1633 gene locus_tag LOCUS_06260 gene yjjX 2163 1633 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061167.1 protein_id gnl|my_center|LOCUS_06260 2629 2168 gene locus_tag LOCUS_06270 2629 2168 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_06270 3645 4226 gene locus_tag LOCUS_06280 3645 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4223 5338 gene locus_tag LOCUS_06290 gene gntC 4223 5338 CDS product guanitoxin biosynthesis PLP-dependent (S)-gamma-hydroxy-L-arginine cyclodehydratase GntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061335.1 protein_id gnl|my_center|LOCUS_06290 5346 6224 gene locus_tag LOCUS_06300 5346 6224 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877489.1 protein_id gnl|my_center|LOCUS_06300 6700 6230 gene locus_tag LOCUS_06310 6700 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061165.1 protein_id gnl|my_center|LOCUS_06310 6822 6737 gene locus_tag LOCUS_t00130 6822 6737 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6879 7058 gene locus_tag LOCUS_06320 6879 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 7581 7135 gene locus_tag LOCUS_06330 7581 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 8082 7747 gene locus_tag LOCUS_06340 8082 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 8582 8175 gene locus_tag LOCUS_06350 8582 8175 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877486.1 protein_id gnl|my_center|LOCUS_06350 9483 8563 gene locus_tag LOCUS_06360 9483 8563 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877485.1 protein_id gnl|my_center|LOCUS_06360 10235 9588 gene locus_tag LOCUS_06370 10235 9588 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_06370 10818 10294 gene locus_tag LOCUS_06380 10818 10294 CDS product DUF2096 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877483.1 protein_id gnl|my_center|LOCUS_06380 11081 10815 gene locus_tag LOCUS_06390 11081 10815 CDS product DUF749 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877482.1 protein_id gnl|my_center|LOCUS_06390 12105 11188 gene locus_tag LOCUS_06400 gene hdrB 12105 11188 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877481.1 protein_id gnl|my_center|LOCUS_06400 <12990 12125 gene locus_tag LOCUS_06410 <12990 12125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052261191.1:CoB--CoM heterodisulfide reductase subunit C >Feature sequence030 739 173 gene locus_tag LOCUS_06420 739 173 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 protein_id gnl|my_center|LOCUS_06420 1546 764 gene locus_tag LOCUS_06430 1546 764 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 protein_id gnl|my_center|LOCUS_06430 1857 1561 gene locus_tag LOCUS_06440 gene eif1A 1857 1561 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876635.1 protein_id gnl|my_center|LOCUS_06440 2023 3246 gene locus_tag LOCUS_06450 2023 3246 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060944.1 protein_id gnl|my_center|LOCUS_06450 4009 3224 gene locus_tag LOCUS_06460 gene cobK 4009 3224 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876633.1 protein_id gnl|my_center|LOCUS_06460 6510 4006 gene locus_tag LOCUS_06470 6510 4006 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060943.1 protein_id gnl|my_center|LOCUS_06470 6914 6507 gene locus_tag LOCUS_06480 6914 6507 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876631.1 protein_id gnl|my_center|LOCUS_06480 6976 7365 gene locus_tag LOCUS_06490 gene rimI 6976 7365 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876630.1 protein_id gnl|my_center|LOCUS_06490 7378 8460 gene locus_tag LOCUS_06500 gene carA 7378 8460 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060942.1 protein_id gnl|my_center|LOCUS_06500 8472 11648 gene locus_tag LOCUS_06510 gene carB 8472 11648 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_06510 11724 12878 gene locus_tag LOCUS_06520 11724 12878 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876625.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence031 1311 922 gene locus_tag LOCUS_06530 1311 922 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877189.1 protein_id gnl|my_center|LOCUS_06530 3075 1420 gene locus_tag LOCUS_06540 3075 1420 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061094.1 protein_id gnl|my_center|LOCUS_06540 4388 3117 gene locus_tag LOCUS_06550 gene thiC 4388 3117 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877184.1 protein_id gnl|my_center|LOCUS_06550 4437 4835 gene locus_tag LOCUS_06560 4437 4835 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061093.1 protein_id gnl|my_center|LOCUS_06560 5656 4841 gene locus_tag LOCUS_06570 5656 4841 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061092.1 protein_id gnl|my_center|LOCUS_06570 6692 5661 gene locus_tag LOCUS_06580 6692 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485789.1 protein_id gnl|my_center|LOCUS_06580 6819 7157 gene locus_tag LOCUS_06590 6819 7157 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876157.1 protein_id gnl|my_center|LOCUS_06590 7154 7804 gene locus_tag LOCUS_06600 7154 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8352 7876 gene locus_tag LOCUS_06610 8352 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876599.1 protein_id gnl|my_center|LOCUS_06610 8709 9068 gene locus_tag LOCUS_06620 8709 9068 CDS product DUF5518 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061141.1 protein_id gnl|my_center|LOCUS_06620 9141 9647 gene locus_tag LOCUS_06630 9141 9647 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877376.1 protein_id gnl|my_center|LOCUS_06630 9654 10268 gene locus_tag LOCUS_06640 gene rrmJ 9654 10268 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877375.1 protein_id gnl|my_center|LOCUS_06640 10695 10261 gene locus_tag LOCUS_06650 10695 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061140.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence032 30 329 gene locus_tag LOCUS_06660 30 329 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876811.1 protein_id gnl|my_center|LOCUS_06660 1405 326 gene locus_tag LOCUS_06670 1405 326 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_06670 1704 1417 gene locus_tag LOCUS_06680 1704 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 2523 3668 gene locus_tag LOCUS_06690 2523 3668 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_06690 4345 3659 gene locus_tag LOCUS_06700 4345 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876815.1 protein_id gnl|my_center|LOCUS_06700 4548 5237 gene locus_tag LOCUS_06710 4548 5237 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_06710 5631 6371 gene locus_tag LOCUS_06720 5631 6371 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_06720 6413 6877 gene locus_tag LOCUS_06730 6413 6877 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060987.1 protein_id gnl|my_center|LOCUS_06730 6899 7888 gene locus_tag LOCUS_06740 6899 7888 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876818.1 protein_id gnl|my_center|LOCUS_06740 7905 8579 gene locus_tag LOCUS_06750 7905 8579 CDS product DUF2100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876819.1 protein_id gnl|my_center|LOCUS_06750 8657 9634 gene locus_tag LOCUS_06760 gene mptA 8657 9634 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876820.1 protein_id gnl|my_center|LOCUS_06760 9618 10058 gene locus_tag LOCUS_06770 9618 10058 CDS product DUF2120 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061284.1 protein_id gnl|my_center|LOCUS_06770 10059 11138 gene locus_tag LOCUS_06780 gene cofG 10059 11138 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876822.1 protein_id gnl|my_center|LOCUS_06780 11687 11133 gene locus_tag LOCUS_06790 11687 11133 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876823.1 protein_id gnl|my_center|LOCUS_06790 <12460 11701 gene locus_tag LOCUS_06800 <12460 11701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060988.1:class I SAM-dependent methyltransferase family protein >Feature sequence033 136 1287 gene locus_tag LOCUS_06810 136 1287 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_06810 2936 1314 gene locus_tag LOCUS_06820 gene thsA 2936 1314 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876429.1 protein_id gnl|my_center|LOCUS_06820 3082 3660 gene locus_tag LOCUS_06830 3082 3660 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_06830 4180 3662 gene locus_tag LOCUS_06840 4180 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892171.1 protein_id gnl|my_center|LOCUS_06840 5820 4774 gene locus_tag LOCUS_06850 gene asd 5820 4774 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_06850 6647 5826 gene locus_tag LOCUS_06860 gene dapB 6647 5826 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876435.1 protein_id gnl|my_center|LOCUS_06860 7554 6661 gene locus_tag LOCUS_06870 gene dapA 7554 6661 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_06870 8771 7551 gene locus_tag LOCUS_06880 8771 7551 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 protein_id gnl|my_center|LOCUS_06880 8977 8786 gene locus_tag LOCUS_06890 8977 8786 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876438.1 protein_id gnl|my_center|LOCUS_06890 9276 8980 gene locus_tag LOCUS_06900 9276 8980 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869744.1 protein_id gnl|my_center|LOCUS_06900 10140 9283 gene locus_tag LOCUS_06910 10140 9283 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061249.1 protein_id gnl|my_center|LOCUS_06910 10404 10243 gene locus_tag LOCUS_06920 10404 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 10602 10871 gene locus_tag LOCUS_06930 10602 10871 CDS product MJ0307 family thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876442.1 protein_id gnl|my_center|LOCUS_06930 10879 11970 gene locus_tag LOCUS_06940 gene cbiD 10879 11970 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876443.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence034 1954 2076 gene locus_tag LOCUS_06950 1954 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2464 2392 gene locus_tag LOCUS_t00140 2464 2392 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2705 2878 gene locus_tag LOCUS_06960 2705 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3446 4456 gene locus_tag LOCUS_06970 3446 4456 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_06970 5207 4869 gene locus_tag LOCUS_06980 5207 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 5366 7147 gene locus_tag LOCUS_06990 5366 7147 CDS product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876090.1 protein_id gnl|my_center|LOCUS_06990 7161 10709 gene locus_tag LOCUS_07000 7161 10709 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750440.1 protein_id gnl|my_center|LOCUS_07000 11418 12026 gene locus_tag LOCUS_07010 11418 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence035 417 824 gene locus_tag LOCUS_07020 417 824 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876949.1 protein_id gnl|my_center|LOCUS_07020 1970 798 gene locus_tag LOCUS_07030 1970 798 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 protein_id gnl|my_center|LOCUS_07030 2516 2007 gene locus_tag LOCUS_07040 2516 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3454 2516 gene locus_tag LOCUS_07050 3454 2516 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876955.1 protein_id gnl|my_center|LOCUS_07050 4284 3460 gene locus_tag LOCUS_07060 gene hisF 4284 3460 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061292.1 protein_id gnl|my_center|LOCUS_07060 4547 4624 gene locus_tag LOCUS_t00150 4547 4624 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5584 4832 gene locus_tag LOCUS_07070 5584 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 5496 5750 gene locus_tag LOCUS_07080 5496 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 6673 5981 gene locus_tag LOCUS_07090 gene cobI 6673 5981 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876960.1 protein_id gnl|my_center|LOCUS_07090 6738 8456 gene locus_tag LOCUS_07100 6738 8456 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876959.1 protein_id gnl|my_center|LOCUS_07100 10148 8523 gene locus_tag LOCUS_07110 10148 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07110 11341 10145 gene locus_tag LOCUS_07120 11341 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07120 11464 11712 gene locus_tag LOCUS_07130 11464 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence036 1328 30 gene locus_tag LOCUS_07140 1328 30 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061087.1 protein_id gnl|my_center|LOCUS_07140 2164 1352 gene locus_tag LOCUS_07150 2164 1352 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877167.1 protein_id gnl|my_center|LOCUS_07150 3873 2161 gene locus_tag LOCUS_07160 3873 2161 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877166.1 protein_id gnl|my_center|LOCUS_07160 4281 3886 gene locus_tag LOCUS_07170 4281 3886 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877165.1 protein_id gnl|my_center|LOCUS_07170 4526 4278 gene locus_tag LOCUS_07180 4526 4278 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877164.1 protein_id gnl|my_center|LOCUS_07180 5593 4541 gene locus_tag LOCUS_07190 5593 4541 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061086.1 protein_id gnl|my_center|LOCUS_07190 6048 5593 gene locus_tag LOCUS_07200 6048 5593 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061085.1 protein_id gnl|my_center|LOCUS_07200 8810 6156 gene locus_tag LOCUS_07210 gene fdhF 8810 6156 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061084.1 protein_id gnl|my_center|LOCUS_07210 8887 9570 gene locus_tag LOCUS_07220 gene mobB 8887 9570 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877160.1 protein_id gnl|my_center|LOCUS_07220 9564 10508 gene locus_tag LOCUS_07230 gene moaA 9564 10508 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061083.1 protein_id gnl|my_center|LOCUS_07230 <11753 10505 gene locus_tag LOCUS_07240 <11753 10505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052261150.1:pseudomurein-binding repeat-containing protein >Feature sequence037 110 391 gene locus_tag LOCUS_07250 110 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 1564 701 gene locus_tag LOCUS_07260 1564 701 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877416.1 protein_id gnl|my_center|LOCUS_07260 1728 2543 gene locus_tag LOCUS_07270 1728 2543 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877413.1 protein_id gnl|my_center|LOCUS_07270 2651 3169 gene locus_tag LOCUS_07280 2651 3169 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877408.1 protein_id gnl|my_center|LOCUS_07280 3278 3889 gene locus_tag LOCUS_07290 3278 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3990 4739 gene locus_tag LOCUS_07300 3990 4739 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877405.1 protein_id gnl|my_center|LOCUS_07300 4736 7315 gene locus_tag LOCUS_07310 4736 7315 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877404.1 protein_id gnl|my_center|LOCUS_07310 7976 7293 gene locus_tag LOCUS_07320 7976 7293 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877403.1 protein_id gnl|my_center|LOCUS_07320 8979 7969 gene locus_tag LOCUS_07330 gene rfbB 8979 7969 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_07330 9549 8989 gene locus_tag LOCUS_07340 gene rfbC 9549 8989 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877392.1 protein_id gnl|my_center|LOCUS_07340 10423 9554 gene locus_tag LOCUS_07350 gene rfbA 10423 9554 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_07350 11253 10420 gene locus_tag LOCUS_07360 gene rfbD 11253 10420 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence038 1221 151 gene locus_tag LOCUS_07370 1221 151 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061048.1 protein_id gnl|my_center|LOCUS_07370 1309 2928 gene locus_tag LOCUS_07380 1309 2928 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877037.1 protein_id gnl|my_center|LOCUS_07380 2947 3507 gene locus_tag LOCUS_07390 2947 3507 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877036.1 protein_id gnl|my_center|LOCUS_07390 3504 3905 gene locus_tag LOCUS_07400 3504 3905 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061047.1 protein_id gnl|my_center|LOCUS_07400 3871 5226 gene locus_tag LOCUS_07410 3871 5226 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330372.1 protein_id gnl|my_center|LOCUS_07410 5228 6400 gene locus_tag LOCUS_07420 5228 6400 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_07420 6471 8675 gene locus_tag LOCUS_07430 6471 8675 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877027.1 protein_id gnl|my_center|LOCUS_07430 8680 9411 gene locus_tag LOCUS_07440 8680 9411 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061045.1 protein_id gnl|my_center|LOCUS_07440 9420 10334 gene locus_tag LOCUS_07450 gene pyrB 9420 10334 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877025.1 protein_id gnl|my_center|LOCUS_07450 11424 10336 gene locus_tag LOCUS_07460 gene cdc6-1 11424 10336 CDS product ORC1-type DNA replication protein Cdc6-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877024.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence039 151 1722 gene locus_tag LOCUS_07470 151 1722 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877347.1 protein_id gnl|my_center|LOCUS_07470 1746 2687 gene locus_tag LOCUS_07480 1746 2687 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877348.1 protein_id gnl|my_center|LOCUS_07480 2662 2862 gene locus_tag LOCUS_07490 2662 2862 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061136.1 protein_id gnl|my_center|LOCUS_07490 2867 3730 gene locus_tag LOCUS_07500 2867 3730 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 protein_id gnl|my_center|LOCUS_07500 3820 4602 gene locus_tag LOCUS_07510 3820 4602 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877353.1 protein_id gnl|my_center|LOCUS_07510 4639 4833 gene locus_tag LOCUS_07520 4639 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877354.1 protein_id gnl|my_center|LOCUS_07520 6121 4835 gene locus_tag LOCUS_07530 6121 4835 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892544.1 protein_id gnl|my_center|LOCUS_07530 7394 6327 gene locus_tag LOCUS_07540 7394 6327 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870054.1 protein_id gnl|my_center|LOCUS_07540 8491 7529 gene locus_tag LOCUS_07550 gene mer 8491 7529 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877358.1 protein_id gnl|my_center|LOCUS_07550 9897 8863 gene locus_tag LOCUS_07560 9897 8863 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877311.1 protein_id gnl|my_center|LOCUS_07560 11490 9928 gene locus_tag LOCUS_07570 11490 9928 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750460.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence040 85 654 gene locus_tag LOCUS_07580 gene hpt 85 654 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061024.1 protein_id gnl|my_center|LOCUS_07580 656 1645 gene locus_tag LOCUS_07590 gene dph2 656 1645 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_07590 1596 1736 gene locus_tag LOCUS_07600 1596 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 1736 2308 gene locus_tag LOCUS_07610 1736 2308 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876931.1 protein_id gnl|my_center|LOCUS_07610 2325 2588 gene locus_tag LOCUS_07620 2325 2588 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876930.1 protein_id gnl|my_center|LOCUS_07620 2585 3184 gene locus_tag LOCUS_07630 2585 3184 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_07630 3194 3622 gene locus_tag LOCUS_07640 3194 3622 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876928.1 protein_id gnl|my_center|LOCUS_07640 3693 4007 gene locus_tag LOCUS_07650 3693 4007 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061022.1 protein_id gnl|my_center|LOCUS_07650 4033 4410 gene locus_tag LOCUS_07660 4033 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 4479 5213 gene locus_tag LOCUS_07670 gene pcn 4479 5213 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876925.1 protein_id gnl|my_center|LOCUS_07670 5231 5851 gene locus_tag LOCUS_07680 5231 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061021.1 protein_id gnl|my_center|LOCUS_07680 5968 6246 gene locus_tag LOCUS_07690 5968 6246 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876923.1 protein_id gnl|my_center|LOCUS_07690 6262 6441 gene locus_tag LOCUS_07700 6262 6441 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876922.1 protein_id gnl|my_center|LOCUS_07700 6451 7230 gene locus_tag LOCUS_07710 6451 7230 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061020.1 protein_id gnl|my_center|LOCUS_07710 7406 8179 gene locus_tag LOCUS_07720 7406 8179 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496756.1 protein_id gnl|my_center|LOCUS_07720 8186 9349 gene locus_tag LOCUS_07730 8186 9349 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876918.1 protein_id gnl|my_center|LOCUS_07730 9588 9514 gene locus_tag LOCUS_t00160 9588 9514 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9690 9615 gene locus_tag LOCUS_t00170 9690 9615 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10479 9748 gene locus_tag LOCUS_07740 10479 9748 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876917.1 protein_id gnl|my_center|LOCUS_07740 10964 10476 gene locus_tag LOCUS_07750 10964 10476 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061019.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence041 1175 81 gene locus_tag LOCUS_07760 1175 81 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485757.1 protein_id gnl|my_center|LOCUS_07760 1651 1181 gene locus_tag LOCUS_07770 gene hycI 1651 1181 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485809.1 protein_id gnl|my_center|LOCUS_07770 2421 1648 gene locus_tag LOCUS_07780 2421 1648 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876377.1 protein_id gnl|my_center|LOCUS_07780 2840 2418 gene locus_tag LOCUS_07790 gene nikR 2840 2418 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876378.1 protein_id gnl|my_center|LOCUS_07790 3103 3492 gene locus_tag LOCUS_07800 3103 3492 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876379.1 protein_id gnl|my_center|LOCUS_07800 3507 3974 gene locus_tag LOCUS_07810 3507 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457324.1 protein_id gnl|my_center|LOCUS_07810 5507 3978 gene locus_tag LOCUS_07820 5507 3978 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876381.1 protein_id gnl|my_center|LOCUS_07820 6441 5521 gene locus_tag LOCUS_07830 6441 5521 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876382.1 protein_id gnl|my_center|LOCUS_07830 7412 6438 gene locus_tag LOCUS_07840 gene hemB 7412 6438 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060891.1 protein_id gnl|my_center|LOCUS_07840 8250 7423 gene locus_tag LOCUS_07850 8250 7423 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876384.1 protein_id gnl|my_center|LOCUS_07850 8899 8234 gene locus_tag LOCUS_07860 8899 8234 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060892.1 protein_id gnl|my_center|LOCUS_07860 8960 9625 gene locus_tag LOCUS_07870 8960 9625 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_07870 9638 10741 gene locus_tag LOCUS_07880 gene aroC 9638 10741 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061243.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence042 291 1343 gene locus_tag LOCUS_07890 291 1343 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876249.1 protein_id gnl|my_center|LOCUS_07890 1344 1784 gene locus_tag LOCUS_07900 1344 1784 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876248.1 protein_id gnl|my_center|LOCUS_07900 1798 2460 gene locus_tag LOCUS_07910 gene rpiA 1798 2460 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060856.1 protein_id gnl|my_center|LOCUS_07910 3660 2863 gene locus_tag LOCUS_07920 3660 2863 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485751.1 protein_id gnl|my_center|LOCUS_07920 4414 3671 gene locus_tag LOCUS_07930 4414 3671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876244.1 protein_id gnl|my_center|LOCUS_07930 5269 4427 gene locus_tag LOCUS_07940 5269 4427 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 protein_id gnl|my_center|LOCUS_07940 5355 5762 gene locus_tag LOCUS_07950 5355 5762 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876242.1 protein_id gnl|my_center|LOCUS_07950 6517 5759 gene locus_tag LOCUS_07960 gene cobM 6517 5759 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876241.1 protein_id gnl|my_center|LOCUS_07960 6785 6531 gene locus_tag LOCUS_07970 6785 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 7296 6814 gene locus_tag LOCUS_07980 7296 6814 CDS product methyl-coenzyme M reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892259.1 protein_id gnl|my_center|LOCUS_07980 7486 7842 gene locus_tag LOCUS_07990 7486 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876236.1 protein_id gnl|my_center|LOCUS_07990 7845 8336 gene locus_tag LOCUS_08000 7845 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 8643 8855 gene locus_tag LOCUS_08010 8643 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08010 8858 10033 gene locus_tag LOCUS_08020 8858 10033 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060852.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence043 643 38 gene locus_tag LOCUS_08030 643 38 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060758.1 protein_id gnl|my_center|LOCUS_08030 1307 660 gene locus_tag LOCUS_08040 1307 660 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875798.1 protein_id gnl|my_center|LOCUS_08040 1826 1311 gene locus_tag LOCUS_08050 1826 1311 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_08050 2993 1833 gene locus_tag LOCUS_08060 2993 1833 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875796.1 protein_id gnl|my_center|LOCUS_08060 3156 2995 gene locus_tag LOCUS_08070 3156 2995 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875795.1 protein_id gnl|my_center|LOCUS_08070 4113 3439 gene locus_tag LOCUS_08080 4113 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876163.1 protein_id gnl|my_center|LOCUS_08080 4889 4401 gene locus_tag LOCUS_08090 4889 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876397.1 protein_id gnl|my_center|LOCUS_08090 5373 4996 gene locus_tag LOCUS_08100 5373 4996 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876395.1 protein_id gnl|my_center|LOCUS_08100 5958 5386 gene locus_tag LOCUS_08110 5958 5386 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060893.1 protein_id gnl|my_center|LOCUS_08110 7796 5955 gene locus_tag LOCUS_08120 7796 5955 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876393.1 protein_id gnl|my_center|LOCUS_08120 9862 7820 gene locus_tag LOCUS_08130 9862 7820 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence044 7 1500 gene locus_tag LOCUS_08140 gene top6B 7 1500 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876638.1 protein_id gnl|my_center|LOCUS_08140 1493 2551 gene locus_tag LOCUS_08150 1493 2551 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_08150 2649 3662 gene locus_tag LOCUS_08160 2649 3662 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876640.1 protein_id gnl|my_center|LOCUS_08160 3673 3939 gene locus_tag LOCUS_08170 3673 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08170 3939 4517 gene locus_tag LOCUS_08180 3939 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08180 4575 5696 gene locus_tag LOCUS_08190 4575 5696 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060948.1 protein_id gnl|my_center|LOCUS_08190 6714 5794 gene locus_tag LOCUS_08200 gene hemA 6714 5794 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060949.1 protein_id gnl|my_center|LOCUS_08200 7599 6973 gene locus_tag LOCUS_08210 7599 6973 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060950.1 protein_id gnl|my_center|LOCUS_08210 8083 7604 gene locus_tag LOCUS_08220 8083 7604 CDS product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876645.1 protein_id gnl|my_center|LOCUS_08220 9714 8119 gene locus_tag LOCUS_08230 gene atwA 9714 8119 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060951.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence045 166 804 gene locus_tag LOCUS_08240 166 804 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061119.1 protein_id gnl|my_center|LOCUS_08240 806 1810 gene locus_tag LOCUS_08250 806 1810 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877288.1 protein_id gnl|my_center|LOCUS_08250 1853 2164 gene locus_tag LOCUS_08260 1853 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2255 4957 gene locus_tag LOCUS_08270 gene alaS 2255 4957 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877290.1 protein_id gnl|my_center|LOCUS_08270 4960 6201 gene locus_tag LOCUS_08280 4960 6201 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877291.1 protein_id gnl|my_center|LOCUS_08280 6217 7362 gene locus_tag LOCUS_08290 gene thiI 6217 7362 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 protein_id gnl|my_center|LOCUS_08290 7434 8531 gene locus_tag LOCUS_08300 gene fbp 7434 8531 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877293.1 protein_id gnl|my_center|LOCUS_08300 9195 8545 gene locus_tag LOCUS_08310 9195 8545 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250893.1 protein_id gnl|my_center|LOCUS_08310 9851 9195 gene locus_tag LOCUS_08320 9851 9195 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877296.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence046 307 1512 gene locus_tag LOCUS_08330 307 1512 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061035.1 protein_id gnl|my_center|LOCUS_08330 1548 4670 gene locus_tag LOCUS_08340 gene ileS 1548 4670 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876987.1 protein_id gnl|my_center|LOCUS_08340 4683 6824 gene locus_tag LOCUS_08350 gene purL 4683 6824 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876986.1 protein_id gnl|my_center|LOCUS_08350 6852 7421 gene locus_tag LOCUS_08360 6852 7421 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876985.1 protein_id gnl|my_center|LOCUS_08360 7512 9209 gene locus_tag LOCUS_08370 7512 9209 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061091.1 protein_id gnl|my_center|LOCUS_08370 9216 9506 gene locus_tag LOCUS_08380 9216 9506 CDS product DUF2097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061090.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence047 413 1420 gene locus_tag LOCUS_08390 413 1420 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496555.1 protein_id gnl|my_center|LOCUS_08390 1457 2806 gene locus_tag LOCUS_08400 gene gatB 1457 2806 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876897.1 protein_id gnl|my_center|LOCUS_08400 2823 3062 gene locus_tag LOCUS_08410 2823 3062 CDS product DUF504 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876898.1 protein_id gnl|my_center|LOCUS_08410 3064 3873 gene locus_tag LOCUS_08420 3064 3873 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876899.1 protein_id gnl|my_center|LOCUS_08420 3863 4156 gene locus_tag LOCUS_08430 gene hisE 3863 4156 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876900.1 protein_id gnl|my_center|LOCUS_08430 4927 4157 gene locus_tag LOCUS_08440 gene larB 4927 4157 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061016.1 protein_id gnl|my_center|LOCUS_08440 4994 7291 gene locus_tag LOCUS_08450 gene hypF 4994 7291 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496588.1 protein_id gnl|my_center|LOCUS_08450 7753 7286 gene locus_tag LOCUS_08460 7753 7286 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876905.1 protein_id gnl|my_center|LOCUS_08460 7853 8368 gene locus_tag LOCUS_08470 7853 8368 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876906.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence048 258 776 gene locus_tag LOCUS_08480 258 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 855 1832 gene locus_tag LOCUS_08490 gene galE 855 1832 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_08490 2054 2308 gene locus_tag LOCUS_08500 2054 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3196 5172 gene locus_tag LOCUS_08510 3196 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876271.1 protein_id gnl|my_center|LOCUS_08510 5188 6444 gene locus_tag LOCUS_08520 5188 6444 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876272.1 protein_id gnl|my_center|LOCUS_08520 7273 6416 gene locus_tag LOCUS_08530 gene galU 7273 6416 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876273.1 protein_id gnl|my_center|LOCUS_08530 7839 7285 gene locus_tag LOCUS_08540 7839 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 7970 8055 gene locus_tag LOCUS_t00180 7970 8055 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence049 732 457 gene locus_tag LOCUS_08550 732 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 1138 767 gene locus_tag LOCUS_08560 1138 767 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876316.1 protein_id gnl|my_center|LOCUS_08560 1398 1105 gene locus_tag LOCUS_08570 1398 1105 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876317.1 protein_id gnl|my_center|LOCUS_08570 1766 1398 gene locus_tag LOCUS_08580 1766 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1997 1866 gene locus_tag LOCUS_08590 1997 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2268 1999 gene locus_tag LOCUS_08600 gene rpl37A 2268 1999 CDS product 50S ribosomal protein L37Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876320.1 protein_id gnl|my_center|LOCUS_08600 3085 2270 gene locus_tag LOCUS_08610 gene rrp42 3085 2270 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876321.1 protein_id gnl|my_center|LOCUS_08610 3813 3088 gene locus_tag LOCUS_08620 gene rrp41 3813 3088 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876322.1 protein_id gnl|my_center|LOCUS_08620 4508 3810 gene locus_tag LOCUS_08630 gene rrp4 4508 3810 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876323.1 protein_id gnl|my_center|LOCUS_08630 5258 4560 gene locus_tag LOCUS_08640 5258 4560 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876324.1 protein_id gnl|my_center|LOCUS_08640 6010 5261 gene locus_tag LOCUS_08650 gene psmA 6010 5261 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876325.1 protein_id gnl|my_center|LOCUS_08650 6448 6080 gene locus_tag LOCUS_08660 6448 6080 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876326.1 protein_id gnl|my_center|LOCUS_08660 7166 6462 gene locus_tag LOCUS_08670 7166 6462 CDS product ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876327.1 protein_id gnl|my_center|LOCUS_08670 7564 7163 gene locus_tag LOCUS_08680 7564 7163 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061237.1 protein_id gnl|my_center|LOCUS_08680 8100 7561 gene locus_tag LOCUS_08690 8100 7561 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750468.1 protein_id gnl|my_center|LOCUS_08690 8604 8281 gene locus_tag LOCUS_08700 8604 8281 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060879.1 protein_id gnl|my_center|LOCUS_08700 <9306 8643 gene locus_tag LOCUS_08710 <9306 8643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876331.1:SPFH domain-containing protein >Feature sequence050 58 1335 gene locus_tag LOCUS_08720 gene hisS 58 1335 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 protein_id gnl|my_center|LOCUS_08720 1419 1718 gene locus_tag LOCUS_08730 gene hisI 1419 1718 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_08730 1725 3551 gene locus_tag LOCUS_08740 1725 3551 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875885.1 protein_id gnl|my_center|LOCUS_08740 3566 4312 gene locus_tag LOCUS_08750 3566 4312 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485719.1 protein_id gnl|my_center|LOCUS_08750 4324 4992 gene locus_tag LOCUS_08760 gene npdG 4324 4992 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_08760 5004 5570 gene locus_tag LOCUS_08770 gene hxlB 5004 5570 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061192.1 protein_id gnl|my_center|LOCUS_08770 5584 6090 gene locus_tag LOCUS_08780 gene endA 5584 6090 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060780.1 protein_id gnl|my_center|LOCUS_08780 6104 7207 gene locus_tag LOCUS_08790 6104 7207 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875890.1 protein_id gnl|my_center|LOCUS_08790 7204 7806 gene locus_tag LOCUS_08800 7204 7806 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892541.1 protein_id gnl|my_center|LOCUS_08800 7811 9019 gene locus_tag LOCUS_08810 gene thrC 7811 9019 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061193.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence051 1602 277 gene locus_tag LOCUS_08820 1602 277 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_08820 2219 1635 gene locus_tag LOCUS_08830 2219 1635 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877014.1 protein_id gnl|my_center|LOCUS_08830 3285 2230 gene locus_tag LOCUS_08840 gene cobJ 3285 2230 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877015.1 protein_id gnl|my_center|LOCUS_08840 3787 3296 gene locus_tag LOCUS_08850 3787 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892718.1 protein_id gnl|my_center|LOCUS_08850 4033 5424 gene locus_tag LOCUS_08860 4033 5424 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877017.1 protein_id gnl|my_center|LOCUS_08860 5453 6025 gene locus_tag LOCUS_08870 5453 6025 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892716.1 protein_id gnl|my_center|LOCUS_08870 6285 6037 gene locus_tag LOCUS_08880 6285 6037 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061044.1 protein_id gnl|my_center|LOCUS_08880 7337 6363 gene locus_tag LOCUS_08890 7337 6363 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877020.1 protein_id gnl|my_center|LOCUS_08890 8245 7355 gene locus_tag LOCUS_08900 gene cbiB 8245 7355 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_08900 8339 8809 gene locus_tag LOCUS_08910 8339 8809 CDS product DUF2299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877022.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence052 428 153 gene locus_tag LOCUS_08920 428 153 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_08920 535 831 gene locus_tag LOCUS_08930 535 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1264 938 gene locus_tag LOCUS_08940 1264 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 3350 1935 gene locus_tag LOCUS_08950 gene bchE 3350 1935 CDS product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933616.1 protein_id gnl|my_center|LOCUS_08950 3553 3365 gene locus_tag LOCUS_08960 3553 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 3642 4046 gene locus_tag LOCUS_08970 3642 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 4490 5533 gene locus_tag LOCUS_08980 4490 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 6473 7756 gene locus_tag LOCUS_08990 6473 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08990 7768 8952 gene locus_tag LOCUS_09000 7768 8952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09000 >Feature sequence053 235 1146 gene locus_tag LOCUS_09010 gene nadA 235 1146 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877429.1 protein_id gnl|my_center|LOCUS_09010 2252 1149 gene locus_tag LOCUS_09020 2252 1149 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877428.1 protein_id gnl|my_center|LOCUS_09020 2382 2789 gene locus_tag LOCUS_09030 2382 2789 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061150.1 protein_id gnl|my_center|LOCUS_09030 3232 2792 gene locus_tag LOCUS_09040 3232 2792 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061149.1 protein_id gnl|my_center|LOCUS_09040 3537 3259 gene locus_tag LOCUS_09050 3537 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892859.1 protein_id gnl|my_center|LOCUS_09050 4514 3540 gene locus_tag LOCUS_09060 4514 3540 CDS product alpha/beta fold hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877422.1 protein_id gnl|my_center|LOCUS_09060 4731 4516 gene locus_tag LOCUS_09070 4731 4516 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877421.1 protein_id gnl|my_center|LOCUS_09070 4815 5156 gene locus_tag LOCUS_09080 4815 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485797.1 protein_id gnl|my_center|LOCUS_09080 6507 5143 gene locus_tag LOCUS_09090 6507 5143 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061146.1 protein_id gnl|my_center|LOCUS_09090 6567 7337 gene locus_tag LOCUS_09100 gene nucS 6567 7337 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061145.1 protein_id gnl|my_center|LOCUS_09100 8415 7321 gene locus_tag LOCUS_09110 8415 7321 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061331.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence054 24 1226 gene locus_tag LOCUS_09120 24 1226 CDS product MnmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875814.1 protein_id gnl|my_center|LOCUS_09120 1214 3160 gene locus_tag LOCUS_09130 gene tgtA 1214 3160 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060763.1 protein_id gnl|my_center|LOCUS_09130 3157 3504 gene locus_tag LOCUS_09140 3157 3504 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875816.1 protein_id gnl|my_center|LOCUS_09140 3506 4249 gene locus_tag LOCUS_09150 3506 4249 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990915.1 protein_id gnl|my_center|LOCUS_09150 4265 5290 gene locus_tag LOCUS_09160 4265 5290 CDS product Zc3h12a-like ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060764.1 protein_id gnl|my_center|LOCUS_09160 5292 6497 gene locus_tag LOCUS_09170 5292 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060765.1 protein_id gnl|my_center|LOCUS_09170 6576 6806 gene locus_tag LOCUS_09180 6576 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 6847 8037 gene locus_tag LOCUS_09190 gene argJ 6847 8037 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330363.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence055 124 1260 gene locus_tag LOCUS_09200 124 1260 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296321.1 protein_id gnl|my_center|LOCUS_09200 1277 2875 gene locus_tag LOCUS_09210 1277 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 2978 3916 gene locus_tag LOCUS_09220 2978 3916 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060800.1 protein_id gnl|my_center|LOCUS_09220 3932 4810 gene locus_tag LOCUS_09230 3932 4810 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_09230 4828 5820 gene locus_tag LOCUS_09240 4828 5820 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060801.1 protein_id gnl|my_center|LOCUS_09240 5839 7041 gene locus_tag LOCUS_09250 5839 7041 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876015.1 protein_id gnl|my_center|LOCUS_09250 7096 7022 gene locus_tag LOCUS_t00190 7096 7022 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7881 7087 gene locus_tag LOCUS_09260 7881 7087 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876389.1 protein_id gnl|my_center|LOCUS_09260 <8804 7927 gene locus_tag LOCUS_09270 <8804 7927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876390.1:DUF2121 family protein >Feature sequence056 312 94 gene locus_tag LOCUS_09280 312 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 410 1084 gene locus_tag LOCUS_09290 410 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1120 1680 gene locus_tag LOCUS_09300 1120 1680 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876802.1 protein_id gnl|my_center|LOCUS_09300 1696 2019 gene locus_tag LOCUS_09310 1696 2019 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876801.1 protein_id gnl|my_center|LOCUS_09310 2040 2843 gene locus_tag LOCUS_09320 2040 2843 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060983.1 protein_id gnl|my_center|LOCUS_09320 2840 3223 gene locus_tag LOCUS_09330 2840 3223 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876799.1 protein_id gnl|my_center|LOCUS_09330 3231 4109 gene locus_tag LOCUS_09340 3231 4109 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876798.1 protein_id gnl|my_center|LOCUS_09340 4106 4402 gene locus_tag LOCUS_09350 4106 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09350 4374 4991 gene locus_tag LOCUS_09360 4374 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09360 4988 6190 gene locus_tag LOCUS_09370 4988 6190 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876796.1 protein_id gnl|my_center|LOCUS_09370 7475 6183 gene locus_tag LOCUS_09380 7475 6183 CDS product methyl-coenzyme M reductase glutamine C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876795.1 protein_id gnl|my_center|LOCUS_09380 8722 7472 gene locus_tag LOCUS_09390 gene mmp10 8722 7472 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876794.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence057 <1 870 gene locus_tag LOCUS_09400 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193330362.1:phosphate ABC transporter substrate-binding protein 888 1763 gene locus_tag LOCUS_09410 gene pstC 888 1763 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_09410 1765 2625 gene locus_tag LOCUS_09420 gene pstA 1765 2625 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877336.1 protein_id gnl|my_center|LOCUS_09420 2628 3380 gene locus_tag LOCUS_09430 gene pstB 2628 3380 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061132.1 protein_id gnl|my_center|LOCUS_09430 3407 4066 gene locus_tag LOCUS_09440 gene phoU 3407 4066 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877340.1 protein_id gnl|my_center|LOCUS_09440 4969 4130 gene locus_tag LOCUS_09450 4969 4130 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877341.1 protein_id gnl|my_center|LOCUS_09450 5417 4986 gene locus_tag LOCUS_09460 5417 4986 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877342.1 protein_id gnl|my_center|LOCUS_09460 5911 5429 gene locus_tag LOCUS_09470 5911 5429 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061134.1 protein_id gnl|my_center|LOCUS_09470 6794 5928 gene locus_tag LOCUS_09480 gene porB 6794 5928 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 protein_id gnl|my_center|LOCUS_09480 7946 6795 gene locus_tag LOCUS_09490 gene porA 7946 6795 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_09490 8202 7960 gene locus_tag LOCUS_09500 gene porD 8202 7960 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869765.1 protein_id gnl|my_center|LOCUS_09500 8739 8209 gene locus_tag LOCUS_09510 gene porC 8739 8209 CDS product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892553.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence058 44 781 gene locus_tag LOCUS_09520 44 781 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330364.1 protein_id gnl|my_center|LOCUS_09520 1381 767 gene locus_tag LOCUS_09530 1381 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3336 1585 gene locus_tag LOCUS_09540 3336 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4030 3350 gene locus_tag LOCUS_09550 4030 3350 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875848.1 protein_id gnl|my_center|LOCUS_09550 4706 4044 gene locus_tag LOCUS_09560 gene polB2 4706 4044 CDS product DNA polymerase PolB subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875847.1 protein_id gnl|my_center|LOCUS_09560 5101 4718 gene locus_tag LOCUS_09570 5101 4718 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_09570 5365 6375 gene locus_tag LOCUS_09580 gene hypE 5365 6375 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 protein_id gnl|my_center|LOCUS_09580 6393 6785 gene locus_tag LOCUS_09590 6393 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 6782 7381 gene locus_tag LOCUS_09600 6782 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09600 7975 7385 gene locus_tag LOCUS_09610 7975 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877047.1 protein_id gnl|my_center|LOCUS_09610 8290 7976 gene locus_tag LOCUS_09620 8290 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877046.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence059 1025 327 gene locus_tag LOCUS_09630 1025 327 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971370.1 protein_id gnl|my_center|LOCUS_09630 1153 1782 gene locus_tag LOCUS_09640 1153 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876656.1 protein_id gnl|my_center|LOCUS_09640 1784 2854 gene locus_tag LOCUS_09650 1784 2854 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_09650 2866 3495 gene locus_tag LOCUS_09660 gene rnhB 2866 3495 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876654.1 protein_id gnl|my_center|LOCUS_09660 3497 4336 gene locus_tag LOCUS_09670 3497 4336 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876653.1 protein_id gnl|my_center|LOCUS_09670 4353 4748 gene locus_tag LOCUS_09680 4353 4748 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876652.1 protein_id gnl|my_center|LOCUS_09680 4763 5368 gene locus_tag LOCUS_09690 gene purO 4763 5368 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876651.1 protein_id gnl|my_center|LOCUS_09690 5396 6151 gene locus_tag LOCUS_09700 gene cofE 5396 6151 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_09700 6138 7076 gene locus_tag LOCUS_09710 gene cofD 6138 7076 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060952.1 protein_id gnl|my_center|LOCUS_09710 7073 7825 gene locus_tag LOCUS_09720 7073 7825 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876648.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence060 176 1021 gene locus_tag LOCUS_09730 176 1021 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876722.1 protein_id gnl|my_center|LOCUS_09730 1772 1296 gene locus_tag LOCUS_09740 1772 1296 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876721.1 protein_id gnl|my_center|LOCUS_09740 3141 1792 gene locus_tag LOCUS_09750 3141 1792 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_09750 5098 3155 gene locus_tag LOCUS_09760 5098 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 5355 5095 gene locus_tag LOCUS_09770 5355 5095 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876719.1 protein_id gnl|my_center|LOCUS_09770 6753 5359 gene locus_tag LOCUS_09780 gene kaiC 6753 5359 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876718.1 protein_id gnl|my_center|LOCUS_09780 6888 7826 gene locus_tag LOCUS_09790 6888 7826 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876717.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence061 502 221 gene locus_tag LOCUS_09800 502 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 979 791 gene locus_tag LOCUS_09810 979 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1160 987 gene locus_tag LOCUS_09820 1160 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1265 2152 gene locus_tag LOCUS_09830 1265 2152 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060745.1 protein_id gnl|my_center|LOCUS_09830 2163 3053 gene locus_tag LOCUS_09840 2163 3053 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060746.1 protein_id gnl|my_center|LOCUS_09840 3126 3626 gene locus_tag LOCUS_09850 3126 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4254 3610 gene locus_tag LOCUS_09860 gene pyrF 4254 3610 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060747.1 protein_id gnl|my_center|LOCUS_09860 4419 5441 gene locus_tag LOCUS_09870 gene trm10 4419 5441 CDS product tRNA (guanine(9)-/adenine(9)-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249377.1 protein_id gnl|my_center|LOCUS_09870 5783 5559 gene locus_tag LOCUS_09880 5783 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09880 6549 6800 gene locus_tag LOCUS_09890 6549 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09890 7035 8165 gene locus_tag LOCUS_09900 7035 8165 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060795.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence062 464 18 gene locus_tag LOCUS_09910 464 18 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877470.1 protein_id gnl|my_center|LOCUS_09910 830 468 gene locus_tag LOCUS_09920 830 468 CDS product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877469.1 protein_id gnl|my_center|LOCUS_09920 1263 832 gene locus_tag LOCUS_09930 1263 832 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061162.1 protein_id gnl|my_center|LOCUS_09930 2782 1238 gene locus_tag LOCUS_09940 2782 1238 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061161.1 protein_id gnl|my_center|LOCUS_09940 3784 2795 gene locus_tag LOCUS_09950 3784 2795 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 protein_id gnl|my_center|LOCUS_09950 4922 3804 gene locus_tag LOCUS_09960 4922 3804 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869557.1 protein_id gnl|my_center|LOCUS_09960 5435 4929 gene locus_tag LOCUS_09970 5435 4929 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877464.1 protein_id gnl|my_center|LOCUS_09970 5774 6301 gene locus_tag LOCUS_09980 5774 6301 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061158.1 protein_id gnl|my_center|LOCUS_09980 6504 6980 gene locus_tag LOCUS_09990 6504 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7378 6977 gene locus_tag LOCUS_10000 gene tsaA 7378 6977 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877399.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence063 <1 720 gene locus_tag LOCUS_10010 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721980.1:molecular chaperone DnaK 750 1874 gene locus_tag LOCUS_10020 gene dnaJ 750 1874 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876908.1 protein_id gnl|my_center|LOCUS_10020 2302 2226 gene locus_tag LOCUS_t00200 2302 2226 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3102 2641 gene locus_tag LOCUS_10030 3102 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876909.1 protein_id gnl|my_center|LOCUS_10030 3529 3104 gene locus_tag LOCUS_10040 3529 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876910.1 protein_id gnl|my_center|LOCUS_10040 3628 4527 gene locus_tag LOCUS_10050 gene map 3628 4527 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061017.1 protein_id gnl|my_center|LOCUS_10050 4618 4827 gene locus_tag LOCUS_10060 4618 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4832 5371 gene locus_tag LOCUS_10070 4832 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 5393 5914 gene locus_tag LOCUS_10080 5393 5914 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880613.1 protein_id gnl|my_center|LOCUS_10080 5916 6155 gene locus_tag LOCUS_10090 5916 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 7028 6183 gene locus_tag LOCUS_10100 gene frhB 7028 6183 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876912.1 protein_id gnl|my_center|LOCUS_10100 <7739 7042 gene locus_tag LOCUS_10110 <7739 7042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876913.1:coenzyme F420 hydrogenase subunit gamma >Feature sequence064 1191 370 gene locus_tag LOCUS_10120 1191 370 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060996.1 protein_id gnl|my_center|LOCUS_10120 2047 1208 gene locus_tag LOCUS_10130 2047 1208 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060997.1 protein_id gnl|my_center|LOCUS_10130 3014 2073 gene locus_tag LOCUS_10140 3014 2073 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876848.1 protein_id gnl|my_center|LOCUS_10140 3936 3115 gene locus_tag LOCUS_10150 3936 3115 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876849.1 protein_id gnl|my_center|LOCUS_10150 4492 3929 gene locus_tag LOCUS_10160 4492 3929 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876850.1 protein_id gnl|my_center|LOCUS_10160 5197 4505 gene locus_tag LOCUS_10170 5197 4505 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060998.1 protein_id gnl|my_center|LOCUS_10170 5685 5194 gene locus_tag LOCUS_10180 5685 5194 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060999.1 protein_id gnl|my_center|LOCUS_10180 6255 5692 gene locus_tag LOCUS_10190 6255 5692 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061000.1 protein_id gnl|my_center|LOCUS_10190 6623 6255 gene locus_tag LOCUS_10200 6623 6255 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876854.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence065 33 305 gene locus_tag LOCUS_10210 33 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 293 781 gene locus_tag LOCUS_10220 293 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 817 1086 gene locus_tag LOCUS_10230 817 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061001.1 protein_id gnl|my_center|LOCUS_10230 1739 1083 gene locus_tag LOCUS_10240 1739 1083 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876859.1 protein_id gnl|my_center|LOCUS_10240 1989 1747 gene locus_tag LOCUS_10250 1989 1747 CDS product energy-converting hydrogenase B subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061002.1 protein_id gnl|my_center|LOCUS_10250 2996 2013 gene locus_tag LOCUS_10260 2996 2013 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876861.1 protein_id gnl|my_center|LOCUS_10260 4120 3002 gene locus_tag LOCUS_10270 4120 3002 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061003.1 protein_id gnl|my_center|LOCUS_10270 4586 4140 gene locus_tag LOCUS_10280 4586 4140 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876863.1 protein_id gnl|my_center|LOCUS_10280 5092 4598 gene locus_tag LOCUS_10290 5092 4598 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061004.1 protein_id gnl|my_center|LOCUS_10290 6457 5108 gene locus_tag LOCUS_10300 6457 5108 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061005.1 protein_id gnl|my_center|LOCUS_10300 6709 6473 gene locus_tag LOCUS_10310 6709 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876866.1 protein_id gnl|my_center|LOCUS_10310 7170 6721 gene locus_tag LOCUS_10320 7170 6721 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876867.1 protein_id gnl|my_center|LOCUS_10320 7451 7173 gene locus_tag LOCUS_10330 7451 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061006.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence066 106 753 gene locus_tag LOCUS_10340 gene hypB 106 753 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_10340 775 1803 gene locus_tag LOCUS_10350 775 1803 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485760.1 protein_id gnl|my_center|LOCUS_10350 1877 1803 gene locus_tag LOCUS_t00210 1877 1803 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1942 2421 gene locus_tag LOCUS_10360 1942 2421 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296330.1 protein_id gnl|my_center|LOCUS_10360 2479 3558 gene locus_tag LOCUS_10370 2479 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060897.1 protein_id gnl|my_center|LOCUS_10370 3562 4023 gene locus_tag LOCUS_10380 3562 4023 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876415.1 protein_id gnl|my_center|LOCUS_10380 4025 4330 gene locus_tag LOCUS_10390 4025 4330 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876414.1 protein_id gnl|my_center|LOCUS_10390 4532 5290 gene locus_tag LOCUS_10400 4532 5290 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876413.1 protein_id gnl|my_center|LOCUS_10400 5265 5915 gene locus_tag LOCUS_10410 5265 5915 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061245.1 protein_id gnl|my_center|LOCUS_10410 5921 6883 gene locus_tag LOCUS_10420 gene mch 5921 6883 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876411.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence067 317 520 gene locus_tag LOCUS_10430 317 520 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060956.1 protein_id gnl|my_center|LOCUS_10430 513 1640 gene locus_tag LOCUS_10440 513 1640 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_10440 1654 2508 gene locus_tag LOCUS_10450 gene korB 1654 2508 CDS product 2-oxoglutarate synthase subunit KorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876665.1 protein_id gnl|my_center|LOCUS_10450 2514 3077 gene locus_tag LOCUS_10460 2514 3077 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060957.1 protein_id gnl|my_center|LOCUS_10460 3074 4177 gene locus_tag LOCUS_10470 gene sucC 3074 4177 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876667.1 protein_id gnl|my_center|LOCUS_10470 5266 4181 gene locus_tag LOCUS_10480 5266 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876668.1 protein_id gnl|my_center|LOCUS_10480 6112 5282 gene locus_tag LOCUS_10490 6112 5282 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060958.1 protein_id gnl|my_center|LOCUS_10490 7044 6127 gene locus_tag LOCUS_10500 gene twy1 7044 6127 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061270.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence068 144 674 gene locus_tag LOCUS_10510 144 674 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876447.1 protein_id gnl|my_center|LOCUS_10510 852 667 gene locus_tag LOCUS_10520 852 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10520 1542 1237 gene locus_tag LOCUS_10530 1542 1237 CDS product DUF2098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060902.1 protein_id gnl|my_center|LOCUS_10530 1833 1558 gene locus_tag LOCUS_10540 1833 1558 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892157.1 protein_id gnl|my_center|LOCUS_10540 1873 2943 gene locus_tag LOCUS_10550 1873 2943 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876451.1 protein_id gnl|my_center|LOCUS_10550 2961 4574 gene locus_tag LOCUS_10560 2961 4574 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061250.1 protein_id gnl|my_center|LOCUS_10560 4584 5267 gene locus_tag LOCUS_10570 gene deoC 4584 5267 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060904.1 protein_id gnl|my_center|LOCUS_10570 5442 5795 gene locus_tag LOCUS_10580 5442 5795 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061251.1 protein_id gnl|my_center|LOCUS_10580 6906 5776 gene locus_tag LOCUS_10590 gene cofH 6906 5776 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence069 134 715 gene locus_tag LOCUS_10600 134 715 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879016.1 protein_id gnl|my_center|LOCUS_10600 766 2328 gene locus_tag LOCUS_10610 766 2328 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870892.1 protein_id gnl|my_center|LOCUS_10610 2342 3022 gene locus_tag LOCUS_10620 2342 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 3034 3267 gene locus_tag LOCUS_10630 3034 3267 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061061.1 protein_id gnl|my_center|LOCUS_10630 3233 3808 gene locus_tag LOCUS_10640 gene hisB 3233 3808 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061060.1 protein_id gnl|my_center|LOCUS_10640 5764 4382 gene locus_tag LOCUS_10650 5764 4382 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868782.1 protein_id gnl|my_center|LOCUS_10650 6633 5803 gene locus_tag LOCUS_10660 6633 5803 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877074.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence070 635 456 gene locus_tag LOCUS_10670 635 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1883 753 gene locus_tag LOCUS_10680 gene ftsZ 1883 753 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877283.1 protein_id gnl|my_center|LOCUS_10680 2761 2198 gene locus_tag LOCUS_10690 2761 2198 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877282.1 protein_id gnl|my_center|LOCUS_10690 2858 3634 gene locus_tag LOCUS_10700 gene comA 2858 3634 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877281.1 protein_id gnl|my_center|LOCUS_10700 3634 4410 gene locus_tag LOCUS_10710 3634 4410 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877280.1 protein_id gnl|my_center|LOCUS_10710 4429 5130 gene locus_tag LOCUS_10720 4429 5130 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402640.1 protein_id gnl|my_center|LOCUS_10720 5205 5885 gene locus_tag LOCUS_10730 5205 5885 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 protein_id gnl|my_center|LOCUS_10730 5892 6725 gene locus_tag LOCUS_10740 5892 6725 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877277.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence071 1822 524 gene locus_tag LOCUS_10750 1822 524 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261178.1 protein_id gnl|my_center|LOCUS_10750 1887 2462 gene locus_tag LOCUS_10760 gene tmk 1887 2462 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877367.1 protein_id gnl|my_center|LOCUS_10760 2658 2464 gene locus_tag LOCUS_10770 2658 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877368.1 protein_id gnl|my_center|LOCUS_10770 3625 2669 gene locus_tag LOCUS_10780 3625 2669 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877369.1 protein_id gnl|my_center|LOCUS_10780 4677 3631 gene locus_tag LOCUS_10790 4677 3631 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877370.1 protein_id gnl|my_center|LOCUS_10790 5111 4695 gene locus_tag LOCUS_10800 5111 4695 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877371.1 protein_id gnl|my_center|LOCUS_10800 <6775 5130 gene locus_tag LOCUS_10810 <6775 5130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877372.1:minichromosome maintenance protein MCM >Feature sequence072 1943 1041 gene locus_tag LOCUS_10820 1943 1041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876982.1 protein_id gnl|my_center|LOCUS_10820 2021 3235 gene locus_tag LOCUS_10830 2021 3235 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876981.1 protein_id gnl|my_center|LOCUS_10830 3248 4405 gene locus_tag LOCUS_10840 3248 4405 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061033.1 protein_id gnl|my_center|LOCUS_10840 4716 4432 gene locus_tag LOCUS_10850 4716 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5042 4731 gene locus_tag LOCUS_10860 5042 4731 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061032.1 protein_id gnl|my_center|LOCUS_10860 5763 5047 gene locus_tag LOCUS_10870 5763 5047 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876976.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence073 361 843 gene locus_tag LOCUS_10880 361 843 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084126250.1 protein_id gnl|my_center|LOCUS_10880 840 1865 gene locus_tag LOCUS_10890 840 1865 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_10890 1922 2815 gene locus_tag LOCUS_10900 gene fhcD 1922 2815 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061010.1 protein_id gnl|my_center|LOCUS_10900 4761 2812 gene locus_tag LOCUS_10910 4761 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4852 6366 gene locus_tag LOCUS_10920 4852 6366 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876880.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence074 39 896 gene locus_tag LOCUS_10930 39 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 960 3473 gene locus_tag LOCUS_10940 960 3473 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877231.1 protein_id gnl|my_center|LOCUS_10940 3847 3470 gene locus_tag LOCUS_10950 3847 3470 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877230.1 protein_id gnl|my_center|LOCUS_10950 3921 5009 gene locus_tag LOCUS_10960 3921 5009 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 protein_id gnl|my_center|LOCUS_10960 5021 5800 gene locus_tag LOCUS_10970 5021 5800 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_10970 5806 6363 gene locus_tag LOCUS_10980 5806 6363 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877227.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence075 65 1078 gene locus_tag LOCUS_10990 gene rpl3p 65 1078 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875644.1 protein_id gnl|my_center|LOCUS_10990 1080 1871 gene locus_tag LOCUS_11000 gene rpl4p 1080 1871 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 protein_id gnl|my_center|LOCUS_11000 1877 2137 gene locus_tag LOCUS_11010 1877 2137 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060727.1 protein_id gnl|my_center|LOCUS_11010 2162 2872 gene locus_tag LOCUS_11020 2162 2872 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_11020 2896 3306 gene locus_tag LOCUS_11030 gene rpsS 2896 3306 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875648.1 protein_id gnl|my_center|LOCUS_11030 3323 3784 gene locus_tag LOCUS_11040 gene rplV 3323 3784 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875649.1 protein_id gnl|my_center|LOCUS_11040 3789 4475 gene locus_tag LOCUS_11050 3789 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4482 4676 gene locus_tag LOCUS_11060 gene rpmC 4482 4676 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875651.1 protein_id gnl|my_center|LOCUS_11060 4689 4994 gene locus_tag LOCUS_11070 gene yciH 4689 4994 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875652.1 protein_id gnl|my_center|LOCUS_11070 4991 5272 gene locus_tag LOCUS_11080 4991 5272 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875653.1 protein_id gnl|my_center|LOCUS_11080 5286 5606 gene locus_tag LOCUS_11090 5286 5606 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875654.1 protein_id gnl|my_center|LOCUS_11090 5608 6006 gene locus_tag LOCUS_11100 5608 6006 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875655.1 protein_id gnl|my_center|LOCUS_11100 6118 6390 gene locus_tag LOCUS_11110 gene rplX 6118 6390 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875656.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence076 789 52 gene locus_tag LOCUS_11120 789 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 833 1090 gene locus_tag LOCUS_11130 833 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1791 1138 gene locus_tag LOCUS_11140 1791 1138 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876521.1 protein_id gnl|my_center|LOCUS_11140 2086 1796 gene locus_tag LOCUS_11150 2086 1796 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876522.1 protein_id gnl|my_center|LOCUS_11150 2290 2691 gene locus_tag LOCUS_11160 2290 2691 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876523.1 protein_id gnl|my_center|LOCUS_11160 2720 3862 gene locus_tag LOCUS_11170 gene dnaG 2720 3862 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876524.1 protein_id gnl|my_center|LOCUS_11170 3873 5378 gene locus_tag LOCUS_11180 3873 5378 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876525.1 protein_id gnl|my_center|LOCUS_11180 5419 6315 gene locus_tag LOCUS_11190 5419 6315 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence077 212 754 gene locus_tag LOCUS_11200 212 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 851 1642 gene locus_tag LOCUS_11210 851 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060818.1 protein_id gnl|my_center|LOCUS_11210 1646 2326 gene locus_tag LOCUS_11220 1646 2326 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_11220 2721 2323 gene locus_tag LOCUS_11230 2721 2323 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876072.1 protein_id gnl|my_center|LOCUS_11230 3270 2737 gene locus_tag LOCUS_11240 3270 2737 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060819.1 protein_id gnl|my_center|LOCUS_11240 4031 3282 gene locus_tag LOCUS_11250 4031 3282 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876074.1 protein_id gnl|my_center|LOCUS_11250 4130 4327 gene locus_tag LOCUS_11260 4130 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876075.1 protein_id gnl|my_center|LOCUS_11260 4334 5362 gene locus_tag LOCUS_11270 4334 5362 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060820.1 protein_id gnl|my_center|LOCUS_11270 6092 5367 gene locus_tag LOCUS_11280 6092 5367 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876078.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence078 22 1518 gene locus_tag LOCUS_11290 22 1518 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061157.1 protein_id gnl|my_center|LOCUS_11290 1484 2212 gene locus_tag LOCUS_11300 1484 2212 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877451.1 protein_id gnl|my_center|LOCUS_11300 2303 3349 gene locus_tag LOCUS_11310 2303 3349 CDS product DUF1512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877450.1 protein_id gnl|my_center|LOCUS_11310 3352 3960 gene locus_tag LOCUS_11320 gene dcd 3352 3960 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061156.1 protein_id gnl|my_center|LOCUS_11320 3963 5705 gene locus_tag LOCUS_11330 gene glyS 3963 5705 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061155.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence079 <1 1015 gene locus_tag LOCUS_11340 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877132.1:Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit 1008 2015 gene locus_tag LOCUS_11350 1008 2015 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877133.1 protein_id gnl|my_center|LOCUS_11350 2022 2618 gene locus_tag LOCUS_11360 gene hisH 2022 2618 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_11360 2627 3982 gene locus_tag LOCUS_11370 2627 3982 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061078.1 protein_id gnl|my_center|LOCUS_11370 3972 4406 gene locus_tag LOCUS_11380 3972 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 4678 >6099 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatcccattttggtctgattttaac >Feature sequence080 122 973 gene locus_tag LOCUS_11390 gene mthRnl 122 973 CDS product ATP-dependent RNA/DNA ligase MthRnl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060995.1 protein_id gnl|my_center|LOCUS_11390 989 1810 gene locus_tag LOCUS_11400 gene pheA 989 1810 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060994.1 protein_id gnl|my_center|LOCUS_11400 1878 2453 gene locus_tag LOCUS_11410 1878 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2483 3007 gene locus_tag LOCUS_11420 2483 3007 CDS product PsbP-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876842.1 protein_id gnl|my_center|LOCUS_11420 3398 3204 gene locus_tag LOCUS_11430 3398 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 4418 4918 gene locus_tag LOCUS_11440 4418 4918 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060993.1 protein_id gnl|my_center|LOCUS_11440 4929 6065 gene locus_tag LOCUS_11450 gene coaBC 4929 6065 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876840.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence081 1411 869 gene locus_tag LOCUS_11460 1411 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060984.1 protein_id gnl|my_center|LOCUS_11460 1487 2155 gene locus_tag LOCUS_11470 gene comB 1487 2155 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876806.1 protein_id gnl|my_center|LOCUS_11470 2171 3328 gene locus_tag LOCUS_11480 2171 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 3332 3544 gene locus_tag LOCUS_11490 3332 3544 CDS product DUF1922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876808.1 protein_id gnl|my_center|LOCUS_11490 3551 5146 gene locus_tag LOCUS_11500 3551 5146 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876809.1 protein_id gnl|my_center|LOCUS_11500 5972 5130 gene locus_tag LOCUS_11510 5972 5130 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876810.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence082 169 14 gene locus_tag LOCUS_11520 169 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 748 182 gene locus_tag LOCUS_11530 gene pgsA 748 182 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061121.1 protein_id gnl|my_center|LOCUS_11530 819 1436 gene locus_tag LOCUS_11540 819 1436 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877299.1 protein_id gnl|my_center|LOCUS_11540 1433 2140 gene locus_tag LOCUS_11550 gene radB 1433 2140 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877300.1 protein_id gnl|my_center|LOCUS_11550 2409 3455 gene locus_tag LOCUS_11560 2409 3455 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877301.1 protein_id gnl|my_center|LOCUS_11560 5325 3634 gene locus_tag LOCUS_11570 5325 3634 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061122.1 protein_id gnl|my_center|LOCUS_11570 5771 5562 gene locus_tag LOCUS_11580 5771 5562 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence083 <1 1000 gene locus_tag LOCUS_11590 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876948.1:diaminopimelate decarboxylase 1020 1883 gene locus_tag LOCUS_11600 gene dapF 1020 1883 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876947.1 protein_id gnl|my_center|LOCUS_11600 2462 1875 gene locus_tag LOCUS_11610 2462 1875 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061290.1 protein_id gnl|my_center|LOCUS_11610 2662 2459 gene locus_tag LOCUS_11620 2662 2459 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876941.1 protein_id gnl|my_center|LOCUS_11620 3094 2735 gene locus_tag LOCUS_11630 3094 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876940.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11630 3962 3138 gene locus_tag LOCUS_11640 gene rsmA 3962 3138 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876939.1 protein_id gnl|my_center|LOCUS_11640 4552 3962 gene locus_tag LOCUS_11650 4552 3962 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_11650 4913 4578 gene locus_tag LOCUS_11660 4913 4578 CDS product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061025.1 protein_id gnl|my_center|LOCUS_11660 5210 4920 gene locus_tag LOCUS_11670 5210 4920 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876936.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence084 941 504 gene locus_tag LOCUS_11680 941 504 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875667.1 protein_id gnl|my_center|LOCUS_11680 1413 958 gene locus_tag LOCUS_11690 gene rpmD 1413 958 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875666.1 protein_id gnl|my_center|LOCUS_11690 2071 1427 gene locus_tag LOCUS_11700 gene rpsE 2071 1427 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192961070.1 protein_id gnl|my_center|LOCUS_11700 2649 2068 gene locus_tag LOCUS_11710 2649 2068 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875664.1 protein_id gnl|my_center|LOCUS_11710 3110 2664 gene locus_tag LOCUS_11720 3110 2664 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875663.1 protein_id gnl|my_center|LOCUS_11720 3476 3150 gene locus_tag LOCUS_11730 3476 3150 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875662.1 protein_id gnl|my_center|LOCUS_11730 4014 3481 gene locus_tag LOCUS_11740 4014 3481 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 protein_id gnl|my_center|LOCUS_11740 4423 4031 gene locus_tag LOCUS_11750 4423 4031 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060728.1 protein_id gnl|my_center|LOCUS_11750 4584 4441 gene locus_tag LOCUS_11760 4584 4441 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295326.1 protein_id gnl|my_center|LOCUS_11760 5100 4591 gene locus_tag LOCUS_11770 5100 4591 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875658.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence085 86 403 gene locus_tag LOCUS_11780 86 403 CDS product DUF4064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876159.1 protein_id gnl|my_center|LOCUS_11780 411 824 gene locus_tag LOCUS_11790 411 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876158.1 protein_id gnl|my_center|LOCUS_11790 992 2014 gene locus_tag LOCUS_11800 992 2014 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876254.1 protein_id gnl|my_center|LOCUS_11800 2752 2009 gene locus_tag LOCUS_11810 gene thiD 2752 2009 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876253.1 protein_id gnl|my_center|LOCUS_11810 3436 2759 gene locus_tag LOCUS_11820 gene cofC 3436 2759 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876252.1 protein_id gnl|my_center|LOCUS_11820 4139 3459 gene locus_tag LOCUS_11830 4139 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876251.1 protein_id gnl|my_center|LOCUS_11830 5431 4154 gene locus_tag LOCUS_11840 gene proS 5431 4154 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060857.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence086 789 163 gene locus_tag LOCUS_11850 789 163 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877124.1 protein_id gnl|my_center|LOCUS_11850 903 2090 gene locus_tag LOCUS_11860 903 2090 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_11860 2126 4843 gene locus_tag LOCUS_11870 2126 4843 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061075.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence087 157 1713 gene locus_tag LOCUS_11880 157 1713 CDS product DUF530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876227.1 protein_id gnl|my_center|LOCUS_11880 1769 2221 gene locus_tag LOCUS_11890 1769 2221 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060850.1 protein_id gnl|my_center|LOCUS_11890 2228 3190 gene locus_tag LOCUS_11900 2228 3190 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060851.1 protein_id gnl|my_center|LOCUS_11900 4045 3170 gene locus_tag LOCUS_11910 4045 3170 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485806.1 protein_id gnl|my_center|LOCUS_11910 4722 4042 gene locus_tag LOCUS_11920 4722 4042 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876231.1 protein_id gnl|my_center|LOCUS_11920 5055 4738 gene locus_tag LOCUS_11930 5055 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence088 28 813 gene locus_tag LOCUS_11940 gene cbiQ 28 813 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877313.1 protein_id gnl|my_center|LOCUS_11940 1332 2084 gene locus_tag LOCUS_11950 1332 2084 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877180.1 protein_id gnl|my_center|LOCUS_11950 2139 3467 gene locus_tag LOCUS_11960 gene glnA 2139 3467 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877179.1 protein_id gnl|my_center|LOCUS_11960 4614 3490 gene locus_tag LOCUS_11970 4614 3490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876984.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence089 298 447 gene locus_tag LOCUS_11980 298 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 940 1926 gene locus_tag LOCUS_11990 940 1926 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060741.1 protein_id gnl|my_center|LOCUS_11990 2223 2372 gene locus_tag LOCUS_12000 2223 2372 CDS product TIGR04165 family Cys-rich peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750434.1 protein_id gnl|my_center|LOCUS_12000 3186 3512 gene locus_tag LOCUS_12010 3186 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3871 3521 gene locus_tag LOCUS_12020 3871 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 4017 4238 gene locus_tag LOCUS_12030 4017 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060739.1 protein_id gnl|my_center|LOCUS_12030 4787 4239 gene locus_tag LOCUS_12040 4787 4239 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061179.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence090 995 306 gene locus_tag LOCUS_12050 995 306 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875831.1 protein_id gnl|my_center|LOCUS_12050 1926 1009 gene locus_tag LOCUS_12060 1926 1009 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_12060 2493 1927 gene locus_tag LOCUS_12070 gene pdxT 2493 1927 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875829.1 protein_id gnl|my_center|LOCUS_12070 3697 2714 gene locus_tag LOCUS_12080 3697 2714 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875827.1 protein_id gnl|my_center|LOCUS_12080 4281 3724 gene locus_tag LOCUS_12090 4281 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence091 54 1286 gene locus_tag LOCUS_12100 54 1286 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877471.1 protein_id gnl|my_center|LOCUS_12100 1296 1862 gene locus_tag LOCUS_12110 1296 1862 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877472.1 protein_id gnl|my_center|LOCUS_12110 1856 2716 gene locus_tag LOCUS_12120 gene nifB 1856 2716 CDS product FeMo cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877473.1 protein_id gnl|my_center|LOCUS_12120 2732 3661 gene locus_tag LOCUS_12130 gene mtnA 2732 3661 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061163.1 protein_id gnl|my_center|LOCUS_12130 4674 3658 gene locus_tag LOCUS_12140 4674 3658 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877475.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence092 431 246 gene locus_tag LOCUS_12150 431 246 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061279.1 protein_id gnl|my_center|LOCUS_12150 707 2419 gene locus_tag LOCUS_12160 gene oadA 707 2419 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876731.1 protein_id gnl|my_center|LOCUS_12160 3091 2420 gene locus_tag LOCUS_12170 gene queC 3091 2420 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876732.1 protein_id gnl|my_center|LOCUS_12170 4294 3098 gene locus_tag LOCUS_12180 gene larC 4294 3098 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060969.1 protein_id gnl|my_center|LOCUS_12180 4679 4305 gene locus_tag LOCUS_12190 4679 4305 CDS product MJ1244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060970.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence093 311 180 gene locus_tag LOCUS_12200 311 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12200 1441 293 gene locus_tag LOCUS_12210 1441 293 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_12210 2097 1438 gene locus_tag LOCUS_12220 2097 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 2411 2175 gene locus_tag LOCUS_12230 2411 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060734.1 protein_id gnl|my_center|LOCUS_12230 2883 2506 gene locus_tag LOCUS_12240 2883 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875725.1 protein_id gnl|my_center|LOCUS_12240 3221 3027 gene locus_tag LOCUS_12250 3221 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12250 4078 3893 gene locus_tag LOCUS_12260 4078 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12260 4317 4075 gene locus_tag LOCUS_12270 4317 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12270 >Feature sequence094 565 1176 gene locus_tag LOCUS_12280 565 1176 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875869.1 protein_id gnl|my_center|LOCUS_12280 2459 1200 gene locus_tag LOCUS_12290 gene hemL 2459 1200 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875867.1 protein_id gnl|my_center|LOCUS_12290 3085 2456 gene locus_tag LOCUS_12300 3085 2456 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060776.1 protein_id gnl|my_center|LOCUS_12300 <4231 3098 gene locus_tag LOCUS_12310 <4231 3098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875865.1:aspartate--tRNA(Asn) ligase >Feature sequence095 1284 871 gene locus_tag LOCUS_12320 1284 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 2308 2111 gene locus_tag LOCUS_12330 2308 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2355 2645 gene locus_tag LOCUS_12340 2355 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence096 1884 931 gene locus_tag LOCUS_12350 1884 931 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060778.1 protein_id gnl|my_center|LOCUS_12350 2736 1891 gene locus_tag LOCUS_12360 2736 1891 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_12360 2841 3503 gene locus_tag LOCUS_12370 2841 3503 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875882.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence097 <1 965 gene locus_tag LOCUS_12380 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024418.1:50S ribosomal protein L11 methyltransferase 2203 962 gene locus_tag LOCUS_12390 2203 962 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892580.1 protein_id gnl|my_center|LOCUS_12390 2480 2211 gene locus_tag LOCUS_12400 2480 2211 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_12400 2861 2700 gene locus_tag LOCUS_12410 2861 2700 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877306.1 protein_id gnl|my_center|LOCUS_12410 3508 2864 gene locus_tag LOCUS_12420 3508 2864 CDS product delta 1-pyrroline-5-carboxylate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061123.1 protein_id gnl|my_center|LOCUS_12420 3896 3558 gene locus_tag LOCUS_12430 gene pth2 3896 3558 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877304.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence098 1811 756 gene locus_tag LOCUS_12440 1811 756 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061107.1 protein_id gnl|my_center|LOCUS_12440 1911 2282 gene locus_tag LOCUS_12450 1911 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892608.1 protein_id gnl|my_center|LOCUS_12450 2627 2223 gene locus_tag LOCUS_12460 2627 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence099 112 267 gene locus_tag LOCUS_12470 112 267 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868637.1 protein_id gnl|my_center|LOCUS_12470 294 539 gene locus_tag LOCUS_12480 294 539 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877220.1 protein_id gnl|my_center|LOCUS_12480 552 1214 gene locus_tag LOCUS_12490 552 1214 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877219.1 protein_id gnl|my_center|LOCUS_12490 1230 1460 gene locus_tag LOCUS_12500 gene rpl18a 1230 1460 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061100.1 protein_id gnl|my_center|LOCUS_12500 1466 1909 gene locus_tag LOCUS_12510 gene pfdA 1466 1909 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877217.1 protein_id gnl|my_center|LOCUS_12510 1910 2956 gene locus_tag LOCUS_12520 gene ftsY 1910 2956 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877216.1 protein_id gnl|my_center|LOCUS_12520 2977 3651 gene locus_tag LOCUS_12530 2977 3651 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022642.1 protein_id gnl|my_center|LOCUS_12530 3620 3799 gene locus_tag LOCUS_12540 3620 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence100 <1 1239 gene locus_tag LOCUS_12550 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060774.1:cyclic 2,3-diphosphoglycerate synthase 1261 1788 gene locus_tag LOCUS_12560 1261 1788 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875861.1 protein_id gnl|my_center|LOCUS_12560 2341 3558 gene locus_tag LOCUS_12570 2341 3558 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060773.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence101 95 979 gene locus_tag LOCUS_12580 95 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 985 1719 gene locus_tag LOCUS_12590 gene cobS 985 1719 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876736.1 protein_id gnl|my_center|LOCUS_12590 1727 2257 gene locus_tag LOCUS_12600 1727 2257 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061280.1 protein_id gnl|my_center|LOCUS_12600 2254 2889 gene locus_tag LOCUS_12610 gene upp 2254 2889 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876738.1 protein_id gnl|my_center|LOCUS_12610 3376 2882 gene locus_tag LOCUS_12620 3376 2882 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669045.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence102 25 1134 gene locus_tag LOCUS_12630 25 1134 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_12630 1148 1804 gene locus_tag LOCUS_12640 1148 1804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 protein_id gnl|my_center|LOCUS_12640 1807 2364 gene locus_tag LOCUS_12650 gene afpA 1807 2364 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876336.1 protein_id gnl|my_center|LOCUS_12650 2668 2366 gene locus_tag LOCUS_12660 2668 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060881.1 protein_id gnl|my_center|LOCUS_12660 <3566 2679 gene locus_tag LOCUS_12670 <3566 2679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876813.1:type II CAAX endopeptidase family protein >Feature sequence103 376 1674 gene locus_tag LOCUS_12680 376 1674 CDS product DUF515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876659.1 protein_id gnl|my_center|LOCUS_12680 1693 2646 gene locus_tag LOCUS_12690 1693 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060954.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence104 332 1231 gene locus_tag LOCUS_12700 332 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1266 2003 gene locus_tag LOCUS_12710 1266 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2084 2770 gene locus_tag LOCUS_12720 2084 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877379.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence105 100 258 gene locus_tag LOCUS_12730 100 258 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013294958.1 protein_id gnl|my_center|LOCUS_12730 276 1625 gene locus_tag LOCUS_12740 gene purB 276 1625 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877146.1 protein_id gnl|my_center|LOCUS_12740 <3283 1649 gene locus_tag LOCUS_12750 <3283 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877144.1:heavy metal translocating P-type ATPase >Feature sequence106 1709 213 gene locus_tag LOCUS_12760 gene ehbF 1709 213 CDS product energy conserving hydrogenase EhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876870.1 protein_id gnl|my_center|LOCUS_12760 2083 1727 gene locus_tag LOCUS_12770 2083 1727 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330371.1 protein_id gnl|my_center|LOCUS_12770 2313 2080 gene locus_tag LOCUS_12780 2313 2080 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869936.1 protein_id gnl|my_center|LOCUS_12780 2578 2306 gene locus_tag LOCUS_12790 2578 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2842 2585 gene locus_tag LOCUS_12800 2842 2585 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876874.1 protein_id gnl|my_center|LOCUS_12800 3166 2855 gene locus_tag LOCUS_12810 3166 2855 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876875.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence107 347 652 gene locus_tag LOCUS_12820 347 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2099 684 gene locus_tag LOCUS_12830 2099 684 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132046.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence108 1285 1022 gene locus_tag LOCUS_12840 1285 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12840 1929 1216 gene locus_tag LOCUS_12850 1929 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12850 2357 2214 gene locus_tag LOCUS_12860 2357 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12860 2460 2389 gene locus_tag LOCUS_t00220 2460 2389 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence109 91 2103 gene locus_tag LOCUS_12870 gene ppsA 91 2103 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867221.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence110 84 1055 gene locus_tag LOCUS_12880 84 1055 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060919.1 protein_id gnl|my_center|LOCUS_12880 1069 1299 gene locus_tag LOCUS_12890 1069 1299 CDS product MTH895/ArsE family thioredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060920.1 protein_id gnl|my_center|LOCUS_12890 1314 1508 gene locus_tag LOCUS_12900 1314 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060921.1 protein_id gnl|my_center|LOCUS_12900 1511 2269 gene locus_tag LOCUS_12910 1511 2269 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061259.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence111 142 756 gene locus_tag LOCUS_12920 142 756 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876891.1 protein_id gnl|my_center|LOCUS_12920 1430 753 gene locus_tag LOCUS_12930 1430 753 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061014.1 protein_id gnl|my_center|LOCUS_12930 2845 1463 gene locus_tag LOCUS_12940 2845 1463 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061013.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence112 <1 648 gene locus_tag LOCUS_12950 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875745.1:tributyrin esterase 662 2524 gene locus_tag LOCUS_12960 662 2524 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060738.1 protein_id gnl|my_center|LOCUS_12960 2824 2570 gene locus_tag LOCUS_12970 2824 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence113 74 544 gene locus_tag LOCUS_12980 gene moaC 74 544 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943324.1 protein_id gnl|my_center|LOCUS_12980 541 2622 gene locus_tag LOCUS_12990 gene hel308 541 2622 CDS product ATP-dependent DNA helicase Hel308 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876445.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence114 911 75 gene locus_tag LOCUS_13000 gene nadC 911 75 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877434.1 protein_id gnl|my_center|LOCUS_13000 984 1904 gene locus_tag LOCUS_13010 gene rnz 984 1904 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061333.1 protein_id gnl|my_center|LOCUS_13010 1882 2613 gene locus_tag LOCUS_13020 1882 2613 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877432.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence115 2377 317 gene locus_tag LOCUS_13030 2377 317 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485824.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence116 2682 1837 gene locus_tag LOCUS_13040 2682 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876151.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence117 292 966 gene locus_tag LOCUS_13050 gene tpiA 292 966 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876672.1 protein_id gnl|my_center|LOCUS_13050 989 2209 gene locus_tag LOCUS_13060 gene pgk 989 2209 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_13060 2283 2356 gene locus_tag LOCUS_t00230 2283 2356 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2371 2447 gene locus_tag LOCUS_t00240 2371 2447 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2461 2535 gene locus_tag LOCUS_t00250 2461 2535 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence118 <1 519 gene locus_tag LOCUS_13070 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061152.1:DUF2226 domain-containing protein 544 1323 gene locus_tag LOCUS_13080 544 1323 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_13080 1348 2187 gene locus_tag LOCUS_13090 1348 2187 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061153.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence119 97 170 gene locus_tag LOCUS_t00260 97 170 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 530 1702 gene locus_tag LOCUS_13100 530 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2094 1603 gene locus_tag LOCUS_13110 2094 1603 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876457.1 protein_id gnl|my_center|LOCUS_13110 2387 2178 gene locus_tag LOCUS_13120 2387 2178 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence120 1198 221 gene locus_tag LOCUS_13130 1198 221 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060797.1 protein_id gnl|my_center|LOCUS_13130 1298 1519 gene locus_tag LOCUS_13140 1298 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1654 2418 gene locus_tag LOCUS_13150 1654 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 >Feature sequence121 1376 543 gene locus_tag LOCUS_13160 1376 543 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977503.1 protein_id gnl|my_center|LOCUS_13160 2346 1426 gene locus_tag LOCUS_13170 gene ilvE 2346 1426 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence122 111 584 gene locus_tag LOCUS_13180 111 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 596 1180 gene locus_tag LOCUS_13190 596 1180 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060967.1 protein_id gnl|my_center|LOCUS_13190 1177 1959 gene locus_tag LOCUS_13200 1177 1959 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876725.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence123 1008 652 gene locus_tag LOCUS_13210 1008 652 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877438.1 protein_id gnl|my_center|LOCUS_13210 1121 2182 gene locus_tag LOCUS_13220 1121 2182 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877439.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence124 2290 959 gene locus_tag LOCUS_13230 2290 959 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876934.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence125 226 501 gene locus_tag LOCUS_13240 226 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13240 520 804 gene locus_tag LOCUS_13250 520 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 911 2008 gene locus_tag LOCUS_13260 911 2008 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence126 1493 249 gene locus_tag LOCUS_13270 gene truD 1493 249 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877138.1 protein_id gnl|my_center|LOCUS_13270 2051 1695 gene locus_tag LOCUS_13280 2051 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence127 1284 1063 gene locus_tag LOCUS_13290 1284 1063 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876745.1 protein_id gnl|my_center|LOCUS_13290 1507 1989 gene locus_tag LOCUS_13300 gene rplJ 1507 1989 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876743.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence128 3 536 gene locus_tag LOCUS_13310 3 536 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876008.1 protein_id gnl|my_center|LOCUS_13310 536 1498 gene locus_tag LOCUS_13320 536 1498 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876007.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence129 <1 561 gene locus_tag LOCUS_13330 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875832.1:Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain 561 2063 gene locus_tag LOCUS_13340 561 2063 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875833.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence130 266 472 gene locus_tag LOCUS_13350 266 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 480 1277 gene locus_tag LOCUS_13360 480 1277 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871156.1 protein_id gnl|my_center|LOCUS_13360 2191 1466 gene locus_tag LOCUS_13370 2191 1466 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence131 389 1279 gene locus_tag LOCUS_13380 389 1279 CDS product PhoU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877330.1 protein_id gnl|my_center|LOCUS_13380 <2182 1328 gene locus_tag LOCUS_13390 <2182 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876593.1:citryl-CoA lyase >Feature sequence132 72 251 gene locus_tag LOCUS_13400 72 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 973 272 gene locus_tag LOCUS_13410 973 272 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875837.1 protein_id gnl|my_center|LOCUS_13410 <2148 963 gene locus_tag LOCUS_13420 <2148 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875834.1:MFS transporter >Feature sequence133 142 1233 gene locus_tag LOCUS_13430 142 1233 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060989.1 protein_id gnl|my_center|LOCUS_13430 1417 1425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1482 2021 gene locus_tag LOCUS_13440 gene psmB 1482 2021 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence134 717 250 gene locus_tag LOCUS_13450 717 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 632 1174 gene locus_tag LOCUS_13460 632 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1941 1177 gene locus_tag LOCUS_13470 1941 1177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061277.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence135 >Feature sequence136 694 218 gene locus_tag LOCUS_13480 gene frhD 694 218 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876914.1 protein_id gnl|my_center|LOCUS_13480 1915 698 gene locus_tag LOCUS_13490 gene frhA 1915 698 CDS product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061018.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence137 <1 1212 gene locus_tag LOCUS_13500 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061138.1:endonuclease MutS2 1533 1417 gene locus_tag LOCUS_r00010 1533 1417 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence138 <1783 1226 gene locus_tag LOCUS_13510 <1783 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876746.1:serine--tRNA ligase >Feature sequence139 83 823 gene locus_tag LOCUS_13520 83 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877479.1 protein_id gnl|my_center|LOCUS_13520 1375 815 gene locus_tag LOCUS_13530 1375 815 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877478.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence140 >Feature sequence141 1221 496 gene locus_tag LOCUS_13540 gene mtxX 1221 496 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875870.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence142 1550 1347 gene locus_tag LOCUS_13550 1550 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence143 3 236 gene locus_tag LOCUS_13560 3 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1490 711 gene locus_tag LOCUS_13570 1490 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence144 1177 611 gene locus_tag LOCUS_13580 1177 611 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877383.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence145 113 550 gene locus_tag LOCUS_13590 113 550 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877224.1 protein_id gnl|my_center|LOCUS_13590 568 903 gene locus_tag LOCUS_13600 568 903 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877223.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence146 >Feature sequence147 101 445 gene locus_tag LOCUS_13610 101 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061151.1 protein_id gnl|my_center|LOCUS_13610 1006 452 gene locus_tag LOCUS_13620 1006 452 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877436.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence148 <1 871 gene locus_tag LOCUS_13630 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875715.1:pseudomurein-binding repeat-containing protein >Feature sequence149 4 789 gene locus_tag LOCUS_13640 4 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence150 71 562 gene locus_tag LOCUS_13650 71 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060860.1 protein_id gnl|my_center|LOCUS_13650 <1388 606 gene locus_tag LOCUS_13660 <1388 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065939.1:Xaa-Pro peptidase family protein >Feature sequence151 757 86 gene locus_tag LOCUS_13670 757 86 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060848.1 protein_id gnl|my_center|LOCUS_13670 1276 839 gene locus_tag LOCUS_13680 1276 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence152 12 87 gene locus_tag LOCUS_t00270 12 87 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 238 1278 gene locus_tag LOCUS_13690 238 1278 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence153 1167 604 gene locus_tag LOCUS_13700 1167 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060844.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence154 >Feature sequence155 >Feature sequence156 308 883 gene locus_tag LOCUS_13710 308 883 CDS product DUF483 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875875.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence157 >Feature sequence158 >Feature sequence159 <879 15 gene locus_tag LOCUS_13720 <879 15 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877192.1:phosphoglucosamine mutase >Feature sequence160 50 123 gene locus_tag LOCUS_t00280 50 123 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 128 205 gene locus_tag LOCUS_t00290 128 205 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 248 332 gene locus_tag LOCUS_t00300 248 332 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 356 431 gene locus_tag LOCUS_t00310 356 431 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence161 >Feature sequence162 <1 581 gene locus_tag LOCUS_13730 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228547.1:acetate--CoA ligase >Feature sequence163 >Feature sequence164 >Feature sequence165