>Feature sequence0001 1508 3184 gene locus_tag LOCUS_00010 1508 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3694 5235 gene locus_tag LOCUS_00020 3694 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 6495 5770 gene locus_tag LOCUS_00030 6495 5770 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_00030 9677 6495 gene locus_tag LOCUS_00040 9677 6495 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_00040 10656 9781 gene locus_tag LOCUS_00050 10656 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 11869 10670 gene locus_tag LOCUS_00060 11869 10670 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138985883.1 protein_id gnl|my_center|LOCUS_00060 13560 12064 gene locus_tag LOCUS_00070 13560 12064 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_00070 14158 13580 gene locus_tag LOCUS_00080 14158 13580 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128417842.1 protein_id gnl|my_center|LOCUS_00080 14740 14222 gene locus_tag LOCUS_00090 14740 14222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 16355 15201 gene locus_tag LOCUS_00100 16355 15201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 17460 16333 gene locus_tag LOCUS_00110 17460 16333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 19382 17457 gene locus_tag LOCUS_00120 19382 17457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 20675 19398 gene locus_tag LOCUS_00130 20675 19398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 21458 20691 gene locus_tag LOCUS_00140 21458 20691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 21597 21749 gene locus_tag LOCUS_00150 21597 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 22309 22602 gene locus_tag LOCUS_00160 22309 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 23063 23275 gene locus_tag LOCUS_00170 23063 23275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 24054 23428 gene locus_tag LOCUS_00180 24054 23428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24518 24153 gene locus_tag LOCUS_00190 24518 24153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 25014 24499 gene locus_tag LOCUS_00200 25014 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 25325 25041 gene locus_tag LOCUS_00210 25325 25041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25451 26668 gene locus_tag LOCUS_00220 25451 26668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27470 27057 gene locus_tag LOCUS_00230 27470 27057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 >Feature sequence0002 36 713 gene locus_tag LOCUS_00240 36 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 716 1255 gene locus_tag LOCUS_00250 716 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 1285 2121 gene locus_tag LOCUS_00260 1285 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 2084 2800 gene locus_tag LOCUS_00270 2084 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 2825 3559 gene locus_tag LOCUS_00280 2825 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 3546 4535 gene locus_tag LOCUS_00290 3546 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 4822 5289 gene locus_tag LOCUS_00300 4822 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 5502 6860 gene locus_tag LOCUS_00310 5502 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 7017 7700 gene locus_tag LOCUS_00320 7017 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 7727 8245 gene locus_tag LOCUS_00330 7727 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 8280 8834 gene locus_tag LOCUS_00340 8280 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 8849 9292 gene locus_tag LOCUS_00350 8849 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 9344 9916 gene locus_tag LOCUS_00360 9344 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 10009 11778 gene locus_tag LOCUS_00370 10009 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 11791 12093 gene locus_tag LOCUS_00380 11791 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 12132 12455 gene locus_tag LOCUS_00390 12132 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 12688 13683 gene locus_tag LOCUS_00400 12688 13683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 13825 14400 gene locus_tag LOCUS_00410 13825 14400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 14390 14707 gene locus_tag LOCUS_00420 14390 14707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 18404 14808 gene locus_tag LOCUS_00430 18404 14808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 19218 18397 gene locus_tag LOCUS_00440 19218 18397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 20875 19514 gene locus_tag LOCUS_00450 20875 19514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 23259 20872 gene locus_tag LOCUS_00460 23259 20872 CDS product Piwi domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031225.1 protein_id gnl|my_center|LOCUS_00460 24215 24610 gene locus_tag LOCUS_00470 24215 24610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 24550 24795 gene locus_tag LOCUS_00480 24550 24795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 24831 25148 gene locus_tag LOCUS_00490 24831 25148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 25135 25344 gene locus_tag LOCUS_00500 25135 25344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 25372 25608 gene locus_tag LOCUS_00510 25372 25608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 25613 26269 gene locus_tag LOCUS_00520 25613 26269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 26284 26865 gene locus_tag LOCUS_00530 26284 26865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 26889 27437 gene locus_tag LOCUS_00540 26889 27437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 >Feature sequence0003 <1 1397 gene locus_tag LOCUS_00550 <1 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257328.1:permease 1457 2602 gene locus_tag LOCUS_00560 1457 2602 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228204.1 protein_id gnl|my_center|LOCUS_00560 2624 4102 gene locus_tag LOCUS_00570 2624 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 4099 8316 gene locus_tag LOCUS_00580 4099 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 9130 8327 gene locus_tag LOCUS_00590 9130 8327 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_00590 10059 9694 gene locus_tag LOCUS_00600 10059 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 13756 10604 gene locus_tag LOCUS_00610 13756 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 14030 14212 gene locus_tag LOCUS_00620 14030 14212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 15667 14168 gene locus_tag LOCUS_00630 15667 14168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 16977 15709 gene locus_tag LOCUS_00640 16977 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 18928 17546 gene locus_tag LOCUS_00650 18928 17546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 19330 19115 gene locus_tag LOCUS_00660 19330 19115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 19597 19860 gene locus_tag LOCUS_00670 19597 19860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 19895 20416 gene locus_tag LOCUS_00680 19895 20416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00680 22777 20630 gene locus_tag LOCUS_00690 22777 20630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 23142 23375 gene locus_tag LOCUS_00700 23142 23375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 >Feature sequence0004 <1 3873 gene locus_tag LOCUS_00710 <1 3873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037631.1:TonB-dependent receptor 4254 5033 gene locus_tag LOCUS_00720 4254 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 5463 8693 gene locus_tag LOCUS_00730 5463 8693 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_00730 8861 9466 gene locus_tag LOCUS_00740 8861 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 9877 13485 gene locus_tag LOCUS_00750 9877 13485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 14941 13598 gene locus_tag LOCUS_00760 14941 13598 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942640.1 protein_id gnl|my_center|LOCUS_00760 15454 15882 gene locus_tag LOCUS_00770 15454 15882 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_00770 17182 16055 gene locus_tag LOCUS_00780 gene ald 17182 16055 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946659.1 protein_id gnl|my_center|LOCUS_00780 18869 17298 gene locus_tag LOCUS_00790 18869 17298 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257638.1 protein_id gnl|my_center|LOCUS_00790 20546 18948 gene locus_tag LOCUS_00800 20546 18948 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565602.1 protein_id gnl|my_center|LOCUS_00800 21030 21470 gene locus_tag LOCUS_00810 21030 21470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 21735 21923 gene locus_tag LOCUS_00820 21735 21923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 22443 21940 gene locus_tag LOCUS_00830 22443 21940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 23736 22771 gene locus_tag LOCUS_00840 23736 22771 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_00840 24395 23865 gene locus_tag LOCUS_00850 24395 23865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 24761 24402 gene locus_tag LOCUS_00860 24761 24402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 >Feature sequence0005 380 156 gene locus_tag LOCUS_00870 380 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 1050 373 gene locus_tag LOCUS_00880 1050 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 1337 2053 gene locus_tag LOCUS_00890 1337 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 2279 2076 gene locus_tag LOCUS_00900 2279 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 3244 2312 gene locus_tag LOCUS_00910 3244 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 4989 3853 gene locus_tag LOCUS_00920 4989 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 5704 5246 gene locus_tag LOCUS_00930 5704 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 6609 5740 gene locus_tag LOCUS_00940 6609 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 7393 6575 gene locus_tag LOCUS_00950 7393 6575 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221868.1 protein_id gnl|my_center|LOCUS_00950 7886 7452 gene locus_tag LOCUS_00960 7886 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 8145 7897 gene locus_tag LOCUS_00970 8145 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 8432 8217 gene locus_tag LOCUS_00980 8432 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 8645 9055 gene locus_tag LOCUS_00990 8645 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 9333 9626 gene locus_tag LOCUS_01000 9333 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 9711 10043 gene locus_tag LOCUS_01010 9711 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 10040 10813 gene locus_tag LOCUS_01020 10040 10813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 10899 11660 gene locus_tag LOCUS_01030 10899 11660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 11967 12353 gene locus_tag LOCUS_01040 11967 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 12728 12910 gene locus_tag LOCUS_01050 12728 12910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 13042 13269 gene locus_tag LOCUS_01060 13042 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 13644 14114 gene locus_tag LOCUS_01070 13644 14114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 14527 15168 gene locus_tag LOCUS_01080 14527 15168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 15711 15295 gene locus_tag LOCUS_01090 15711 15295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 16313 15708 gene locus_tag LOCUS_01100 16313 15708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 20439 16372 gene locus_tag LOCUS_01110 20439 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 >Feature sequence0006 1626 487 gene locus_tag LOCUS_01120 1626 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 2081 2380 gene locus_tag LOCUS_01130 2081 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 5383 2597 gene locus_tag LOCUS_01140 5383 2597 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_01140 6867 6667 gene locus_tag LOCUS_01150 6867 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 8287 8739 gene locus_tag LOCUS_01160 8287 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 10224 8929 gene locus_tag LOCUS_01170 10224 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 11353 11754 gene locus_tag LOCUS_01180 11353 11754 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_01180 12096 12317 gene locus_tag LOCUS_01190 12096 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 12712 12966 gene locus_tag LOCUS_01200 12712 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 13212 13532 gene locus_tag LOCUS_01210 13212 13532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 14392 16695 gene locus_tag LOCUS_01220 gene ppsA 14392 16695 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_01220 16808 17269 gene locus_tag LOCUS_01230 16808 17269 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141683.1 protein_id gnl|my_center|LOCUS_01230 17867 18271 gene locus_tag LOCUS_01240 17867 18271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 19382 21130 gene locus_tag LOCUS_01250 19382 21130 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_01250 >Feature sequence0007 261 746 gene locus_tag LOCUS_01260 261 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 1239 1535 gene locus_tag LOCUS_01270 1239 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 1593 1976 gene locus_tag LOCUS_01280 1593 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 2152 2394 gene locus_tag LOCUS_01290 2152 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 2409 2801 gene locus_tag LOCUS_01300 2409 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 2912 3175 gene locus_tag LOCUS_01310 2912 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 3234 3752 gene locus_tag LOCUS_01320 3234 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 3785 4231 gene locus_tag LOCUS_01330 3785 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 5277 4294 gene locus_tag LOCUS_01340 gene galM 5277 4294 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 protein_id gnl|my_center|LOCUS_01340 5804 6979 gene locus_tag LOCUS_01350 5804 6979 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031334.1 protein_id gnl|my_center|LOCUS_01350 6996 7151 gene locus_tag LOCUS_01360 6996 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 8139 7195 gene locus_tag LOCUS_01370 8139 7195 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_01370 8311 8778 gene locus_tag LOCUS_01380 8311 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 8922 9944 gene locus_tag LOCUS_01390 8922 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 10547 11605 gene locus_tag LOCUS_01400 10547 11605 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839725.1 protein_id gnl|my_center|LOCUS_01400 11612 12376 gene locus_tag LOCUS_01410 11612 12376 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_01410 12661 13038 gene locus_tag LOCUS_01420 12661 13038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 13092 13436 gene locus_tag LOCUS_01430 13092 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 13492 14022 gene locus_tag LOCUS_01440 13492 14022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 14166 14654 gene locus_tag LOCUS_01450 14166 14654 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530718.1 protein_id gnl|my_center|LOCUS_01450 14763 15518 gene locus_tag LOCUS_01460 14763 15518 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265531.1 protein_id gnl|my_center|LOCUS_01460 15917 15845 gene locus_tag LOCUS_t00010 15917 15845 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 16136 15936 gene locus_tag LOCUS_01470 16136 15936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 16299 16087 gene locus_tag LOCUS_01480 16299 16087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 16291 16506 gene locus_tag LOCUS_01490 16291 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 17225 16566 gene locus_tag LOCUS_01500 17225 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 19180 17651 gene locus_tag LOCUS_01510 19180 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 <21053 19422 gene locus_tag LOCUS_01520 <21053 19422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065134.1:radical SAM protein >Feature sequence0008 <1 860 gene locus_tag LOCUS_01530 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094111.1:UDP-3-O-acyl-N-acetylglucosamine deacetylase 1688 1035 gene locus_tag LOCUS_01540 1688 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 1881 2513 gene locus_tag LOCUS_01550 1881 2513 CDS product protein-S-isoprenylcysteine O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022658.1 protein_id gnl|my_center|LOCUS_01550 3020 2562 gene locus_tag LOCUS_01560 3020 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 6221 3105 gene locus_tag LOCUS_01570 6221 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 9705 6418 gene locus_tag LOCUS_01580 9705 6418 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_01580 9920 12685 gene locus_tag LOCUS_01590 9920 12685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 12762 12837 gene locus_tag LOCUS_t00020 12762 12837 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13061 14776 gene locus_tag LOCUS_01600 13061 14776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 14904 14976 gene locus_tag LOCUS_t00030 14904 14976 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15086 15397 gene locus_tag LOCUS_01610 15086 15397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 15398 15940 gene locus_tag LOCUS_01620 15398 15940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 15937 16692 gene locus_tag LOCUS_01630 15937 16692 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_01630 16966 17229 gene locus_tag LOCUS_01640 16966 17229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 17507 18070 gene locus_tag LOCUS_01650 17507 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 <19881 18224 gene locus_tag LOCUS_01660 <19881 18224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence0009 54 710 gene locus_tag LOCUS_01670 54 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 1182 817 gene locus_tag LOCUS_01680 1182 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 1602 2759 gene locus_tag LOCUS_01690 gene solA 1602 2759 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_01690 3192 2830 gene locus_tag LOCUS_01700 3192 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 3984 3799 gene locus_tag LOCUS_01710 3984 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 3983 4297 gene locus_tag LOCUS_01720 3983 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01720 4450 4187 gene locus_tag LOCUS_01730 4450 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 4472 4936 gene locus_tag LOCUS_01740 4472 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01740 5687 5010 gene locus_tag LOCUS_01750 5687 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 6311 5853 gene locus_tag LOCUS_01760 6311 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 8161 6527 gene locus_tag LOCUS_01770 8161 6527 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 protein_id gnl|my_center|LOCUS_01770 8814 8263 gene locus_tag LOCUS_01780 8814 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 9767 9168 gene locus_tag LOCUS_01790 9767 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 10455 10006 gene locus_tag LOCUS_01800 10455 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 11237 10911 gene locus_tag LOCUS_01810 11237 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 13262 11289 gene locus_tag LOCUS_01820 13262 11289 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948595.1 protein_id gnl|my_center|LOCUS_01820 14395 13574 gene locus_tag LOCUS_01830 14395 13574 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090078.1 protein_id gnl|my_center|LOCUS_01830 15854 14388 gene locus_tag LOCUS_01840 15854 14388 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088683.1 protein_id gnl|my_center|LOCUS_01840 16081 15857 gene locus_tag LOCUS_01850 16081 15857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 17429 16182 gene locus_tag LOCUS_01860 17429 16182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 17676 17437 gene locus_tag LOCUS_01870 17676 17437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 17811 18029 gene locus_tag LOCUS_01880 17811 18029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 18110 18433 gene locus_tag LOCUS_01890 18110 18433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 18430 18777 gene locus_tag LOCUS_01900 18430 18777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 >Feature sequence0010 2121 1459 gene locus_tag LOCUS_01910 2121 1459 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005947811.1 protein_id gnl|my_center|LOCUS_01910 3359 2118 gene locus_tag LOCUS_01920 gene pseC 3359 2118 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_01920 4037 3699 gene locus_tag LOCUS_01930 4037 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 5331 4648 gene locus_tag LOCUS_01940 5331 4648 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887077.1 protein_id gnl|my_center|LOCUS_01940 7056 5347 gene locus_tag LOCUS_01950 7056 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 7779 7540 gene locus_tag LOCUS_01960 7779 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 10317 7903 gene locus_tag LOCUS_01970 10317 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 11539 10496 gene locus_tag LOCUS_01980 11539 10496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 12250 11591 gene locus_tag LOCUS_01990 12250 11591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 15488 12291 gene locus_tag LOCUS_02000 15488 12291 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_02000 16098 15829 gene locus_tag LOCUS_02010 16098 15829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 16517 16272 gene locus_tag LOCUS_02020 16517 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 16648 17355 gene locus_tag LOCUS_02030 16648 17355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 17554 17847 gene locus_tag LOCUS_02040 17554 17847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02040 17998 17909 gene locus_tag LOCUS_t00040 17998 17909 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0011 1671 988 gene locus_tag LOCUS_02050 1671 988 CDS product succinate dehydrogenase cytochrome b558 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272241.1 protein_id gnl|my_center|LOCUS_02050 1984 2928 gene locus_tag LOCUS_02060 1984 2928 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_02060 2937 3476 gene locus_tag LOCUS_02070 2937 3476 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 protein_id gnl|my_center|LOCUS_02070 3514 4914 gene locus_tag LOCUS_02080 3514 4914 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729439.1 protein_id gnl|my_center|LOCUS_02080 4951 5967 gene locus_tag LOCUS_02090 4951 5967 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_02090 6857 6240 gene locus_tag LOCUS_02100 gene thpR 6857 6240 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256208.1 protein_id gnl|my_center|LOCUS_02100 8286 6862 gene locus_tag LOCUS_02110 8286 6862 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716439.1 protein_id gnl|my_center|LOCUS_02110 8799 8329 gene locus_tag LOCUS_02120 8799 8329 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259362.1 protein_id gnl|my_center|LOCUS_02120 9954 8800 gene locus_tag LOCUS_02130 9954 8800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 10659 10027 gene locus_tag LOCUS_02140 10659 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 11861 10677 gene locus_tag LOCUS_02150 11861 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 13071 11890 gene locus_tag LOCUS_02160 13071 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 13700 13101 gene locus_tag LOCUS_02170 gene sigW 13700 13101 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_02170 13938 14816 gene locus_tag LOCUS_02180 13938 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 14901 15572 gene locus_tag LOCUS_02190 14901 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 15667 16323 gene locus_tag LOCUS_02200 15667 16323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 17157 16327 gene locus_tag LOCUS_02210 17157 16327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence0012 294 653 gene locus_tag LOCUS_02220 294 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 1198 791 gene locus_tag LOCUS_02230 1198 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 2323 1247 gene locus_tag LOCUS_02240 gene tsaD 2323 1247 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_02240 3757 2354 gene locus_tag LOCUS_02250 gene cysS 3757 2354 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570132.1 protein_id gnl|my_center|LOCUS_02250 4951 3827 gene locus_tag LOCUS_02260 gene thiL 4951 3827 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_02260 6156 4987 gene locus_tag LOCUS_02270 gene aspC 6156 4987 CDS product aspartate/prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227669.1 protein_id gnl|my_center|LOCUS_02270 6547 7161 gene locus_tag LOCUS_02280 6547 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 7187 8224 gene locus_tag LOCUS_02290 7187 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 8389 8943 gene locus_tag LOCUS_02300 8389 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 9017 9090 gene locus_tag LOCUS_t00050 9017 9090 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9922 9170 gene locus_tag LOCUS_02310 9922 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 11120 10086 gene locus_tag LOCUS_02320 11120 10086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 11771 12946 gene locus_tag LOCUS_02330 gene sucC 11771 12946 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932072.1 protein_id gnl|my_center|LOCUS_02330 13148 13768 gene locus_tag LOCUS_02340 13148 13768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 13851 14123 gene locus_tag LOCUS_02350 13851 14123 CDS product DUF3303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532573.1 protein_id gnl|my_center|LOCUS_02350 14234 15637 gene locus_tag LOCUS_02360 14234 15637 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555126.1 protein_id gnl|my_center|LOCUS_02360 >Feature sequence0013 <1 1061 gene locus_tag LOCUS_02370 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009291985.1:dihydrolipoamide acetyltransferase family protein 1233 2174 gene locus_tag LOCUS_02380 1233 2174 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 protein_id gnl|my_center|LOCUS_02380 2155 3366 gene locus_tag LOCUS_02390 2155 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 3363 4172 gene locus_tag LOCUS_02400 3363 4172 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_02400 4169 5488 gene locus_tag LOCUS_02410 4169 5488 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 protein_id gnl|my_center|LOCUS_02410 5507 6364 gene locus_tag LOCUS_02420 5507 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 8637 6415 gene locus_tag LOCUS_02430 8637 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 10422 8671 gene locus_tag LOCUS_02440 10422 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 11291 10425 gene locus_tag LOCUS_02450 11291 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12128 11385 gene locus_tag LOCUS_02460 12128 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 12950 12147 gene locus_tag LOCUS_02470 12950 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 13577 13020 gene locus_tag LOCUS_02480 13577 13020 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909489.1 protein_id gnl|my_center|LOCUS_02480 14287 13592 gene locus_tag LOCUS_02490 14287 13592 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_02490 14484 15500 gene locus_tag LOCUS_02500 14484 15500 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 protein_id gnl|my_center|LOCUS_02500 15563 16024 gene locus_tag LOCUS_02510 gene ybiA 15563 16024 CDS product N-glycosidase YbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145128.1 protein_id gnl|my_center|LOCUS_02510 >Feature sequence0014 1650 949 gene locus_tag LOCUS_02520 1650 949 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646306.1 protein_id gnl|my_center|LOCUS_02520 1939 2184 gene locus_tag LOCUS_02530 1939 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 2719 2327 gene locus_tag LOCUS_02540 2719 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 2625 2897 gene locus_tag LOCUS_02550 2625 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 3088 3294 gene locus_tag LOCUS_02560 3088 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 3681 3857 gene locus_tag LOCUS_02570 3681 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 4601 4200 gene locus_tag LOCUS_02580 4601 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 4827 4591 gene locus_tag LOCUS_02590 4827 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 5666 6274 gene locus_tag LOCUS_02600 5666 6274 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141420.1 protein_id gnl|my_center|LOCUS_02600 6636 7877 gene locus_tag LOCUS_02610 6636 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 7874 8503 gene locus_tag LOCUS_02620 7874 8503 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_02620 8647 9078 gene locus_tag LOCUS_02630 8647 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 9322 9999 gene locus_tag LOCUS_02640 9322 9999 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367229.1 protein_id gnl|my_center|LOCUS_02640 10046 11998 gene locus_tag LOCUS_02650 10046 11998 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095410.1 protein_id gnl|my_center|LOCUS_02650 12107 12670 gene locus_tag LOCUS_02660 12107 12670 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368006.1 protein_id gnl|my_center|LOCUS_02660 12803 13501 gene locus_tag LOCUS_02670 12803 13501 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_02670 13515 13928 gene locus_tag LOCUS_02680 13515 13928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 14209 14967 gene locus_tag LOCUS_02690 14209 14967 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090295.1 protein_id gnl|my_center|LOCUS_02690 14990 15622 gene locus_tag LOCUS_02700 14990 15622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 15619 16593 gene locus_tag LOCUS_02710 15619 16593 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731487.1 protein_id gnl|my_center|LOCUS_02710 >Feature sequence0015 681 848 gene locus_tag LOCUS_02720 681 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 1178 1960 gene locus_tag LOCUS_02730 1178 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 2126 3583 gene locus_tag LOCUS_02740 2126 3583 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_02740 3610 4224 gene locus_tag LOCUS_02750 3610 4224 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248969.1 protein_id gnl|my_center|LOCUS_02750 4245 4724 gene locus_tag LOCUS_02760 4245 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 4884 5972 gene locus_tag LOCUS_02770 4884 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 6049 7149 gene locus_tag LOCUS_02780 6049 7149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184119.1 protein_id gnl|my_center|LOCUS_02780 7277 7978 gene locus_tag LOCUS_02790 7277 7978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984863.1 protein_id gnl|my_center|LOCUS_02790 8079 8426 gene locus_tag LOCUS_02800 8079 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 8492 9202 gene locus_tag LOCUS_02810 8492 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 9247 9855 gene locus_tag LOCUS_02820 9247 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 10167 11186 gene locus_tag LOCUS_02830 10167 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 11218 12210 gene locus_tag LOCUS_02840 11218 12210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 13288 12380 gene locus_tag LOCUS_02850 13288 12380 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289364.1 protein_id gnl|my_center|LOCUS_02850 13783 13415 gene locus_tag LOCUS_02860 13783 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 14532 13840 gene locus_tag LOCUS_02870 14532 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 15608 14817 gene locus_tag LOCUS_02880 15608 14817 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_02880 <16725 15776 gene locus_tag LOCUS_02890 <16725 15776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839725.1:histidine kinase >Feature sequence0016 <1 2547 gene locus_tag LOCUS_02900 <1 2547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:Stk1 family PASTA domain-containing Ser/Thr kinase 3742 2603 gene locus_tag LOCUS_02910 3742 2603 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_02910 4121 7417 gene locus_tag LOCUS_02920 4121 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 9298 7514 gene locus_tag LOCUS_02930 9298 7514 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028251.1 protein_id gnl|my_center|LOCUS_02930 9501 9989 gene locus_tag LOCUS_02940 9501 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 10211 10402 gene locus_tag LOCUS_02950 10211 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 10564 12750 gene locus_tag LOCUS_02960 10564 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 13611 12889 gene locus_tag LOCUS_02970 13611 12889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 13949 13680 gene locus_tag LOCUS_02980 13949 13680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531822.1 protein_id gnl|my_center|LOCUS_02980 14194 13952 gene locus_tag LOCUS_02990 14194 13952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02990 14542 14303 gene locus_tag LOCUS_03000 14542 14303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 15067 14603 gene locus_tag LOCUS_03010 15067 14603 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113784.1 protein_id gnl|my_center|LOCUS_03010 15231 16109 gene locus_tag LOCUS_03020 15231 16109 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence0017 <1 2019 gene locus_tag LOCUS_03030 <1 2019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879160.1:vitamin B12-dependent ribonucleotide reductase 2126 3367 gene locus_tag LOCUS_03040 2126 3367 CDS product DUF3854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391901.1 protein_id gnl|my_center|LOCUS_03040 3919 3689 gene locus_tag LOCUS_03050 3919 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 4822 4019 gene locus_tag LOCUS_03060 4822 4019 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880556.1 protein_id gnl|my_center|LOCUS_03060 5989 4832 gene locus_tag LOCUS_03070 5989 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 6497 6132 gene locus_tag LOCUS_03080 6497 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 7400 6693 gene locus_tag LOCUS_03090 7400 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 8355 7363 gene locus_tag LOCUS_03100 8355 7363 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870446.1 protein_id gnl|my_center|LOCUS_03100 9373 8585 gene locus_tag LOCUS_03110 9373 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 9567 9893 gene locus_tag LOCUS_03120 9567 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 9890 10294 gene locus_tag LOCUS_03130 9890 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 10450 11346 gene locus_tag LOCUS_03140 10450 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 11399 12076 gene locus_tag LOCUS_03150 11399 12076 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_03150 13089 12376 gene locus_tag LOCUS_03160 13089 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03160 13232 13405 gene locus_tag LOCUS_03170 13232 13405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 13769 13990 gene locus_tag LOCUS_03180 13769 13990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 14714 14016 gene locus_tag LOCUS_03190 14714 14016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 15704 14853 gene locus_tag LOCUS_03200 15704 14853 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118082.1 protein_id gnl|my_center|LOCUS_03200 16015 15767 gene locus_tag LOCUS_03210 16015 15767 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118081.1 protein_id gnl|my_center|LOCUS_03210 16192 16052 gene locus_tag LOCUS_03220 16192 16052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 >Feature sequence0018 <1 720 gene locus_tag LOCUS_03230 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011199012.1:NAD-dependent malic enzyme 4 866 1924 gene locus_tag LOCUS_03240 866 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_03240 2113 2622 gene locus_tag LOCUS_03250 2113 2622 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_03250 2645 3211 gene locus_tag LOCUS_03260 2645 3211 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_03260 3953 3249 gene locus_tag LOCUS_03270 3953 3249 CDS product DpnI domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678771.1 protein_id gnl|my_center|LOCUS_03270 5091 3979 gene locus_tag LOCUS_03280 5091 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 5361 6290 gene locus_tag LOCUS_03290 5361 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 7329 6334 gene locus_tag LOCUS_03300 7329 6334 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399008.1 protein_id gnl|my_center|LOCUS_03300 11109 7423 gene locus_tag LOCUS_03310 11109 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 12185 11148 gene locus_tag LOCUS_03320 12185 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 14885 12249 gene locus_tag LOCUS_03330 14885 12249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence0019 <1 613 gene locus_tag LOCUS_03340 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000003914.1:methionine adenosyltransferase 639 1916 gene locus_tag LOCUS_03350 gene ahcY 639 1916 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143175.1 protein_id gnl|my_center|LOCUS_03350 4326 1996 gene locus_tag LOCUS_03360 4326 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 5082 4327 gene locus_tag LOCUS_03370 5082 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 5288 5118 gene locus_tag LOCUS_03380 5288 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 5551 5285 gene locus_tag LOCUS_03390 5551 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 6242 5742 gene locus_tag LOCUS_03400 6242 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 7584 6421 gene locus_tag LOCUS_03410 7584 6421 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_03410 8339 7647 gene locus_tag LOCUS_03420 gene fabG 8339 7647 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_03420 9280 8531 gene locus_tag LOCUS_03430 9280 8531 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016437.1 protein_id gnl|my_center|LOCUS_03430 9526 10065 gene locus_tag LOCUS_03440 gene hslV 9526 10065 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_03440 10072 11508 gene locus_tag LOCUS_03450 gene hslU 10072 11508 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392544.1 protein_id gnl|my_center|LOCUS_03450 11679 12644 gene locus_tag LOCUS_03460 11679 12644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 12652 13437 gene locus_tag LOCUS_03470 12652 13437 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888247.1 protein_id gnl|my_center|LOCUS_03470 13437 14420 gene locus_tag LOCUS_03480 13437 14420 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_03480 14413 14976 gene locus_tag LOCUS_03490 14413 14976 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223272.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence0020 533 1744 gene locus_tag LOCUS_03500 533 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 2098 3063 gene locus_tag LOCUS_03510 2098 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3719 3180 gene locus_tag LOCUS_03520 3719 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 3993 5087 gene locus_tag LOCUS_03530 3993 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 5460 5672 gene locus_tag LOCUS_03540 5460 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 5926 6174 gene locus_tag LOCUS_03550 5926 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 6254 6940 gene locus_tag LOCUS_03560 6254 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 7145 7879 gene locus_tag LOCUS_03570 7145 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 8002 8214 gene locus_tag LOCUS_03580 8002 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 8549 9559 gene locus_tag LOCUS_03590 8549 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 9663 10058 gene locus_tag LOCUS_03600 9663 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 10460 13378 gene locus_tag LOCUS_03610 10460 13378 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_03610 14883 13453 gene locus_tag LOCUS_03620 14883 13453 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256199.1 protein_id gnl|my_center|LOCUS_03620 >Feature sequence0021 281 655 gene locus_tag LOCUS_03630 281 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 665 1114 gene locus_tag LOCUS_03640 665 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03640 1678 1259 gene locus_tag LOCUS_03650 1678 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 2311 3129 gene locus_tag LOCUS_03660 2311 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 3200 3724 gene locus_tag LOCUS_03670 3200 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 3774 4844 gene locus_tag LOCUS_03680 3774 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 4920 5297 gene locus_tag LOCUS_03690 4920 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 6209 11149 gene locus_tag LOCUS_03700 6209 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 11536 12210 gene locus_tag LOCUS_03710 11536 12210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 12359 12634 gene locus_tag LOCUS_03720 12359 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 12675 15143 gene locus_tag LOCUS_03730 12675 15143 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence0022 <1 1461 gene locus_tag LOCUS_03740 <1 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113236.1:VWA domain-containing protein 1533 1778 gene locus_tag LOCUS_03750 1533 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 1775 2107 gene locus_tag LOCUS_03760 1775 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 2366 2683 gene locus_tag LOCUS_03770 2366 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 2680 3030 gene locus_tag LOCUS_03780 2680 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 3135 3896 gene locus_tag LOCUS_03790 3135 3896 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143646.1 protein_id gnl|my_center|LOCUS_03790 4149 4655 gene locus_tag LOCUS_03800 4149 4655 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_03800 5023 9060 gene locus_tag LOCUS_03810 5023 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 9877 9203 gene locus_tag LOCUS_03820 9877 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 10239 9874 gene locus_tag LOCUS_03830 10239 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 11087 10335 gene locus_tag LOCUS_03840 11087 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 >Feature sequence0023 139 1467 gene locus_tag LOCUS_03850 139 1467 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_03850 1578 2711 gene locus_tag LOCUS_03860 1578 2711 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_03860 2699 3898 gene locus_tag LOCUS_03870 2699 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03870 4500 3988 gene locus_tag LOCUS_03880 4500 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 6149 4527 gene locus_tag LOCUS_03890 6149 4527 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_03890 6391 6146 gene locus_tag LOCUS_03900 6391 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 6760 8037 gene locus_tag LOCUS_03910 6760 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 8739 9800 gene locus_tag LOCUS_03920 8739 9800 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_03920 10059 13676 gene locus_tag LOCUS_03930 10059 13676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence0024 4116 2500 gene locus_tag LOCUS_03940 4116 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 7439 4641 gene locus_tag LOCUS_03950 7439 4641 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640527.1 protein_id gnl|my_center|LOCUS_03950 8086 7499 gene locus_tag LOCUS_03960 8086 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 9022 8096 gene locus_tag LOCUS_03970 9022 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 11960 9252 gene locus_tag LOCUS_03980 11960 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 12166 11957 gene locus_tag LOCUS_03990 12166 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 13190 12255 gene locus_tag LOCUS_04000 gene mdh 13190 12255 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_04000 >Feature sequence0025 70 876 gene locus_tag LOCUS_04010 gene lpxI 70 876 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_04010 1573 995 gene locus_tag LOCUS_04020 1573 995 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_04020 3962 1743 gene locus_tag LOCUS_04030 3962 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 4310 4723 gene locus_tag LOCUS_04040 4310 4723 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152611757.1 protein_id gnl|my_center|LOCUS_04040 4783 5427 gene locus_tag LOCUS_04050 4783 5427 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086746.1 protein_id gnl|my_center|LOCUS_04050 5970 5641 gene locus_tag LOCUS_04060 5970 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 6162 7088 gene locus_tag LOCUS_04070 6162 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 7116 7643 gene locus_tag LOCUS_04080 7116 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 11027 7662 gene locus_tag LOCUS_04090 11027 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 11694 11188 gene locus_tag LOCUS_04100 11694 11188 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930822.1 protein_id gnl|my_center|LOCUS_04100 12920 11709 gene locus_tag LOCUS_04110 12920 11709 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_04110 <13715 12989 gene locus_tag LOCUS_04120 <13715 12989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259102.1:5'-nucleotidase C-terminal domain-containing protein >Feature sequence0026 289 741 gene locus_tag LOCUS_04130 289 741 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_04130 884 1714 gene locus_tag LOCUS_04140 884 1714 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256259.1 protein_id gnl|my_center|LOCUS_04140 1924 3105 gene locus_tag LOCUS_04150 1924 3105 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086505.1 protein_id gnl|my_center|LOCUS_04150 3268 5118 gene locus_tag LOCUS_04160 3268 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 5622 9431 gene locus_tag LOCUS_04170 5622 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 9948 13244 gene locus_tag LOCUS_04180 9948 13244 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence0027 2843 90 gene locus_tag LOCUS_04190 2843 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 4007 3390 gene locus_tag LOCUS_04200 4007 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 5125 4199 gene locus_tag LOCUS_04210 5125 4199 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_04210 6647 5142 gene locus_tag LOCUS_04220 6647 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 6972 6745 gene locus_tag LOCUS_04230 6972 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 7547 7732 gene locus_tag LOCUS_04240 7547 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 7866 8105 gene locus_tag LOCUS_04250 7866 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 10589 8196 gene locus_tag LOCUS_04260 10589 8196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 10890 11774 gene locus_tag LOCUS_04270 10890 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 12140 13366 gene locus_tag LOCUS_04280 12140 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 >Feature sequence0028 1700 1281 gene locus_tag LOCUS_04290 1700 1281 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_04290 3544 1718 gene locus_tag LOCUS_04300 3544 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 4368 3565 gene locus_tag LOCUS_04310 4368 3565 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337288.1 protein_id gnl|my_center|LOCUS_04310 4811 4356 gene locus_tag LOCUS_04320 4811 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_04320 5720 4896 gene locus_tag LOCUS_04330 5720 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 6570 5722 gene locus_tag LOCUS_04340 6570 5722 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_04340 6840 6592 gene locus_tag LOCUS_04350 6840 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 7051 8397 gene locus_tag LOCUS_04360 7051 8397 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339547.1 protein_id gnl|my_center|LOCUS_04360 8671 9237 gene locus_tag LOCUS_04370 gene sigR 8671 9237 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_04370 9594 9947 gene locus_tag LOCUS_04380 9594 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04380 10097 9912 gene locus_tag LOCUS_04390 10097 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 10231 10848 gene locus_tag LOCUS_04400 10231 10848 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688115.1 protein_id gnl|my_center|LOCUS_04400 10871 11185 gene locus_tag LOCUS_04410 10871 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 11479 11763 gene locus_tag LOCUS_04420 11479 11763 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233591.1 protein_id gnl|my_center|LOCUS_04420 12015 12551 gene locus_tag LOCUS_04430 12015 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence0029 701 1321 gene locus_tag LOCUS_04440 701 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 1360 1713 gene locus_tag LOCUS_04450 1360 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 2943 1762 gene locus_tag LOCUS_04460 2943 1762 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484168.1 protein_id gnl|my_center|LOCUS_04460 3392 3075 gene locus_tag LOCUS_04470 3392 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3916 3500 gene locus_tag LOCUS_04480 3916 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4526 3909 gene locus_tag LOCUS_04490 4526 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 5099 4680 gene locus_tag LOCUS_04500 5099 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5540 8350 gene locus_tag LOCUS_04510 5540 8350 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325625.1 protein_id gnl|my_center|LOCUS_04510 11314 8486 gene locus_tag LOCUS_04520 11314 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 12718 11717 gene locus_tag LOCUS_04530 12718 11717 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_04530 >Feature sequence0030 522 2534 gene locus_tag LOCUS_04540 522 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 3699 2683 gene locus_tag LOCUS_04550 3699 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 3979 4413 gene locus_tag LOCUS_04560 3979 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 4562 4897 gene locus_tag LOCUS_04570 4562 4897 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064420.1 protein_id gnl|my_center|LOCUS_04570 4927 5286 gene locus_tag LOCUS_04580 4927 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 5974 5447 gene locus_tag LOCUS_04590 5974 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 6342 5974 gene locus_tag LOCUS_04600 6342 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 7417 6479 gene locus_tag LOCUS_04610 7417 6479 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_04610 9120 7780 gene locus_tag LOCUS_04620 9120 7780 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_04620 10173 9271 gene locus_tag LOCUS_04630 10173 9271 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 protein_id gnl|my_center|LOCUS_04630 11043 10318 gene locus_tag LOCUS_04640 11043 10318 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345437.1 protein_id gnl|my_center|LOCUS_04640 11625 11134 gene locus_tag LOCUS_04650 11625 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 12838 11654 gene locus_tag LOCUS_04660 12838 11654 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_04660 >Feature sequence0031 3555 7274 gene locus_tag LOCUS_04670 3555 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 7378 8391 gene locus_tag LOCUS_04680 7378 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 8749 12255 gene locus_tag LOCUS_04690 8749 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 >Feature sequence0032 1303 383 gene locus_tag LOCUS_04700 1303 383 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144111.1 protein_id gnl|my_center|LOCUS_04700 3300 1318 gene locus_tag LOCUS_04710 3300 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 5617 3605 gene locus_tag LOCUS_04720 5617 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 6248 5643 gene locus_tag LOCUS_04730 gene coaE 6248 5643 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_04730 7278 6319 gene locus_tag LOCUS_04740 gene folD 7278 6319 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_04740 7428 8276 gene locus_tag LOCUS_04750 7428 8276 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_04750 8321 9127 gene locus_tag LOCUS_04760 8321 9127 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928847.1 protein_id gnl|my_center|LOCUS_04760 10529 9222 gene locus_tag LOCUS_04770 10529 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_04770 11632 10655 gene locus_tag LOCUS_04780 gene etfA 11632 10655 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 protein_id gnl|my_center|LOCUS_04780 12528 11755 gene locus_tag LOCUS_04790 12528 11755 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence0033 1909 200 gene locus_tag LOCUS_04800 1909 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 2430 2164 gene locus_tag LOCUS_04810 2430 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 3443 2451 gene locus_tag LOCUS_04820 3443 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 6047 3453 gene locus_tag LOCUS_04830 6047 3453 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258514.1 protein_id gnl|my_center|LOCUS_04830 7129 6605 gene locus_tag LOCUS_04840 7129 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 7655 7164 gene locus_tag LOCUS_04850 7655 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 8271 7867 gene locus_tag LOCUS_04860 8271 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 11464 8438 gene locus_tag LOCUS_04870 11464 8438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 12462 11521 gene locus_tag LOCUS_04880 12462 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 >Feature sequence0034 <1 1221 gene locus_tag LOCUS_04890 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023172762.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 1502 2416 gene locus_tag LOCUS_04900 1502 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 4042 2510 gene locus_tag LOCUS_04910 4042 2510 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_04910 4648 4136 gene locus_tag LOCUS_04920 4648 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 6096 4684 gene locus_tag LOCUS_04930 6096 4684 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778115.1 protein_id gnl|my_center|LOCUS_04930 7598 6186 gene locus_tag LOCUS_04940 7598 6186 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132306.1 protein_id gnl|my_center|LOCUS_04940 7689 8846 gene locus_tag LOCUS_04950 7689 8846 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_04950 8941 9516 gene locus_tag LOCUS_04960 8941 9516 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 protein_id gnl|my_center|LOCUS_04960 9577 9762 gene locus_tag LOCUS_04970 9577 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 9816 10229 gene locus_tag LOCUS_04980 9816 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 10236 10307 gene locus_tag LOCUS_t00060 10236 10307 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10526 11200 gene locus_tag LOCUS_04990 10526 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 11439 11735 gene locus_tag LOCUS_05000 11439 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence0035 118 1605 gene locus_tag LOCUS_05010 118 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 1652 2395 gene locus_tag LOCUS_05020 gene pepE 1652 2395 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072673.1 protein_id gnl|my_center|LOCUS_05020 2392 3240 gene locus_tag LOCUS_05030 gene thyA 2392 3240 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208311.1 protein_id gnl|my_center|LOCUS_05030 3278 3766 gene locus_tag LOCUS_05040 3278 3766 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208310.1 protein_id gnl|my_center|LOCUS_05040 5040 3814 gene locus_tag LOCUS_05050 gene cruC 5040 3814 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_05050 6413 5040 gene locus_tag LOCUS_05060 6413 5040 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_05060 6923 7675 gene locus_tag LOCUS_05070 6923 7675 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_05070 7961 8329 gene locus_tag LOCUS_05080 7961 8329 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_05080 9447 8446 gene locus_tag LOCUS_05090 9447 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 11079 9481 gene locus_tag LOCUS_05100 11079 9481 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943196.1 protein_id gnl|my_center|LOCUS_05100 11813 11076 gene locus_tag LOCUS_05110 gene tmk 11813 11076 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_05110 12346 11810 gene locus_tag LOCUS_05120 gene tmk 12346 11810 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05120 >Feature sequence0036 1039 812 gene locus_tag LOCUS_05130 1039 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 1569 3311 gene locus_tag LOCUS_05140 gene ftsH 1569 3311 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191694.1 protein_id gnl|my_center|LOCUS_05140 3750 4481 gene locus_tag LOCUS_05150 3750 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 4478 7090 gene locus_tag LOCUS_05160 gene mutS 4478 7090 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_05160 8236 7283 gene locus_tag LOCUS_05170 8236 7283 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258947.1 protein_id gnl|my_center|LOCUS_05170 8484 8284 gene locus_tag LOCUS_05180 8484 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 9898 8507 gene locus_tag LOCUS_05190 9898 8507 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_05190 10992 10009 gene locus_tag LOCUS_05200 10992 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 <12114 11072 gene locus_tag LOCUS_05210 <12114 11072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000980946.1:pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha >Feature sequence0037 2879 2259 gene locus_tag LOCUS_05220 2879 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 3497 3012 gene locus_tag LOCUS_05230 3497 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 3700 3494 gene locus_tag LOCUS_05240 3700 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 7550 3750 gene locus_tag LOCUS_05250 7550 3750 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_05250 7827 7901 gene locus_tag LOCUS_t00070 7827 7901 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8128 9303 gene locus_tag LOCUS_05260 8128 9303 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074554312.1 protein_id gnl|my_center|LOCUS_05260 9409 9696 gene locus_tag LOCUS_05270 9409 9696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 9726 11846 gene locus_tag LOCUS_05280 9726 11846 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence0038 <1 608 gene locus_tag LOCUS_05290 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529927.1:esterase family protein 3328 746 gene locus_tag LOCUS_05300 3328 746 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535017.1 protein_id gnl|my_center|LOCUS_05300 5154 3526 gene locus_tag LOCUS_05310 5154 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 6336 5362 gene locus_tag LOCUS_05320 6336 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05320 6903 6340 gene locus_tag LOCUS_05330 6903 6340 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_05330 7264 9012 gene locus_tag LOCUS_05340 7264 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 9257 9646 gene locus_tag LOCUS_tm00010 9257 9646 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 11583 9754 gene locus_tag LOCUS_05350 11583 9754 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207976.1 protein_id gnl|my_center|LOCUS_05350 >Feature sequence0039 321 725 gene locus_tag LOCUS_05360 321 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 881 1282 gene locus_tag LOCUS_05370 881 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 1469 3025 gene locus_tag LOCUS_05380 1469 3025 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203086395.1 protein_id gnl|my_center|LOCUS_05380 3022 4179 gene locus_tag LOCUS_05390 3022 4179 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091593875.1 protein_id gnl|my_center|LOCUS_05390 4192 4617 gene locus_tag LOCUS_05400 4192 4617 CDS product DUF3995 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905581.1 protein_id gnl|my_center|LOCUS_05400 6054 4762 gene locus_tag LOCUS_05410 6054 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 6690 7583 gene locus_tag LOCUS_05420 6690 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 8347 7922 gene locus_tag LOCUS_05430 8347 7922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 9217 10692 gene locus_tag LOCUS_05440 9217 10692 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339151.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence0040 494 2122 gene locus_tag LOCUS_05450 494 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 2519 3898 gene locus_tag LOCUS_05460 2519 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3895 5145 gene locus_tag LOCUS_05470 3895 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 5735 8968 gene locus_tag LOCUS_05480 5735 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 <11902 9290 gene locus_tag LOCUS_05490 <11902 9290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039200.1:TonB-dependent receptor >Feature sequence0041 <1 620 gene locus_tag LOCUS_05500 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942950.1:diguanylate cyclase 985 4350 gene locus_tag LOCUS_05510 985 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 4626 6662 gene locus_tag LOCUS_05520 4626 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 6655 7308 gene locus_tag LOCUS_05530 6655 7308 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198408415.1 protein_id gnl|my_center|LOCUS_05530 7782 9467 gene locus_tag LOCUS_05540 7782 9467 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_05540 9760 11061 gene locus_tag LOCUS_05550 9760 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence0042 847 128 gene locus_tag LOCUS_05560 847 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 1595 888 gene locus_tag LOCUS_05570 1595 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2666 1596 gene locus_tag LOCUS_05580 gene pilM 2666 1596 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_05580 3489 5210 gene locus_tag LOCUS_05590 3489 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 6362 5217 gene locus_tag LOCUS_05600 6362 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 6366 6602 gene locus_tag LOCUS_05610 6366 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 7825 6677 gene locus_tag LOCUS_05620 7825 6677 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732907.1 protein_id gnl|my_center|LOCUS_05620 8040 8669 gene locus_tag LOCUS_05630 8040 8669 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_05630 9305 9380 gene locus_tag LOCUS_t00080 9305 9380 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9513 10106 gene locus_tag LOCUS_05640 9513 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 10122 11141 gene locus_tag LOCUS_05650 10122 11141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence0043 1974 1315 gene locus_tag LOCUS_05660 1974 1315 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_05660 2643 2080 gene locus_tag LOCUS_05670 2643 2080 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_05670 2832 3362 gene locus_tag LOCUS_05680 2832 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3770 4060 gene locus_tag LOCUS_05690 3770 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 4200 4475 gene locus_tag LOCUS_05700 4200 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 7764 4792 gene locus_tag LOCUS_05710 7764 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 8381 7818 gene locus_tag LOCUS_05720 8381 7818 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_05720 8893 9291 gene locus_tag LOCUS_05730 8893 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 9620 10837 gene locus_tag LOCUS_05740 9620 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 >Feature sequence0044 246 773 gene locus_tag LOCUS_05750 246 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 900 1601 gene locus_tag LOCUS_05760 900 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 2245 2511 gene locus_tag LOCUS_05770 2245 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 2754 3554 gene locus_tag LOCUS_05780 2754 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3551 3883 gene locus_tag LOCUS_05790 3551 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 5475 4048 gene locus_tag LOCUS_05800 5475 4048 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_05800 6386 5472 gene locus_tag LOCUS_05810 6386 5472 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942637.1 protein_id gnl|my_center|LOCUS_05810 6548 9961 gene locus_tag LOCUS_05820 6548 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 <11426 10202 gene locus_tag LOCUS_05830 <11426 10202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122716.1:sigma-54 dependent transcriptional regulator >Feature sequence0045 1505 645 gene locus_tag LOCUS_05840 1505 645 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537692.1 protein_id gnl|my_center|LOCUS_05840 1953 2702 gene locus_tag LOCUS_05850 1953 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 2889 3242 gene locus_tag LOCUS_05860 2889 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 3387 3947 gene locus_tag LOCUS_05870 gene ymdB 3387 3947 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857399.1 protein_id gnl|my_center|LOCUS_05870 4038 6206 gene locus_tag LOCUS_05880 4038 6206 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_05880 7413 6577 gene locus_tag LOCUS_05890 7413 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 8305 7445 gene locus_tag LOCUS_05900 8305 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 8699 10810 gene locus_tag LOCUS_05910 8699 10810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence0046 945 271 gene locus_tag LOCUS_05920 945 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 1754 942 gene locus_tag LOCUS_05930 1754 942 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088822.1 protein_id gnl|my_center|LOCUS_05930 2594 1803 gene locus_tag LOCUS_05940 2594 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 3058 2666 gene locus_tag LOCUS_05950 3058 2666 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372681.1 protein_id gnl|my_center|LOCUS_05950 3764 3153 gene locus_tag LOCUS_05960 3764 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 4742 3951 gene locus_tag LOCUS_05970 gene paaG 4742 3951 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_05970 5686 4841 gene locus_tag LOCUS_05980 5686 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 5970 5749 gene locus_tag LOCUS_05990 5970 5749 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_05990 6184 5963 gene locus_tag LOCUS_06000 6184 5963 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391793.1 protein_id gnl|my_center|LOCUS_06000 6337 6435 gene locus_tag LOCUS_t00090 6337 6435 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 6551 7324 gene locus_tag LOCUS_06010 6551 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 7595 9259 gene locus_tag LOCUS_06020 7595 9259 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222839.1 protein_id gnl|my_center|LOCUS_06020 9272 10777 gene locus_tag LOCUS_06030 gene glpK 9272 10777 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence0047 1069 173 gene locus_tag LOCUS_06040 1069 173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583036.1 protein_id gnl|my_center|LOCUS_06040 2013 1072 gene locus_tag LOCUS_06050 2013 1072 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966906.1 protein_id gnl|my_center|LOCUS_06050 3000 2032 gene locus_tag LOCUS_06060 3000 2032 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083809.1 protein_id gnl|my_center|LOCUS_06060 4001 3003 gene locus_tag LOCUS_06070 4001 3003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_06070 5819 4074 gene locus_tag LOCUS_06080 5819 4074 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140950.1 protein_id gnl|my_center|LOCUS_06080 6744 6466 gene locus_tag LOCUS_06090 6744 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 7723 7358 gene locus_tag LOCUS_06100 7723 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 8168 9295 gene locus_tag LOCUS_06110 8168 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence0048 1470 550 gene locus_tag LOCUS_06120 gene larE 1470 550 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_06120 1745 3208 gene locus_tag LOCUS_06130 1745 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 3208 3882 gene locus_tag LOCUS_06140 3208 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3940 4491 gene locus_tag LOCUS_06150 3940 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 4670 5245 gene locus_tag LOCUS_06160 4670 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 5589 5347 gene locus_tag LOCUS_06170 5589 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 5759 6142 gene locus_tag LOCUS_06180 5759 6142 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_06180 6391 7452 gene locus_tag LOCUS_06190 6391 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 7680 7979 gene locus_tag LOCUS_06200 7680 7979 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192868.1 protein_id gnl|my_center|LOCUS_06200 8935 8084 gene locus_tag LOCUS_06210 8935 8084 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_06210 9794 9084 gene locus_tag LOCUS_06220 9794 9084 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444635.1 protein_id gnl|my_center|LOCUS_06220 10826 9966 gene locus_tag LOCUS_06230 10826 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence0049 545 1201 gene locus_tag LOCUS_06240 545 1201 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986882.1 protein_id gnl|my_center|LOCUS_06240 1349 2473 gene locus_tag LOCUS_06250 1349 2473 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389234.1 protein_id gnl|my_center|LOCUS_06250 2809 3666 gene locus_tag LOCUS_06260 2809 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3704 3889 gene locus_tag LOCUS_06270 3704 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3919 4986 gene locus_tag LOCUS_06280 3919 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4983 6071 gene locus_tag LOCUS_06290 4983 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 6186 6452 gene locus_tag LOCUS_06300 6186 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 6507 7073 gene locus_tag LOCUS_06310 6507 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 7082 8032 gene locus_tag LOCUS_06320 7082 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 8326 8051 gene locus_tag LOCUS_06330 8326 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 8585 9214 gene locus_tag LOCUS_06340 8585 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 10918 9272 gene locus_tag LOCUS_06350 10918 9272 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence0050 251 322 gene locus_tag LOCUS_t00100 251 322 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 655 6777 gene locus_tag LOCUS_06360 655 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 7967 6849 gene locus_tag LOCUS_06370 7967 6849 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051894.1 protein_id gnl|my_center|LOCUS_06370 8413 8204 gene locus_tag LOCUS_06380 8413 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 8649 8479 gene locus_tag LOCUS_06390 8649 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 9911 9144 gene locus_tag LOCUS_06400 9911 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence0051 533 1432 gene locus_tag LOCUS_06410 533 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1531 1920 gene locus_tag LOCUS_06420 1531 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 2445 1987 gene locus_tag LOCUS_06430 2445 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 2763 4604 gene locus_tag LOCUS_06440 2763 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4601 5284 gene locus_tag LOCUS_06450 4601 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 5685 6071 gene locus_tag LOCUS_06460 5685 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 8510 6177 gene locus_tag LOCUS_06470 8510 6177 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence0052 237 61 gene locus_tag LOCUS_06480 237 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06480 1290 406 gene locus_tag LOCUS_06490 1290 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 7958 1359 gene locus_tag LOCUS_06500 7958 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 10159 9056 gene locus_tag LOCUS_06510 10159 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 10524 10339 gene locus_tag LOCUS_06520 10524 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence0053 1154 417 gene locus_tag LOCUS_06530 1154 417 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225648.1 protein_id gnl|my_center|LOCUS_06530 1500 1234 gene locus_tag LOCUS_06540 1500 1234 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225640.1 protein_id gnl|my_center|LOCUS_06540 3805 1505 gene locus_tag LOCUS_06550 gene hypF 3805 1505 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258631.1 protein_id gnl|my_center|LOCUS_06550 4626 3943 gene locus_tag LOCUS_06560 gene hypB 4626 3943 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889574.1 protein_id gnl|my_center|LOCUS_06560 4970 4623 gene locus_tag LOCUS_06570 gene hypA 4970 4623 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258629.1 protein_id gnl|my_center|LOCUS_06570 5642 5070 gene locus_tag LOCUS_06580 5642 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5886 5656 gene locus_tag LOCUS_06590 5886 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 6110 5955 gene locus_tag LOCUS_06600 6110 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 6661 6146 gene locus_tag LOCUS_06610 6661 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06610 6984 6658 gene locus_tag LOCUS_06620 6984 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06620 8075 6981 gene locus_tag LOCUS_06630 8075 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06630 8767 8075 gene locus_tag LOCUS_06640 8767 8075 CDS product DUF6084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225643.1 protein_id gnl|my_center|LOCUS_06640 9362 8760 gene locus_tag LOCUS_06650 9362 8760 CDS product DUF5947 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467021.1 protein_id gnl|my_center|LOCUS_06650 9760 9539 gene locus_tag LOCUS_06660 9760 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 10692 9838 gene locus_tag LOCUS_06670 10692 9838 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894102.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence0054 2730 2485 gene locus_tag LOCUS_06680 2730 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4432 3278 gene locus_tag LOCUS_06690 4432 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 4635 5102 gene locus_tag LOCUS_06700 4635 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 5118 6392 gene locus_tag LOCUS_06710 5118 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 6534 7439 gene locus_tag LOCUS_06720 6534 7439 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_06720 7443 8774 gene locus_tag LOCUS_06730 7443 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 8774 9544 gene locus_tag LOCUS_06740 8774 9544 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214431907.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence0055 1287 469 gene locus_tag LOCUS_06750 1287 469 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230452.1 protein_id gnl|my_center|LOCUS_06750 1653 1300 gene locus_tag LOCUS_06760 1653 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1933 1640 gene locus_tag LOCUS_06770 1933 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 2161 1940 gene locus_tag LOCUS_06780 2161 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 2543 2208 gene locus_tag LOCUS_06790 2543 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2542 2727 gene locus_tag LOCUS_06800 2542 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 3098 2670 gene locus_tag LOCUS_06810 3098 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3312 3503 gene locus_tag LOCUS_06820 3312 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3541 4848 gene locus_tag LOCUS_06830 3541 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 4967 5506 gene locus_tag LOCUS_06840 4967 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 5978 6397 gene locus_tag LOCUS_06850 5978 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 6434 7018 gene locus_tag LOCUS_06860 6434 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 7068 7511 gene locus_tag LOCUS_06870 7068 7511 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528902.1 protein_id gnl|my_center|LOCUS_06870 7772 8428 gene locus_tag LOCUS_06880 7772 8428 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798745.1 protein_id gnl|my_center|LOCUS_06880 8662 9057 gene locus_tag LOCUS_06890 8662 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 <10723 9188 gene locus_tag LOCUS_06900 <10723 9188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765353.1:S41 family peptidase >Feature sequence0056 823 1896 gene locus_tag LOCUS_06910 823 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 1896 2708 gene locus_tag LOCUS_06920 1896 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 2715 4907 gene locus_tag LOCUS_06930 2715 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 4922 5509 gene locus_tag LOCUS_06940 4922 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 6381 6758 gene locus_tag LOCUS_06950 6381 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 6937 7869 gene locus_tag LOCUS_06960 6937 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 8151 8462 gene locus_tag LOCUS_06970 8151 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 8615 9049 gene locus_tag LOCUS_06980 8615 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 10509 9163 gene locus_tag LOCUS_06990 10509 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 >Feature sequence0057 1847 954 gene locus_tag LOCUS_07000 1847 954 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_07000 2973 2035 gene locus_tag LOCUS_07010 2973 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 3426 3812 gene locus_tag LOCUS_07020 3426 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 5872 3929 gene locus_tag LOCUS_07030 gene dxs 5872 3929 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_07030 6130 6687 gene locus_tag LOCUS_07040 6130 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 7795 6767 gene locus_tag LOCUS_07050 7795 6767 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_07050 8318 7863 gene locus_tag LOCUS_07060 8318 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 8546 8331 gene locus_tag LOCUS_07070 8546 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 9555 8623 gene locus_tag LOCUS_07080 gene lipA 9555 8623 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932756.1 protein_id gnl|my_center|LOCUS_07080 10241 10029 gene locus_tag LOCUS_07090 10241 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07090 >Feature sequence0058 <1 2259 gene locus_tag LOCUS_07100 <1 2259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839369.1:M1 family metallopeptidase 5110 2453 gene locus_tag LOCUS_07110 5110 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 5771 5184 gene locus_tag LOCUS_07120 5771 5184 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_07120 6046 7044 gene locus_tag LOCUS_07130 6046 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 7386 9254 gene locus_tag LOCUS_07140 7386 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence0059 1512 1715 gene locus_tag LOCUS_07150 1512 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2645 1677 gene locus_tag LOCUS_07160 gene truB 2645 1677 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399346.1 protein_id gnl|my_center|LOCUS_07160 2766 3383 gene locus_tag LOCUS_07170 2766 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3511 6600 gene locus_tag LOCUS_07180 3511 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 6802 9501 gene locus_tag LOCUS_07190 gene alaS 6802 9501 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_07190 10006 9632 gene locus_tag LOCUS_07200 10006 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence0060 <1 815 gene locus_tag LOCUS_07210 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393340.1:bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase 1151 3058 gene locus_tag LOCUS_07220 1151 3058 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_07220 3542 9229 gene locus_tag LOCUS_07230 3542 9229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 9908 9117 gene locus_tag LOCUS_07240 9908 9117 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence0061 268 2448 gene locus_tag LOCUS_07250 268 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 2745 4235 gene locus_tag LOCUS_07260 2745 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4358 4603 gene locus_tag LOCUS_07270 4358 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5400 4705 gene locus_tag LOCUS_07280 5400 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 5620 7521 gene locus_tag LOCUS_07290 5620 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 7848 8144 gene locus_tag LOCUS_07300 7848 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 8144 8503 gene locus_tag LOCUS_07310 8144 8503 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190909147.1 protein_id gnl|my_center|LOCUS_07310 9357 8524 gene locus_tag LOCUS_07320 gene mazG 9357 8524 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531500.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence0062 619 104 gene locus_tag LOCUS_07330 619 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 927 2717 gene locus_tag LOCUS_07340 927 2717 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_07340 2983 3249 gene locus_tag LOCUS_07350 2983 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 3339 5141 gene locus_tag LOCUS_07360 3339 5141 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence0063 1262 201 gene locus_tag LOCUS_07370 1262 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 5099 1383 gene locus_tag LOCUS_07380 5099 1383 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_07380 6286 5675 gene locus_tag LOCUS_07390 6286 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 7309 6584 gene locus_tag LOCUS_07400 7309 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 7530 8516 gene locus_tag LOCUS_07410 7530 8516 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_07410 8878 9285 gene locus_tag LOCUS_07420 8878 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 9282 9695 gene locus_tag LOCUS_07430 9282 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence0064 1186 2814 gene locus_tag LOCUS_07440 1186 2814 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_07440 3065 6580 gene locus_tag LOCUS_07450 3065 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 6934 6593 gene locus_tag LOCUS_07460 6934 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 6848 7870 gene locus_tag LOCUS_07470 gene nagA 6848 7870 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582637.1 protein_id gnl|my_center|LOCUS_07470 9153 7945 gene locus_tag LOCUS_07480 9153 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 9690 9178 gene locus_tag LOCUS_07490 9690 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence0065 788 2953 gene locus_tag LOCUS_07500 788 2953 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_07500 3007 4746 gene locus_tag LOCUS_07510 3007 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 4798 7059 gene locus_tag LOCUS_07520 4798 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 7106 9436 gene locus_tag LOCUS_07530 7106 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 9880 9620 gene locus_tag LOCUS_07540 9880 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence0066 453 79 gene locus_tag LOCUS_07550 453 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3357 481 gene locus_tag LOCUS_07560 3357 481 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_07560 5003 4446 gene locus_tag LOCUS_07570 5003 4446 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941979.1 protein_id gnl|my_center|LOCUS_07570 6376 5075 gene locus_tag LOCUS_07580 6376 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 7242 6502 gene locus_tag LOCUS_07590 7242 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 8422 7559 gene locus_tag LOCUS_07600 8422 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 9391 8606 gene locus_tag LOCUS_07610 9391 8606 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence0067 1702 170 gene locus_tag LOCUS_07620 1702 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2974 1712 gene locus_tag LOCUS_07630 2974 1712 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_07630 4557 2980 gene locus_tag LOCUS_07640 4557 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 5931 4789 gene locus_tag LOCUS_07650 5931 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 6641 6952 gene locus_tag LOCUS_07660 6641 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 9028 7190 gene locus_tag LOCUS_07670 9028 7190 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_07670 9665 9156 gene locus_tag LOCUS_07680 9665 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence0068 <1 1814 gene locus_tag LOCUS_07690 <1 1814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140284.1:TonB-dependent receptor 2183 2743 gene locus_tag LOCUS_07700 2183 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 3864 2905 gene locus_tag LOCUS_07710 3864 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4128 4934 gene locus_tag LOCUS_07720 4128 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5798 4959 gene locus_tag LOCUS_07730 5798 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 6067 8712 gene locus_tag LOCUS_07740 6067 8712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 9093 8728 gene locus_tag LOCUS_07750 9093 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence0069 885 103 gene locus_tag LOCUS_07760 885 103 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_07760 1380 1003 gene locus_tag LOCUS_07770 1380 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2391 1474 gene locus_tag LOCUS_07780 2391 1474 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_07780 2587 3726 gene locus_tag LOCUS_07790 gene trxB 2587 3726 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_07790 5325 3793 gene locus_tag LOCUS_07800 5325 3793 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_07800 5981 5424 gene locus_tag LOCUS_07810 5981 5424 CDS product DUF2585 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122157.1 protein_id gnl|my_center|LOCUS_07810 6852 6082 gene locus_tag LOCUS_07820 6852 6082 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119176.1 protein_id gnl|my_center|LOCUS_07820 7404 6904 gene locus_tag LOCUS_07830 7404 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 7557 8534 gene locus_tag LOCUS_07840 7557 8534 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_07840 8653 9195 gene locus_tag LOCUS_07850 8653 9195 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence0070 1819 1469 gene locus_tag LOCUS_07860 1819 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1799 1936 gene locus_tag LOCUS_07870 1799 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2655 1969 gene locus_tag LOCUS_07880 2655 1969 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971351.1 protein_id gnl|my_center|LOCUS_07880 2954 5368 gene locus_tag LOCUS_07890 2954 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 5842 5492 gene locus_tag LOCUS_07900 5842 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 6309 5878 gene locus_tag LOCUS_07910 6309 5878 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_07910 7341 6685 gene locus_tag LOCUS_07920 7341 6685 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_07920 <9492 7565 gene locus_tag LOCUS_07930 <9492 7565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064241751.1:chemotaxis protein CheB >Feature sequence0071 501 91 gene locus_tag LOCUS_07940 501 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 1737 538 gene locus_tag LOCUS_07950 gene aroB 1737 538 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_07950 3277 1751 gene locus_tag LOCUS_07960 3277 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 5143 3704 gene locus_tag LOCUS_07970 gene glmM 5143 3704 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461863.1 protein_id gnl|my_center|LOCUS_07970 6301 5336 gene locus_tag LOCUS_07980 6301 5336 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938577.1 protein_id gnl|my_center|LOCUS_07980 7208 6342 gene locus_tag LOCUS_07990 gene cdaA 7208 6342 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_07990 8285 7338 gene locus_tag LOCUS_08000 8285 7338 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230883.1 protein_id gnl|my_center|LOCUS_08000 <9481 8560 gene locus_tag LOCUS_08010 <9481 8560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545010.1:site-2 protease family protein >Feature sequence0072 1993 215 gene locus_tag LOCUS_08020 1993 215 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_08020 5125 2756 gene locus_tag LOCUS_08030 5125 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 7923 5491 gene locus_tag LOCUS_08040 7923 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 <9478 8440 gene locus_tag LOCUS_08050 <9478 8440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403282.1:Glu/Leu/Phe/Val dehydrogenase >Feature sequence0073 2170 863 gene locus_tag LOCUS_08060 2170 863 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479553.1 protein_id gnl|my_center|LOCUS_08060 3314 2217 gene locus_tag LOCUS_08070 3314 2217 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775736.1 protein_id gnl|my_center|LOCUS_08070 4310 3333 gene locus_tag LOCUS_08080 4310 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5195 4338 gene locus_tag LOCUS_08090 5195 4338 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 protein_id gnl|my_center|LOCUS_08090 6575 5202 gene locus_tag LOCUS_08100 6575 5202 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028234.1 protein_id gnl|my_center|LOCUS_08100 7977 6613 gene locus_tag LOCUS_08110 7977 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 9017 8061 gene locus_tag LOCUS_08120 9017 8061 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925938.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence0074 526 158 gene locus_tag LOCUS_08130 526 158 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_08130 2239 542 gene locus_tag LOCUS_08140 gene recN 2239 542 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_08140 3247 2273 gene locus_tag LOCUS_08150 3247 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 3517 4410 gene locus_tag LOCUS_08160 3517 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 4407 9224 gene locus_tag LOCUS_08170 4407 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence0075 3188 1779 gene locus_tag LOCUS_08180 3188 1779 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_08180 5476 3194 gene locus_tag LOCUS_08190 5476 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 5947 5789 gene locus_tag LOCUS_08200 5947 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 7135 5969 gene locus_tag LOCUS_08210 7135 5969 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_08210 8072 7272 gene locus_tag LOCUS_08220 8072 7272 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530111.1 protein_id gnl|my_center|LOCUS_08220 8450 8376 gene locus_tag LOCUS_t00110 8450 8376 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9204 8503 gene locus_tag LOCUS_08230 9204 8503 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140612.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence0076 506 2140 gene locus_tag LOCUS_08240 506 2140 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878256.1 protein_id gnl|my_center|LOCUS_08240 2317 2805 gene locus_tag LOCUS_08250 2317 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3118 7311 gene locus_tag LOCUS_08260 3118 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence0077 699 2141 gene locus_tag LOCUS_08270 699 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 2487 2281 gene locus_tag LOCUS_08280 2487 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 2377 3963 gene locus_tag LOCUS_08290 2377 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 3970 4677 gene locus_tag LOCUS_08300 3970 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 5429 8308 gene locus_tag LOCUS_08310 5429 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence0078 188 3319 gene locus_tag LOCUS_08320 188 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 3686 6748 gene locus_tag LOCUS_08330 3686 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 6942 7181 gene locus_tag LOCUS_08340 6942 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence0079 2625 1558 gene locus_tag LOCUS_08350 gene queA 2625 1558 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173135.1 protein_id gnl|my_center|LOCUS_08350 3428 2622 gene locus_tag LOCUS_08360 3428 2622 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027986.1 protein_id gnl|my_center|LOCUS_08360 3526 4206 gene locus_tag LOCUS_08370 3526 4206 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926969.1 protein_id gnl|my_center|LOCUS_08370 4273 4872 gene locus_tag LOCUS_08380 4273 4872 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086782.1 protein_id gnl|my_center|LOCUS_08380 5158 5817 gene locus_tag LOCUS_08390 5158 5817 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_08390 5819 6883 gene locus_tag LOCUS_08400 5819 6883 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259230.1 protein_id gnl|my_center|LOCUS_08400 7201 8922 gene locus_tag LOCUS_08410 7201 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence0080 7 930 gene locus_tag LOCUS_08420 7 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1066 1854 gene locus_tag LOCUS_08430 1066 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2017 2514 gene locus_tag LOCUS_08440 2017 2514 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_08440 2592 3611 gene locus_tag LOCUS_08450 gene ispB 2592 3611 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216396.1 protein_id gnl|my_center|LOCUS_08450 3709 4335 gene locus_tag LOCUS_08460 3709 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 4475 5485 gene locus_tag LOCUS_08470 4475 5485 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933711.1 protein_id gnl|my_center|LOCUS_08470 5726 6796 gene locus_tag LOCUS_08480 5726 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 6901 8214 gene locus_tag LOCUS_08490 gene asnS 6901 8214 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257312.1 protein_id gnl|my_center|LOCUS_08490 8309 8848 gene locus_tag LOCUS_08500 8309 8848 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320322.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence0081 2945 1854 gene locus_tag LOCUS_08510 2945 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 3326 2961 gene locus_tag LOCUS_08520 3326 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4584 3445 gene locus_tag LOCUS_08530 4584 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 5090 4653 gene locus_tag LOCUS_08540 5090 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 5288 5106 gene locus_tag LOCUS_08550 5288 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 5637 7604 gene locus_tag LOCUS_08560 5637 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 7802 8299 gene locus_tag LOCUS_08570 7802 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 8846 8343 gene locus_tag LOCUS_08580 8846 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 9046 8843 gene locus_tag LOCUS_08590 9046 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence0082 500 1360 gene locus_tag LOCUS_08600 500 1360 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266784.1 protein_id gnl|my_center|LOCUS_08600 1501 2217 gene locus_tag LOCUS_08610 1501 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2242 2679 gene locus_tag LOCUS_08620 2242 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3020 2808 gene locus_tag LOCUS_08630 3020 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3640 3101 gene locus_tag LOCUS_08640 gene idi 3640 3101 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890634.1 protein_id gnl|my_center|LOCUS_08640 3906 4814 gene locus_tag LOCUS_08650 3906 4814 CDS product excisionase family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335835.1 protein_id gnl|my_center|LOCUS_08650 4862 5266 gene locus_tag LOCUS_08660 4862 5266 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142058.1 protein_id gnl|my_center|LOCUS_08660 5273 6289 gene locus_tag LOCUS_08670 5273 6289 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224196.1 protein_id gnl|my_center|LOCUS_08670 6293 7873 gene locus_tag LOCUS_08680 gene crtI 6293 7873 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_08680 7863 8636 gene locus_tag LOCUS_08690 7863 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence0083 1920 724 gene locus_tag LOCUS_08700 1920 724 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_08700 3140 2160 gene locus_tag LOCUS_08710 3140 2160 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_08710 3358 5004 gene locus_tag LOCUS_08720 3358 5004 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 protein_id gnl|my_center|LOCUS_08720 5984 5082 gene locus_tag LOCUS_08730 5984 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 6707 6159 gene locus_tag LOCUS_08740 6707 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 7040 8911 gene locus_tag LOCUS_08750 7040 8911 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence0084 3428 1230 gene locus_tag LOCUS_08760 3428 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 4736 3504 gene locus_tag LOCUS_08770 4736 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 6994 5045 gene locus_tag LOCUS_08780 6994 5045 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928481.1 protein_id gnl|my_center|LOCUS_08780 <8980 7143 gene locus_tag LOCUS_08790 <8980 7143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925729.1:DUF5916 domain-containing protein >Feature sequence0085 1519 140 gene locus_tag LOCUS_08800 1519 140 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_08800 2760 1552 gene locus_tag LOCUS_08810 gene tyrS 2760 1552 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938252.1 protein_id gnl|my_center|LOCUS_08810 3445 2846 gene locus_tag LOCUS_08820 gene purN 3445 2846 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_08820 4566 3532 gene locus_tag LOCUS_08830 gene purM 4566 3532 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_08830 4869 4576 gene locus_tag LOCUS_08840 4869 4576 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_08840 5136 4888 gene locus_tag LOCUS_08850 5136 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 5473 5186 gene locus_tag LOCUS_08860 5473 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 6022 5513 gene locus_tag LOCUS_08870 6022 5513 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_08870 7158 6058 gene locus_tag LOCUS_08880 7158 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 8877 7258 gene locus_tag LOCUS_08890 gene purF 8877 7258 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence0086 2660 1041 gene locus_tag LOCUS_08900 2660 1041 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_08900 3433 2900 gene locus_tag LOCUS_08910 3433 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 4107 3544 gene locus_tag LOCUS_08920 4107 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 5223 4180 gene locus_tag LOCUS_08930 gene glpX 5223 4180 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057116.1 protein_id gnl|my_center|LOCUS_08930 5484 6302 gene locus_tag LOCUS_08940 5484 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 6911 7834 gene locus_tag LOCUS_08950 6911 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 8887 7913 gene locus_tag LOCUS_08960 8887 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence0087 1659 2246 gene locus_tag LOCUS_08970 1659 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 2302 2850 gene locus_tag LOCUS_08980 2302 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2897 3928 gene locus_tag LOCUS_08990 2897 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 3971 6985 gene locus_tag LOCUS_09000 3971 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 8733 7372 gene locus_tag LOCUS_09010 8733 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence0088 2974 1175 gene locus_tag LOCUS_09020 2974 1175 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040200.1 protein_id gnl|my_center|LOCUS_09020 3219 3605 gene locus_tag LOCUS_09030 3219 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3602 3949 gene locus_tag LOCUS_09040 3602 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4147 4941 gene locus_tag LOCUS_09050 4147 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 5015 5467 gene locus_tag LOCUS_09060 5015 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 5577 5939 gene locus_tag LOCUS_09070 5577 5939 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228912.1 protein_id gnl|my_center|LOCUS_09070 6007 6411 gene locus_tag LOCUS_09080 6007 6411 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528798.1 protein_id gnl|my_center|LOCUS_09080 6512 7000 gene locus_tag LOCUS_09090 6512 7000 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285028.1 protein_id gnl|my_center|LOCUS_09090 8603 7137 gene locus_tag LOCUS_09100 8603 7137 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204581.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence0089 1395 397 gene locus_tag LOCUS_09110 1395 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2458 3801 gene locus_tag LOCUS_09120 2458 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3826 4836 gene locus_tag LOCUS_09130 3826 4836 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719803.1 protein_id gnl|my_center|LOCUS_09130 4836 7844 gene locus_tag LOCUS_09140 4836 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence0090 800 5335 gene locus_tag LOCUS_09150 800 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 5356 5790 gene locus_tag LOCUS_09160 5356 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 5809 6264 gene locus_tag LOCUS_09170 5809 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 7228 6410 gene locus_tag LOCUS_09180 7228 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence0091 164 5026 gene locus_tag LOCUS_09190 164 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence0092 1266 184 gene locus_tag LOCUS_09200 1266 184 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_09200 2499 1291 gene locus_tag LOCUS_09210 2499 1291 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402774.1 protein_id gnl|my_center|LOCUS_09210 4384 2528 gene locus_tag LOCUS_09220 4384 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6247 4457 gene locus_tag LOCUS_09230 6247 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 7886 6318 gene locus_tag LOCUS_09240 7886 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence0093 357 1715 gene locus_tag LOCUS_09250 357 1715 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_09250 1945 7989 gene locus_tag LOCUS_09260 1945 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 <8633 8075 gene locus_tag LOCUS_09270 <8633 8075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956840.1:acetate kinase >Feature sequence0094 125 787 gene locus_tag LOCUS_09280 125 787 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224640.1 protein_id gnl|my_center|LOCUS_09280 941 1726 gene locus_tag LOCUS_09290 941 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1873 3045 gene locus_tag LOCUS_09300 1873 3045 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_09300 3162 8174 gene locus_tag LOCUS_09310 3162 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence0095 199 1149 gene locus_tag LOCUS_09320 199 1149 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730493.1 protein_id gnl|my_center|LOCUS_09320 1217 1456 gene locus_tag LOCUS_09330 1217 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1484 1819 gene locus_tag LOCUS_09340 1484 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2520 1843 gene locus_tag LOCUS_09350 gene msrA 2520 1843 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928865.1 protein_id gnl|my_center|LOCUS_09350 3030 4139 gene locus_tag LOCUS_09360 gene wecB 3030 4139 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_09360 4141 5985 gene locus_tag LOCUS_09370 4141 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 5993 7225 gene locus_tag LOCUS_09380 5993 7225 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_09380 7280 8293 gene locus_tag LOCUS_09390 7280 8293 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence0096 4213 3536 gene locus_tag LOCUS_09400 4213 3536 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881307.1 protein_id gnl|my_center|LOCUS_09400 4518 7241 gene locus_tag LOCUS_09410 4518 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 7580 8356 gene locus_tag LOCUS_09420 7580 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence0097 1775 738 gene locus_tag LOCUS_09430 1775 738 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403756.1 protein_id gnl|my_center|LOCUS_09430 3112 1775 gene locus_tag LOCUS_09440 3112 1775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_09440 3954 3112 gene locus_tag LOCUS_09450 3954 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 5185 4250 gene locus_tag LOCUS_09460 5185 4250 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532147.1 protein_id gnl|my_center|LOCUS_09460 5489 6283 gene locus_tag LOCUS_09470 5489 6283 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_09470 6288 7010 gene locus_tag LOCUS_09480 6288 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 7183 8208 gene locus_tag LOCUS_09490 gene rfbB 7183 8208 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence0098 29 1054 gene locus_tag LOCUS_09500 29 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3065 1176 gene locus_tag LOCUS_09510 3065 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 3627 3157 gene locus_tag LOCUS_09520 3627 3157 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941058.1 protein_id gnl|my_center|LOCUS_09520 4052 3705 gene locus_tag LOCUS_09530 4052 3705 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_09530 4685 4203 gene locus_tag LOCUS_09540 4685 4203 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258222.1 protein_id gnl|my_center|LOCUS_09540 4884 6215 gene locus_tag LOCUS_09550 gene aroA 4884 6215 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_09550 6212 6766 gene locus_tag LOCUS_09560 6212 6766 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403434.1 protein_id gnl|my_center|LOCUS_09560 6763 7338 gene locus_tag LOCUS_09570 6763 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925589.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence0099 684 1082 gene locus_tag LOCUS_09580 684 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1210 1533 gene locus_tag LOCUS_09590 1210 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1530 2348 gene locus_tag LOCUS_09600 1530 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3288 2482 gene locus_tag LOCUS_09610 3288 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3488 4774 gene locus_tag LOCUS_09620 3488 4774 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_09620 5769 4849 gene locus_tag LOCUS_09630 5769 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 6549 6061 gene locus_tag LOCUS_09640 6549 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence0100 688 386 gene locus_tag LOCUS_09650 688 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 671 2176 gene locus_tag LOCUS_09660 671 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 2562 2359 gene locus_tag LOCUS_09670 2562 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2996 3967 gene locus_tag LOCUS_09680 2996 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 6062 4362 gene locus_tag LOCUS_09690 6062 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 5950 6159 gene locus_tag LOCUS_09700 5950 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 6290 7144 gene locus_tag LOCUS_09710 6290 7144 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_09710 7176 7424 gene locus_tag LOCUS_09720 7176 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7591 8001 gene locus_tag LOCUS_09730 7591 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence0101 1015 710 gene locus_tag LOCUS_09740 1015 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1535 1098 gene locus_tag LOCUS_09750 1535 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2243 1623 gene locus_tag LOCUS_09760 2243 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2900 2307 gene locus_tag LOCUS_09770 2900 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3405 3019 gene locus_tag LOCUS_09780 3405 3019 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974590.1 protein_id gnl|my_center|LOCUS_09780 3952 3488 gene locus_tag LOCUS_09790 3952 3488 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090958.1 protein_id gnl|my_center|LOCUS_09790 4480 4079 gene locus_tag LOCUS_09800 4480 4079 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_09800 5065 7509 gene locus_tag LOCUS_09810 5065 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence0102 2154 682 gene locus_tag LOCUS_09820 2154 682 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_09820 2471 2250 gene locus_tag LOCUS_09830 2471 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 4569 2602 gene locus_tag LOCUS_09840 4569 2602 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_09840 5197 4799 gene locus_tag LOCUS_09850 5197 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 6255 5299 gene locus_tag LOCUS_09860 gene rsmH 6255 5299 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_09860 6804 6361 gene locus_tag LOCUS_09870 gene mraZ 6804 6361 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095567.1 protein_id gnl|my_center|LOCUS_09870 7245 7895 gene locus_tag LOCUS_09880 7245 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence0103 <1 2035 gene locus_tag LOCUS_09890 <1 2035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250640.1:S8 family serine peptidase 3569 2166 gene locus_tag LOCUS_09900 3569 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 4028 5536 gene locus_tag LOCUS_09910 gene ffh 4028 5536 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_09910 5631 5894 gene locus_tag LOCUS_09920 gene rpsP 5631 5894 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545141.1 protein_id gnl|my_center|LOCUS_09920 5989 6225 gene locus_tag LOCUS_09930 5989 6225 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_09930 6222 6800 gene locus_tag LOCUS_09940 gene rimM 6222 6800 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111677.1 protein_id gnl|my_center|LOCUS_09940 6802 7632 gene locus_tag LOCUS_09950 gene trmD 6802 7632 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_09950 7725 8129 gene locus_tag LOCUS_09960 gene rplS 7725 8129 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence0104 598 1149 gene locus_tag LOCUS_09970 598 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1277 3193 gene locus_tag LOCUS_09980 gene mrdA 1277 3193 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_09980 3211 4332 gene locus_tag LOCUS_09990 gene rodA 3211 4332 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_09990 4418 4993 gene locus_tag LOCUS_10000 4418 4993 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_10000 5269 4934 gene locus_tag LOCUS_10010 5269 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 5150 5683 gene locus_tag LOCUS_10020 5150 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 6345 7583 gene locus_tag LOCUS_10030 6345 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence0105 891 82 gene locus_tag LOCUS_10040 891 82 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143015.1 protein_id gnl|my_center|LOCUS_10040 1585 1148 gene locus_tag LOCUS_10050 1585 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2511 1609 gene locus_tag LOCUS_10060 2511 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2654 3715 gene locus_tag LOCUS_10070 2654 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 3976 4791 gene locus_tag LOCUS_10080 gene rlmB 3976 4791 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887393.1 protein_id gnl|my_center|LOCUS_10080 4863 5390 gene locus_tag LOCUS_10090 4863 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5436 5975 gene locus_tag LOCUS_10100 5436 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 6046 7614 gene locus_tag LOCUS_10110 gene aroE 6046 7614 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence0106 331 1308 gene locus_tag LOCUS_10120 331 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1444 2661 gene locus_tag LOCUS_10130 gene trpB 1444 2661 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258563.1 protein_id gnl|my_center|LOCUS_10130 2658 3452 gene locus_tag LOCUS_10140 gene trpA 2658 3452 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_10140 6888 3577 gene locus_tag LOCUS_10150 6888 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence0107 <1 1255 gene locus_tag LOCUS_10160 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200858940.1:ATP-dependent zinc metalloprotease FtsH 1647 3311 gene locus_tag LOCUS_10170 1647 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3434 4204 gene locus_tag LOCUS_10180 3434 4204 CDS product dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086612.1 protein_id gnl|my_center|LOCUS_10180 4297 5160 gene locus_tag LOCUS_10190 gene folP 4297 5160 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_10190 5279 5833 gene locus_tag LOCUS_10200 5279 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 6000 6980 gene locus_tag LOCUS_10210 gene holA 6000 6980 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_10210 7414 6977 gene locus_tag LOCUS_10220 7414 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_10220 7787 7518 gene locus_tag LOCUS_10230 gene rpsT 7787 7518 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence0108 798 2171 gene locus_tag LOCUS_10240 798 2171 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 protein_id gnl|my_center|LOCUS_10240 2426 2791 gene locus_tag LOCUS_10250 2426 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3109 4284 gene locus_tag LOCUS_10260 3109 4284 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_10260 4374 4607 gene locus_tag LOCUS_10270 4374 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 4952 4623 gene locus_tag LOCUS_10280 4952 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5653 4949 gene locus_tag LOCUS_10290 5653 4949 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872152.1 protein_id gnl|my_center|LOCUS_10290 5826 6911 gene locus_tag LOCUS_10300 5826 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 7330 7025 gene locus_tag LOCUS_10310 7330 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 7955 7497 gene locus_tag LOCUS_10320 7955 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence0109 <1 720 gene locus_tag LOCUS_10330 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145647357.1:acetate kinase 2005 1214 gene locus_tag LOCUS_10340 2005 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2631 2125 gene locus_tag LOCUS_10350 2631 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3185 2970 gene locus_tag LOCUS_10360 3185 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3810 3322 gene locus_tag LOCUS_10370 3810 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 4416 3937 gene locus_tag LOCUS_10380 4416 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 4779 4429 gene locus_tag LOCUS_10390 4779 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884122.1 protein_id gnl|my_center|LOCUS_10390 4907 5350 gene locus_tag LOCUS_10400 4907 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 5845 5369 gene locus_tag LOCUS_10410 5845 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 7364 5991 gene locus_tag LOCUS_10420 7364 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 <8036 7415 gene locus_tag LOCUS_10430 <8036 7415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113481.1:C39 family peptidase >Feature sequence0110 830 63 gene locus_tag LOCUS_10440 830 63 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_10440 1041 1814 gene locus_tag LOCUS_10450 1041 1814 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_10450 1911 2768 gene locus_tag LOCUS_10460 1911 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 3440 2892 gene locus_tag LOCUS_10470 3440 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 5674 3683 gene locus_tag LOCUS_10480 5674 3683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 protein_id gnl|my_center|LOCUS_10480 6923 5709 gene locus_tag LOCUS_10490 6923 5709 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772519.1 protein_id gnl|my_center|LOCUS_10490 7499 7074 gene locus_tag LOCUS_10500 7499 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence0111 86 802 gene locus_tag LOCUS_10510 86 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 911 1168 gene locus_tag LOCUS_10520 911 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2274 1279 gene locus_tag LOCUS_10530 2274 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2571 3239 gene locus_tag LOCUS_10540 2571 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3262 3537 gene locus_tag LOCUS_10550 3262 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 3934 3626 gene locus_tag LOCUS_10560 3934 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 4345 3953 gene locus_tag LOCUS_10570 4345 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 5551 4592 gene locus_tag LOCUS_10580 5551 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 6318 5710 gene locus_tag LOCUS_10590 6318 5710 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_10590 7826 6450 gene locus_tag LOCUS_10600 7826 6450 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence0112 2821 1136 gene locus_tag LOCUS_10610 2821 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 3475 3053 gene locus_tag LOCUS_10620 3475 3053 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941789.1 protein_id gnl|my_center|LOCUS_10620 3885 3472 gene locus_tag LOCUS_10630 3885 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 4348 3914 gene locus_tag LOCUS_10640 4348 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 4723 4361 gene locus_tag LOCUS_10650 4723 4361 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_10650 5412 4765 gene locus_tag LOCUS_10660 5412 4765 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_10660 5637 6497 gene locus_tag LOCUS_10670 5637 6497 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_10670 6523 7620 gene locus_tag LOCUS_10680 6523 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence0113 1911 3515 gene locus_tag LOCUS_10690 gene nadB 1911 3515 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_10690 3612 4361 gene locus_tag LOCUS_10700 gene nfi 3612 4361 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082416.1 protein_id gnl|my_center|LOCUS_10700 4759 4403 gene locus_tag LOCUS_10710 4759 4403 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978039.1 protein_id gnl|my_center|LOCUS_10710 5107 4811 gene locus_tag LOCUS_10720 5107 4811 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015205689.1 protein_id gnl|my_center|LOCUS_10720 5378 5091 gene locus_tag LOCUS_10730 5378 5091 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_10730 6246 5524 gene locus_tag LOCUS_10740 6246 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 <7988 6480 gene locus_tag LOCUS_10750 <7988 6480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275523.1:serine hydrolase >Feature sequence0114 892 2157 gene locus_tag LOCUS_10760 892 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3597 2296 gene locus_tag LOCUS_10770 3597 2296 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_10770 4785 3727 gene locus_tag LOCUS_10780 4785 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 5718 4822 gene locus_tag LOCUS_10790 5718 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5969 5760 gene locus_tag LOCUS_10800 5969 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 6630 6493 gene locus_tag LOCUS_10810 6630 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10810 6839 6627 gene locus_tag LOCUS_10820 6839 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 7422 6832 gene locus_tag LOCUS_10830 7422 6832 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_10830 <7977 7425 gene locus_tag LOCUS_10840 <7977 7425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161952859.1:ribose 5-phosphate isomerase B >Feature sequence0115 94 2805 gene locus_tag LOCUS_10850 94 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3064 4053 gene locus_tag LOCUS_10860 3064 4053 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256898.1 protein_id gnl|my_center|LOCUS_10860 4371 4057 gene locus_tag LOCUS_10870 4371 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 5245 4460 gene locus_tag LOCUS_10880 5245 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 5557 6108 gene locus_tag LOCUS_10890 5557 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 6520 6819 gene locus_tag LOCUS_10900 6520 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 7291 7671 gene locus_tag LOCUS_10910 7291 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence0116 1597 59 gene locus_tag LOCUS_10920 1597 59 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023977.1 protein_id gnl|my_center|LOCUS_10920 3869 1800 gene locus_tag LOCUS_10930 3869 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 4245 5282 gene locus_tag LOCUS_10940 4245 5282 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124130.1 protein_id gnl|my_center|LOCUS_10940 5279 6310 gene locus_tag LOCUS_10950 5279 6310 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174672.1 protein_id gnl|my_center|LOCUS_10950 6718 7572 gene locus_tag LOCUS_10960 6718 7572 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence0117 <1 2460 gene locus_tag LOCUS_10970 <1 2460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039298.1:TonB-dependent receptor 2621 3706 gene locus_tag LOCUS_10980 2621 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3859 6246 gene locus_tag LOCUS_10990 3859 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 6276 6797 gene locus_tag LOCUS_11000 6276 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 6923 7537 gene locus_tag LOCUS_11010 6923 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence0118 1131 376 gene locus_tag LOCUS_11020 1131 376 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973515.1 protein_id gnl|my_center|LOCUS_11020 1467 3110 gene locus_tag LOCUS_11030 1467 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 3107 6259 gene locus_tag LOCUS_11040 3107 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 6351 6731 gene locus_tag LOCUS_11050 6351 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 7487 6828 gene locus_tag LOCUS_11060 7487 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence0119 801 631 gene locus_tag LOCUS_11070 801 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1098 1640 gene locus_tag LOCUS_11080 1098 1640 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_11080 1667 2389 gene locus_tag LOCUS_11090 1667 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2529 3965 gene locus_tag LOCUS_11100 gene hisS 2529 3965 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142552.1 protein_id gnl|my_center|LOCUS_11100 4004 5818 gene locus_tag LOCUS_11110 gene aspS 4004 5818 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_11110 6067 6579 gene locus_tag LOCUS_11120 6067 6579 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771208.1 protein_id gnl|my_center|LOCUS_11120 6645 7025 gene locus_tag LOCUS_11130 6645 7025 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_11130 7070 7780 gene locus_tag LOCUS_11140 7070 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence0120 182 1351 gene locus_tag LOCUS_11150 gene xylA 182 1351 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_11150 1462 2310 gene locus_tag LOCUS_11160 gene kduI 1462 2310 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035408.1 protein_id gnl|my_center|LOCUS_11160 3300 2317 gene locus_tag LOCUS_11170 3300 2317 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 protein_id gnl|my_center|LOCUS_11170 3387 4073 gene locus_tag LOCUS_11180 3387 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 4040 4825 gene locus_tag LOCUS_11190 4040 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 6227 4872 gene locus_tag LOCUS_11200 6227 4872 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265890.1 protein_id gnl|my_center|LOCUS_11200 7819 6320 gene locus_tag LOCUS_11210 gene hutH 7819 6320 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence0121 56 877 gene locus_tag LOCUS_11220 56 877 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_11220 994 1341 gene locus_tag LOCUS_11230 994 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1458 2771 gene locus_tag LOCUS_11240 gene purB 1458 2771 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_11240 2768 3241 gene locus_tag LOCUS_11250 2768 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 3285 3530 gene locus_tag LOCUS_11260 gene purS 3285 3530 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_11260 3527 4225 gene locus_tag LOCUS_11270 gene purQ 3527 4225 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_11270 4857 4306 gene locus_tag LOCUS_11280 4857 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 5275 6174 gene locus_tag LOCUS_11290 5275 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 6428 7048 gene locus_tag LOCUS_11300 6428 7048 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970048.1 protein_id gnl|my_center|LOCUS_11300 7063 7707 gene locus_tag LOCUS_11310 7063 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence0122 3394 1001 gene locus_tag LOCUS_11320 3394 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3782 3480 gene locus_tag LOCUS_11330 gene nuoK 3782 3480 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_11330 4456 3779 gene locus_tag LOCUS_11340 4456 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 5598 4531 gene locus_tag LOCUS_11350 gene nuoH 5598 4531 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545198.1 protein_id gnl|my_center|LOCUS_11350 <7740 5685 gene locus_tag LOCUS_11360 <7740 5685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969254.1:NADH-quinone oxidoreductase subunit NuoG >Feature sequence0123 1568 159 gene locus_tag LOCUS_11370 1568 159 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_11370 2414 1689 gene locus_tag LOCUS_11380 2414 1689 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065490.1 protein_id gnl|my_center|LOCUS_11380 4376 2430 gene locus_tag LOCUS_11390 4376 2430 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_11390 6315 4726 gene locus_tag LOCUS_11400 gene malQ 6315 4726 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_11400 <7736 6629 gene locus_tag LOCUS_11410 <7736 6629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839780.1:glycoside hydrolase family 13 protein >Feature sequence0124 1218 433 gene locus_tag LOCUS_11420 1218 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2681 1215 gene locus_tag LOCUS_11430 gene crtI 2681 1215 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_11430 3865 2693 gene locus_tag LOCUS_11440 gene cruC 3865 2693 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_11440 4908 3943 gene locus_tag LOCUS_11450 4908 3943 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_11450 5712 4912 gene locus_tag LOCUS_11460 5712 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 7207 5702 gene locus_tag LOCUS_11470 gene crtI 7207 5702 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence0125 640 266 gene locus_tag LOCUS_11480 gene queD 640 266 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_11480 2744 705 gene locus_tag LOCUS_11490 2744 705 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105733.1 protein_id gnl|my_center|LOCUS_11490 2625 2951 gene locus_tag LOCUS_11500 2625 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3113 2925 gene locus_tag LOCUS_11510 3113 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 4638 3334 gene locus_tag LOCUS_11520 4638 3334 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_11520 6137 4989 gene locus_tag LOCUS_11530 6137 4989 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091709.1 protein_id gnl|my_center|LOCUS_11530 6298 7410 gene locus_tag LOCUS_11540 6298 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence0126 303 725 gene locus_tag LOCUS_11550 gene mce 303 725 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_11550 743 2077 gene locus_tag LOCUS_11560 743 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2217 3803 gene locus_tag LOCUS_11570 2217 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3824 4693 gene locus_tag LOCUS_11580 3824 4693 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_11580 4811 5686 gene locus_tag LOCUS_11590 4811 5686 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142419.1 protein_id gnl|my_center|LOCUS_11590 5795 6262 gene locus_tag LOCUS_11600 5795 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 6375 7316 gene locus_tag LOCUS_11610 6375 7316 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence0127 2824 4407 gene locus_tag LOCUS_11620 2824 4407 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640391.1 protein_id gnl|my_center|LOCUS_11620 4489 5181 gene locus_tag LOCUS_11630 4489 5181 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920047.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence0128 <1 746 gene locus_tag LOCUS_11640 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928427.1:ATP-binding protein 1908 841 gene locus_tag LOCUS_11650 1908 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2936 3145 gene locus_tag LOCUS_11660 2936 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 3213 5363 gene locus_tag LOCUS_11670 gene ppk1 3213 5363 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_11670 5570 5731 gene locus_tag LOCUS_11680 5570 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 5866 6117 gene locus_tag LOCUS_11690 5866 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 6126 6824 gene locus_tag LOCUS_11700 6126 6824 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_11700 7225 7464 gene locus_tag LOCUS_11710 7225 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence0129 1613 54 gene locus_tag LOCUS_11720 1613 54 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_11720 2646 1621 gene locus_tag LOCUS_11730 2646 1621 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867671.1 protein_id gnl|my_center|LOCUS_11730 3973 2726 gene locus_tag LOCUS_11740 gene vpsj 3973 2726 CDS product exopolysaccharide biosynthesis protein VpsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843487.1 protein_id gnl|my_center|LOCUS_11740 5213 4062 gene locus_tag LOCUS_11750 5213 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 6386 5319 gene locus_tag LOCUS_11760 6386 5319 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_11760 7480 6515 gene locus_tag LOCUS_11770 7480 6515 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence0130 2339 342 gene locus_tag LOCUS_11780 2339 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3304 2372 gene locus_tag LOCUS_11790 3304 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3934 5607 gene locus_tag LOCUS_11800 3934 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5604 7301 gene locus_tag LOCUS_11810 5604 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence0131 <1 512 gene locus_tag LOCUS_11820 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110443.1:glycogen synthase GlgA 629 976 gene locus_tag LOCUS_11830 gene trxA 629 976 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852918.1 protein_id gnl|my_center|LOCUS_11830 1134 1535 gene locus_tag LOCUS_11840 1134 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1615 2934 gene locus_tag LOCUS_11850 1615 2934 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_11850 3056 3355 gene locus_tag LOCUS_11860 3056 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3476 3548 gene locus_tag LOCUS_t00120 3476 3548 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3998 3537 gene locus_tag LOCUS_11870 3998 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 5069 4275 gene locus_tag LOCUS_11880 5069 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence0132 523 771 gene locus_tag LOCUS_11890 523 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1124 1642 gene locus_tag LOCUS_11900 1124 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1687 2448 gene locus_tag LOCUS_11910 1687 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2448 2693 gene locus_tag LOCUS_11920 2448 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3248 3024 gene locus_tag LOCUS_11930 3248 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3189 3686 gene locus_tag LOCUS_11940 3189 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 4980 3808 gene locus_tag LOCUS_11950 4980 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 5977 5300 gene locus_tag LOCUS_11960 5977 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 6610 6197 gene locus_tag LOCUS_11970 6610 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 7138 6692 gene locus_tag LOCUS_11980 7138 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence0133 721 26 gene locus_tag LOCUS_11990 721 26 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088253.1 protein_id gnl|my_center|LOCUS_11990 866 1387 gene locus_tag LOCUS_12000 866 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1875 1426 gene locus_tag LOCUS_12010 1875 1426 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_12010 2193 1942 gene locus_tag LOCUS_12020 2193 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 3503 2463 gene locus_tag LOCUS_12030 3503 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4244 3654 gene locus_tag LOCUS_12040 gene dcd 4244 3654 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092017.1 protein_id gnl|my_center|LOCUS_12040 5349 4429 gene locus_tag LOCUS_12050 5349 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 6201 5446 gene locus_tag LOCUS_12060 6201 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 7101 6379 gene locus_tag LOCUS_12070 7101 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence0134 86 2305 gene locus_tag LOCUS_12080 86 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2325 3284 gene locus_tag LOCUS_12090 2325 3284 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444469.1 protein_id gnl|my_center|LOCUS_12090 3294 4088 gene locus_tag LOCUS_12100 3294 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 4095 4313 gene locus_tag LOCUS_12110 4095 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4814 4413 gene locus_tag LOCUS_12120 4814 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 4929 5693 gene locus_tag LOCUS_12130 gene xth 4929 5693 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 protein_id gnl|my_center|LOCUS_12130 5720 6748 gene locus_tag LOCUS_12140 5720 6748 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123665.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence0135 1025 84 gene locus_tag LOCUS_12150 1025 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1311 4115 gene locus_tag LOCUS_12160 1311 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 5204 4131 gene locus_tag LOCUS_12170 5204 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 6607 5429 gene locus_tag LOCUS_12180 6607 5429 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705134.1 protein_id gnl|my_center|LOCUS_12180 <7340 6604 gene locus_tag LOCUS_12190 <7340 6604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027075.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence0136 163 1368 gene locus_tag LOCUS_12200 163 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2110 1460 gene locus_tag LOCUS_12210 2110 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2628 2362 gene locus_tag LOCUS_12220 2628 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3844 3032 gene locus_tag LOCUS_12230 3844 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5843 4293 gene locus_tag LOCUS_12240 5843 4293 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_12240 6328 5861 gene locus_tag LOCUS_12250 gene smpB 6328 5861 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700605.1 protein_id gnl|my_center|LOCUS_12250 <7307 6454 gene locus_tag LOCUS_12260 <7307 6454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940417.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase >Feature sequence0137 119 436 gene locus_tag LOCUS_12270 119 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 466 1104 gene locus_tag LOCUS_12280 466 1104 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940563.1 protein_id gnl|my_center|LOCUS_12280 1198 1629 gene locus_tag LOCUS_12290 1198 1629 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_12290 1877 2758 gene locus_tag LOCUS_12300 gene ubiA 1877 2758 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_12300 2799 3404 gene locus_tag LOCUS_12310 2799 3404 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_12310 3425 4537 gene locus_tag LOCUS_12320 gene mqnE 3425 4537 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339462.1 protein_id gnl|my_center|LOCUS_12320 4567 5136 gene locus_tag LOCUS_12330 4567 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 5161 6009 gene locus_tag LOCUS_12340 5161 6009 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_12340 6241 7137 gene locus_tag LOCUS_12350 6241 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence0138 2765 2256 gene locus_tag LOCUS_12360 2765 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 3187 2798 gene locus_tag LOCUS_12370 3187 2798 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230674.1 protein_id gnl|my_center|LOCUS_12370 3533 3246 gene locus_tag LOCUS_12380 3533 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 4046 3591 gene locus_tag LOCUS_12390 4046 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 6274 4073 gene locus_tag LOCUS_12400 6274 4073 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_12400 6756 6292 gene locus_tag LOCUS_12410 6756 6292 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173437.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence0139 1464 445 gene locus_tag LOCUS_12420 gene aroF 1464 445 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256593.1 protein_id gnl|my_center|LOCUS_12420 3650 1590 gene locus_tag LOCUS_12430 3650 1590 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889193.1 protein_id gnl|my_center|LOCUS_12430 3958 5181 gene locus_tag LOCUS_12440 gene larC 3958 5181 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_12440 5185 5811 gene locus_tag LOCUS_12450 gene folE 5185 5811 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429416.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence0140 1298 297 gene locus_tag LOCUS_12460 1298 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2417 1557 gene locus_tag LOCUS_12470 gene ttcA 2417 1557 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 protein_id gnl|my_center|LOCUS_12470 2731 2420 gene locus_tag LOCUS_12480 2731 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2903 3307 gene locus_tag LOCUS_12490 2903 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 3258 3662 gene locus_tag LOCUS_12500 3258 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 3925 4470 gene locus_tag LOCUS_12510 3925 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 4517 6175 gene locus_tag LOCUS_12520 4517 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 6369 6899 gene locus_tag LOCUS_12530 6369 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence0141 1268 684 gene locus_tag LOCUS_12540 1268 684 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037571.1 protein_id gnl|my_center|LOCUS_12540 2176 1265 gene locus_tag LOCUS_12550 2176 1265 CDS product excisionase family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335835.1 protein_id gnl|my_center|LOCUS_12550 2422 2979 gene locus_tag LOCUS_12560 2422 2979 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 protein_id gnl|my_center|LOCUS_12560 3318 3974 gene locus_tag LOCUS_12570 3318 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 4005 4724 gene locus_tag LOCUS_12580 4005 4724 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530083.1 protein_id gnl|my_center|LOCUS_12580 5649 5230 gene locus_tag LOCUS_12590 5649 5230 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_12590 6384 5728 gene locus_tag LOCUS_12600 6384 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530135.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence0142 <1 689 gene locus_tag LOCUS_12610 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943554.1:glutamate racemase 670 1425 gene locus_tag LOCUS_12620 gene rph 670 1425 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_12620 1495 2517 gene locus_tag LOCUS_12630 1495 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2677 3192 gene locus_tag LOCUS_12640 2677 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 3294 3731 gene locus_tag LOCUS_12650 3294 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 4705 3770 gene locus_tag LOCUS_12660 4705 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 5389 4769 gene locus_tag LOCUS_12670 5389 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 <7196 5463 gene locus_tag LOCUS_12680 <7196 5463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393971.1:ATP-binding protein >Feature sequence0143 2117 225 gene locus_tag LOCUS_12690 2117 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 3354 2560 gene locus_tag LOCUS_12700 3354 2560 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_12700 3548 4318 gene locus_tag LOCUS_12710 3548 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 4355 5521 gene locus_tag LOCUS_12720 4355 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence0144 533 279 gene locus_tag LOCUS_12730 gene rpmE 533 279 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_12730 858 2177 gene locus_tag LOCUS_12740 858 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 2184 2438 gene locus_tag LOCUS_12750 2184 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 2511 3644 gene locus_tag LOCUS_12760 gene nuoD 2511 3644 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_12760 3770 4264 gene locus_tag LOCUS_12770 3770 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4261 4719 gene locus_tag LOCUS_12780 4261 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4747 4953 gene locus_tag LOCUS_12790 4747 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 4950 6275 gene locus_tag LOCUS_12800 4950 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 6377 6910 gene locus_tag LOCUS_12810 6377 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence0145 1794 3410 gene locus_tag LOCUS_12820 1794 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 3876 4577 gene locus_tag LOCUS_12830 3876 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence0146 1527 16 gene locus_tag LOCUS_12840 1527 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 3024 1771 gene locus_tag LOCUS_12850 3024 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3880 3047 gene locus_tag LOCUS_12860 gene cysT 3880 3047 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391148.1 protein_id gnl|my_center|LOCUS_12860 4284 3991 gene locus_tag LOCUS_12870 4284 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5070 4312 gene locus_tag LOCUS_12880 5070 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12880 5268 5609 gene locus_tag LOCUS_12890 5268 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 5996 6433 gene locus_tag LOCUS_12900 5996 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence0147 453 2711 gene locus_tag LOCUS_12910 453 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2844 4205 gene locus_tag LOCUS_12920 gene rimO 2844 4205 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_12920 4262 4861 gene locus_tag LOCUS_12930 4262 4861 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937834.1 protein_id gnl|my_center|LOCUS_12930 4874 5107 gene locus_tag LOCUS_12940 4874 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 5346 6944 gene locus_tag LOCUS_12950 gene serA 5346 6944 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391569.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence0148 723 133 gene locus_tag LOCUS_12960 723 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12960 905 1114 gene locus_tag LOCUS_12970 905 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2329 1241 gene locus_tag LOCUS_12980 2329 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3010 2441 gene locus_tag LOCUS_12990 3010 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 3634 3152 gene locus_tag LOCUS_13000 3634 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3924 5672 gene locus_tag LOCUS_13010 3924 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 5782 6324 gene locus_tag LOCUS_13020 5782 6324 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113921.1 protein_id gnl|my_center|LOCUS_13020 6340 6879 gene locus_tag LOCUS_13030 6340 6879 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence0149 1695 148 gene locus_tag LOCUS_13040 1695 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2242 3360 gene locus_tag LOCUS_13050 gene gcvT 2242 3360 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_13050 3531 3926 gene locus_tag LOCUS_13060 gene gcvH 3531 3926 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_13060 3933 5276 gene locus_tag LOCUS_13070 gene gcvPA 3933 5276 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_13070 5273 6802 gene locus_tag LOCUS_13080 gene gcvPB 5273 6802 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence0150 176 706 gene locus_tag LOCUS_13090 176 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1262 6226 gene locus_tag LOCUS_13100 1262 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence0151 2654 516 gene locus_tag LOCUS_13110 2654 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 6835 2825 gene locus_tag LOCUS_13120 6835 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence0152 1666 866 gene locus_tag LOCUS_13130 gene trpA 1666 866 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_13130 2871 1663 gene locus_tag LOCUS_13140 gene trpB 2871 1663 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258563.1 protein_id gnl|my_center|LOCUS_13140 3530 2868 gene locus_tag LOCUS_13150 3530 2868 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_13150 4338 3535 gene locus_tag LOCUS_13160 gene trpC 4338 3535 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969378.1 protein_id gnl|my_center|LOCUS_13160 5435 4335 gene locus_tag LOCUS_13170 gene trpD 5435 4335 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_13170 6353 5439 gene locus_tag LOCUS_13180 6353 5439 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927833.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence0153 2421 4328 gene locus_tag LOCUS_13190 gene betA 2421 4328 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763658.1 protein_id gnl|my_center|LOCUS_13190 4363 4548 gene locus_tag LOCUS_13200 4363 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence0154 190 1281 gene locus_tag LOCUS_13210 190 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1674 2774 gene locus_tag LOCUS_13220 1674 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4338 2842 gene locus_tag LOCUS_13230 gene crtD 4338 2842 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142868.1 protein_id gnl|my_center|LOCUS_13230 5227 4340 gene locus_tag LOCUS_13240 5227 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 6229 5414 gene locus_tag LOCUS_13250 6229 5414 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_13250 6840 6265 gene locus_tag LOCUS_13260 6840 6265 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence0155 1239 622 gene locus_tag LOCUS_13270 gene plsY 1239 622 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_13270 1890 1477 gene locus_tag LOCUS_13280 1890 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2390 2052 gene locus_tag LOCUS_13290 2390 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 3733 2498 gene locus_tag LOCUS_13300 3733 2498 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_13300 4745 3861 gene locus_tag LOCUS_13310 4745 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 6646 4877 gene locus_tag LOCUS_13320 6646 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence0156 498 2696 gene locus_tag LOCUS_13330 498 2696 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962866.1 protein_id gnl|my_center|LOCUS_13330 2892 3299 gene locus_tag LOCUS_13340 2892 3299 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_13340 3323 4246 gene locus_tag LOCUS_13350 3323 4246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_13350 4243 5046 gene locus_tag LOCUS_13360 4243 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 5114 6802 gene locus_tag LOCUS_13370 5114 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence0157 245 1048 gene locus_tag LOCUS_13380 245 1048 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240575.1 protein_id gnl|my_center|LOCUS_13380 1404 2162 gene locus_tag LOCUS_13390 1404 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 2286 3404 gene locus_tag LOCUS_13400 2286 3404 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015646101.1 protein_id gnl|my_center|LOCUS_13400 3629 5572 gene locus_tag LOCUS_13410 3629 5572 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_13410 6232 5732 gene locus_tag LOCUS_13420 gene moaC 6232 5732 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence0158 2508 1414 gene locus_tag LOCUS_13430 2508 1414 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_13430 2833 4077 gene locus_tag LOCUS_13440 2833 4077 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_13440 4074 5006 gene locus_tag LOCUS_13450 4074 5006 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_13450 5006 5263 gene locus_tag LOCUS_13460 5006 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence0159 1505 267 gene locus_tag LOCUS_13470 1505 267 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_13470 1765 4872 gene locus_tag LOCUS_13480 1765 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 6205 4919 gene locus_tag LOCUS_13490 6205 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 6402 6650 gene locus_tag LOCUS_13500 6402 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13500 >Feature sequence0160 346 137 gene locus_tag LOCUS_13510 346 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 418 588 gene locus_tag LOCUS_13520 418 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1080 1685 gene locus_tag LOCUS_13530 1080 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 2143 4497 gene locus_tag LOCUS_13540 2143 4497 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_13540 4718 6628 gene locus_tag LOCUS_13550 4718 6628 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223197.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence0161 1604 177 gene locus_tag LOCUS_13560 1604 177 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_13560 1818 1612 gene locus_tag LOCUS_13570 1818 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 6081 1876 gene locus_tag LOCUS_13580 6081 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence0162 1436 204 gene locus_tag LOCUS_13590 1436 204 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_13590 1977 3164 gene locus_tag LOCUS_13600 1977 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 3502 4800 gene locus_tag LOCUS_13610 3502 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 4800 5672 gene locus_tag LOCUS_13620 4800 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence0163 846 1592 gene locus_tag LOCUS_13630 846 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3117 1783 gene locus_tag LOCUS_13640 3117 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4078 3221 gene locus_tag LOCUS_13650 4078 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 5409 4105 gene locus_tag LOCUS_13660 5409 4105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419151.1 protein_id gnl|my_center|LOCUS_13660 5539 6432 gene locus_tag LOCUS_13670 5539 6432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184046096.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence0164 3830 2589 gene locus_tag LOCUS_13680 gene gguB 3830 2589 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974840.1 protein_id gnl|my_center|LOCUS_13680 5404 3857 gene locus_tag LOCUS_13690 5404 3857 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 protein_id gnl|my_center|LOCUS_13690 6591 5407 gene locus_tag LOCUS_13700 gene xylF 6591 5407 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence0165 955 584 gene locus_tag LOCUS_13710 955 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1249 2484 gene locus_tag LOCUS_13720 1249 2484 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_13720 2561 3820 gene locus_tag LOCUS_13730 2561 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 3856 5616 gene locus_tag LOCUS_13740 3856 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence0166 1885 1022 gene locus_tag LOCUS_13750 1885 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2724 1882 gene locus_tag LOCUS_13760 2724 1882 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868825.1 protein_id gnl|my_center|LOCUS_13760 5201 2721 gene locus_tag LOCUS_13770 gene glgB 5201 2721 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_13770 6159 5389 gene locus_tag LOCUS_13780 6159 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence0167 1159 152 gene locus_tag LOCUS_13790 gene pta 1159 152 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_13790 1898 1356 gene locus_tag LOCUS_13800 1898 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3551 2112 gene locus_tag LOCUS_13810 gene mpl 3551 2112 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479669.1 protein_id gnl|my_center|LOCUS_13810 5016 3673 gene locus_tag LOCUS_13820 5016 3673 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883999.1 protein_id gnl|my_center|LOCUS_13820 5534 5082 gene locus_tag LOCUS_13830 5534 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 6599 5547 gene locus_tag LOCUS_13840 6599 5547 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883998.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence0168 212 3976 gene locus_tag LOCUS_13850 212 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 4203 6059 gene locus_tag LOCUS_13860 4203 6059 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272653.1 protein_id gnl|my_center|LOCUS_13860 <6682 6144 gene locus_tag LOCUS_13870 <6682 6144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964225.1:amino acid permease >Feature sequence0169 650 378 gene locus_tag LOCUS_13880 650 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1326 694 gene locus_tag LOCUS_13890 1326 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 4176 2164 gene locus_tag LOCUS_13900 4176 2164 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_13900 5201 4500 gene locus_tag LOCUS_13910 5201 4500 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_13910 6454 5261 gene locus_tag LOCUS_13920 6454 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence0170 597 373 gene locus_tag LOCUS_13930 597 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13930 3157 746 gene locus_tag LOCUS_13940 3157 746 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 protein_id gnl|my_center|LOCUS_13940 4505 3534 gene locus_tag LOCUS_13950 4505 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_13950 5219 4575 gene locus_tag LOCUS_13960 5219 4575 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_13960 <6659 5254 gene locus_tag LOCUS_13970 <6659 5254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389505.1:excinuclease ABC subunit UvrA >Feature sequence0171 405 587 gene locus_tag LOCUS_13980 405 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 574 1098 gene locus_tag LOCUS_13990 574 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1221 3347 gene locus_tag LOCUS_14000 1221 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence0172 <1 966 gene locus_tag LOCUS_14010 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799131.1:EAL domain-containing protein 1751 1056 gene locus_tag LOCUS_14020 1751 1056 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143132.1 protein_id gnl|my_center|LOCUS_14020 2197 1751 gene locus_tag LOCUS_14030 2197 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4163 2484 gene locus_tag LOCUS_14040 4163 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 5185 4295 gene locus_tag LOCUS_14050 5185 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530101.1 protein_id gnl|my_center|LOCUS_14050 6186 5224 gene locus_tag LOCUS_14060 6186 5224 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931606.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence0173 1900 1064 gene locus_tag LOCUS_14070 gene rsmA 1900 1064 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_14070 3036 1897 gene locus_tag LOCUS_14080 gene ribD 3036 1897 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_14080 4499 3111 gene locus_tag LOCUS_14090 4499 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 5481 4657 gene locus_tag LOCUS_14100 5481 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 <6605 5579 gene locus_tag LOCUS_14110 <6605 5579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545054.1:HD domain-containing protein >Feature sequence0174 <1 835 gene locus_tag LOCUS_14120 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545206.1:apolipoprotein N-acyltransferase 1013 1993 gene locus_tag LOCUS_14130 gene prfB 1013 1993 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_14130 2044 2574 gene locus_tag LOCUS_14140 2044 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2608 5322 gene locus_tag LOCUS_14150 2608 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 5590 5934 gene locus_tag LOCUS_14160 5590 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence0175 148 708 gene locus_tag LOCUS_14170 gene rplF 148 708 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_14170 806 1216 gene locus_tag LOCUS_14180 gene rplR 806 1216 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_14180 1239 1745 gene locus_tag LOCUS_14190 gene rpsE 1239 1745 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_14190 1832 2035 gene locus_tag LOCUS_14200 gene rpmD 1832 2035 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_14200 2130 2621 gene locus_tag LOCUS_14210 gene rplO 2130 2621 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081797.1 protein_id gnl|my_center|LOCUS_14210 2855 4276 gene locus_tag LOCUS_14220 gene secY 2855 4276 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_14220 4383 5018 gene locus_tag LOCUS_14230 4383 5018 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 protein_id gnl|my_center|LOCUS_14230 5118 5864 gene locus_tag LOCUS_14240 gene map 5118 5864 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence0176 <1 1576 gene locus_tag LOCUS_14250 <1 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083435096.1:DUF4347 domain-containing protein >Feature sequence0177 624 2186 gene locus_tag LOCUS_14260 624 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 3860 2205 gene locus_tag LOCUS_14270 3860 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 5951 4119 gene locus_tag LOCUS_14280 5951 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence0178 539 964 gene locus_tag LOCUS_14290 539 964 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405616.1 protein_id gnl|my_center|LOCUS_14290 1039 2148 gene locus_tag LOCUS_14300 1039 2148 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228032.1 protein_id gnl|my_center|LOCUS_14300 3256 2240 gene locus_tag LOCUS_14310 3256 2240 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_14310 4492 3455 gene locus_tag LOCUS_14320 4492 3455 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583968.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence0179 2324 87 gene locus_tag LOCUS_14330 2324 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 5139 2521 gene locus_tag LOCUS_14340 5139 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 <6540 5478 gene locus_tag LOCUS_14350 <6540 5478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223261.1:CHAT domain-containing protein >Feature sequence0180 962 81 gene locus_tag LOCUS_14360 962 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 2884 1259 gene locus_tag LOCUS_14370 2884 1259 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532193.1 protein_id gnl|my_center|LOCUS_14370 3029 4150 gene locus_tag LOCUS_14380 3029 4150 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_14380 4304 4639 gene locus_tag LOCUS_14390 4304 4639 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192500.1 protein_id gnl|my_center|LOCUS_14390 <6527 4655 gene locus_tag LOCUS_14400 <6527 4655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_065451001.1:DUF2339 domain-containing protein >Feature sequence0181 3782 558 gene locus_tag LOCUS_14410 3782 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 <6515 4307 gene locus_tag LOCUS_14420 <6515 4307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392048.1:sporulation protein YhbH >Feature sequence0182 314 1108 gene locus_tag LOCUS_14430 314 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1125 1682 gene locus_tag LOCUS_14440 1125 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1725 2333 gene locus_tag LOCUS_14450 1725 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2675 3445 gene locus_tag LOCUS_14460 2675 3445 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_14460 4187 3510 gene locus_tag LOCUS_14470 4187 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4853 4191 gene locus_tag LOCUS_14480 gene modB 4853 4191 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144266.1 protein_id gnl|my_center|LOCUS_14480 5647 4850 gene locus_tag LOCUS_14490 gene modA 5647 4850 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021258.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence0183 <1 1041 gene locus_tag LOCUS_14500 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084207611.1:S9 family peptidase 1220 2272 gene locus_tag LOCUS_14510 1220 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 2272 4638 gene locus_tag LOCUS_14520 2272 4638 CDS product CDC27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279089.1 protein_id gnl|my_center|LOCUS_14520 4670 5308 gene locus_tag LOCUS_14530 gene thiE 4670 5308 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence0184 2795 1908 gene locus_tag LOCUS_14540 gene panC 2795 1908 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_14540 3808 2912 gene locus_tag LOCUS_14550 gene panB 3808 2912 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_14550 3815 3982 gene locus_tag LOCUS_14560 3815 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4649 4179 gene locus_tag LOCUS_14570 gene folK 4649 4179 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_14570 5491 4730 gene locus_tag LOCUS_14580 5491 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 5378 5731 gene locus_tag LOCUS_14590 5378 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 <6480 5959 gene locus_tag LOCUS_14600 <6480 5959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000435830.1:DUF1572 domain-containing protein >Feature sequence0185 2494 509 gene locus_tag LOCUS_14610 2494 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2574 2783 gene locus_tag LOCUS_14620 2574 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3161 3487 gene locus_tag LOCUS_14630 3161 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 3585 4463 gene locus_tag LOCUS_14640 gene rnd 3585 4463 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925719.1 protein_id gnl|my_center|LOCUS_14640 <6479 4507 gene locus_tag LOCUS_14650 <6479 4507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257128.1:thioredoxin domain-containing protein >Feature sequence0186 87 644 gene locus_tag LOCUS_14660 87 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 772 1539 gene locus_tag LOCUS_14670 772 1539 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_14670 1653 2606 gene locus_tag LOCUS_14680 gene ribF 1653 2606 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_14680 2809 4590 gene locus_tag LOCUS_14690 2809 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 4806 6374 gene locus_tag LOCUS_14700 4806 6374 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence0187 1500 1105 gene locus_tag LOCUS_14710 1500 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2134 1505 gene locus_tag LOCUS_14720 2134 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 2223 2579 gene locus_tag LOCUS_14730 2223 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 <6461 2774 gene locus_tag LOCUS_14740 <6461 2774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957530.1:PQQ-dependent sugar dehydrogenase >Feature sequence0188 1431 394 gene locus_tag LOCUS_14750 1431 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2881 1481 gene locus_tag LOCUS_14760 2881 1481 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_14760 3417 2938 gene locus_tag LOCUS_14770 3417 2938 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108259.1 protein_id gnl|my_center|LOCUS_14770 4198 3449 gene locus_tag LOCUS_14780 gene fabG 4198 3449 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_14780 6307 4406 gene locus_tag LOCUS_14790 6307 4406 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence0189 713 237 gene locus_tag LOCUS_14800 713 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1046 1822 gene locus_tag LOCUS_14810 1046 1822 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_14810 2027 4399 gene locus_tag LOCUS_14820 2027 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence0190 554 1366 gene locus_tag LOCUS_14830 554 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1487 2053 gene locus_tag LOCUS_14840 1487 2053 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_14840 4398 2131 gene locus_tag LOCUS_14850 4398 2131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088156.1 protein_id gnl|my_center|LOCUS_14850 5576 4455 gene locus_tag LOCUS_14860 5576 4455 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401993.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence0191 <1 895 gene locus_tag LOCUS_14870 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815179.1:redox-regulated ATPase YchF 1268 969 gene locus_tag LOCUS_14880 1268 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1717 1283 gene locus_tag LOCUS_14890 1717 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2388 3005 gene locus_tag LOCUS_14900 2388 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3162 3590 gene locus_tag LOCUS_14910 3162 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 3710 4099 gene locus_tag LOCUS_14920 3710 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 4124 4711 gene locus_tag LOCUS_14930 4124 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 4743 4964 gene locus_tag LOCUS_14940 4743 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 4961 5314 gene locus_tag LOCUS_14950 4961 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 5397 5882 gene locus_tag LOCUS_14960 5397 5882 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942971.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence0192 2647 1250 gene locus_tag LOCUS_14970 2647 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 3262 2723 gene locus_tag LOCUS_14980 3262 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143103.1 protein_id gnl|my_center|LOCUS_14980 3992 3447 gene locus_tag LOCUS_14990 3992 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 5189 4044 gene locus_tag LOCUS_15000 5189 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 6034 5189 gene locus_tag LOCUS_15010 6034 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence0193 1176 2177 gene locus_tag LOCUS_15020 gene queG 1176 2177 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_15020 2153 3142 gene locus_tag LOCUS_15030 2153 3142 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532618.1 protein_id gnl|my_center|LOCUS_15030 3387 4430 gene locus_tag LOCUS_15040 3387 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 4508 5065 gene locus_tag LOCUS_15050 4508 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 5089 6090 gene locus_tag LOCUS_15060 gene moaA 5089 6090 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence0194 <1 3520 gene locus_tag LOCUS_15070 <1 3520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404654.1:TonB-dependent receptor 3525 4589 gene locus_tag LOCUS_15080 3525 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4666 5211 gene locus_tag LOCUS_15090 4666 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 6280 5243 gene locus_tag LOCUS_15100 6280 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence0195 2698 2048 gene locus_tag LOCUS_15110 2698 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 3226 3612 gene locus_tag LOCUS_15120 3226 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 3624 4535 gene locus_tag LOCUS_15130 3624 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 4784 4602 gene locus_tag LOCUS_15140 4784 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 6015 4816 gene locus_tag LOCUS_15150 6015 4816 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence0196 253 1323 gene locus_tag LOCUS_15160 253 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1706 3355 gene locus_tag LOCUS_15170 1706 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence0197 31 114 gene locus_tag LOCUS_t00130 31 114 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1403 219 gene locus_tag LOCUS_15180 1403 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 3739 1400 gene locus_tag LOCUS_15190 3739 1400 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222071.1 protein_id gnl|my_center|LOCUS_15190 4228 3779 gene locus_tag LOCUS_15200 4228 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 6254 4239 gene locus_tag LOCUS_15210 gene ligA 6254 4239 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence0198 <1 1386 gene locus_tag LOCUS_15220 <1 1386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225853.1:phospholipid carrier-dependent glycosyltransferase 2890 1433 gene locus_tag LOCUS_15230 2890 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 3039 4955 gene locus_tag LOCUS_15240 3039 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 6198 5065 gene locus_tag LOCUS_15250 6198 5065 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence0199 265 633 gene locus_tag LOCUS_15260 265 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1222 749 gene locus_tag LOCUS_15270 1222 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1853 1242 gene locus_tag LOCUS_15280 1853 1242 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_15280 2492 1866 gene locus_tag LOCUS_15290 2492 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3425 2541 gene locus_tag LOCUS_15300 3425 2541 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 protein_id gnl|my_center|LOCUS_15300 4692 3601 gene locus_tag LOCUS_15310 gene ada 4692 3601 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_15310 5422 4880 gene locus_tag LOCUS_15320 5422 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 6232 5534 gene locus_tag LOCUS_15330 6232 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence0200 1399 3522 gene locus_tag LOCUS_15340 gene katE 1399 3522 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266295.1 protein_id gnl|my_center|LOCUS_15340 <6226 3694 gene locus_tag LOCUS_15350 <6226 3694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162013106.1:tetratricopeptide repeat protein >Feature sequence0201 <1 2448 gene locus_tag LOCUS_15360 <1 2448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141168.1:glucosidase 2599 4554 gene locus_tag LOCUS_15370 2599 4554 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_15370 4742 5230 gene locus_tag LOCUS_15380 4742 5230 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975952.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence0202 711 1778 gene locus_tag LOCUS_15390 711 1778 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_15390 2277 1804 gene locus_tag LOCUS_15400 2277 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2818 2321 gene locus_tag LOCUS_15410 2818 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2938 4767 gene locus_tag LOCUS_15420 2938 4767 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888050.1 protein_id gnl|my_center|LOCUS_15420 5011 5865 gene locus_tag LOCUS_15430 5011 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence0203 <1 1505 gene locus_tag LOCUS_15440 <1 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925729.1:DUF5916 domain-containing protein 345 428 gene locus_tag LOCUS_t00140 345 428 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1605 2072 gene locus_tag LOCUS_15450 1605 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2241 2576 gene locus_tag LOCUS_15460 2241 2576 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261097.1 protein_id gnl|my_center|LOCUS_15460 3249 2629 gene locus_tag LOCUS_15470 3249 2629 CDS product ABATE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530137.1 protein_id gnl|my_center|LOCUS_15470 3383 3850 gene locus_tag LOCUS_15480 3383 3850 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731503.1 protein_id gnl|my_center|LOCUS_15480 3884 4783 gene locus_tag LOCUS_15490 3884 4783 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111553.1 protein_id gnl|my_center|LOCUS_15490 4907 6064 gene locus_tag LOCUS_15500 4907 6064 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence0204 676 104 gene locus_tag LOCUS_15510 676 104 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_15510 876 1088 gene locus_tag LOCUS_15520 876 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1401 1541 gene locus_tag LOCUS_15530 1401 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1925 1599 gene locus_tag LOCUS_15540 1925 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2310 1954 gene locus_tag LOCUS_15550 2310 1954 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_15550 2984 2793 gene locus_tag LOCUS_15560 2984 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 3348 3082 gene locus_tag LOCUS_15570 3348 3082 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036285.1 protein_id gnl|my_center|LOCUS_15570 3946 3383 gene locus_tag LOCUS_15580 3946 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 5579 4203 gene locus_tag LOCUS_15590 5579 4203 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456667.1 protein_id gnl|my_center|LOCUS_15590 6040 5576 gene locus_tag LOCUS_15600 6040 5576 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529944.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence0205 1155 733 gene locus_tag LOCUS_15610 1155 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1848 3419 gene locus_tag LOCUS_15620 1848 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3560 4054 gene locus_tag LOCUS_15630 3560 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence0206 2922 1405 gene locus_tag LOCUS_15640 2922 1405 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118670.1 protein_id gnl|my_center|LOCUS_15640 3326 2985 gene locus_tag LOCUS_15650 3326 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 3565 3323 gene locus_tag LOCUS_15660 3565 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 4826 3642 gene locus_tag LOCUS_15670 4826 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 5393 4938 gene locus_tag LOCUS_15680 5393 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 6126 5446 gene locus_tag LOCUS_15690 6126 5446 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence0207 1813 635 gene locus_tag LOCUS_15700 gene aroC 1813 635 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768335.1 protein_id gnl|my_center|LOCUS_15700 2281 1841 gene locus_tag LOCUS_15710 2281 1841 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111846.1 protein_id gnl|my_center|LOCUS_15710 3833 2292 gene locus_tag LOCUS_15720 3833 2292 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_15720 4402 3866 gene locus_tag LOCUS_15730 4402 3866 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118797.1 protein_id gnl|my_center|LOCUS_15730 <6142 4490 gene locus_tag LOCUS_15740 <6142 4490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391795.1:excinuclease ABC subunit UvrB >Feature sequence0208 879 2462 gene locus_tag LOCUS_15750 879 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2811 5624 gene locus_tag LOCUS_15760 2811 5624 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence0209 1 282 gene locus_tag LOCUS_15770 1 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 279 1550 gene locus_tag LOCUS_15780 279 1550 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_15780 3470 1590 gene locus_tag LOCUS_15790 3470 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 5090 3639 gene locus_tag LOCUS_15800 5090 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 <6108 5272 gene locus_tag LOCUS_15810 <6108 5272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921083.1:homoserine dehydrogenase >Feature sequence0210 <1 1739 gene locus_tag LOCUS_15820 <1 1739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940943.1:glutamine--fructose-6-phosphate transaminase (isomerizing) 3217 1820 gene locus_tag LOCUS_15830 3217 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263244.1 protein_id gnl|my_center|LOCUS_15830 4556 3387 gene locus_tag LOCUS_15840 4556 3387 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_15840 4850 5974 gene locus_tag LOCUS_15850 4850 5974 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence0211 2123 546 gene locus_tag LOCUS_15860 2123 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2922 2230 gene locus_tag LOCUS_15870 2922 2230 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976284.1 protein_id gnl|my_center|LOCUS_15870 3476 3048 gene locus_tag LOCUS_15880 3476 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3711 5078 gene locus_tag LOCUS_15890 3711 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 5230 5937 gene locus_tag LOCUS_15900 5230 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence0212 343 1203 gene locus_tag LOCUS_15910 343 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1211 2008 gene locus_tag LOCUS_15920 1211 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 2036 3031 gene locus_tag LOCUS_15930 2036 3031 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881003.1 protein_id gnl|my_center|LOCUS_15930 3265 3900 gene locus_tag LOCUS_15940 3265 3900 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031897.1 protein_id gnl|my_center|LOCUS_15940 5514 3973 gene locus_tag LOCUS_15950 5514 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence0213 192 752 gene locus_tag LOCUS_15960 192 752 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_15960 2323 1034 gene locus_tag LOCUS_15970 2323 1034 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_15970 2606 4210 gene locus_tag LOCUS_15980 2606 4210 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369856.1 protein_id gnl|my_center|LOCUS_15980 <6036 4295 gene locus_tag LOCUS_15990 <6036 4295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964428.1:S9 family peptidase >Feature sequence0214 1168 446 gene locus_tag LOCUS_16000 gene hisA 1168 446 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_16000 1793 1287 gene locus_tag LOCUS_16010 1793 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 3735 1798 gene locus_tag LOCUS_16020 3735 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 5242 3755 gene locus_tag LOCUS_16030 5242 3755 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792662.1 protein_id gnl|my_center|LOCUS_16030 5272 5907 gene locus_tag LOCUS_16040 5272 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence0215 1623 577 gene locus_tag LOCUS_16050 1623 577 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_16050 1724 2722 gene locus_tag LOCUS_16060 1724 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 3427 2834 gene locus_tag LOCUS_16070 3427 2834 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_16070 4030 3497 gene locus_tag LOCUS_16080 4030 3497 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence0216 <1 996 gene locus_tag LOCUS_16090 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339387.1:NAD(P)/FAD-dependent oxidoreductase 1011 1448 gene locus_tag LOCUS_16100 1011 1448 CDS product ABA4-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_16100 1445 2248 gene locus_tag LOCUS_16110 1445 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222822.1 protein_id gnl|my_center|LOCUS_16110 2336 4039 gene locus_tag LOCUS_16120 2336 4039 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_16120 5007 4153 gene locus_tag LOCUS_16130 5007 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4978 5580 gene locus_tag LOCUS_16140 4978 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence0217 <1 771 gene locus_tag LOCUS_16150 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942084.1:M48 family metallopeptidase 856 1224 gene locus_tag LOCUS_16160 856 1224 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812160.1 protein_id gnl|my_center|LOCUS_16160 4287 1477 gene locus_tag LOCUS_16170 4287 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 4550 5011 gene locus_tag LOCUS_16180 4550 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 5110 5571 gene locus_tag LOCUS_16190 gene rplM 5110 5571 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence0218 695 72 gene locus_tag LOCUS_16200 695 72 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458621.1 protein_id gnl|my_center|LOCUS_16200 778 1503 gene locus_tag LOCUS_16210 778 1503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_16210 1500 4028 gene locus_tag LOCUS_16220 1500 4028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_16220 4549 4130 gene locus_tag LOCUS_16230 4549 4130 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164258.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence0219 852 1454 gene locus_tag LOCUS_16240 852 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1451 2581 gene locus_tag LOCUS_16250 1451 2581 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530208.1 protein_id gnl|my_center|LOCUS_16250 2828 5071 gene locus_tag LOCUS_16260 2828 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence0220 <1 1221 gene locus_tag LOCUS_16270 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393393.1:phosphoenolpyruvate carboxykinase (ATP) 3037 1451 gene locus_tag LOCUS_16280 3037 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 4126 3209 gene locus_tag LOCUS_16290 4126 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 4744 4145 gene locus_tag LOCUS_16300 4744 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 5415 4864 gene locus_tag LOCUS_16310 5415 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence0221 47 865 gene locus_tag LOCUS_16320 47 865 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_16320 1665 1997 gene locus_tag LOCUS_16330 1665 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2054 2359 gene locus_tag LOCUS_16340 2054 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence0222 485 1204 gene locus_tag LOCUS_16350 485 1204 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921561.1 protein_id gnl|my_center|LOCUS_16350 1210 2442 gene locus_tag LOCUS_16360 1210 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 2495 3997 gene locus_tag LOCUS_16370 2495 3997 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228418.1 protein_id gnl|my_center|LOCUS_16370 4060 4284 gene locus_tag LOCUS_16380 4060 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 4330 5199 gene locus_tag LOCUS_16390 4330 5199 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence0223 <1 575 gene locus_tag LOCUS_16400 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928775.1:ABC transporter permease 702 3161 gene locus_tag LOCUS_16410 702 3161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_16410 3286 5727 gene locus_tag LOCUS_16420 3286 5727 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence0224 1029 466 gene locus_tag LOCUS_16430 1029 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1618 1139 gene locus_tag LOCUS_16440 1618 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2007 1654 gene locus_tag LOCUS_16450 2007 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2232 2747 gene locus_tag LOCUS_16460 2232 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2783 3901 gene locus_tag LOCUS_16470 2783 3901 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839930.1 protein_id gnl|my_center|LOCUS_16470 4321 4680 gene locus_tag LOCUS_16480 4321 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 4809 5642 gene locus_tag LOCUS_16490 gene speB 4809 5642 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence0225 <1 1668 gene locus_tag LOCUS_16500 <1 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963842.1:amino acid permease 3013 1811 gene locus_tag LOCUS_16510 3013 1811 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_16510 3104 4696 gene locus_tag LOCUS_16520 3104 4696 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence0226 956 126 gene locus_tag LOCUS_16530 956 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1505 978 gene locus_tag LOCUS_16540 1505 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1951 1574 gene locus_tag LOCUS_16550 1951 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2679 1966 gene locus_tag LOCUS_16560 2679 1966 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_16560 2895 4082 gene locus_tag LOCUS_16570 2895 4082 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728145.1 protein_id gnl|my_center|LOCUS_16570 4084 4800 gene locus_tag LOCUS_16580 4084 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035389.1 protein_id gnl|my_center|LOCUS_16580 5006 5629 gene locus_tag LOCUS_16590 gene ruvA 5006 5629 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072405.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence0227 460 660 gene locus_tag LOCUS_16600 460 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16600 1145 4000 gene locus_tag LOCUS_16610 1145 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4101 5255 gene locus_tag LOCUS_16620 4101 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence0228 205 903 gene locus_tag LOCUS_16630 205 903 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_16630 927 2138 gene locus_tag LOCUS_16640 927 2138 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706990.1 protein_id gnl|my_center|LOCUS_16640 2251 3204 gene locus_tag LOCUS_16650 2251 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 3387 3476 gene locus_tag LOCUS_t00150 3387 3476 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3517 4035 gene locus_tag LOCUS_16660 3517 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 4412 4789 gene locus_tag LOCUS_16670 4412 4789 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800772.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence0229 809 1501 gene locus_tag LOCUS_16680 809 1501 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_16680 1502 3016 gene locus_tag LOCUS_16690 1502 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 3142 3798 gene locus_tag LOCUS_16700 3142 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 3852 4217 gene locus_tag LOCUS_16710 3852 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence0230 <1 532 gene locus_tag LOCUS_16720 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034349500.1:serine hydrolase 653 1531 gene locus_tag LOCUS_16730 653 1531 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013300.1 protein_id gnl|my_center|LOCUS_16730 1719 1543 gene locus_tag LOCUS_16740 1719 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 2609 1860 gene locus_tag LOCUS_16750 2609 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 3609 2692 gene locus_tag LOCUS_16760 3609 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 4072 3626 gene locus_tag LOCUS_16770 4072 3626 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387794.1 protein_id gnl|my_center|LOCUS_16770 4608 4084 gene locus_tag LOCUS_16780 4608 4084 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_16780 <5777 4611 gene locus_tag LOCUS_16790 <5777 4611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926646.1:heme lyase CcmF/NrfE family subunit >Feature sequence0231 3184 2609 gene locus_tag LOCUS_16800 gene efp 3184 2609 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_16800 3434 3934 gene locus_tag LOCUS_16810 3434 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3959 4441 gene locus_tag LOCUS_16820 3959 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 <5770 4507 gene locus_tag LOCUS_16830 <5770 4507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028088.1:FdhF/YdeP family oxidoreductase >Feature sequence0232 455 1534 gene locus_tag LOCUS_16840 gene prfA 455 1534 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_16840 1547 2194 gene locus_tag LOCUS_16850 1547 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2350 3783 gene locus_tag LOCUS_16860 2350 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 4105 4989 gene locus_tag LOCUS_16870 4105 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 <5763 5091 gene locus_tag LOCUS_16880 <5763 5091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941007.1:NADH-quinone oxidoreductase subunit B >Feature sequence0233 2179 80 gene locus_tag LOCUS_16890 2179 80 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_16890 2427 4199 gene locus_tag LOCUS_16900 2427 4199 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_16900 4280 5035 gene locus_tag LOCUS_16910 4280 5035 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933673.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence0234 322 1014 gene locus_tag LOCUS_16920 322 1014 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_16920 1463 1744 gene locus_tag LOCUS_16930 1463 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1759 2157 gene locus_tag LOCUS_16940 1759 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3158 2313 gene locus_tag LOCUS_16950 3158 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 5571 3292 gene locus_tag LOCUS_16960 gene clpA 5571 3292 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546336.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence0235 923 459 gene locus_tag LOCUS_16970 923 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 5011 1337 gene locus_tag LOCUS_16980 5011 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 <5709 5100 gene locus_tag LOCUS_16990 <5709 5100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000992924.1:DNA helicase PcrA >Feature sequence0236 931 101 gene locus_tag LOCUS_17000 931 101 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_17000 1835 918 gene locus_tag LOCUS_17010 gene dapA 1835 918 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933288.1 protein_id gnl|my_center|LOCUS_17010 2618 1908 gene locus_tag LOCUS_17020 gene dapB 2618 1908 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_17020 3837 2824 gene locus_tag LOCUS_17030 gene dapE 3837 2824 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929912.1 protein_id gnl|my_center|LOCUS_17030 5369 3948 gene locus_tag LOCUS_17040 gene lysC 5369 3948 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence0237 671 1189 gene locus_tag LOCUS_17050 671 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1229 1735 gene locus_tag LOCUS_17060 1229 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1809 3098 gene locus_tag LOCUS_17070 1809 3098 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_17070 3144 4502 gene locus_tag LOCUS_17080 3144 4502 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537977.1 protein_id gnl|my_center|LOCUS_17080 4629 5591 gene locus_tag LOCUS_17090 4629 5591 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939400.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence0238 611 459 gene locus_tag LOCUS_17100 611 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1452 619 gene locus_tag LOCUS_17110 1452 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1823 3043 gene locus_tag LOCUS_17120 1823 3043 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869075.1 protein_id gnl|my_center|LOCUS_17120 3073 4071 gene locus_tag LOCUS_17130 gene ala 3073 4071 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence0239 369 3392 gene locus_tag LOCUS_17140 369 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3488 5170 gene locus_tag LOCUS_17150 gene bshC 3488 5170 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence0240 481 1257 gene locus_tag LOCUS_17160 481 1257 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975928.1 protein_id gnl|my_center|LOCUS_17160 1460 1753 gene locus_tag LOCUS_17170 1460 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1907 2071 gene locus_tag LOCUS_17180 1907 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 4126 2081 gene locus_tag LOCUS_17190 4126 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 4518 4123 gene locus_tag LOCUS_17200 4518 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 5011 5265 gene locus_tag LOCUS_17210 5011 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence0241 269 1387 gene locus_tag LOCUS_17220 269 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2448 1504 gene locus_tag LOCUS_17230 2448 1504 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_17230 3038 2541 gene locus_tag LOCUS_17240 3038 2541 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228194.1 protein_id gnl|my_center|LOCUS_17240 4973 3120 gene locus_tag LOCUS_17250 4973 3120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_17250 5531 5079 gene locus_tag LOCUS_17260 5531 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence0242 506 339 gene locus_tag LOCUS_17270 506 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 517 1815 gene locus_tag LOCUS_17280 517 1815 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_17280 1907 2368 gene locus_tag LOCUS_17290 1907 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17290 2501 2869 gene locus_tag LOCUS_17300 2501 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17300 3168 2890 gene locus_tag LOCUS_17310 3168 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 4234 3188 gene locus_tag LOCUS_17320 gene mtnA 4234 3188 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_17320 4901 4482 gene locus_tag LOCUS_17330 4901 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence0243 3671 693 gene locus_tag LOCUS_17340 3671 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3868 4083 gene locus_tag LOCUS_17350 3868 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 <5619 4031 gene locus_tag LOCUS_17360 <5619 4031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:response regulator >Feature sequence0244 <1 1137 gene locus_tag LOCUS_17370 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393187.1:glycine betaine ABC transporter substrate-binding protein 1622 1224 gene locus_tag LOCUS_17380 1622 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2170 2610 gene locus_tag LOCUS_17390 2170 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2650 2928 gene locus_tag LOCUS_17400 2650 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3144 4847 gene locus_tag LOCUS_17410 gene cruA 3144 4847 CDS product lycopene beta-monocyclase CruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932144.1 protein_id gnl|my_center|LOCUS_17410 5209 5000 gene locus_tag LOCUS_17420 5209 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence0245 2573 174 gene locus_tag LOCUS_17430 2573 174 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089686.1 protein_id gnl|my_center|LOCUS_17430 4669 2627 gene locus_tag LOCUS_17440 4669 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 5565 4771 gene locus_tag LOCUS_17450 5565 4771 CDS product PGL/p-HBAD biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003918527.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence0246 27 1685 gene locus_tag LOCUS_17460 27 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1972 1712 gene locus_tag LOCUS_17470 1972 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1865 2686 gene locus_tag LOCUS_17480 1865 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3883 2786 gene locus_tag LOCUS_17490 3883 2786 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 protein_id gnl|my_center|LOCUS_17490 4893 4144 gene locus_tag LOCUS_17500 4893 4144 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938748.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence0247 1643 3217 gene locus_tag LOCUS_17510 1643 3217 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393478.1 protein_id gnl|my_center|LOCUS_17510 3198 4151 gene locus_tag LOCUS_17520 3198 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 4183 5511 gene locus_tag LOCUS_17530 4183 5511 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence0248 2236 2886 gene locus_tag LOCUS_17540 2236 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 4631 3156 gene locus_tag LOCUS_17550 gene pap 4631 3156 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_17550 <5559 4897 gene locus_tag LOCUS_17560 <5559 4897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932680.1:RNB domain-containing ribonuclease >Feature sequence0249 590 2323 gene locus_tag LOCUS_17570 590 2323 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_17570 2686 3213 gene locus_tag LOCUS_17580 2686 3213 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948620.1 protein_id gnl|my_center|LOCUS_17580 3459 3241 gene locus_tag LOCUS_17590 3459 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 4364 3456 gene locus_tag LOCUS_17600 4364 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 4539 5327 gene locus_tag LOCUS_17610 4539 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence0250 <1 1627 gene locus_tag LOCUS_17620 <1 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928760.1:transferrin receptor-like dimerization domain-containing protein 1827 4649 gene locus_tag LOCUS_17630 1827 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 4767 5138 gene locus_tag LOCUS_17640 4767 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence0251 1686 688 gene locus_tag LOCUS_17650 1686 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1861 2394 gene locus_tag LOCUS_17660 1861 2394 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143393.1 protein_id gnl|my_center|LOCUS_17660 3740 2532 gene locus_tag LOCUS_17670 3740 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4768 3773 gene locus_tag LOCUS_17680 4768 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 <5543 4981 gene locus_tag LOCUS_17690 <5543 4981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545108.1:preprotein translocase subunit SecA >Feature sequence0252 778 1290 gene locus_tag LOCUS_17700 778 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1312 5049 gene locus_tag LOCUS_17710 1312 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence0253 1337 4714 gene locus_tag LOCUS_17720 1337 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 <5522 4830 gene locus_tag LOCUS_17730 <5522 4830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035498.1:S9 family peptidase >Feature sequence0254 1341 451 gene locus_tag LOCUS_17740 1341 451 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_17740 2775 1432 gene locus_tag LOCUS_17750 2775 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 3163 5361 gene locus_tag LOCUS_17760 3163 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence0255 1245 397 gene locus_tag LOCUS_17770 1245 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2403 1411 gene locus_tag LOCUS_17780 2403 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 2740 4143 gene locus_tag LOCUS_17790 gene amrA 2740 4143 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_17790 4258 4488 gene locus_tag LOCUS_17800 4258 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence0256 354 76 gene locus_tag LOCUS_17810 354 76 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_17810 913 464 gene locus_tag LOCUS_17820 913 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1147 2643 gene locus_tag LOCUS_17830 1147 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3774 2626 gene locus_tag LOCUS_17840 3774 2626 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175116.1 protein_id gnl|my_center|LOCUS_17840 4359 3778 gene locus_tag LOCUS_17850 4359 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4636 4376 gene locus_tag LOCUS_17860 4636 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 <5495 4655 gene locus_tag LOCUS_17870 <5495 4655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040561.1:acyl-CoA dehydrogenase family protein >Feature sequence0257 <1 1113 gene locus_tag LOCUS_17880 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962644.1:M28 family peptidase 1662 1162 gene locus_tag LOCUS_17890 1662 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2251 1787 gene locus_tag LOCUS_17900 2251 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2787 2332 gene locus_tag LOCUS_17910 2787 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence0258 543 785 gene locus_tag LOCUS_17920 543 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2046 919 gene locus_tag LOCUS_17930 2046 919 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243654.1 protein_id gnl|my_center|LOCUS_17930 2185 2257 gene locus_tag LOCUS_t00160 2185 2257 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2358 2432 gene locus_tag LOCUS_t00170 2358 2432 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2492 2935 gene locus_tag LOCUS_17940 2492 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2936 3946 gene locus_tag LOCUS_17950 2936 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence0259 301 59 gene locus_tag LOCUS_17960 301 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1985 378 gene locus_tag LOCUS_17970 1985 378 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109097.1 protein_id gnl|my_center|LOCUS_17970 3183 2005 gene locus_tag LOCUS_17980 gene galK 3183 2005 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_17980 5236 3218 gene locus_tag LOCUS_17990 5236 3218 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence0260 <1 895 gene locus_tag LOCUS_18000 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243652.1:AI-2E family transporter 1103 1513 gene locus_tag LOCUS_18010 1103 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1602 1973 gene locus_tag LOCUS_18020 1602 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3178 2066 gene locus_tag LOCUS_18030 gene carA 3178 2066 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931760.1 protein_id gnl|my_center|LOCUS_18030 4477 3185 gene locus_tag LOCUS_18040 4477 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 4888 4520 gene locus_tag LOCUS_18050 4888 4520 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_18050 <5447 4925 gene locus_tag LOCUS_18060 <5447 4925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870097.1:signal peptidase I >Feature sequence0261 2035 509 gene locus_tag LOCUS_18070 2035 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18070 3417 2032 gene locus_tag LOCUS_18080 3417 2032 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_18080 4022 3846 gene locus_tag LOCUS_18090 4022 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence0262 1793 288 gene locus_tag LOCUS_18100 gene gltX 1793 288 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545418.1 protein_id gnl|my_center|LOCUS_18100 2463 1861 gene locus_tag LOCUS_18110 2463 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2711 2621 gene locus_tag LOCUS_t00180 2711 2621 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2908 3723 gene locus_tag LOCUS_18120 2908 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 4785 3805 gene locus_tag LOCUS_18130 4785 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 5278 4883 gene locus_tag LOCUS_18140 5278 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence0263 <1 643 gene locus_tag LOCUS_18150 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977465.1:pyridoxamine 5'-phosphate oxidase family protein 754 1683 gene locus_tag LOCUS_18160 754 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 2160 2660 gene locus_tag LOCUS_18170 2160 2660 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_18170 2827 3420 gene locus_tag LOCUS_18180 2827 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3506 4582 gene locus_tag LOCUS_18190 3506 4582 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence0264 812 135 gene locus_tag LOCUS_18200 gene lipB 812 135 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_18200 881 1477 gene locus_tag LOCUS_18210 881 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1558 3210 gene locus_tag LOCUS_18220 1558 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 4467 3253 gene locus_tag LOCUS_18230 4467 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 <5407 4814 gene locus_tag LOCUS_18240 <5407 4814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838096.1:OmpA family protein >Feature sequence0265 <1 1854 gene locus_tag LOCUS_18250 <1 1854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941319.1:ATP-dependent chaperone ClpB 1948 2400 gene locus_tag LOCUS_18260 1948 2400 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173658.1 protein_id gnl|my_center|LOCUS_18260 2523 3230 gene locus_tag LOCUS_18270 gene grpE 2523 3230 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392121.1 protein_id gnl|my_center|LOCUS_18270 3282 4913 gene locus_tag LOCUS_18280 gene groL 3282 4913 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence0266 2444 1284 gene locus_tag LOCUS_18290 2444 1284 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_18290 4162 2843 gene locus_tag LOCUS_18300 4162 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 4696 5232 gene locus_tag LOCUS_18310 4696 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18310 >Feature sequence0267 715 2427 gene locus_tag LOCUS_18320 715 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2688 4742 gene locus_tag LOCUS_18330 2688 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 5124 4981 gene locus_tag LOCUS_18340 5124 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence0268 107 36 gene locus_tag LOCUS_t00190 107 36 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 394 2931 gene locus_tag LOCUS_18350 394 2931 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_18350 3551 3036 gene locus_tag LOCUS_18360 3551 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 3788 5218 gene locus_tag LOCUS_18370 gene der 3788 5218 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence0269 <1 2891 gene locus_tag LOCUS_18380 <1 2891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880620.1:AMP-binding protein 3160 4269 gene locus_tag LOCUS_18390 3160 4269 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_18390 5218 4274 gene locus_tag LOCUS_18400 5218 4274 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence0270 1174 2883 gene locus_tag LOCUS_18410 1174 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 4579 3032 gene locus_tag LOCUS_18420 gene gpmI 4579 3032 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_18420 4850 4629 gene locus_tag LOCUS_18430 4850 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence0271 <1 1154 gene locus_tag LOCUS_18440 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_082901051.1:type I secretion system permease/ATPase 1427 1597 gene locus_tag LOCUS_18450 1427 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1682 1840 gene locus_tag LOCUS_18460 1682 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2047 2241 gene locus_tag LOCUS_18470 2047 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2334 2525 gene locus_tag LOCUS_18480 2334 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2611 2853 gene locus_tag LOCUS_18490 2611 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2895 3080 gene locus_tag LOCUS_18500 2895 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3145 4263 gene locus_tag LOCUS_18510 3145 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence0272 1344 676 gene locus_tag LOCUS_18520 gene rpoE 1344 676 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_18520 1781 2596 gene locus_tag LOCUS_18530 1781 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2716 3840 gene locus_tag LOCUS_18540 2716 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 4090 5223 gene locus_tag LOCUS_18550 4090 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence0273 306 91 gene locus_tag LOCUS_18560 306 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 1018 359 gene locus_tag LOCUS_18570 1018 359 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_18570 1347 1021 gene locus_tag LOCUS_18580 1347 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1585 2136 gene locus_tag LOCUS_18590 1585 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 2152 2655 gene locus_tag LOCUS_18600 2152 2655 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_18600 2707 3726 gene locus_tag LOCUS_18610 gene rtcA 2707 3726 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827117.1 protein_id gnl|my_center|LOCUS_18610 4995 3772 gene locus_tag LOCUS_18620 4995 3772 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence0274 636 118 gene locus_tag LOCUS_18630 636 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1116 751 gene locus_tag LOCUS_18640 1116 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2252 1488 gene locus_tag LOCUS_18650 2252 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 3587 2436 gene locus_tag LOCUS_18660 3587 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 4786 4031 gene locus_tag LOCUS_18670 4786 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 5080 5280 gene locus_tag LOCUS_18680 5080 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence0275 1722 211 gene locus_tag LOCUS_18690 1722 211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529633.1 protein_id gnl|my_center|LOCUS_18690 2839 1805 gene locus_tag LOCUS_18700 2839 1805 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_18700 4158 2836 gene locus_tag LOCUS_18710 gene deoA 4158 2836 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529628.1 protein_id gnl|my_center|LOCUS_18710 4474 4175 gene locus_tag LOCUS_18720 4474 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 4958 4482 gene locus_tag LOCUS_18730 gene ispF 4958 4482 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404396.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence0276 1970 1263 gene locus_tag LOCUS_18740 1970 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 3072 2434 gene locus_tag LOCUS_18750 3072 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 5105 3330 gene locus_tag LOCUS_18760 gene murJ 5105 3330 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence0277 360 1199 gene locus_tag LOCUS_18770 360 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1553 1281 gene locus_tag LOCUS_18780 1553 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 2150 1590 gene locus_tag LOCUS_18790 2150 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 3173 2154 gene locus_tag LOCUS_18800 3173 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3401 4567 gene locus_tag LOCUS_18810 3401 4567 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879296.1 protein_id gnl|my_center|LOCUS_18810 4676 5005 gene locus_tag LOCUS_18820 4676 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence0278 374 838 gene locus_tag LOCUS_18830 374 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1036 1506 gene locus_tag LOCUS_18840 1036 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1604 1723 gene locus_tag LOCUS_18850 1604 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1794 2270 gene locus_tag LOCUS_18860 1794 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 2361 4472 gene locus_tag LOCUS_18870 2361 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence0279 <1 852 gene locus_tag LOCUS_18880 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149839243.1:DUF6298 domain-containing protein 1509 889 gene locus_tag LOCUS_18890 1509 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 1861 2937 gene locus_tag LOCUS_18900 1861 2937 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225647.1 protein_id gnl|my_center|LOCUS_18900 2934 4838 gene locus_tag LOCUS_18910 2934 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence0280 <1 1230 gene locus_tag LOCUS_18920 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008664668.1:TolC family protein 2283 1489 gene locus_tag LOCUS_18930 2283 1489 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224130.1 protein_id gnl|my_center|LOCUS_18930 2628 3200 gene locus_tag LOCUS_18940 2628 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 3204 3968 gene locus_tag LOCUS_18950 gene bshB1 3204 3968 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015666.1 protein_id gnl|my_center|LOCUS_18950 4889 4083 gene locus_tag LOCUS_18960 4889 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence0281 <1 594 gene locus_tag LOCUS_18970 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546555.1:anthranilate synthase component I 591 1460 gene locus_tag LOCUS_18980 591 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 1476 2060 gene locus_tag LOCUS_18990 1476 2060 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_18990 2071 2313 gene locus_tag LOCUS_19000 2071 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2326 3423 gene locus_tag LOCUS_19010 gene trpD 2326 3423 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_19010 3424 4254 gene locus_tag LOCUS_19020 gene trpC 3424 4254 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531739.1 protein_id gnl|my_center|LOCUS_19020 4261 4890 gene locus_tag LOCUS_19030 4261 4890 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082737.1 protein_id gnl|my_center|LOCUS_19030 5146 4841 gene locus_tag LOCUS_19040 5146 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence0282 <1 577 gene locus_tag LOCUS_19050 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254545.1:N-acetylmuramic acid 6-phosphate etherase 674 1381 gene locus_tag LOCUS_19060 674 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1441 3099 gene locus_tag LOCUS_19070 1441 3099 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_19070 3463 5196 gene locus_tag LOCUS_19080 3463 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence0283 <1 2203 gene locus_tag LOCUS_19090 <1 2203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228715.1:molecular chaperone DnaK 2381 3325 gene locus_tag LOCUS_19100 2381 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence0284 <1 2010 gene locus_tag LOCUS_19110 <1 2010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040502.1:efflux RND transporter permease subunit 2224 4461 gene locus_tag LOCUS_19120 2224 4461 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869185.1 protein_id gnl|my_center|LOCUS_19120 4475 5074 gene locus_tag LOCUS_19130 4475 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence0285 513 1862 gene locus_tag LOCUS_19140 513 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255956.1 protein_id gnl|my_center|LOCUS_19140 1938 2999 gene locus_tag LOCUS_19150 1938 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3654 3031 gene locus_tag LOCUS_19160 3654 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 4304 3702 gene locus_tag LOCUS_19170 4304 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 5164 4511 gene locus_tag LOCUS_19180 5164 4511 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403974.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence0286 2416 662 gene locus_tag LOCUS_19190 2416 662 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257979.1 protein_id gnl|my_center|LOCUS_19190 2631 3443 gene locus_tag LOCUS_19200 2631 3443 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence0287 924 358 gene locus_tag LOCUS_19210 924 358 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence0288 687 103 gene locus_tag LOCUS_19220 687 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1793 972 gene locus_tag LOCUS_19230 1793 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2123 1905 gene locus_tag LOCUS_19240 2123 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2681 2208 gene locus_tag LOCUS_19250 2681 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4304 2706 gene locus_tag LOCUS_19260 4304 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 5071 4409 gene locus_tag LOCUS_19270 5071 4409 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496597.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence0289 1617 1189 gene locus_tag LOCUS_19280 1617 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1695 3737 gene locus_tag LOCUS_19290 1695 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 <5214 3816 gene locus_tag LOCUS_19300 <5214 3816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940682.1:DNA gyrase subunit A >Feature sequence0290 3515 2136 gene locus_tag LOCUS_19310 3515 2136 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_19310 4691 3669 gene locus_tag LOCUS_19320 gene egtD 4691 3669 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027441.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence0291 1856 1128 gene locus_tag LOCUS_19330 1856 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 3064 1931 gene locus_tag LOCUS_19340 3064 1931 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_19340 4419 3139 gene locus_tag LOCUS_19350 4419 3139 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056098.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence0292 1823 1476 gene locus_tag LOCUS_19360 1823 1476 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_19360 2028 3266 gene locus_tag LOCUS_19370 2028 3266 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_19370 3393 4601 gene locus_tag LOCUS_19380 3393 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 4878 5090 gene locus_tag LOCUS_19390 4878 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence0293 480 848 gene locus_tag LOCUS_19400 480 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 994 1407 gene locus_tag LOCUS_19410 994 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1577 1873 gene locus_tag LOCUS_19420 1577 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 1966 4140 gene locus_tag LOCUS_19430 1966 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 4214 4933 gene locus_tag LOCUS_19440 4214 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence0294 >Feature sequence0295 732 22 gene locus_tag LOCUS_19450 732 22 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532623.1 protein_id gnl|my_center|LOCUS_19450 1000 1401 gene locus_tag LOCUS_19460 1000 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2281 1427 gene locus_tag LOCUS_19470 2281 1427 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976385.1 protein_id gnl|my_center|LOCUS_19470 2736 2281 gene locus_tag LOCUS_19480 2736 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 3159 2812 gene locus_tag LOCUS_19490 3159 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 3321 4724 gene locus_tag LOCUS_19500 3321 4724 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226022.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence0296 2925 5048 gene locus_tag LOCUS_19510 2925 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence0297 1126 53 gene locus_tag LOCUS_19520 gene amrS 1126 53 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 protein_id gnl|my_center|LOCUS_19520 1230 2177 gene locus_tag LOCUS_19530 1230 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2191 3744 gene locus_tag LOCUS_19540 2191 3744 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495579.1 protein_id gnl|my_center|LOCUS_19540 3751 4422 gene locus_tag LOCUS_19550 3751 4422 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083722.1 protein_id gnl|my_center|LOCUS_19550 4682 4476 gene locus_tag LOCUS_19560 4682 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence0298 <1 920 gene locus_tag LOCUS_19570 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816905.1:(2E,6E)-farnesyl diphosphate synthase 929 2080 gene locus_tag LOCUS_19580 929 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2307 2840 gene locus_tag LOCUS_19590 2307 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 3842 2925 gene locus_tag LOCUS_19600 3842 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 4476 4186 gene locus_tag LOCUS_19610 4476 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 4918 4499 gene locus_tag LOCUS_19620 4918 4499 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523327.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence0299 <1 1062 gene locus_tag LOCUS_19630 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880939.1:DegQ family serine endoprotease 1385 1726 gene locus_tag LOCUS_19640 1385 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1881 2531 gene locus_tag LOCUS_19650 1881 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2613 2861 gene locus_tag LOCUS_19660 2613 2861 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_19660 2862 3212 gene locus_tag LOCUS_19670 2862 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 3219 3863 gene locus_tag LOCUS_19680 gene udg 3219 3863 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879766.1 protein_id gnl|my_center|LOCUS_19680 3880 4527 gene locus_tag LOCUS_19690 3880 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4697 5098 gene locus_tag LOCUS_19700 4697 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence0300 721 4260 gene locus_tag LOCUS_19710 721 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence0301 320 1351 gene locus_tag LOCUS_19720 320 1351 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108001.1 protein_id gnl|my_center|LOCUS_19720 1859 1443 gene locus_tag LOCUS_19730 1859 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2306 1860 gene locus_tag LOCUS_19740 2306 1860 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 protein_id gnl|my_center|LOCUS_19740 3019 2372 gene locus_tag LOCUS_19750 3019 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3559 3149 gene locus_tag LOCUS_19760 3559 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence0302 1769 828 gene locus_tag LOCUS_19770 gene cpaB 1769 828 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 protein_id gnl|my_center|LOCUS_19770 2341 1814 gene locus_tag LOCUS_19780 2341 1814 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523374.1 protein_id gnl|my_center|LOCUS_19780 2542 2387 gene locus_tag LOCUS_19790 2542 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2822 2667 gene locus_tag LOCUS_19800 2822 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 3169 2915 gene locus_tag LOCUS_19810 3169 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence0303 <1 1391 gene locus_tag LOCUS_19820 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799131.1:EAL domain-containing protein 1403 1996 gene locus_tag LOCUS_19830 1403 1996 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166172348.1 protein_id gnl|my_center|LOCUS_19830 2602 2144 gene locus_tag LOCUS_19840 2602 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 3760 3134 gene locus_tag LOCUS_19850 3760 3134 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_19850 4057 3818 gene locus_tag LOCUS_19860 4057 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 4667 4062 gene locus_tag LOCUS_19870 4667 4062 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence0304 3250 1496 gene locus_tag LOCUS_19880 gene ggt 3250 1496 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_19880 3763 3296 gene locus_tag LOCUS_19890 3763 3296 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_19890 4948 3773 gene locus_tag LOCUS_19900 4948 3773 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence0305 928 596 gene locus_tag LOCUS_19910 928 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1067 1987 gene locus_tag LOCUS_19920 1067 1987 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_19920 1999 2508 gene locus_tag LOCUS_19930 1999 2508 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080739.1 protein_id gnl|my_center|LOCUS_19930 3269 2532 gene locus_tag LOCUS_19940 3269 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 4204 3266 gene locus_tag LOCUS_19950 4204 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 <5104 4294 gene locus_tag LOCUS_19960 <5104 4294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100953.1:cystathionine gamma-synthase >Feature sequence0306 1466 108 gene locus_tag LOCUS_19970 1466 108 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222478.1 protein_id gnl|my_center|LOCUS_19970 2725 1463 gene locus_tag LOCUS_19980 2725 1463 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_19980 3336 2815 gene locus_tag LOCUS_19990 3336 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 4791 3346 gene locus_tag LOCUS_20000 4791 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20000 >Feature sequence0307 2019 742 gene locus_tag LOCUS_20010 2019 742 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_20010 4248 2119 gene locus_tag LOCUS_20020 4248 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence0308 829 1047 gene locus_tag LOCUS_20030 829 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1544 1278 gene locus_tag LOCUS_20040 1544 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2656 1544 gene locus_tag LOCUS_20050 2656 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3685 2660 gene locus_tag LOCUS_20060 3685 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3923 3738 gene locus_tag LOCUS_20070 3923 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 4765 3938 gene locus_tag LOCUS_20080 4765 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence0309 <1 627 gene locus_tag LOCUS_20090 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768338.1:selenide, water dikinase SelD 734 1492 gene locus_tag LOCUS_20100 734 1492 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530032.1 protein_id gnl|my_center|LOCUS_20100 3472 1643 gene locus_tag LOCUS_20110 3472 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 3806 3881 gene locus_tag LOCUS_t00200 3806 3881 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4394 3960 gene locus_tag LOCUS_20120 4394 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 <5072 4485 gene locus_tag LOCUS_20130 <5072 4485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123116.1:ammonia-forming cytochrome c nitrite reductase subunit c552 >Feature sequence0310 2590 3810 gene locus_tag LOCUS_20140 2590 3810 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397428.1 protein_id gnl|my_center|LOCUS_20140 4269 3838 gene locus_tag LOCUS_20150 4269 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 5031 4486 gene locus_tag LOCUS_20160 5031 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence0311 2098 5 gene locus_tag LOCUS_20170 gene pheT 2098 5 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_20170 3315 2221 gene locus_tag LOCUS_20180 gene pheS 3315 2221 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_20180 3725 3345 gene locus_tag LOCUS_20190 gene rplT 3725 3345 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_20190 4107 3838 gene locus_tag LOCUS_20200 4107 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 4816 4190 gene locus_tag LOCUS_20210 4816 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence0312 123 707 gene locus_tag LOCUS_20220 123 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 1094 759 gene locus_tag LOCUS_20230 1094 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1430 1176 gene locus_tag LOCUS_20240 1430 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 3706 1640 gene locus_tag LOCUS_20250 3706 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 4526 3759 gene locus_tag LOCUS_20260 4526 3759 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence0313 1562 1026 gene locus_tag LOCUS_20270 1562 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2317 1559 gene locus_tag LOCUS_20280 2317 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 3510 2473 gene locus_tag LOCUS_20290 3510 2473 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349090.1 protein_id gnl|my_center|LOCUS_20290 4370 3804 gene locus_tag LOCUS_20300 4370 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 <5020 4367 gene locus_tag LOCUS_20310 <5020 4367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943758.1:isoleucine--tRNA ligase >Feature sequence0314 <1 1936 gene locus_tag LOCUS_20320 <1 1936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583095.1:DUF3857 domain-containing protein 2026 3039 gene locus_tag LOCUS_20330 2026 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 3870 3103 gene locus_tag LOCUS_20340 3870 3103 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390116.1 protein_id gnl|my_center|LOCUS_20340 <5010 3925 gene locus_tag LOCUS_20350 <5010 3925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275477.1:phospholipase D-like domain-containing protein >Feature sequence0315 1663 818 gene locus_tag LOCUS_20360 1663 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2475 1660 gene locus_tag LOCUS_20370 2475 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 3311 2493 gene locus_tag LOCUS_20380 3311 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence0316 814 1338 gene locus_tag LOCUS_20390 814 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1540 1842 gene locus_tag LOCUS_20400 1540 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2098 4044 gene locus_tag LOCUS_20410 2098 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 4063 4707 gene locus_tag LOCUS_20420 gene can 4063 4707 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence0317 120 1037 gene locus_tag LOCUS_20430 120 1037 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_20430 1041 2276 gene locus_tag LOCUS_20440 1041 2276 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583299.1 protein_id gnl|my_center|LOCUS_20440 2273 3142 gene locus_tag LOCUS_20450 2273 3142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_20450 3209 3913 gene locus_tag LOCUS_20460 3209 3913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944002.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence0318 562 1392 gene locus_tag LOCUS_20470 562 1392 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392587.1 protein_id gnl|my_center|LOCUS_20470 1548 3014 gene locus_tag LOCUS_20480 gene guaB 1548 3014 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_20480 3533 3054 gene locus_tag LOCUS_20490 3533 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 4610 3537 gene locus_tag LOCUS_20500 4610 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence0319 2 1051 gene locus_tag LOCUS_20510 gene thiO 2 1051 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_20510 1070 2431 gene locus_tag LOCUS_20520 1070 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2525 3784 gene locus_tag LOCUS_20530 2525 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 3878 4558 gene locus_tag LOCUS_20540 3878 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence0320 2432 264 gene locus_tag LOCUS_20550 2432 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2793 2461 gene locus_tag LOCUS_20560 2793 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 3148 2831 gene locus_tag LOCUS_20570 3148 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 3973 3167 gene locus_tag LOCUS_20580 gene gvpL 3973 3167 CDS product gas vesicle protein GvpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890528.1 protein_id gnl|my_center|LOCUS_20580 4265 4798 gene locus_tag LOCUS_20590 4265 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761769.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence0321 439 1014 gene locus_tag LOCUS_20600 439 1014 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_20600 2672 1092 gene locus_tag LOCUS_20610 2672 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 4213 3005 gene locus_tag LOCUS_20620 4213 3005 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_20620 4560 4829 gene locus_tag LOCUS_20630 4560 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence0322 572 84 gene locus_tag LOCUS_20640 572 84 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_20640 1844 573 gene locus_tag LOCUS_20650 1844 573 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_20650 3181 1847 gene locus_tag LOCUS_20660 gene sufD 3181 1847 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_20660 4042 3269 gene locus_tag LOCUS_20670 gene sufC 4042 3269 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_20670 <4960 4138 gene locus_tag LOCUS_20680 <4960 4138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141370.1:Fe-S cluster assembly protein SufB >Feature sequence0323 488 1012 gene locus_tag LOCUS_20690 488 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20690 1019 2842 gene locus_tag LOCUS_20700 1019 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20700 3396 2932 gene locus_tag LOCUS_20710 3396 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 4246 3872 gene locus_tag LOCUS_20720 4246 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 4642 4869 gene locus_tag LOCUS_20730 4642 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence0324 3179 4051 gene locus_tag LOCUS_20740 3179 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 <4950 4168 gene locus_tag LOCUS_20750 <4950 4168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933683.1:DNA mismatch repair endonuclease MutL >Feature sequence0325 1134 91 gene locus_tag LOCUS_20760 1134 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1510 2448 gene locus_tag LOCUS_20770 1510 2448 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141662.1 protein_id gnl|my_center|LOCUS_20770 3005 2544 gene locus_tag LOCUS_20780 3005 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 4631 3243 gene locus_tag LOCUS_20790 4631 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence0326 <1 1292 gene locus_tag LOCUS_20800 <1 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257772.1:amidohydrolase family protein 1603 2790 gene locus_tag LOCUS_20810 1603 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 3109 2873 gene locus_tag LOCUS_20820 3109 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 <4931 3114 gene locus_tag LOCUS_20830 <4931 3114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326708.1:ferrous iron transporter B >Feature sequence0327 <1 1244 gene locus_tag LOCUS_20840 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942540.1:CTP synthase 1273 1443 gene locus_tag LOCUS_20850 1273 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 1681 3963 gene locus_tag LOCUS_20860 1681 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 3960 4820 gene locus_tag LOCUS_20870 gene kdsA 3960 4820 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence0328 2494 2285 gene locus_tag LOCUS_20880 2494 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2763 2635 gene locus_tag LOCUS_20890 2763 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3438 3671 gene locus_tag LOCUS_20900 3438 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3677 3913 gene locus_tag LOCUS_20910 3677 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 3939 4148 gene locus_tag LOCUS_20920 3939 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence0329 3431 1845 gene locus_tag LOCUS_20930 3431 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence0330 1829 1329 gene locus_tag LOCUS_20940 1829 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2471 2040 gene locus_tag LOCUS_20950 2471 2040 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975235.1 protein_id gnl|my_center|LOCUS_20950 2645 3301 gene locus_tag LOCUS_20960 2645 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 3390 4784 gene locus_tag LOCUS_20970 3390 4784 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence0331 <1 630 gene locus_tag LOCUS_20980 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225805.1:FadR/GntR family transcriptional regulator 1564 848 gene locus_tag LOCUS_20990 gene eda 1564 848 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_20990 2694 1576 gene locus_tag LOCUS_21000 2694 1576 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_21000 4071 2695 gene locus_tag LOCUS_21010 4071 2695 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_21010 <4907 4167 gene locus_tag LOCUS_21020 <4907 4167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919366.1:2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD >Feature sequence0332 974 231 gene locus_tag LOCUS_21030 gene pgl 974 231 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_21030 1970 981 gene locus_tag LOCUS_21040 gene glk 1970 981 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_21040 3162 2011 gene locus_tag LOCUS_21050 3162 2011 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256406.1 protein_id gnl|my_center|LOCUS_21050 4662 3259 gene locus_tag LOCUS_21060 gene zwf 4662 3259 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence0333 1563 448 gene locus_tag LOCUS_21070 1563 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 1861 2430 gene locus_tag LOCUS_21080 1861 2430 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence0334 205 1371 gene locus_tag LOCUS_21090 205 1371 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 protein_id gnl|my_center|LOCUS_21090 1507 2304 gene locus_tag LOCUS_21100 1507 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 3113 2397 gene locus_tag LOCUS_21110 3113 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 4078 3179 gene locus_tag LOCUS_21120 gene xerD 4078 3179 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_21120 <4871 4206 gene locus_tag LOCUS_21130 <4871 4206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027385545.1:ATPase >Feature sequence0335 298 912 gene locus_tag LOCUS_21140 298 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 993 1214 gene locus_tag LOCUS_21150 993 1214 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770699.1 protein_id gnl|my_center|LOCUS_21150 1284 2474 gene locus_tag LOCUS_21160 1284 2474 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_21160 2949 2611 gene locus_tag LOCUS_21170 2949 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3760 3008 gene locus_tag LOCUS_21180 3760 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 <4869 3834 gene locus_tag LOCUS_21190 <4869 3834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338051.1:NAD-dependent dihydropyrimidine dehydrogenase subunit PreA >Feature sequence0336 1725 667 gene locus_tag LOCUS_21200 1725 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2068 2355 gene locus_tag LOCUS_21210 2068 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence0337 127 624 gene locus_tag LOCUS_21220 127 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 633 1001 gene locus_tag LOCUS_21230 633 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975153.1 protein_id gnl|my_center|LOCUS_21230 1017 1670 gene locus_tag LOCUS_21240 1017 1670 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_21240 1698 3563 gene locus_tag LOCUS_21250 1698 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence0338 <1 738 gene locus_tag LOCUS_21260 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034350019.1:UV DNA damage repair endonuclease UvsE 878 1855 gene locus_tag LOCUS_21270 878 1855 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_21270 1962 2618 gene locus_tag LOCUS_21280 1962 2618 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_21280 2632 3240 gene locus_tag LOCUS_21290 2632 3240 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636477.1 protein_id gnl|my_center|LOCUS_21290 3315 4250 gene locus_tag LOCUS_21300 3315 4250 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224412629.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence0339 912 679 gene locus_tag LOCUS_21310 912 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2135 924 gene locus_tag LOCUS_21320 2135 924 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_21320 3640 2234 gene locus_tag LOCUS_21330 gene lpdA 3640 2234 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258694.1 protein_id gnl|my_center|LOCUS_21330 4232 3810 gene locus_tag LOCUS_21340 4232 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 4335 4703 gene locus_tag LOCUS_21350 4335 4703 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence0340 1082 654 gene locus_tag LOCUS_21360 1082 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 3235 1310 gene locus_tag LOCUS_21370 3235 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 4080 3247 gene locus_tag LOCUS_21380 4080 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 <4836 4212 gene locus_tag LOCUS_21390 <4836 4212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986707.1:oligopeptide transporter, OPT family >Feature sequence0341 <1 1749 gene locus_tag LOCUS_21400 <1 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963830.1:excinuclease ABC subunit UvrC 2198 1797 gene locus_tag LOCUS_21410 2198 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 3207 2308 gene locus_tag LOCUS_21420 3207 2308 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679543.1 protein_id gnl|my_center|LOCUS_21420 3385 3939 gene locus_tag LOCUS_21430 3385 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence0342 306 1937 gene locus_tag LOCUS_21440 306 1937 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_21440 2217 3041 gene locus_tag LOCUS_21450 2217 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 3265 3870 gene locus_tag LOCUS_21460 3265 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 3907 4029 gene locus_tag LOCUS_21470 3907 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4487 4086 gene locus_tag LOCUS_21480 4487 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence0343 443 2281 gene locus_tag LOCUS_21490 443 2281 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_21490 2766 2377 gene locus_tag LOCUS_21500 2766 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 3017 3883 gene locus_tag LOCUS_21510 3017 3883 CDS product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence0344 667 593 gene locus_tag LOCUS_t00210 667 593 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1608 676 gene locus_tag LOCUS_21520 gene ispE 1608 676 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933161.1 protein_id gnl|my_center|LOCUS_21520 2351 1680 gene locus_tag LOCUS_21530 2351 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 4732 2651 gene locus_tag LOCUS_21540 4732 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence0345 1233 3140 gene locus_tag LOCUS_21550 1233 3140 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409258.1 protein_id gnl|my_center|LOCUS_21550 4596 3520 gene locus_tag LOCUS_21560 4596 3520 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence0346 110 373 gene locus_tag LOCUS_21570 110 373 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869965.1 protein_id gnl|my_center|LOCUS_21570 648 1709 gene locus_tag LOCUS_21580 648 1709 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_21580 2678 1869 gene locus_tag LOCUS_21590 2678 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 3199 2699 gene locus_tag LOCUS_21600 3199 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3273 3800 gene locus_tag LOCUS_21610 3273 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence0347 700 401 gene locus_tag LOCUS_21620 700 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 1642 767 gene locus_tag LOCUS_21630 1642 767 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250141.1 protein_id gnl|my_center|LOCUS_21630 2379 1639 gene locus_tag LOCUS_21640 gene cmk 2379 1639 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110867.1 protein_id gnl|my_center|LOCUS_21640 3652 2507 gene locus_tag LOCUS_21650 gene hemW 3652 2507 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_21650 <4784 3768 gene locus_tag LOCUS_21660 <4784 3768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230328.1:dipeptidase >Feature sequence0348 886 731 gene locus_tag LOCUS_21670 886 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 2061 1075 gene locus_tag LOCUS_21680 2061 1075 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_21680 2266 3528 gene locus_tag LOCUS_21690 gene pfp 2266 3528 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083005.1 protein_id gnl|my_center|LOCUS_21690 3555 3755 gene locus_tag LOCUS_21700 3555 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence0349 417 1829 gene locus_tag LOCUS_21710 417 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2109 4481 gene locus_tag LOCUS_21720 2109 4481 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence0350 244 2445 gene locus_tag LOCUS_21730 244 2445 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_21730 2722 3108 gene locus_tag LOCUS_21740 2722 3108 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_21740 3445 3251 gene locus_tag LOCUS_21750 gene rpmB 3445 3251 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193812.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence0351 2300 1956 gene locus_tag LOCUS_21760 2300 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 4604 2361 gene locus_tag LOCUS_21770 4604 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence0352 2096 2323 gene locus_tag LOCUS_21780 2096 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2481 2618 gene locus_tag LOCUS_21790 2481 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2623 3546 gene locus_tag LOCUS_21800 2623 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence0353 <1 658 gene locus_tag LOCUS_21810 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000195733.1:phenylalanine 4-monooxygenase 1796 636 gene locus_tag LOCUS_21820 1796 636 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335445.1 protein_id gnl|my_center|LOCUS_21820 2365 1793 gene locus_tag LOCUS_21830 gene purE 2365 1793 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_21830 3396 2371 gene locus_tag LOCUS_21840 3396 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 3948 3424 gene locus_tag LOCUS_21850 3948 3424 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167131.1 protein_id gnl|my_center|LOCUS_21850 4748 3966 gene locus_tag LOCUS_21860 4748 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence0354 1381 3528 gene locus_tag LOCUS_21870 gene ppk1 1381 3528 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_21870 3558 4571 gene locus_tag LOCUS_21880 3558 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence0355 1409 1681 gene locus_tag LOCUS_21890 1409 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2002 2313 gene locus_tag LOCUS_21900 2002 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2480 3223 gene locus_tag LOCUS_21910 2480 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence0356 <1 885 gene locus_tag LOCUS_21920 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942684.1:sigma-54 dependent transcriptional regulator 931 1491 gene locus_tag LOCUS_21930 931 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1662 2048 gene locus_tag LOCUS_21940 1662 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2172 2744 gene locus_tag LOCUS_21950 2172 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence0357 120 638 gene locus_tag LOCUS_21960 120 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1126 2160 gene locus_tag LOCUS_21970 1126 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2394 3005 gene locus_tag LOCUS_21980 2394 3005 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_21980 3022 4032 gene locus_tag LOCUS_21990 gene trpS 3022 4032 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862742.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence0358 387 1346 gene locus_tag LOCUS_22000 387 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 1467 2612 gene locus_tag LOCUS_22010 1467 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 3582 2695 gene locus_tag LOCUS_22020 gene argB 3582 2695 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_22020 <4724 3754 gene locus_tag LOCUS_22030 <4724 3754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037393.1:N-acetylornithine carbamoyltransferase >Feature sequence0359 1947 148 gene locus_tag LOCUS_22040 1947 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098076974.1 protein_id gnl|my_center|LOCUS_22040 3100 2129 gene locus_tag LOCUS_22050 3100 2129 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_22050 4436 3117 gene locus_tag LOCUS_22060 4436 3117 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence0360 3144 3806 gene locus_tag LOCUS_22070 3144 3806 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597710.1 protein_id gnl|my_center|LOCUS_22070 <4710 3937 gene locus_tag LOCUS_22080 <4710 3937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026955981.1:long-chain fatty acid--CoA ligase >Feature sequence0361 791 3742 gene locus_tag LOCUS_22090 791 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence0362 1190 1756 gene locus_tag LOCUS_22100 gene pyrR 1190 1756 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172875.1 protein_id gnl|my_center|LOCUS_22100 1822 2901 gene locus_tag LOCUS_22110 1822 2901 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_22110 2904 4211 gene locus_tag LOCUS_22120 2904 4211 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence0363 880 410 gene locus_tag LOCUS_22130 880 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2009 1815 gene locus_tag LOCUS_22140 2009 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2334 2122 gene locus_tag LOCUS_22150 2334 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3838 2384 gene locus_tag LOCUS_22160 gene hemG 3838 2384 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_22160 <4656 4021 gene locus_tag LOCUS_22170 <4656 4021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121766.1:ferrochelatase >Feature sequence0364 1427 909 gene locus_tag LOCUS_22180 1427 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2637 1450 gene locus_tag LOCUS_22190 2637 1450 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459196.1 protein_id gnl|my_center|LOCUS_22190 2784 3926 gene locus_tag LOCUS_22200 2784 3926 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258545.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence0365 >Feature sequence0366 1361 939 gene locus_tag LOCUS_22210 1361 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 1668 2447 gene locus_tag LOCUS_22220 1668 2447 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence0367 2447 3142 gene locus_tag LOCUS_22230 2447 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 3183 3881 gene locus_tag LOCUS_22240 3183 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence0368 1487 303 gene locus_tag LOCUS_22250 gene lpxB 1487 303 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_22250 1811 3748 gene locus_tag LOCUS_22260 1811 3748 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941908.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence0369 609 1004 gene locus_tag LOCUS_22270 609 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 1029 2294 gene locus_tag LOCUS_22280 1029 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2326 3498 gene locus_tag LOCUS_22290 2326 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 3523 4407 gene locus_tag LOCUS_22300 3523 4407 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017276633.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence0370 <1 2406 gene locus_tag LOCUS_22310 <1 2406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_234782358.1:adenylate/guanylate cyclase domain-containing protein 2826 2590 gene locus_tag LOCUS_22320 2826 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3149 2919 gene locus_tag LOCUS_22330 3149 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence0371 2137 1832 gene locus_tag LOCUS_22340 2137 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2553 2191 gene locus_tag LOCUS_22350 gene clpS 2553 2191 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440419.1 protein_id gnl|my_center|LOCUS_22350 2653 3303 gene locus_tag LOCUS_22360 gene aat 2653 3303 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_22360 4187 3306 gene locus_tag LOCUS_22370 4187 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence0372 2677 359 gene locus_tag LOCUS_22380 2677 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 4157 2970 gene locus_tag LOCUS_22390 4157 2970 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence0373 1137 2483 gene locus_tag LOCUS_22400 1137 2483 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120884.1 protein_id gnl|my_center|LOCUS_22400 4193 2769 gene locus_tag LOCUS_22410 4193 2769 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839714.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence0374 1479 2336 gene locus_tag LOCUS_22420 gene rfbD 1479 2336 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893216.1 protein_id gnl|my_center|LOCUS_22420 2480 4495 gene locus_tag LOCUS_22430 2480 4495 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence0375 >Feature sequence0376 1787 1128 gene locus_tag LOCUS_22440 1787 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2644 1715 gene locus_tag LOCUS_22450 2644 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3229 3459 gene locus_tag LOCUS_22460 3229 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 3790 3969 gene locus_tag LOCUS_22470 3790 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 3966 4484 gene locus_tag LOCUS_22480 3966 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence0377 173 2647 gene locus_tag LOCUS_22490 173 2647 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 protein_id gnl|my_center|LOCUS_22490 2662 3246 gene locus_tag LOCUS_22500 2662 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 3277 3771 gene locus_tag LOCUS_22510 3277 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 3768 4247 gene locus_tag LOCUS_22520 gene ybaK 3768 4247 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943709.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence0378 305 1198 gene locus_tag LOCUS_22530 305 1198 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_22530 1493 1417 gene locus_tag LOCUS_t00220 1493 1417 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1731 2660 gene locus_tag LOCUS_22540 gene hemB 1731 2660 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_22540 3090 2740 gene locus_tag LOCUS_22550 3090 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 3531 3313 gene locus_tag LOCUS_22560 3531 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 <4560 3808 gene locus_tag LOCUS_22570 <4560 3808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937806.1:selenocysteine-specific translation elongation factor >Feature sequence0379 <1 1305 gene locus_tag LOCUS_22580 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404599.1:phosphoribosylamine--glycine ligase 1614 2303 gene locus_tag LOCUS_22590 gene pspA 1614 2303 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057162.1 protein_id gnl|my_center|LOCUS_22590 2346 3185 gene locus_tag LOCUS_22600 2346 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 4349 3342 gene locus_tag LOCUS_22610 gene hslO 4349 3342 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence0380 1195 626 gene locus_tag LOCUS_22620 1195 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3077 1437 gene locus_tag LOCUS_22630 3077 1437 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_22630 3440 4102 gene locus_tag LOCUS_22640 3440 4102 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894969.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence0381 194 829 gene locus_tag LOCUS_22650 194 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1293 880 gene locus_tag LOCUS_22660 1293 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 1628 2173 gene locus_tag LOCUS_22670 1628 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 3066 2419 gene locus_tag LOCUS_22680 3066 2419 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_22680 3229 3699 gene locus_tag LOCUS_22690 3229 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 3880 4203 gene locus_tag LOCUS_22700 gene gatC 3880 4203 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence0382 1044 583 gene locus_tag LOCUS_22710 1044 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1513 1148 gene locus_tag LOCUS_22720 1513 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 1732 2682 gene locus_tag LOCUS_22730 1732 2682 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence0383 <1 1073 gene locus_tag LOCUS_22740 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113242.1:heme d1 biosynthesis radical SAM protein NirJ 1124 2323 gene locus_tag LOCUS_22750 1124 2323 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_22750 2446 3195 gene locus_tag LOCUS_22760 gene fabG 2446 3195 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_22760 3410 3871 gene locus_tag LOCUS_22770 3410 3871 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391610.1 protein_id gnl|my_center|LOCUS_22770 4265 3972 gene locus_tag LOCUS_22780 4265 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence0384 1002 391 gene locus_tag LOCUS_22790 1002 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2096 1476 gene locus_tag LOCUS_22800 2096 1476 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_22800 3547 2372 gene locus_tag LOCUS_22810 3547 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22810 <4524 3946 gene locus_tag LOCUS_22820 <4524 3946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921961.1:redoxin domain-containing protein >Feature sequence0385 2482 8 gene locus_tag LOCUS_22830 2482 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2778 3434 gene locus_tag LOCUS_22840 2778 3434 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_22840 3447 4232 gene locus_tag LOCUS_22850 3447 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence0386 766 395 gene locus_tag LOCUS_22860 766 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 1326 1021 gene locus_tag LOCUS_22870 1326 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 1511 2446 gene locus_tag LOCUS_22880 1511 2446 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108987323.1 protein_id gnl|my_center|LOCUS_22880 2443 3468 gene locus_tag LOCUS_22890 2443 3468 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053082.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence0387 <1 665 gene locus_tag LOCUS_22900 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275486.1:YSC84-related protein 735 1526 gene locus_tag LOCUS_22910 735 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1733 1924 gene locus_tag LOCUS_22920 1733 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1999 2706 gene locus_tag LOCUS_22930 1999 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2937 3788 gene locus_tag LOCUS_22940 2937 3788 CDS product IS1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081285673.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence0388 194 583 gene locus_tag LOCUS_22950 194 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 1786 725 gene locus_tag LOCUS_22960 1786 725 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_22960 3878 1941 gene locus_tag LOCUS_22970 gene speA 3878 1941 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783873.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence0389 854 4360 gene locus_tag LOCUS_22980 854 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence0390 549 722 gene locus_tag LOCUS_22990 549 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1923 2387 gene locus_tag LOCUS_23000 1923 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence0391 3574 2321 gene locus_tag LOCUS_23010 3574 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 <4439 3859 gene locus_tag LOCUS_23020 <4439 3859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942526.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence0392 1266 841 gene locus_tag LOCUS_23030 gene ybeY 1266 841 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430894.1 protein_id gnl|my_center|LOCUS_23030 <4434 1317 gene locus_tag LOCUS_23040 <4434 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028328048.1:SNF2-related protein >Feature sequence0393 <1 1693 gene locus_tag LOCUS_23050 <1 1693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860915.1:sodium:solute symporter 2748 1801 gene locus_tag LOCUS_23060 2748 1801 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_23060 2994 3872 gene locus_tag LOCUS_23070 gene proC 2994 3872 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_23070 4185 3880 gene locus_tag LOCUS_23080 4185 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence0394 3772 1262 gene locus_tag LOCUS_23090 3772 1262 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_23090 4330 3791 gene locus_tag LOCUS_23100 4330 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence0395 1311 1078 gene locus_tag LOCUS_23110 1311 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 1615 1424 gene locus_tag LOCUS_23120 1615 1424 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_23120 <4419 2184 gene locus_tag LOCUS_23130 <4419 2184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876334.1:ABC transporter permease >Feature sequence0396 1678 1298 gene locus_tag LOCUS_23140 1678 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2243 1857 gene locus_tag LOCUS_23150 2243 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 3217 3627 gene locus_tag LOCUS_23160 3217 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3700 4008 gene locus_tag LOCUS_23170 3700 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence0397 <4413 2881 gene locus_tag LOCUS_23180 <4413 2881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942479.1:type I glutamate--ammonia ligase >Feature sequence0398 481 215 gene locus_tag LOCUS_23190 481 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 647 3355 gene locus_tag LOCUS_23200 gene pepN 647 3355 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071313.1 protein_id gnl|my_center|LOCUS_23200 3420 4004 gene locus_tag LOCUS_23210 3420 4004 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence0399 3 347 gene locus_tag LOCUS_23220 3 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 493 1308 gene locus_tag LOCUS_23230 493 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 1454 2449 gene locus_tag LOCUS_23240 1454 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2568 3035 gene locus_tag LOCUS_23250 gene mscL 2568 3035 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_23250 3836 3213 gene locus_tag LOCUS_23260 gene lexA 3836 3213 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence0400 <1 782 gene locus_tag LOCUS_23270 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_203473432.1:type I DNA topoisomerase 891 2714 gene locus_tag LOCUS_23280 891 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 >Feature sequence0401 1306 1848 gene locus_tag LOCUS_23290 1306 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence0402 1127 465 gene locus_tag LOCUS_23300 1127 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 1331 3739 gene locus_tag LOCUS_23310 1331 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence0403 <1 1079 gene locus_tag LOCUS_23320 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021623.1:tetratricopeptide repeat protein 1234 1746 gene locus_tag LOCUS_23330 1234 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 1865 3079 gene locus_tag LOCUS_23340 1865 3079 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056882.1 protein_id gnl|my_center|LOCUS_23340 3149 3718 gene locus_tag LOCUS_23350 3149 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 3725 4351 gene locus_tag LOCUS_23360 3725 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence0404 86 319 gene locus_tag LOCUS_23370 86 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 316 471 gene locus_tag LOCUS_23380 316 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 459 704 gene locus_tag LOCUS_23390 459 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 725 1150 gene locus_tag LOCUS_23400 725 1150 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231280.1 protein_id gnl|my_center|LOCUS_23400 1169 2044 gene locus_tag LOCUS_23410 1169 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2441 2067 gene locus_tag LOCUS_23420 2441 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 <4374 2593 gene locus_tag LOCUS_23430 <4374 2593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008671701.1:serine hydrolase >Feature sequence0405 153 1031 gene locus_tag LOCUS_23440 153 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 1046 2107 gene locus_tag LOCUS_23450 1046 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 3908 2121 gene locus_tag LOCUS_23460 3908 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence0406 125 1267 gene locus_tag LOCUS_23470 125 1267 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_23470 1912 1310 gene locus_tag LOCUS_23480 1912 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 3778 1997 gene locus_tag LOCUS_23490 3778 1997 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence0407 2335 2763 gene locus_tag LOCUS_23500 2335 2763 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703648.1 protein_id gnl|my_center|LOCUS_23500 2805 4295 gene locus_tag LOCUS_23510 2805 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence0408 327 1010 gene locus_tag LOCUS_23520 327 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 1206 3590 gene locus_tag LOCUS_23530 1206 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 3645 4325 gene locus_tag LOCUS_23540 3645 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence0409 1751 561 gene locus_tag LOCUS_23550 1751 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 3460 1874 gene locus_tag LOCUS_23560 3460 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 4103 3681 gene locus_tag LOCUS_23570 4103 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence0410 <1 1261 gene locus_tag LOCUS_23580 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392405.1:NFACT RNA binding domain-containing protein 1369 2676 gene locus_tag LOCUS_23590 gene hemL 1369 2676 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence0411 448 1587 gene locus_tag LOCUS_23600 448 1587 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_23600 1741 2574 gene locus_tag LOCUS_23610 1741 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence0412 1048 329 gene locus_tag LOCUS_23620 gene ubiE 1048 329 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_23620 2718 1174 gene locus_tag LOCUS_23630 2718 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence0413 1075 1333 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgtcgctcatcagaacgccg 3395 3634 gene locus_tag LOCUS_23640 3395 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 4213 3671 gene locus_tag LOCUS_23650 4213 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence0414 527 1369 gene locus_tag LOCUS_23660 527 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2295 1366 gene locus_tag LOCUS_23670 2295 1366 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266853.1 protein_id gnl|my_center|LOCUS_23670 2468 3538 gene locus_tag LOCUS_23680 2468 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence0415 <1 1235 gene locus_tag LOCUS_23690 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:EAL domain-containing protein 1328 1729 gene locus_tag LOCUS_23700 1328 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1723 1941 gene locus_tag LOCUS_23710 1723 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence0416 3 728 gene locus_tag LOCUS_23720 3 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 783 1607 gene locus_tag LOCUS_23730 783 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 1951 1688 gene locus_tag LOCUS_23740 1951 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2539 2009 gene locus_tag LOCUS_23750 2539 2009 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143719.1 protein_id gnl|my_center|LOCUS_23750 3547 2642 gene locus_tag LOCUS_23760 gene pip 3547 2642 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_23760 <4303 3682 gene locus_tag LOCUS_23770 <4303 3682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541081.1:ComF family protein >Feature sequence0417 1626 268 gene locus_tag LOCUS_23780 1626 268 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_23780 2636 1641 gene locus_tag LOCUS_23790 2636 1641 CDS product putative capsular polysaccharide synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478193.1 protein_id gnl|my_center|LOCUS_23790 3491 2718 gene locus_tag LOCUS_23800 3491 2718 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447223.1 protein_id gnl|my_center|LOCUS_23800 3894 3577 gene locus_tag LOCUS_23810 3894 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence0418 1658 3364 gene locus_tag LOCUS_23820 1658 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 >Feature sequence0419 <1 546 gene locus_tag LOCUS_23830 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014506491.1:ATP-binding protein 596 1579 gene locus_tag LOCUS_23840 596 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1790 2971 gene locus_tag LOCUS_23850 gene tgt 1790 2971 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_23850 3183 3494 gene locus_tag LOCUS_23860 3183 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence0420 1718 123 gene locus_tag LOCUS_23870 1718 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 3757 2144 gene locus_tag LOCUS_23880 3757 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 <4287 3754 gene locus_tag LOCUS_23890 <4287 3754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405200.1:response regulator transcription factor >Feature sequence0421 2168 1746 gene locus_tag LOCUS_23900 2168 1746 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_23900 2898 2158 gene locus_tag LOCUS_23910 2898 2158 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_23910 3389 2889 gene locus_tag LOCUS_23920 3389 2889 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271000.1 protein_id gnl|my_center|LOCUS_23920 4038 3412 gene locus_tag LOCUS_23930 4038 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence0422 3 437 gene locus_tag LOCUS_23940 3 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 2787 628 gene locus_tag LOCUS_23950 2787 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 3527 3195 gene locus_tag LOCUS_23960 3527 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence0423 1597 254 gene locus_tag LOCUS_23970 1597 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1876 1634 gene locus_tag LOCUS_23980 1876 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2973 1888 gene locus_tag LOCUS_23990 2973 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022977.1 protein_id gnl|my_center|LOCUS_23990 3867 3640 gene locus_tag LOCUS_24000 3867 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 4202 3936 gene locus_tag LOCUS_24010 4202 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence0424 1068 1547 gene locus_tag LOCUS_24020 1068 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2265 1675 gene locus_tag LOCUS_24030 2265 1675 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence0425 1009 605 gene locus_tag LOCUS_24040 1009 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2839 1244 gene locus_tag LOCUS_24050 2839 1244 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_24050 3514 2927 gene locus_tag LOCUS_24060 3514 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 <4280 3558 gene locus_tag LOCUS_24070 <4280 3558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941018.1:NADH-quinone oxidoreductase subunit M >Feature sequence0426 573 214 gene locus_tag LOCUS_24080 573 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 1736 675 gene locus_tag LOCUS_24090 1736 675 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337651.1 protein_id gnl|my_center|LOCUS_24090 2641 2141 gene locus_tag LOCUS_24100 2641 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 3731 2664 gene locus_tag LOCUS_24110 3731 2664 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence0427 <1 1807 gene locus_tag LOCUS_24120 <1 1807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928699.1:TolC family protein 1960 2727 gene locus_tag LOCUS_24130 1960 2727 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_24130 4021 2762 gene locus_tag LOCUS_24140 4021 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence0428 1143 1811 gene locus_tag LOCUS_24150 1143 1811 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 protein_id gnl|my_center|LOCUS_24150 1836 2762 gene locus_tag LOCUS_24160 1836 2762 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_24160 2755 3207 gene locus_tag LOCUS_24170 2755 3207 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence0429 949 2010 gene locus_tag LOCUS_24180 949 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2312 2064 gene locus_tag LOCUS_24190 2312 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence0430 302 9 gene locus_tag LOCUS_24200 302 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 1828 326 gene locus_tag LOCUS_24210 1828 326 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_24210 2829 1888 gene locus_tag LOCUS_24220 2829 1888 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141892.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence0431 <1 1249 gene locus_tag LOCUS_24230 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142441.1:DUF839 domain-containing protein 1689 1318 gene locus_tag LOCUS_24240 1689 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2821 1889 gene locus_tag LOCUS_24250 2821 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 4044 2818 gene locus_tag LOCUS_24260 4044 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence0432 135 1052 gene locus_tag LOCUS_24270 135 1052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932018.1 protein_id gnl|my_center|LOCUS_24270 1148 2293 gene locus_tag LOCUS_24280 1148 2293 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941594.1 protein_id gnl|my_center|LOCUS_24280 2741 3391 gene locus_tag LOCUS_24290 2741 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 <4249 3467 gene locus_tag LOCUS_24300 <4249 3467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065331.1:DUF4956 domain-containing protein >Feature sequence0433 223 792 gene locus_tag LOCUS_24310 223 792 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684454.1 protein_id gnl|my_center|LOCUS_24310 836 1360 gene locus_tag LOCUS_24320 836 1360 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531841.1 protein_id gnl|my_center|LOCUS_24320 1437 1871 gene locus_tag LOCUS_24330 1437 1871 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 protein_id gnl|my_center|LOCUS_24330 2516 1899 gene locus_tag LOCUS_24340 2516 1899 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530055.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence0434 1844 978 gene locus_tag LOCUS_24350 1844 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2401 3375 gene locus_tag LOCUS_24360 2401 3375 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_24360 3474 4184 gene locus_tag LOCUS_24370 3474 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence0435 <1 1612 gene locus_tag LOCUS_24380 <1 1612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140279.1:alkaline phosphatase family protein 1884 2525 gene locus_tag LOCUS_24390 1884 2525 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084189.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence0436 1210 368 gene locus_tag LOCUS_24400 gene prmA 1210 368 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816472.1 protein_id gnl|my_center|LOCUS_24400 2259 1321 gene locus_tag LOCUS_24410 gene era 2259 1321 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460854.1 protein_id gnl|my_center|LOCUS_24410 <4234 2256 gene locus_tag LOCUS_24420 <4234 2256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086850081.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence0437 <1 942 gene locus_tag LOCUS_24430 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940788.1:ATP synthase F1 subunit gamma 1026 1562 gene locus_tag LOCUS_24440 1026 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 1603 2940 gene locus_tag LOCUS_24450 gene fabF 1603 2940 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_24450 2982 3689 gene locus_tag LOCUS_24460 2982 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence0438 2521 2991 gene locus_tag LOCUS_24470 2521 2991 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_24470 3264 3656 gene locus_tag LOCUS_24480 3264 3656 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664252.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence0439 579 1148 gene locus_tag LOCUS_24490 gene pncA 579 1148 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942927.1 protein_id gnl|my_center|LOCUS_24490 1232 2692 gene locus_tag LOCUS_24500 gene pncB 1232 2692 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889531.1 protein_id gnl|my_center|LOCUS_24500 2689 3474 gene locus_tag LOCUS_24510 2689 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence0440 1 249 gene locus_tag LOCUS_24520 1 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 273 458 gene locus_tag LOCUS_24530 273 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 965 729 gene locus_tag LOCUS_24540 965 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1597 1019 gene locus_tag LOCUS_24550 1597 1019 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_24550 3517 1805 gene locus_tag LOCUS_24560 gene rpoD 3517 1805 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence0441 <1 1437 gene locus_tag LOCUS_24570 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257643.1:carbamoyl-phosphate synthase large subunit 2503 2186 gene locus_tag LOCUS_24580 2503 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence0442 634 233 gene locus_tag LOCUS_24590 634 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065761.1 protein_id gnl|my_center|LOCUS_24590 1467 667 gene locus_tag LOCUS_24600 1467 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2451 1672 gene locus_tag LOCUS_24610 2451 1672 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_24610 3936 2623 gene locus_tag LOCUS_24620 3936 2623 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143746.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence0443 1485 253 gene locus_tag LOCUS_24630 1485 253 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_24630 2688 1525 gene locus_tag LOCUS_24640 2688 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 <4180 2902 gene locus_tag LOCUS_24650 <4180 2902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546604.1:sigma-54 dependent transcriptional regulator >Feature sequence0444 <1 1105 gene locus_tag LOCUS_24660 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008672241.1:M28 family peptidase 1309 2766 gene locus_tag LOCUS_24670 1309 2766 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_24670 2999 3457 gene locus_tag LOCUS_24680 gene purE 2999 3457 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_24680 3638 4141 gene locus_tag LOCUS_24690 3638 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence0445 1541 1927 gene locus_tag LOCUS_24700 1541 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 2054 3316 gene locus_tag LOCUS_24710 2054 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 3890 3432 gene locus_tag LOCUS_24720 3890 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence0446 <1 650 gene locus_tag LOCUS_24730 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257821.1:response regulator 1270 740 gene locus_tag LOCUS_24740 1270 740 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_24740 1745 1317 gene locus_tag LOCUS_24750 1745 1317 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143722.1 protein_id gnl|my_center|LOCUS_24750 1867 3702 gene locus_tag LOCUS_24760 1867 3702 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_24760 3695 4129 gene locus_tag LOCUS_24770 3695 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence0447 1505 621 gene locus_tag LOCUS_24780 1505 621 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720501.1 protein_id gnl|my_center|LOCUS_24780 2537 1614 gene locus_tag LOCUS_24790 2537 1614 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338161.1 protein_id gnl|my_center|LOCUS_24790 3516 2689 gene locus_tag LOCUS_24800 3516 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 3965 3495 gene locus_tag LOCUS_24810 3965 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence0448 <1 1047 gene locus_tag LOCUS_24820 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056105.1:DUF87 domain-containing protein 1364 1840 gene locus_tag LOCUS_24830 1364 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 2230 3240 gene locus_tag LOCUS_24840 2230 3240 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 protein_id gnl|my_center|LOCUS_24840 3276 3713 gene locus_tag LOCUS_24850 3276 3713 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 protein_id gnl|my_center|LOCUS_24850 3757 4086 gene locus_tag LOCUS_24860 3757 4086 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258524.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence0449 364 864 gene locus_tag LOCUS_24870 364 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 1153 941 gene locus_tag LOCUS_24880 1153 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 1395 1889 gene locus_tag LOCUS_24890 1395 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence0450 1810 1535 gene locus_tag LOCUS_24900 1810 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence0451 <1 1765 gene locus_tag LOCUS_24910 <1 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257457.1:GAF domain-containing protein 2853 2044 gene locus_tag LOCUS_24920 2853 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 3372 2950 gene locus_tag LOCUS_24930 3372 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 3927 3439 gene locus_tag LOCUS_24940 3927 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence0452 2757 3530 gene locus_tag LOCUS_24950 2757 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence0453 261 629 gene locus_tag LOCUS_24960 261 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 1998 715 gene locus_tag LOCUS_24970 1998 715 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_24970 3071 3853 gene locus_tag LOCUS_24980 3071 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence0454 54 1298 gene locus_tag LOCUS_24990 54 1298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_24990 1357 1737 gene locus_tag LOCUS_25000 1357 1737 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_25000 1821 3056 gene locus_tag LOCUS_25010 1821 3056 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence0455 329 1690 gene locus_tag LOCUS_25020 gene dnaB 329 1690 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_25020 1770 2927 gene locus_tag LOCUS_25030 gene alr 1770 2927 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_25030 3901 3074 gene locus_tag LOCUS_25040 3901 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence0456 446 195 gene locus_tag LOCUS_25050 446 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2095 464 gene locus_tag LOCUS_25060 gene boxC 2095 464 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_25060 2508 2206 gene locus_tag LOCUS_25070 2508 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 <4110 2534 gene locus_tag LOCUS_25080 <4110 2534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257472.1:amidase >Feature sequence0457 526 1092 gene locus_tag LOCUS_25090 526 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 1286 1687 gene locus_tag LOCUS_25100 1286 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence0458 144 575 gene locus_tag LOCUS_25110 144 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2166 661 gene locus_tag LOCUS_25120 gene dhaS 2166 661 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 protein_id gnl|my_center|LOCUS_25120 3511 2330 gene locus_tag LOCUS_25130 3511 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence0459 1332 556 gene locus_tag LOCUS_25140 gene rnc 1332 556 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965055.1 protein_id gnl|my_center|LOCUS_25140 2704 1424 gene locus_tag LOCUS_25150 2704 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 <4100 3103 gene locus_tag LOCUS_25160 <4100 3103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869951.1:penicillin-binding protein 2 >Feature sequence0460 131 715 gene locus_tag LOCUS_25170 131 715 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_25170 1354 794 gene locus_tag LOCUS_25180 1354 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2493 1432 gene locus_tag LOCUS_25190 gene queA 2493 1432 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296565.1 protein_id gnl|my_center|LOCUS_25190 3547 2624 gene locus_tag LOCUS_25200 3547 2624 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence0461 <1 859 gene locus_tag LOCUS_25210 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403516.1:histidine kinase 856 1638 gene locus_tag LOCUS_25220 856 1638 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_25220 2207 1875 gene locus_tag LOCUS_25230 2207 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2842 2450 gene locus_tag LOCUS_25240 2842 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence0462 1561 1106 gene locus_tag LOCUS_25250 gene bcp 1561 1106 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_25250 2347 1616 gene locus_tag LOCUS_25260 2347 1616 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821952.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence0463 43 1131 gene locus_tag LOCUS_25270 gene waaF 43 1131 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_25270 1128 1712 gene locus_tag LOCUS_25280 gene gmhB 1128 1712 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_25280 1716 2795 gene locus_tag LOCUS_25290 gene rfaE1 1716 2795 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_25290 2855 3946 gene locus_tag LOCUS_25300 2855 3946 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence0464 726 538 gene locus_tag LOCUS_25310 726 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25310 1713 850 gene locus_tag LOCUS_25320 1713 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25320 3871 1799 gene locus_tag LOCUS_25330 3871 1799 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459849.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence0465 1029 187 gene locus_tag LOCUS_25340 1029 187 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_25340 2045 1062 gene locus_tag LOCUS_25350 2045 1062 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_25350 2224 3231 gene locus_tag LOCUS_25360 2224 3231 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 protein_id gnl|my_center|LOCUS_25360 <4062 3360 gene locus_tag LOCUS_25370 <4062 3360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003358861.1:WG repeat-containing protein >Feature sequence0466 413 955 gene locus_tag LOCUS_25380 413 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 2673 1012 gene locus_tag LOCUS_25390 2673 1012 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258986.1 protein_id gnl|my_center|LOCUS_25390 4033 2696 gene locus_tag LOCUS_25400 4033 2696 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066958.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence0467 1835 570 gene locus_tag LOCUS_25410 1835 570 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629647.1 protein_id gnl|my_center|LOCUS_25410 2279 1854 gene locus_tag LOCUS_25420 gene umuD 2279 1854 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_25420 2391 3059 gene locus_tag LOCUS_25430 2391 3059 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_25430 3715 4020 gene locus_tag LOCUS_25440 3715 4020 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence0468 2148 397 gene locus_tag LOCUS_25450 2148 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 <4023 2553 gene locus_tag LOCUS_25460 <4023 2553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545466.1:endopeptidase La >Feature sequence0469 691 1290 gene locus_tag LOCUS_25470 691 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1442 3430 gene locus_tag LOCUS_25480 1442 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 3602 3961 gene locus_tag LOCUS_25490 3602 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence0470 1234 1569 gene locus_tag LOCUS_25500 1234 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 2208 2891 gene locus_tag LOCUS_25510 2208 2891 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence0471 <1 1907 gene locus_tag LOCUS_25520 <1 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169337322.1:IPT/TIG domain-containing protein 2387 2019 gene locus_tag LOCUS_25530 2387 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 2567 2968 gene locus_tag LOCUS_25540 2567 2968 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244526.1 protein_id gnl|my_center|LOCUS_25540 3122 3814 gene locus_tag LOCUS_25550 3122 3814 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613246.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence0472 956 501 gene locus_tag LOCUS_25560 gene ykuV 956 501 CDS product thiol-disulfide oxidoreductase YkuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245810.1 protein_id gnl|my_center|LOCUS_25560 1620 1075 gene locus_tag LOCUS_25570 1620 1075 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143150.1 protein_id gnl|my_center|LOCUS_25570 2146 1727 gene locus_tag LOCUS_25580 gene perR 2146 1727 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733104.1 protein_id gnl|my_center|LOCUS_25580 2333 3334 gene locus_tag LOCUS_25590 2333 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 <4006 3405 gene locus_tag LOCUS_25600 <4006 3405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103036621.1:SDR family oxidoreductase >Feature sequence0473 95 1132 gene locus_tag LOCUS_25610 gene holB 95 1132 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_25610 2469 1363 gene locus_tag LOCUS_25620 gene ispG 2469 1363 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_25620 3960 2590 gene locus_tag LOCUS_25630 gene rseP 3960 2590 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence0474 1175 699 gene locus_tag LOCUS_25640 1175 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 1947 1252 gene locus_tag LOCUS_25650 1947 1252 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927102.1 protein_id gnl|my_center|LOCUS_25650 <3998 2002 gene locus_tag LOCUS_25660 <3998 2002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583112.1:ATP-dependent helicase >Feature sequence0475 <1 1218 gene locus_tag LOCUS_25670 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225013.1:BTAD domain-containing putative transcriptional regulator >Feature sequence0476 2644 1304 gene locus_tag LOCUS_25680 2644 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence0477 166 1548 gene locus_tag LOCUS_25690 gene rsmB 166 1548 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_25690 1782 2483 gene locus_tag LOCUS_25700 1782 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2609 3271 gene locus_tag LOCUS_25710 gene rpe 2609 3271 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence0478 337 1014 gene locus_tag LOCUS_25720 337 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 1105 1572 gene locus_tag LOCUS_25730 1105 1572 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258387.1 protein_id gnl|my_center|LOCUS_25730 1651 3000 gene locus_tag LOCUS_25740 1651 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence0479 54 893 gene locus_tag LOCUS_25750 54 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 1000 1545 gene locus_tag LOCUS_25760 1000 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2016 1636 gene locus_tag LOCUS_25770 gene lysM 2016 1636 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369692.1 protein_id gnl|my_center|LOCUS_25770 2401 2033 gene locus_tag LOCUS_25780 2401 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence0480 <1 1425 gene locus_tag LOCUS_25790 <1 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876951.1:peptidylprolyl isomerase 1528 3318 gene locus_tag LOCUS_25800 1528 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence0481 1296 2045 gene locus_tag LOCUS_25810 1296 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3483 2188 gene locus_tag LOCUS_25820 gene pepP 3483 2188 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence0482 <3976 608 gene locus_tag LOCUS_25830 <3976 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944614.1:YncE family protein >Feature sequence0483 916 335 gene locus_tag LOCUS_25840 916 335 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_25840 1069 2397 gene locus_tag LOCUS_25850 1069 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2838 3257 gene locus_tag LOCUS_25860 2838 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 3296 3712 gene locus_tag LOCUS_25870 3296 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence0484 1560 799 gene locus_tag LOCUS_25880 1560 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 1764 3122 gene locus_tag LOCUS_25890 1764 3122 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_25890 3541 3738 gene locus_tag LOCUS_25900 3541 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence0485 761 468 gene locus_tag LOCUS_25910 761 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25910 <3961 1199 gene locus_tag LOCUS_25920 <3961 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919676.1:TonB-dependent receptor >Feature sequence0486 791 1339 gene locus_tag LOCUS_25930 791 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 1336 1881 gene locus_tag LOCUS_25940 gene atpH 1336 1881 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_25940 2015 3592 gene locus_tag LOCUS_25950 gene atpA 2015 3592 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence0487 3 1403 gene locus_tag LOCUS_25960 3 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 1498 2010 gene locus_tag LOCUS_25970 1498 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2106 3320 gene locus_tag LOCUS_25980 2106 3320 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 protein_id gnl|my_center|LOCUS_25980 3343 3747 gene locus_tag LOCUS_25990 3343 3747 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929291.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence0488 3880 3344 gene locus_tag LOCUS_26000 3880 3344 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence0489 2331 25 gene locus_tag LOCUS_26010 2331 25 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966435.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence0490 <1 1465 gene locus_tag LOCUS_26020 <1 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000018463.1:HSP90 family protein 1462 2586 gene locus_tag LOCUS_26030 1462 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570093.1 protein_id gnl|my_center|LOCUS_26030 2756 3355 gene locus_tag LOCUS_26040 2756 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3477 3812 gene locus_tag LOCUS_26050 3477 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence0491 <1 918 gene locus_tag LOCUS_26060 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008547851.1:ATP-dependent Clp protease ATP-binding subunit ClpX 1124 3562 gene locus_tag LOCUS_26070 gene lon 1124 3562 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071918.1 protein_id gnl|my_center|LOCUS_26070 >Feature sequence0492 2216 369 gene locus_tag LOCUS_26080 2216 369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870027.1 protein_id gnl|my_center|LOCUS_26080 2689 2216 gene locus_tag LOCUS_26090 2689 2216 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203920.1 protein_id gnl|my_center|LOCUS_26090 3242 2844 gene locus_tag LOCUS_26100 3242 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence0493 2604 2963 gene locus_tag LOCUS_26110 2604 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence0494 2028 3047 gene locus_tag LOCUS_26120 2028 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence0495 829 539 gene locus_tag LOCUS_26130 829 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 1049 909 gene locus_tag LOCUS_26140 1049 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1647 1069 gene locus_tag LOCUS_26150 1647 1069 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_26150 2858 2439 gene locus_tag LOCUS_26160 2858 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence0496 782 84 gene locus_tag LOCUS_26170 782 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1328 873 gene locus_tag LOCUS_26180 1328 873 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_26180 1538 2491 gene locus_tag LOCUS_26190 1538 2491 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence0497 1976 2797 gene locus_tag LOCUS_26200 1976 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 3520 2924 gene locus_tag LOCUS_26210 3520 2924 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909445.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence0498 1472 1080 gene locus_tag LOCUS_26220 1472 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2371 1508 gene locus_tag LOCUS_26230 2371 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 3715 2576 gene locus_tag LOCUS_26240 3715 2576 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_26240 >Feature sequence0499 1600 137 gene locus_tag LOCUS_26250 1600 137 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_26250 1981 1826 gene locus_tag LOCUS_26260 1981 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 3274 2243 gene locus_tag LOCUS_26270 3274 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence0500 250 1446 gene locus_tag LOCUS_26280 gene kynU 250 1446 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257142.1 protein_id gnl|my_center|LOCUS_26280 1540 2400 gene locus_tag LOCUS_26290 gene kynA 1540 2400 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661971.1 protein_id gnl|my_center|LOCUS_26290 2417 2755 gene locus_tag LOCUS_26300 2417 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence0501 421 2532 gene locus_tag LOCUS_26310 421 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 3744 3004 gene locus_tag LOCUS_26320 3744 3004 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence0502 697 957 gene locus_tag LOCUS_26330 697 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1012 1707 gene locus_tag LOCUS_26340 1012 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1704 1937 gene locus_tag LOCUS_26350 1704 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 2020 2439 gene locus_tag LOCUS_26360 2020 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2443 3378 gene locus_tag LOCUS_26370 2443 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence0503 3 1052 gene locus_tag LOCUS_26380 gene mqnC 3 1052 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_26380 1085 1828 gene locus_tag LOCUS_26390 1085 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2051 2824 gene locus_tag LOCUS_26400 2051 2824 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042382595.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence0504 290 727 gene locus_tag LOCUS_26410 290 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 763 1818 gene locus_tag LOCUS_26420 gene lpxD 763 1818 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142009.1 protein_id gnl|my_center|LOCUS_26420 1989 2279 gene locus_tag LOCUS_26430 1989 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 2819 2358 gene locus_tag LOCUS_26440 2819 2358 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017761.1 protein_id gnl|my_center|LOCUS_26440 3728 2979 gene locus_tag LOCUS_26450 gene fabG 3728 2979 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence0505 1801 863 gene locus_tag LOCUS_26460 1801 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 3703 1820 gene locus_tag LOCUS_26470 gene asnB 3703 1820 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence0506 2562 1627 gene locus_tag LOCUS_26480 2562 1627 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957564.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence0507 1370 498 gene locus_tag LOCUS_26490 1370 498 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_26490 3300 1483 gene locus_tag LOCUS_26500 gene msbA 3300 1483 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence0508 1678 608 gene locus_tag LOCUS_26510 1678 608 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_26510 2342 3631 gene locus_tag LOCUS_26520 2342 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence0509 1326 61 gene locus_tag LOCUS_26530 1326 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 <3837 1567 gene locus_tag LOCUS_26540 <3837 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141063.1:CHAT domain-containing protein >Feature sequence0510 <1 581 gene locus_tag LOCUS_26550 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869041.1:methylmalonyl-CoA mutase family protein 701 1090 gene locus_tag LOCUS_26560 701 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 1157 2536 gene locus_tag LOCUS_26570 1157 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 2608 3642 gene locus_tag LOCUS_26580 2608 3642 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618802.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence0511 <1 2046 gene locus_tag LOCUS_26590 <1 2046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014327132.1:Crp/Fnr family transcriptional regulator 2239 2166 gene locus_tag LOCUS_t00230 2239 2166 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2750 2289 gene locus_tag LOCUS_26600 2750 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 3629 2892 gene locus_tag LOCUS_26610 3629 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence0512 1449 241 gene locus_tag LOCUS_26620 1449 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 1703 2527 gene locus_tag LOCUS_26630 1703 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 3068 2670 gene locus_tag LOCUS_26640 3068 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 3673 3473 gene locus_tag LOCUS_26650 3673 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence0513 221 1348 gene locus_tag LOCUS_26660 221 1348 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_26660 1510 1824 gene locus_tag LOCUS_26670 1510 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2803 2345 gene locus_tag LOCUS_26680 2803 2345 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_26680 3108 3563 gene locus_tag LOCUS_26690 3108 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence0514 210 1211 gene locus_tag LOCUS_26700 210 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2856 1180 gene locus_tag LOCUS_26710 2856 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 3754 2912 gene locus_tag LOCUS_26720 3754 2912 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence0515 79 1257 gene locus_tag LOCUS_26730 gene gcvT 79 1257 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228001.1 protein_id gnl|my_center|LOCUS_26730 1254 1571 gene locus_tag LOCUS_26740 1254 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 2230 1598 gene locus_tag LOCUS_26750 2230 1598 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840180.1 protein_id gnl|my_center|LOCUS_26750 2838 2272 gene locus_tag LOCUS_26760 gene yjjX 2838 2272 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226224.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence0516 <1 2835 gene locus_tag LOCUS_26770 <1 2835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615777.1:RecQ family ATP-dependent DNA helicase 2932 3570 gene locus_tag LOCUS_26780 2932 3570 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222360.1 protein_id gnl|my_center|LOCUS_26780 >Feature sequence0517 2022 142 gene locus_tag LOCUS_26790 2022 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence0518 >Feature sequence0519 2209 650 gene locus_tag LOCUS_26800 2209 650 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931766.1 protein_id gnl|my_center|LOCUS_26800 3416 2397 gene locus_tag LOCUS_26810 gene arsS 3416 2397 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence0520 895 284 gene locus_tag LOCUS_26820 895 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 998 2854 gene locus_tag LOCUS_26830 gene lysS 998 2854 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930190.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence0521 64 444 gene locus_tag LOCUS_26840 64 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 605 1762 gene locus_tag LOCUS_26850 gene pstS 605 1762 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530168.1 protein_id gnl|my_center|LOCUS_26850 1793 2806 gene locus_tag LOCUS_26860 gene pstC 1793 2806 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582860.1 protein_id gnl|my_center|LOCUS_26860 2840 3709 gene locus_tag LOCUS_26870 gene pstA 2840 3709 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_26870 >Feature sequence0522 <1 898 gene locus_tag LOCUS_26880 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257432.1:PAS domain S-box protein 928 2397 gene locus_tag LOCUS_26890 928 2397 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889218.1 protein_id gnl|my_center|LOCUS_26890 2880 3185 gene locus_tag LOCUS_26900 2880 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 3182 3598 gene locus_tag LOCUS_26910 3182 3598 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107978797.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence0523 553 2034 gene locus_tag LOCUS_26920 553 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 2102 3652 gene locus_tag LOCUS_26930 2102 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence0524 <1 1281 gene locus_tag LOCUS_26940 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930426.1:sigma-54 dependent transcriptional regulator 1310 1714 gene locus_tag LOCUS_26950 1310 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 1695 1967 gene locus_tag LOCUS_26960 1695 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 1972 2370 gene locus_tag LOCUS_26970 1972 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 <3693 2584 gene locus_tag LOCUS_26980 <3693 2584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013382996.1:phosphate regulon transcriptional regulator PhoB >Feature sequence0525 3180 241 gene locus_tag LOCUS_26990 3180 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence0526 687 974 gene locus_tag LOCUS_27000 687 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 1236 2672 gene locus_tag LOCUS_27010 1236 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2669 2812 gene locus_tag LOCUS_27020 2669 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence0527 2185 3063 gene locus_tag LOCUS_27030 2185 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence0528 748 2028 gene locus_tag LOCUS_27040 gene egtB 748 2028 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419808.1 protein_id gnl|my_center|LOCUS_27040 2103 3593 gene locus_tag LOCUS_27050 2103 3593 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926839.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence0529 127 1029 gene locus_tag LOCUS_27060 127 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1176 1916 gene locus_tag LOCUS_27070 1176 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 1921 3111 gene locus_tag LOCUS_27080 1921 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence0530 1966 578 gene locus_tag LOCUS_27090 1966 578 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_27090 3128 2004 gene locus_tag LOCUS_27100 3128 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence0531 1569 199 gene locus_tag LOCUS_27110 1569 199 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729271.1 protein_id gnl|my_center|LOCUS_27110 2843 1587 gene locus_tag LOCUS_27120 2843 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence0532 252 1508 gene locus_tag LOCUS_27130 252 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1525 2904 gene locus_tag LOCUS_27140 1525 2904 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729271.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence0533 152 922 gene locus_tag LOCUS_27150 gene hisF 152 922 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_27150 919 1593 gene locus_tag LOCUS_27160 gene hisIE 919 1593 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_27160 1590 2378 gene locus_tag LOCUS_27170 1590 2378 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence0534 1467 169 gene locus_tag LOCUS_27180 gene serS 1467 169 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884181.1 protein_id gnl|my_center|LOCUS_27180 1697 2572 gene locus_tag LOCUS_27190 gene galU 1697 2572 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941523.1 protein_id gnl|my_center|LOCUS_27190 2599 3360 gene locus_tag LOCUS_27200 gene fabG 2599 3360 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence0535 1140 226 gene locus_tag LOCUS_27210 1140 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 1694 2941 gene locus_tag LOCUS_27220 1694 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence0536 2001 1135 gene locus_tag LOCUS_27230 2001 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 3542 2403 gene locus_tag LOCUS_27240 3542 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence0537 335 1789 gene locus_tag LOCUS_27250 335 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 2416 2024 gene locus_tag LOCUS_27260 2416 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 >Feature sequence0538 780 547 gene locus_tag LOCUS_27270 780 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 3313 1709 gene locus_tag LOCUS_27280 3313 1709 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence0539 572 3556 gene locus_tag LOCUS_27290 572 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence0540 326 1540 gene locus_tag LOCUS_27300 326 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 1772 2434 gene locus_tag LOCUS_27310 1772 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence0541 97 591 gene locus_tag LOCUS_27320 97 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1155 631 gene locus_tag LOCUS_27330 1155 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1682 1182 gene locus_tag LOCUS_27340 1682 1182 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029744075.1 protein_id gnl|my_center|LOCUS_27340 <3633 2385 gene locus_tag LOCUS_27350 <3633 2385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141490.1:tetracycline resistance MFS efflux pump >Feature sequence0542 551 51 gene locus_tag LOCUS_27360 551 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 1868 555 gene locus_tag LOCUS_27370 1868 555 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_27370 2850 1891 gene locus_tag LOCUS_27380 gene accD 2850 1891 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_27380 <3630 2959 gene locus_tag LOCUS_27390 <3630 2959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942235.1:bifunctional oligoribonuclease/PAP phosphatase NrnA >Feature sequence0543 741 313 gene locus_tag LOCUS_27400 gene queF 741 313 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143582.1 protein_id gnl|my_center|LOCUS_27400 1567 917 gene locus_tag LOCUS_27410 1567 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2095 1640 gene locus_tag LOCUS_27420 2095 1640 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113661.1 protein_id gnl|my_center|LOCUS_27420 2945 2190 gene locus_tag LOCUS_27430 2945 2190 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence0544 262 1563 gene locus_tag LOCUS_27440 262 1563 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117066.1 protein_id gnl|my_center|LOCUS_27440 >Feature sequence0545 <1 861 gene locus_tag LOCUS_27450 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223822.1:allantoinase AllB 989 1999 gene locus_tag LOCUS_27460 gene alc 989 1999 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553942.1 protein_id gnl|my_center|LOCUS_27460 1992 2525 gene locus_tag LOCUS_27470 gene uraD 1992 2525 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727574.1 protein_id gnl|my_center|LOCUS_27470 2522 2866 gene locus_tag LOCUS_27480 gene uraH 2522 2866 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336831.1 protein_id gnl|my_center|LOCUS_27480 >Feature sequence0546 2553 1414 gene locus_tag LOCUS_27490 2553 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence0547 1527 130 gene locus_tag LOCUS_27500 1527 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 >Feature sequence0548 1684 1328 gene locus_tag LOCUS_27510 1684 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 2070 1786 gene locus_tag LOCUS_27520 gene infA 2070 1786 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936627.1 protein_id gnl|my_center|LOCUS_27520 3313 2090 gene locus_tag LOCUS_27530 3313 2090 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence0549 2447 1416 gene locus_tag LOCUS_27540 2447 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 3484 2444 gene locus_tag LOCUS_27550 gene galT 3484 2444 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367649.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence0550 485 736 gene locus_tag LOCUS_27560 485 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 1279 836 gene locus_tag LOCUS_27570 1279 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 3093 1381 gene locus_tag LOCUS_27580 3093 1381 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035873.1 protein_id gnl|my_center|LOCUS_27580 >Feature sequence0551 1137 223 gene locus_tag LOCUS_27590 1137 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 1824 1228 gene locus_tag LOCUS_27600 1824 1228 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_27600 3019 1952 gene locus_tag LOCUS_27610 3019 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 >Feature sequence0552 308 1657 gene locus_tag LOCUS_27620 308 1657 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 protein_id gnl|my_center|LOCUS_27620 1669 2211 gene locus_tag LOCUS_27630 1669 2211 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938891.1 protein_id gnl|my_center|LOCUS_27630 2351 3505 gene locus_tag LOCUS_27640 2351 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence0553 3231 781 gene locus_tag LOCUS_27650 3231 781 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_27650 >Feature sequence0554 <1 1261 gene locus_tag LOCUS_27660 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225801.1:leucine--tRNA ligase 2298 1381 gene locus_tag LOCUS_27670 2298 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 2920 2336 gene locus_tag LOCUS_27680 2920 2336 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_27680 <3562 2974 gene locus_tag LOCUS_27690 <3562 2974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016327729.1:gamma-glutamyltransferase >Feature sequence0555 534 2099 gene locus_tag LOCUS_27700 534 2099 CDS product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029620.1 protein_id gnl|my_center|LOCUS_27700 3486 2296 gene locus_tag LOCUS_27710 3486 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence0556 377 1852 gene locus_tag LOCUS_27720 377 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 2402 1938 gene locus_tag LOCUS_27730 2402 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 <3553 2502 gene locus_tag LOCUS_27740 <3553 2502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861277.1:YceG family protein >Feature sequence0557 <1 1907 gene locus_tag LOCUS_27750 <1 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391629.1:transcription-repair coupling factor 2125 3261 gene locus_tag LOCUS_27760 2125 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence0558 <1 2616 gene locus_tag LOCUS_27770 <1 2616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814074.1:pitrilysin family protein 3035 2763 gene locus_tag LOCUS_27780 3035 2763 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140124.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence0559 1324 2760 gene locus_tag LOCUS_27790 1324 2760 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888807.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence0560 2304 1510 gene locus_tag LOCUS_27800 gene lptB 2304 1510 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404114.1 protein_id gnl|my_center|LOCUS_27800 >Feature sequence0561 910 1554 gene locus_tag LOCUS_27810 910 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 1958 1737 gene locus_tag LOCUS_27820 1958 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2530 2057 gene locus_tag LOCUS_27830 2530 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 <3538 2664 gene locus_tag LOCUS_27840 <3538 2664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141047.1:deoxyhypusine synthase >Feature sequence0562 <1 798 gene locus_tag LOCUS_27850 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265899.1:M20/M25/M40 family metallo-hydrolase 2016 907 gene locus_tag LOCUS_27860 2016 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 3179 2202 gene locus_tag LOCUS_27870 gene lepB 3179 2202 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933117.1 protein_id gnl|my_center|LOCUS_27870 >Feature sequence0563 549 253 gene locus_tag LOCUS_27880 549 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 678 3377 gene locus_tag LOCUS_27890 678 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence0564 1309 278 gene locus_tag LOCUS_27900 1309 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 2606 1335 gene locus_tag LOCUS_27910 2606 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence0565 813 274 gene locus_tag LOCUS_27920 813 274 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967800.1 protein_id gnl|my_center|LOCUS_27920 1539 904 gene locus_tag LOCUS_27930 1539 904 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174271.1 protein_id gnl|my_center|LOCUS_27930 2056 1559 gene locus_tag LOCUS_27940 2056 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 2310 3335 gene locus_tag LOCUS_27950 2310 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence0566 2218 1010 gene locus_tag LOCUS_27960 2218 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 <3517 2469 gene locus_tag LOCUS_27970 <3517 2469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141063.1:CHAT domain-containing protein >Feature sequence0567 243 875 gene locus_tag LOCUS_27980 gene queC 243 875 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_27980 1023 2345 gene locus_tag LOCUS_27990 1023 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence0568 <1 1662 gene locus_tag LOCUS_28000 <1 1662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071792.1:outer membrane protein assembly factor BamA 1691 2377 gene locus_tag LOCUS_28010 1691 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 2474 3346 gene locus_tag LOCUS_28020 2474 3346 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355679.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence0569 <1 1158 gene locus_tag LOCUS_28030 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933016.1:efflux RND transporter periplasmic adaptor subunit 1155 1928 gene locus_tag LOCUS_28040 1155 1928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_28040 <3511 2049 gene locus_tag LOCUS_28050 <3511 2049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393140.1:VanW family protein >Feature sequence0570 1294 482 gene locus_tag LOCUS_28060 1294 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 2881 1799 gene locus_tag LOCUS_28070 gene secF 2881 1799 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_28070 <3511 2967 gene locus_tag LOCUS_28080 <3511 2967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943255.1:protein translocase subunit SecD >Feature sequence0571 <1 1527 gene locus_tag LOCUS_28090 <1 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000736312.1:alpha2-macroglobulin 1660 2544 gene locus_tag LOCUS_28100 1660 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2552 3472 gene locus_tag LOCUS_28110 2552 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence0572 <1 1099 gene locus_tag LOCUS_28120 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257773.1:MATE family efflux transporter 1114 1455 gene locus_tag LOCUS_28130 1114 1455 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842486.1 protein_id gnl|my_center|LOCUS_28130 1680 2285 gene locus_tag LOCUS_28140 gene rpoE 1680 2285 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_28140 2285 3388 gene locus_tag LOCUS_28150 2285 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 >Feature sequence0573 1230 385 gene locus_tag LOCUS_28160 1230 385 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086566.1 protein_id gnl|my_center|LOCUS_28160 2278 1358 gene locus_tag LOCUS_28170 gene cyoE 2278 1358 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_28170 3228 2326 gene locus_tag LOCUS_28180 3228 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence0574 268 2721 gene locus_tag LOCUS_28190 268 2721 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_28190 3231 2740 gene locus_tag LOCUS_28200 3231 2740 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583739.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence0575 535 2040 gene locus_tag LOCUS_28210 gene moeB 535 2040 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143401.1 protein_id gnl|my_center|LOCUS_28210 2431 2165 gene locus_tag LOCUS_28220 2431 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 2545 2784 gene locus_tag LOCUS_28230 2545 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2914 3084 gene locus_tag LOCUS_28240 2914 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence0576 1926 721 gene locus_tag LOCUS_28250 1926 721 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_28250 2516 2022 gene locus_tag LOCUS_28260 gene coaD 2516 2022 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869854.1 protein_id gnl|my_center|LOCUS_28260 2904 2644 gene locus_tag LOCUS_28270 2904 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence0577 <1 1089 gene locus_tag LOCUS_28280 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146467.1:DUF4910 domain-containing protein 1704 1306 gene locus_tag LOCUS_28290 1704 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 2759 2028 gene locus_tag LOCUS_28300 2759 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 3208 2975 gene locus_tag LOCUS_28310 3208 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence0578 <1 1918 gene locus_tag LOCUS_28320 <1 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383264.1:PIG-L family deacetylase 1938 2486 gene locus_tag LOCUS_28330 1938 2486 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228963.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence0579 2011 827 gene locus_tag LOCUS_28340 2011 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_28340 2389 3249 gene locus_tag LOCUS_28350 2389 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence0580 <1 2343 gene locus_tag LOCUS_28360 <1 2343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919618.1:TonB-dependent receptor 2555 2746 gene locus_tag LOCUS_28370 2555 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence0581 <1 986 gene locus_tag LOCUS_28380 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009967303.1:serine protease AprX 1078 2004 gene locus_tag LOCUS_28390 1078 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence0582 <1 3094 gene locus_tag LOCUS_28400 <1 3094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037631.1:TonB-dependent receptor >Feature sequence0583 <1 800 gene locus_tag LOCUS_28410 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003118743.1:AraC family transcriptional regulator CmrA 1775 816 gene locus_tag LOCUS_28420 1775 816 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031548.1 protein_id gnl|my_center|LOCUS_28420 <3473 1883 gene locus_tag LOCUS_28430 <3473 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141168.1:glucosidase >Feature sequence0584 793 401 gene locus_tag LOCUS_28440 793 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 1552 1016 gene locus_tag LOCUS_28450 1552 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 >Feature sequence0585 1000 1479 gene locus_tag LOCUS_28460 1000 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 2527 2072 gene locus_tag LOCUS_28470 2527 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 2967 2611 gene locus_tag LOCUS_28480 2967 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3265 2984 gene locus_tag LOCUS_28490 3265 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence0586 376 2946 gene locus_tag LOCUS_28500 376 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence0587 590 396 gene locus_tag LOCUS_28510 590 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 768 592 gene locus_tag LOCUS_28520 768 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 1088 837 gene locus_tag LOCUS_28530 1088 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 1519 1250 gene locus_tag LOCUS_28540 1519 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 1892 1722 gene locus_tag LOCUS_28550 1892 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 2225 1953 gene locus_tag LOCUS_28560 2225 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 3159 2284 gene locus_tag LOCUS_28570 3159 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence0588 1462 182 gene locus_tag LOCUS_28580 1462 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 2297 1494 gene locus_tag LOCUS_28590 gene thiD 2297 1494 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221739.1 protein_id gnl|my_center|LOCUS_28590 3016 2357 gene locus_tag LOCUS_28600 3016 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3359 2958 gene locus_tag LOCUS_28610 3359 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 >Feature sequence0589 128 1240 gene locus_tag LOCUS_28620 128 1240 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143073.1 protein_id gnl|my_center|LOCUS_28620 1273 2022 gene locus_tag LOCUS_28630 gene pyrF 1273 2022 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_28630 2165 2950 gene locus_tag LOCUS_28640 2165 2950 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence0590 2556 109 gene locus_tag LOCUS_28650 2556 109 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_28650 <3445 2567 gene locus_tag LOCUS_28660 <3445 2567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141201.1:ABC transporter permease note possible pseudo, frameshifted >Feature sequence0591 <1 1155 gene locus_tag LOCUS_28670 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_108988152.1:2-oxoacid:acceptor oxidoreductase subunit alpha 1165 1812 gene locus_tag LOCUS_28680 1165 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1996 2226 gene locus_tag LOCUS_28690 1996 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 >Feature sequence0592 582 67 gene locus_tag LOCUS_28700 582 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 724 1242 gene locus_tag LOCUS_28710 gene msrB 724 1242 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109730.1 protein_id gnl|my_center|LOCUS_28710 2655 1303 gene locus_tag LOCUS_28720 2655 1303 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_28720 >Feature sequence0593 <1 1589 gene locus_tag LOCUS_28730 <1 1589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838717.1:prolyl oligopeptidase family serine peptidase 1971 3095 gene locus_tag LOCUS_28740 1971 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 >Feature sequence0594 728 231 gene locus_tag LOCUS_28750 728 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 2112 829 gene locus_tag LOCUS_28760 2112 829 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence0595 <1 1012 gene locus_tag LOCUS_28770 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112820.1:Stk1 family PASTA domain-containing Ser/Thr kinase 1097 1585 gene locus_tag LOCUS_28780 1097 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 <3405 1682 gene locus_tag LOCUS_28790 <3405 1682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923343.1:M3 family metallopeptidase >Feature sequence0596 372 1208 gene locus_tag LOCUS_28800 372 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 1398 2930 gene locus_tag LOCUS_28810 1398 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence0597 3 284 gene locus_tag LOCUS_28820 3 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 2308 485 gene locus_tag LOCUS_28830 2308 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 2742 2509 gene locus_tag LOCUS_28840 2742 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 >Feature sequence0598 1613 75 gene locus_tag LOCUS_28850 1613 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 3322 1610 gene locus_tag LOCUS_28860 3322 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence0599 285 2981 gene locus_tag LOCUS_28870 285 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence0600 <1 2726 gene locus_tag LOCUS_28880 <1 2726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143062.1:FAD-linked oxidase C-terminal domain-containing protein >Feature sequence0601 752 2257 gene locus_tag LOCUS_28890 752 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088844313.1 protein_id gnl|my_center|LOCUS_28890 2324 2839 gene locus_tag LOCUS_28900 2324 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence0602 871 464 gene locus_tag LOCUS_28910 871 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 1320 1114 gene locus_tag LOCUS_28920 1320 1114 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_28920 2681 1350 gene locus_tag LOCUS_28930 gene nuoF 2681 1350 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_28930 3290 2730 gene locus_tag LOCUS_28940 gene nuoE 3290 2730 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence0603 1453 65 gene locus_tag LOCUS_28950 1453 65 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404646.1 protein_id gnl|my_center|LOCUS_28950 2868 1450 gene locus_tag LOCUS_28960 2868 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 >Feature sequence0604 <1 781 gene locus_tag LOCUS_28970 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071951.1:DUF885 domain-containing protein 975 1421 gene locus_tag LOCUS_28980 gene tnpA 975 1421 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_28980 2867 1605 gene locus_tag LOCUS_28990 2867 1605 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence0605 <1 780 gene locus_tag LOCUS_29000 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008672241.1:M28 family peptidase 858 2882 gene locus_tag LOCUS_29010 858 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence0606 794 45 gene locus_tag LOCUS_29020 794 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 <3368 1014 gene locus_tag LOCUS_29030 <3368 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925729.1:DUF5916 domain-containing protein >Feature sequence0607 <1 1114 gene locus_tag LOCUS_29040 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037461425.1:TonB-dependent receptor 1226 2638 gene locus_tag LOCUS_29050 1226 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence0608 >Feature sequence0609 <1 1132 gene locus_tag LOCUS_29060 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928997.1:SpoIID/LytB domain-containing protein 1236 2177 gene locus_tag LOCUS_29070 gene miaA 1236 2177 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_29070 2312 2605 gene locus_tag LOCUS_29080 2312 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 2655 3317 gene locus_tag LOCUS_29090 gene tmk 2655 3317 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939417.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence0610 941 93 gene locus_tag LOCUS_29100 941 93 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_29100 2640 964 gene locus_tag LOCUS_29110 2640 964 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035657.1 protein_id gnl|my_center|LOCUS_29110 2953 2726 gene locus_tag LOCUS_29120 2953 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 3344 3063 gene locus_tag LOCUS_29130 3344 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence0611 2284 455 gene locus_tag LOCUS_29140 gene dnaK 2284 455 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_29140 <3341 2365 gene locus_tag LOCUS_29150 <3341 2365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392121.1:nucleotide exchange factor GrpE >Feature sequence0612 610 47 gene locus_tag LOCUS_29160 gene efp 610 47 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626504.1 protein_id gnl|my_center|LOCUS_29160 1696 962 gene locus_tag LOCUS_29170 1696 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence0613 <1 1280 gene locus_tag LOCUS_29180 <1 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389950.1:malto-oligosyltrehalose trehalohydrolase 1277 3322 gene locus_tag LOCUS_29190 1277 3322 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909312.1 protein_id gnl|my_center|LOCUS_29190 >Feature sequence0614 <1 518 gene locus_tag LOCUS_29200 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393979.1:ABC transporter substrate-binding protein 2081 684 gene locus_tag LOCUS_29210 gene argH 2081 684 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230096.1 protein_id gnl|my_center|LOCUS_29210 2246 2662 gene locus_tag LOCUS_29220 gene argR 2246 2662 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633181.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence0615 2204 519 gene locus_tag LOCUS_29230 2204 519 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_29230 3296 2247 gene locus_tag LOCUS_29240 3296 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence0616 53 1801 gene locus_tag LOCUS_29250 53 1801 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_29250 1856 2584 gene locus_tag LOCUS_29260 1856 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171434.1 protein_id gnl|my_center|LOCUS_29260 <3314 2732 gene locus_tag LOCUS_29270 <3314 2732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073780.1:oxidative stress defense protein >Feature sequence0617 655 83 gene locus_tag LOCUS_29280 655 83 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_29280 1135 746 gene locus_tag LOCUS_29290 1135 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1717 1169 gene locus_tag LOCUS_29300 gene msrA 1717 1169 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_29300 1802 2740 gene locus_tag LOCUS_29310 1802 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence0618 1002 4 gene locus_tag LOCUS_29320 1002 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1793 999 gene locus_tag LOCUS_29330 1793 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 3154 1937 gene locus_tag LOCUS_29340 3154 1937 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127180013.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence0619 <1 1263 gene locus_tag LOCUS_29350 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939112.1:amidohydrolase 1286 2083 gene locus_tag LOCUS_29360 1286 2083 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596582.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence0620 1072 887 gene locus_tag LOCUS_29370 gene rpmF 1072 887 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_29370 1722 1189 gene locus_tag LOCUS_29380 1722 1189 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_29380 2936 1803 gene locus_tag LOCUS_29390 2936 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence0621 464 976 gene locus_tag LOCUS_29400 gene rimI 464 976 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225787.1 protein_id gnl|my_center|LOCUS_29400 1104 1346 gene locus_tag LOCUS_29410 1104 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 1495 2088 gene locus_tag LOCUS_29420 1495 2088 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_29420 2085 2981 gene locus_tag LOCUS_29430 gene pssA 2085 2981 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957377.1 protein_id gnl|my_center|LOCUS_29430 >Feature sequence0622 934 3273 gene locus_tag LOCUS_29440 gene ntrY 934 3273 CDS product two-component system sensor histidine kinase NtrY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844315.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence0623 <1 2092 gene locus_tag LOCUS_29450 <1 2092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS 2096 3256 gene locus_tag LOCUS_29460 gene nagZ 2096 3256 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence0624 884 606 gene locus_tag LOCUS_29470 884 606 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_29470 1332 886 gene locus_tag LOCUS_29480 1332 886 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_29480 2304 1339 gene locus_tag LOCUS_29490 gene rapZ 2304 1339 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_29490 <3263 2294 gene locus_tag LOCUS_29500 <3263 2294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942530.1:HPr(Ser) kinase/phosphatase >Feature sequence0625 3184 1085 gene locus_tag LOCUS_29510 3184 1085 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257267.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29510 >Feature sequence0626 1825 1280 gene locus_tag LOCUS_29520 1825 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 2797 1982 gene locus_tag LOCUS_29530 2797 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 3144 2800 gene locus_tag LOCUS_29540 gene uraH 3144 2800 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057392.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence0627 1145 480 gene locus_tag LOCUS_29550 1145 480 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_29550 1718 1269 gene locus_tag LOCUS_29560 gene dtd 1718 1269 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_29560 2469 1750 gene locus_tag LOCUS_29570 2469 1750 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_29570 <3247 2480 gene locus_tag LOCUS_29580 <3247 2480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943991.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB >Feature sequence0628 <1 597 gene locus_tag LOCUS_29590 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870026.1:tetraacyldisaccharide 4'-kinase 2274 697 gene locus_tag LOCUS_29600 2274 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence0629 1107 25 gene locus_tag LOCUS_29610 1107 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 2349 1228 gene locus_tag LOCUS_29620 2349 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 3243 2560 gene locus_tag LOCUS_29630 3243 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence0630 1486 98 gene locus_tag LOCUS_29640 1486 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 2222 1491 gene locus_tag LOCUS_29650 2222 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 <3238 2222 gene locus_tag LOCUS_29660 <3238 2222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528967.1:glycosyltransferase >Feature sequence0631 1 798 gene locus_tag LOCUS_29670 1 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 2244 883 gene locus_tag LOCUS_29680 2244 883 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259421.1 protein_id gnl|my_center|LOCUS_29680 2864 2529 gene locus_tag LOCUS_29690 2864 2529 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626607.1 protein_id gnl|my_center|LOCUS_29690 >Feature sequence0632 1761 592 gene locus_tag LOCUS_29700 1761 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence0633 3 545 gene locus_tag LOCUS_29710 3 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 676 945 gene locus_tag LOCUS_29720 gene rpsO 676 945 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence0634 817 1395 gene locus_tag LOCUS_29730 817 1395 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_29730 1392 2210 gene locus_tag LOCUS_29740 1392 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 2313 2963 gene locus_tag LOCUS_29750 2313 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence0635 1983 1228 gene locus_tag LOCUS_29760 1983 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 2588 2010 gene locus_tag LOCUS_29770 2588 2010 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_29770 >Feature sequence0636 >Feature sequence0637 875 174 gene locus_tag LOCUS_29780 875 174 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_29780 1743 889 gene locus_tag LOCUS_29790 1743 889 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947815.1 protein_id gnl|my_center|LOCUS_29790 1904 2974 gene locus_tag LOCUS_29800 1904 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 >Feature sequence0638 903 127 gene locus_tag LOCUS_29810 903 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 2366 900 gene locus_tag LOCUS_29820 gene crtI 2366 900 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_29820 <3209 2375 gene locus_tag LOCUS_29830 <3209 2375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933643.1:hydroxychlorobactene glucosyltransferase CruC >Feature sequence0639 1236 703 gene locus_tag LOCUS_29840 gene rfbC 1236 703 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_29840 1423 2286 gene locus_tag LOCUS_29850 1423 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 <3200 2355 gene locus_tag LOCUS_29860 <3200 2355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963750.1:glycosyltransferase >Feature sequence0640 1 3123 gene locus_tag LOCUS_29870 1 3123 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403927.1 protein_id gnl|my_center|LOCUS_29870 >Feature sequence0641 48 827 gene locus_tag LOCUS_29880 gene tolQ 48 827 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_29880 946 1410 gene locus_tag LOCUS_29890 gene tolR 946 1410 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_29890 1497 2006 gene locus_tag LOCUS_29900 gene tolR 1497 2006 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_29900 2141 2989 gene locus_tag LOCUS_29910 2141 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 >Feature sequence0642 2591 966 gene locus_tag LOCUS_29920 2591 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 <3197 2684 gene locus_tag LOCUS_29930 <3197 2684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880520.1:tetratricopeptide repeat protein >Feature sequence0643 583 810 gene locus_tag LOCUS_29940 583 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 985 2211 gene locus_tag LOCUS_29950 985 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2267 2719 gene locus_tag LOCUS_29960 2267 2719 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120329.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence0644 919 677 gene locus_tag LOCUS_29970 919 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 1358 1065 gene locus_tag LOCUS_29980 1358 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 1693 1469 gene locus_tag LOCUS_29990 1693 1469 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066120.1 protein_id gnl|my_center|LOCUS_29990 >Feature sequence0645 1 1056 gene locus_tag LOCUS_30000 1 1056 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256870.1 protein_id gnl|my_center|LOCUS_30000 1149 1973 gene locus_tag LOCUS_30010 1149 1973 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_30010 >Feature sequence0646 1325 126 gene locus_tag LOCUS_30020 1325 126 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787334.1 protein_id gnl|my_center|LOCUS_30020 1554 1958 gene locus_tag LOCUS_30030 1554 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 2487 1966 gene locus_tag LOCUS_30040 2487 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence0647 161 232 gene locus_tag LOCUS_t00240 161 232 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 241 315 gene locus_tag LOCUS_t00250 241 315 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 417 490 gene locus_tag LOCUS_t00260 417 490 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 499 574 gene locus_tag LOCUS_t00270 499 574 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 594 667 gene locus_tag LOCUS_t00280 594 667 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 800 876 gene locus_tag LOCUS_t00290 800 876 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 899 977 gene locus_tag LOCUS_t00300 899 977 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 983 1061 gene locus_tag LOCUS_t00310 983 1061 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1071 1144 gene locus_tag LOCUS_t00320 1071 1144 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1154 1227 gene locus_tag LOCUS_t00330 1154 1227 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1234 1307 gene locus_tag LOCUS_t00340 1234 1307 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1313 1386 gene locus_tag LOCUS_t00350 1313 1386 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1534 3087 gene locus_tag LOCUS_30050 1534 3087 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence0648 886 65 gene locus_tag LOCUS_30060 886 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 1588 986 gene locus_tag LOCUS_30070 gene sigE 1588 986 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_30070 1925 3034 gene locus_tag LOCUS_30080 1925 3034 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence0649 434 949 gene locus_tag LOCUS_30090 434 949 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_30090 1172 2899 gene locus_tag LOCUS_30100 1172 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence0650 2320 893 gene locus_tag LOCUS_30110 2320 893 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143099.1 protein_id gnl|my_center|LOCUS_30110 <3159 2409 gene locus_tag LOCUS_30120 <3159 2409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143098.1:DUF3526 domain-containing protein >Feature sequence0651 445 1011 gene locus_tag LOCUS_30130 445 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 1862 1026 gene locus_tag LOCUS_30140 1862 1026 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 protein_id gnl|my_center|LOCUS_30140 2963 1896 gene locus_tag LOCUS_30150 2963 1896 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_30150 >Feature sequence0652 1882 1592 gene locus_tag LOCUS_30160 1882 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence0653 532 80 gene locus_tag LOCUS_30170 532 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 943 608 gene locus_tag LOCUS_30180 943 608 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 protein_id gnl|my_center|LOCUS_30180 2871 1027 gene locus_tag LOCUS_30190 2871 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence0654 653 3034 gene locus_tag LOCUS_30200 653 3034 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141097.1 protein_id gnl|my_center|LOCUS_30200 >Feature sequence0655 68 1333 gene locus_tag LOCUS_30210 68 1333 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928471.1 protein_id gnl|my_center|LOCUS_30210 1668 1378 gene locus_tag LOCUS_30220 1668 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 1549 2727 gene locus_tag LOCUS_30230 1549 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence0656 918 133 gene locus_tag LOCUS_30240 918 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 1163 981 gene locus_tag LOCUS_30250 1163 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30250 2074 1088 gene locus_tag LOCUS_30260 2074 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30260 2815 2345 gene locus_tag LOCUS_30270 2815 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 >Feature sequence0657 762 253 gene locus_tag LOCUS_30280 762 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 1161 835 gene locus_tag LOCUS_30290 1161 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 3108 1582 gene locus_tag LOCUS_30300 gene nrfD 3108 1582 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_30300 >Feature sequence0658 1280 1648 gene locus_tag LOCUS_30310 1280 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 1789 2823 gene locus_tag LOCUS_30320 1789 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence0659 <1 729 gene locus_tag LOCUS_30330 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000291586.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase 803 1429 gene locus_tag LOCUS_30340 803 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence0660 2006 894 gene locus_tag LOCUS_30350 gene hrcA 2006 894 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence0661 733 2850 gene locus_tag LOCUS_30360 gene tkt 733 2850 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_30360 >Feature sequence0662 1756 365 gene locus_tag LOCUS_30370 1756 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 2395 1772 gene locus_tag LOCUS_30380 gene rpoE 2395 1772 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_30380 >Feature sequence0663 1188 694 gene locus_tag LOCUS_30390 gene bcp 1188 694 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142372.1 protein_id gnl|my_center|LOCUS_30390 2584 1568 gene locus_tag LOCUS_30400 2584 1568 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_30400 <3095 2581 gene locus_tag LOCUS_30410 <3095 2581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479688.1:DUF2721 domain-containing protein >Feature sequence0664 252 902 gene locus_tag LOCUS_30420 252 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence0665 402 815 gene locus_tag LOCUS_30430 gene rpsK 402 815 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_30430 977 1618 gene locus_tag LOCUS_30440 gene rpsD 977 1618 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_30440 1725 2777 gene locus_tag LOCUS_30450 1725 2777 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_30450 >Feature sequence0666 806 318 gene locus_tag LOCUS_30460 806 318 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393956.1 protein_id gnl|my_center|LOCUS_30460 1427 870 gene locus_tag LOCUS_30470 1427 870 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929177.1 protein_id gnl|my_center|LOCUS_30470 2791 1484 gene locus_tag LOCUS_30480 2791 1484 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243873.1 protein_id gnl|my_center|LOCUS_30480 3088 2903 gene locus_tag LOCUS_30490 3088 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 >Feature sequence0667 <1 638 gene locus_tag LOCUS_30500 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055983.1:SMC family ATPase 793 1347 gene locus_tag LOCUS_30510 793 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 1406 1801 gene locus_tag LOCUS_30520 1406 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1867 2055 gene locus_tag LOCUS_30530 1867 2055 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_30530 2067 2276 gene locus_tag LOCUS_30540 2067 2276 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393298.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence0668 <3085 1896 gene locus_tag LOCUS_30550 <3085 1896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976449.1:DUF4097 family beta strand repeat-containing protein >Feature sequence0669 <1 1091 gene locus_tag LOCUS_30560 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114739.1:DUF1446 domain-containing protein 1109 1726 gene locus_tag LOCUS_30570 1109 1726 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_30570 1751 2104 gene locus_tag LOCUS_30580 1751 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_30580 2097 2993 gene locus_tag LOCUS_30590 2097 2993 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_30590 >Feature sequence0670 1482 1138 gene locus_tag LOCUS_30600 1482 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 2095 1502 gene locus_tag LOCUS_30610 2095 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 >Feature sequence0671 <1 537 gene locus_tag LOCUS_30620 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025568152.1:glycosyltransferase family 1 protein 766 2952 gene locus_tag LOCUS_30630 766 2952 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence0672 1425 361 gene locus_tag LOCUS_30640 gene lpxD 1425 361 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_30640 2332 1511 gene locus_tag LOCUS_30650 gene lpxA 2332 1511 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948628.1 protein_id gnl|my_center|LOCUS_30650 >Feature sequence0673 1908 1225 gene locus_tag LOCUS_30660 1908 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 <3056 2039 gene locus_tag LOCUS_30670 <3056 2039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010922388.1:alpha-amylase AmyA >Feature sequence0674 439 1272 gene locus_tag LOCUS_30680 439 1272 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083333.1 protein_id gnl|my_center|LOCUS_30680 1453 2379 gene locus_tag LOCUS_30690 1453 2379 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404794.1 protein_id gnl|my_center|LOCUS_30690 >Feature sequence0675 1777 2259 gene locus_tag LOCUS_30700 1777 2259 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339224.1 protein_id gnl|my_center|LOCUS_30700 >Feature sequence0676 170 97 gene locus_tag LOCUS_t00360 170 97 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 316 1506 gene locus_tag LOCUS_30710 316 1506 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243654.1 protein_id gnl|my_center|LOCUS_30710 1499 2068 gene locus_tag LOCUS_30720 1499 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 2409 2155 gene locus_tag LOCUS_30730 2409 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence0677 658 230 gene locus_tag LOCUS_30740 658 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 1399 851 gene locus_tag LOCUS_30750 1399 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 2929 1430 gene locus_tag LOCUS_30760 2929 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence0678 317 1468 gene locus_tag LOCUS_30770 317 1468 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_30770 2720 1554 gene locus_tag LOCUS_30780 2720 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence0679 <1 1250 gene locus_tag LOCUS_30790 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064254970.1:FAD-dependent oxidoreductase 1644 1285 gene locus_tag LOCUS_30800 1644 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 <3028 1802 gene locus_tag LOCUS_30810 <3028 1802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799131.1:EAL domain-containing protein >Feature sequence0680 >Feature sequence0681 >Feature sequence0682 82 1110 gene locus_tag LOCUS_30820 82 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 1220 3016 gene locus_tag LOCUS_30830 1220 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence0683 412 987 gene locus_tag LOCUS_30840 412 987 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_30840 >Feature sequence0684 300 1400 gene locus_tag LOCUS_30850 300 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 1436 2212 gene locus_tag LOCUS_30860 1436 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence0685 2097 43 gene locus_tag LOCUS_30870 gene ppiD 2097 43 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167642.1 protein_id gnl|my_center|LOCUS_30870 >Feature sequence0686 221 574 gene locus_tag LOCUS_30880 221 574 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618815.1 protein_id gnl|my_center|LOCUS_30880 >Feature sequence0687 23 1294 gene locus_tag LOCUS_30890 23 1294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence0688 <2978 1302 gene locus_tag LOCUS_30900 <2978 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942996.1:malto-oligosyltrehalose synthase >Feature sequence0689 1769 783 gene locus_tag LOCUS_30910 1769 783 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_30910 1916 2710 gene locus_tag LOCUS_30920 1916 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence0690 <1 1475 gene locus_tag LOCUS_30930 <1 1475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942207.1:PBP1A family penicillin-binding protein 1859 1545 gene locus_tag LOCUS_30940 1859 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 2069 1893 gene locus_tag LOCUS_30950 2069 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 2519 2121 gene locus_tag LOCUS_30960 2519 2121 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_30960 >Feature sequence0691 <2962 1374 gene locus_tag LOCUS_30970 <2962 1374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112974.1:serine hydrolase domain-containing protein >Feature sequence0692 246 1394 gene locus_tag LOCUS_30980 246 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence0693 196 987 gene locus_tag LOCUS_30990 196 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 1078 1296 gene locus_tag LOCUS_31000 1078 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 1746 2549 gene locus_tag LOCUS_31010 1746 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence0694 1426 566 gene locus_tag LOCUS_31020 gene rsmI 1426 566 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008045.1 protein_id gnl|my_center|LOCUS_31020 2342 1644 gene locus_tag LOCUS_31030 2342 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence0695 554 859 gene locus_tag LOCUS_31040 554 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 1883 927 gene locus_tag LOCUS_31050 1883 927 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056892.1 protein_id gnl|my_center|LOCUS_31050 1982 2920 gene locus_tag LOCUS_31060 1982 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 >Feature sequence0696 166 435 gene locus_tag LOCUS_31070 166 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 1070 576 gene locus_tag LOCUS_31080 1070 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 2501 1206 gene locus_tag LOCUS_31090 2501 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 >Feature sequence0697 1640 438 gene locus_tag LOCUS_31100 1640 438 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030522745.1 protein_id gnl|my_center|LOCUS_31100 <2936 1889 gene locus_tag LOCUS_31110 <2936 1889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921024.1:class I adenylate-forming enzyme family protein >Feature sequence0698 >Feature sequence0699 761 63 gene locus_tag LOCUS_31120 761 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 2662 914 gene locus_tag LOCUS_31130 2662 914 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_31130 >Feature sequence0700 562 197 gene locus_tag LOCUS_31140 562 197 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_31140 1865 645 gene locus_tag LOCUS_31150 1865 645 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_31150 <2930 2072 gene locus_tag LOCUS_31160 <2930 2072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027904.1:methionine synthase >Feature sequence0701 >Feature sequence0702 <1 1091 gene locus_tag LOCUS_31170 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969528.1:TIGR04290 family methyltransferase 1425 2381 gene locus_tag LOCUS_31180 1425 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 >Feature sequence0703 1237 74 gene locus_tag LOCUS_31190 1237 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 1639 2142 gene locus_tag LOCUS_31200 1639 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 2483 2196 gene locus_tag LOCUS_31210 2483 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence0704 118 876 gene locus_tag LOCUS_31220 118 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 1222 2652 gene locus_tag LOCUS_31230 1222 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 >Feature sequence0705 <1 827 gene locus_tag LOCUS_31240 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140378.1:amidohydrolase 2185 860 gene locus_tag LOCUS_31250 2185 860 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_31250 >Feature sequence0706 555 1235 gene locus_tag LOCUS_31260 555 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 1706 1257 gene locus_tag LOCUS_31270 1706 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 >Feature sequence0707 1521 1165 gene locus_tag LOCUS_31280 1521 1165 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 protein_id gnl|my_center|LOCUS_31280 2688 1597 gene locus_tag LOCUS_31290 2688 1597 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306554.1 protein_id gnl|my_center|LOCUS_31290 >Feature sequence0708 <2909 1222 gene locus_tag LOCUS_31300 <2909 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020305.1:VWA domain-containing protein >Feature sequence0709 >Feature sequence0710 <1 558 gene locus_tag LOCUS_31310 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002357486.1:FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO 555 1712 gene locus_tag LOCUS_31320 555 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 1834 2757 gene locus_tag LOCUS_31330 gene xerC 1834 2757 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_31330 >Feature sequence0711 >Feature sequence0712 1423 941 gene locus_tag LOCUS_31340 1423 941 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918690.1 protein_id gnl|my_center|LOCUS_31340 1755 2285 gene locus_tag LOCUS_31350 1755 2285 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence0713 974 54 gene locus_tag LOCUS_31360 974 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 1942 1052 gene locus_tag LOCUS_31370 1942 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 2279 2539 gene locus_tag LOCUS_31380 2279 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence0714 1231 317 gene locus_tag LOCUS_31390 1231 317 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_31390 >Feature sequence0715 1090 641 gene locus_tag LOCUS_31400 1090 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence0716 2374 1436 gene locus_tag LOCUS_31410 2374 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence0717 1390 737 gene locus_tag LOCUS_31420 1390 737 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257063.1 protein_id gnl|my_center|LOCUS_31420 1605 2369 gene locus_tag LOCUS_31430 1605 2369 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_31430 >Feature sequence0718 490 1188 gene locus_tag LOCUS_31440 490 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 >Feature sequence0719 1063 1959 gene locus_tag LOCUS_31450 gene ilvE 1063 1959 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583718.1 protein_id gnl|my_center|LOCUS_31450 >Feature sequence0720 1225 794 gene locus_tag LOCUS_31460 1225 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 2558 1569 gene locus_tag LOCUS_31470 2558 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 >Feature sequence0721 >Feature sequence0722 206 1339 gene locus_tag LOCUS_31480 206 1339 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_31480 2165 2512 gene locus_tag LOCUS_31490 2165 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 >Feature sequence0723 1603 230 gene locus_tag LOCUS_31500 1603 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 <2831 1630 gene locus_tag LOCUS_31510 <2831 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039037.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence0724 1233 25 gene locus_tag LOCUS_31520 gene nifS 1233 25 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_31520 1422 2462 gene locus_tag LOCUS_31530 1422 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence0725 124 909 gene locus_tag LOCUS_31540 124 909 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_31540 957 1373 gene locus_tag LOCUS_31550 957 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 1444 2688 gene locus_tag LOCUS_31560 1444 2688 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122402.1 protein_id gnl|my_center|LOCUS_31560 >Feature sequence0726 <1 725 gene locus_tag LOCUS_31570 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546561.1:RNA polymerase factor sigma-54 906 1460 gene locus_tag LOCUS_31580 gene raiA 906 1460 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_31580 1599 2231 gene locus_tag LOCUS_31590 1599 2231 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705502.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence0727 1208 447 gene locus_tag LOCUS_31600 1208 447 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582796.1 protein_id gnl|my_center|LOCUS_31600 1667 1269 gene locus_tag LOCUS_31610 1667 1269 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816150.1 protein_id gnl|my_center|LOCUS_31610 2663 1680 gene locus_tag LOCUS_31620 2663 1680 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence0728 2811 2422 gene locus_tag LOCUS_31630 2811 2422 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367419.1 protein_id gnl|my_center|LOCUS_31630 >Feature sequence0729 7 1491 gene locus_tag LOCUS_31640 7 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence0730 1972 1103 gene locus_tag LOCUS_31650 1972 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 <2802 2050 gene locus_tag LOCUS_31660 <2802 2050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368563.1:sugar phosphate isomerase/epimerase >Feature sequence0731 <2800 538 gene locus_tag LOCUS_31670 <2800 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020247.1:DEAD/DEAH box helicase >Feature sequence0732 466 1206 gene locus_tag LOCUS_31680 gene larB 466 1206 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_31680 1242 2357 gene locus_tag LOCUS_31690 1242 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence0733 <1 1625 gene locus_tag LOCUS_31700 <1 1625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966153.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0734 2570 27 gene locus_tag LOCUS_31710 2570 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence0735 1710 931 gene locus_tag LOCUS_31720 1710 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 >Feature sequence0736 1267 332 gene locus_tag LOCUS_31730 1267 332 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136856750.1 protein_id gnl|my_center|LOCUS_31730 1558 2268 gene locus_tag LOCUS_31740 1558 2268 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545137.1 protein_id gnl|my_center|LOCUS_31740 2381 2590 gene locus_tag LOCUS_31750 2381 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 >Feature sequence0737 804 1895 gene locus_tag LOCUS_31760 gene mnmA 804 1895 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence0738 2072 1599 gene locus_tag LOCUS_31770 2072 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence0739 1512 2027 gene locus_tag LOCUS_31780 1512 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence0740 >Feature sequence0741 1226 375 gene locus_tag LOCUS_31790 1226 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 2311 1229 gene locus_tag LOCUS_31800 2311 1229 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690162.1 protein_id gnl|my_center|LOCUS_31800 >Feature sequence0742 1379 1155 gene locus_tag LOCUS_31810 1379 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 1644 1360 gene locus_tag LOCUS_31820 1644 1360 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence0743 1031 87 gene locus_tag LOCUS_31830 1031 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1600 1316 gene locus_tag LOCUS_31840 1600 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 1854 2345 gene locus_tag LOCUS_31850 1854 2345 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792591.1 protein_id gnl|my_center|LOCUS_31850 >Feature sequence0744 <2751 164 gene locus_tag LOCUS_31860 <2751 164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037353.1:TonB-dependent receptor >Feature sequence0745 1591 2376 gene locus_tag LOCUS_31870 1591 2376 CDS product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 protein_id gnl|my_center|LOCUS_31870 >Feature sequence0746 1849 683 gene locus_tag LOCUS_31880 1849 683 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868783.1 protein_id gnl|my_center|LOCUS_31880 2138 1902 gene locus_tag LOCUS_31890 2138 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 2380 2138 gene locus_tag LOCUS_31900 2380 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence0747 159 1301 gene locus_tag LOCUS_31910 gene argE 159 1301 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 protein_id gnl|my_center|LOCUS_31910 1407 2534 gene locus_tag LOCUS_31920 1407 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 >Feature sequence0748 1038 64 gene locus_tag LOCUS_31930 gene fabD 1038 64 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_31930 2157 1171 gene locus_tag LOCUS_31940 2157 1171 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_31940 <2728 2226 gene locus_tag LOCUS_31950 <2728 2226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938504.1:phosphate acyltransferase PlsX >Feature sequence0749 570 1184 gene locus_tag LOCUS_31960 570 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 1314 1496 gene locus_tag LOCUS_31970 1314 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 1496 1762 gene locus_tag LOCUS_31980 1496 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence0750 111 830 gene locus_tag LOCUS_31990 gene pnuC 111 830 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_31990 827 1849 gene locus_tag LOCUS_32000 827 1849 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_32000 >Feature sequence0751 >Feature sequence0752 <1 670 gene locus_tag LOCUS_32010 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880423.1:hydantoinase/oxoprolinase family protein 731 2164 gene locus_tag LOCUS_32020 731 2164 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921072.1 protein_id gnl|my_center|LOCUS_32020 >Feature sequence0753 <1 897 gene locus_tag LOCUS_32030 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143789.1:MFS transporter 1627 1277 gene locus_tag LOCUS_32040 1627 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 >Feature sequence0754 <1 748 gene locus_tag LOCUS_32050 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003566292.1:glutamine-hydrolyzing GMP synthase 2017 857 gene locus_tag LOCUS_32060 2017 857 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_32060 2393 2067 gene locus_tag LOCUS_32070 2393 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 >Feature sequence0755 684 70 gene locus_tag LOCUS_32080 gene recR 684 70 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722062.1 protein_id gnl|my_center|LOCUS_32080 1134 829 gene locus_tag LOCUS_32090 1134 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence0756 880 59 gene locus_tag LOCUS_32100 880 59 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867541.1 protein_id gnl|my_center|LOCUS_32100 1774 884 gene locus_tag LOCUS_32110 1774 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 >Feature sequence0757 2515 2354 gene locus_tag LOCUS_32120 2515 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 >Feature sequence0758 1941 1117 gene locus_tag LOCUS_32130 gene prmC 1941 1117 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337836.1 protein_id gnl|my_center|LOCUS_32130 2148 2384 gene locus_tag LOCUS_32140 2148 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 2377 2658 gene locus_tag LOCUS_32150 2377 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence0759 261 989 gene locus_tag LOCUS_32160 261 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 1213 1749 gene locus_tag LOCUS_32170 gene rimP 1213 1749 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_32170 >Feature sequence0760 438 959 gene locus_tag LOCUS_32180 438 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 1721 1059 gene locus_tag LOCUS_32190 gene dnr 1721 1059 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_32190 1946 2287 gene locus_tag LOCUS_32200 gene trxA 1946 2287 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958643.1 protein_id gnl|my_center|LOCUS_32200 >Feature sequence0761 2466 643 gene locus_tag LOCUS_32210 2466 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 >Feature sequence0762 <1 784 gene locus_tag LOCUS_32220 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229567.1:succinate dehydrogenase flavoprotein subunit 781 1572 gene locus_tag LOCUS_32230 gene sdhB 781 1572 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139712.1 protein_id gnl|my_center|LOCUS_32230 >Feature sequence0763 2347 302 gene locus_tag LOCUS_32240 2347 302 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_32240 >Feature sequence0764 1310 990 gene locus_tag LOCUS_32250 1310 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 >Feature sequence0765 67 2646 gene locus_tag LOCUS_32260 67 2646 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_32260 >Feature sequence0766 418 56 gene locus_tag LOCUS_32270 418 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 499 1446 gene locus_tag LOCUS_32280 499 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 1698 2456 gene locus_tag LOCUS_32290 1698 2456 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 protein_id gnl|my_center|LOCUS_32290 >Feature sequence0767 1844 213 gene locus_tag LOCUS_32300 1844 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 <2662 1879 gene locus_tag LOCUS_32310 <2662 1879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064393.1:ABC transporter substrate-binding protein >Feature sequence0768 <1 656 gene locus_tag LOCUS_32320 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942139.1:type II secretion system F family protein 1030 1638 gene locus_tag LOCUS_32330 1030 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 1663 2601 gene locus_tag LOCUS_32340 1663 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence0769 882 370 gene locus_tag LOCUS_32350 882 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 2572 1256 gene locus_tag LOCUS_32360 2572 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence0770 409 801 gene locus_tag LOCUS_32370 409 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 1126 2655 gene locus_tag LOCUS_32380 1126 2655 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence0771 81 2498 gene locus_tag LOCUS_32390 81 2498 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_32390 >Feature sequence0772 514 1053 gene locus_tag LOCUS_32400 514 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence0773 436 164 gene locus_tag LOCUS_32410 436 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 706 1290 gene locus_tag LOCUS_32420 706 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 >Feature sequence0774 <1 671 gene locus_tag LOCUS_32430 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942274.1:type I glyceraldehyde-3-phosphate dehydrogenase 749 1948 gene locus_tag LOCUS_32440 749 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32440 >Feature sequence0775 <2635 1382 gene locus_tag LOCUS_32450 <2635 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391629.1:transcription-repair coupling factor >Feature sequence0776 2120 624 gene locus_tag LOCUS_32460 2120 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence0777 2002 1766 gene locus_tag LOCUS_32470 2002 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 <2633 2065 gene locus_tag LOCUS_32480 <2633 2065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029295.1:RNA polymerase sigma factor SigM note possible pseudo, internal stop codon >Feature sequence0778 1953 1564 gene locus_tag LOCUS_32490 1953 1564 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_32490 <2626 1987 gene locus_tag LOCUS_32500 <2626 1987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073230.1:DUF885 domain-containing protein >Feature sequence0779 1416 829 gene locus_tag LOCUS_32510 1416 829 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 protein_id gnl|my_center|LOCUS_32510 1651 2466 gene locus_tag LOCUS_32520 1651 2466 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803950.1 protein_id gnl|my_center|LOCUS_32520 >Feature sequence0780 >Feature sequence0781 99 2528 gene locus_tag LOCUS_32530 99 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence0782 1828 1616 gene locus_tag LOCUS_32540 1828 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence0783 837 1982 gene locus_tag LOCUS_32550 gene bshA 837 1982 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_32550 >Feature sequence0784 >Feature sequence0785 502 729 gene locus_tag LOCUS_32560 502 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 1004 1336 gene locus_tag LOCUS_32570 1004 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32570 1515 2507 gene locus_tag LOCUS_32580 1515 2507 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530704.1 protein_id gnl|my_center|LOCUS_32580 >Feature sequence0786 998 588 gene locus_tag LOCUS_32590 998 588 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_32590 <2581 1086 gene locus_tag LOCUS_32600 <2581 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940789.1:F0F1 ATP synthase subunit beta >Feature sequence0787 659 291 gene locus_tag LOCUS_32610 659 291 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880109.1 protein_id gnl|my_center|LOCUS_32610 1264 800 gene locus_tag LOCUS_32620 gene rlmH 1264 800 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695929.1 protein_id gnl|my_center|LOCUS_32620 2318 1296 gene locus_tag LOCUS_32630 2318 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence0788 698 1504 gene locus_tag LOCUS_32640 698 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 <2573 1580 gene locus_tag LOCUS_32650 <2573 1580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023977.1:TIGR03663 family protein >Feature sequence0789 <1 603 gene locus_tag LOCUS_32660 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545318.1:YebC/PmpR family DNA-binding transcriptional regulator 1479 718 gene locus_tag LOCUS_32670 1479 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 1772 2329 gene locus_tag LOCUS_32680 gene ruvC 1772 2329 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_32680 >Feature sequence0790 835 1827 gene locus_tag LOCUS_32690 835 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 2244 1885 gene locus_tag LOCUS_32700 2244 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 >Feature sequence0791 323 1393 gene locus_tag LOCUS_32710 323 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 >Feature sequence0792 <1 1696 gene locus_tag LOCUS_32720 <1 1696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:efflux RND transporter permease subunit >Feature sequence0793 879 806 gene locus_tag LOCUS_t00370 879 806 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0794 <1 1838 gene locus_tag LOCUS_32730 <1 1838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144060.1:serine/threonine-protein kinase >Feature sequence0795 153 1766 gene locus_tag LOCUS_32740 153 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 >Feature sequence0796 <1 926 gene locus_tag LOCUS_32750 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_187436936.1:peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein 1096 1617 gene locus_tag LOCUS_32760 1096 1617 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021906.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence0797 368 718 gene locus_tag LOCUS_32770 368 718 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948308.1 protein_id gnl|my_center|LOCUS_32770 741 1931 gene locus_tag LOCUS_32780 741 1931 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404943.1 protein_id gnl|my_center|LOCUS_32780 >Feature sequence0798 2010 625 gene locus_tag LOCUS_32790 2010 625 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055915.1 protein_id gnl|my_center|LOCUS_32790 >Feature sequence0799 1027 302 gene locus_tag LOCUS_32800 1027 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 >Feature sequence0800 1333 455 gene locus_tag LOCUS_32810 1333 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 1831 1334 gene locus_tag LOCUS_32820 1831 1334 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence0801 175 918 gene locus_tag LOCUS_32830 175 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 976 1617 gene locus_tag LOCUS_32840 976 1617 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402887.1 protein_id gnl|my_center|LOCUS_32840 2185 1718 gene locus_tag LOCUS_32850 2185 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence0802 243 800 gene locus_tag LOCUS_32860 243 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 876 1670 gene locus_tag LOCUS_32870 876 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 <2516 1682 gene locus_tag LOCUS_32880 <2516 1682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:CHAT domain-containing protein >Feature sequence0803 >Feature sequence0804 >Feature sequence0805 >Feature sequence0806 390 1499 gene locus_tag LOCUS_32890 390 1499 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005746663.1 protein_id gnl|my_center|LOCUS_32890 1593 1678 gene locus_tag LOCUS_t00380 1593 1678 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0807 >Feature sequence0808 511 1779 gene locus_tag LOCUS_32900 511 1779 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_32900 >Feature sequence0809 928 371 gene locus_tag LOCUS_32910 928 371 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392473.1 protein_id gnl|my_center|LOCUS_32910 1184 2257 gene locus_tag LOCUS_32920 1184 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 >Feature sequence0810 868 356 gene locus_tag LOCUS_32930 868 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 >Feature sequence0811 <1 657 gene locus_tag LOCUS_32940 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003732813.1:phosphatidate cytidylyltransferase 689 877 gene locus_tag LOCUS_32950 689 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 924 2123 gene locus_tag LOCUS_32960 924 2123 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_32960 >Feature sequence0812 748 1944 gene locus_tag LOCUS_32970 gene per 748 1944 CDS product GDP-perosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918896.1 protein_id gnl|my_center|LOCUS_32970 >Feature sequence0813 2336 1221 gene locus_tag LOCUS_32980 2336 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence0814 1867 1592 gene locus_tag LOCUS_32990 1867 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 <2470 1966 gene locus_tag LOCUS_33000 <2470 1966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258974.1:alpha-ketoacid dehydrogenase subunit beta >Feature sequence0815 >Feature sequence0816 <2462 1404 gene locus_tag LOCUS_33010 <2462 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940636.1:sigma 54-interacting transcriptional regulator >Feature sequence0817 455 147 gene locus_tag LOCUS_33020 455 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 815 480 gene locus_tag LOCUS_33030 815 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 2242 872 gene locus_tag LOCUS_33040 2242 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 >Feature sequence0818 147 220 gene locus_tag LOCUS_t00390 147 220 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 231 302 gene locus_tag LOCUS_t00400 231 302 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 315 389 gene locus_tag LOCUS_t00410 315 389 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 395 473 gene locus_tag LOCUS_t00420 395 473 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 481 556 gene locus_tag LOCUS_t00430 481 556 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 594 669 gene locus_tag LOCUS_t00440 594 669 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 698 771 gene locus_tag LOCUS_t00450 698 771 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 792 864 gene locus_tag LOCUS_t00460 792 864 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 875 946 gene locus_tag LOCUS_t00470 875 946 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 957 1031 gene locus_tag LOCUS_t00480 957 1031 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0819 <2438 1111 gene locus_tag LOCUS_33050 <2438 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942586.1:PEP-CTERM system histidine kinase PrsK >Feature sequence0820 <1 528 gene locus_tag LOCUS_33060 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767783.1:carbohydrate kinase 550 1515 gene locus_tag LOCUS_33070 550 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence0821 350 1387 gene locus_tag LOCUS_33080 350 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 1488 1561 gene locus_tag LOCUS_t00490 1488 1561 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2255 1839 gene locus_tag LOCUS_33090 2255 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33090 >Feature sequence0822 <1 826 gene locus_tag LOCUS_33100 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393655.1:NAD(P)H-hydrate dehydratase 823 1299 gene locus_tag LOCUS_33110 823 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 1411 1854 gene locus_tag LOCUS_33120 1411 1854 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923583.1 protein_id gnl|my_center|LOCUS_33120 >Feature sequence0823 <1 1493 gene locus_tag LOCUS_33130 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838717.1:prolyl oligopeptidase family serine peptidase >Feature sequence0824 201 467 gene locus_tag LOCUS_33140 201 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 470 2212 gene locus_tag LOCUS_33150 gene recJ 470 2212 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_33150 >Feature sequence0825 816 1292 gene locus_tag LOCUS_33160 816 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 1450 2352 gene locus_tag LOCUS_33170 1450 2352 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083634.1 protein_id gnl|my_center|LOCUS_33170 >Feature sequence0826 2144 1407 gene locus_tag LOCUS_33180 2144 1407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_33180 >Feature sequence0827 1 801 gene locus_tag LOCUS_33190 1 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 >Feature sequence0828 81 542 gene locus_tag LOCUS_33200 81 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 630 1241 gene locus_tag LOCUS_33210 gene yihA 630 1241 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_33210 >Feature sequence0829 306 2348 gene locus_tag LOCUS_33220 306 2348 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_33220 >Feature sequence0830 <1 1091 gene locus_tag LOCUS_33230 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008669087.1:PQQ-binding-like beta-propeller repeat protein <2407 1390 gene locus_tag LOCUS_33240 <2407 1390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122798.1:DUF58 domain-containing protein >Feature sequence0831 312 602 gene locus_tag LOCUS_33250 312 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 586 1089 gene locus_tag LOCUS_33260 586 1089 CDS product glycine/sarcosine/betaine reductase selenoprotein B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255959.1 protein_id gnl|my_center|LOCUS_33260 1117 1404 gene locus_tag LOCUS_33270 1117 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 1423 2361 gene locus_tag LOCUS_33280 1423 2361 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730493.1 protein_id gnl|my_center|LOCUS_33280 >Feature sequence0832 <1 759 gene locus_tag LOCUS_33290 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388708.1:phospho-N-acetylmuramoyl-pentapeptide-transferase 922 2373 gene locus_tag LOCUS_33300 gene murD 922 2373 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence0833 631 128 gene locus_tag LOCUS_33310 631 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 1328 606 gene locus_tag LOCUS_33320 gene nadD 1328 606 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296447.1 protein_id gnl|my_center|LOCUS_33320 2385 1333 gene locus_tag LOCUS_33330 gene obgE 2385 1333 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_33330 >Feature sequence0834 <1 1058 gene locus_tag LOCUS_33340 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962811.1:M28 family metallopeptidase >Feature sequence0835 >Feature sequence0836 1650 109 gene locus_tag LOCUS_33350 1650 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 <2400 1650 gene locus_tag LOCUS_33360 <2400 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530044.1:pitrilysin family protein >Feature sequence0837 1195 266 gene locus_tag LOCUS_33370 gene ftcD 1195 266 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_33370 1376 2353 gene locus_tag LOCUS_33380 1376 2353 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256411.1 protein_id gnl|my_center|LOCUS_33380 >Feature sequence0838 1803 1591 gene locus_tag LOCUS_33390 1803 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 <2397 1828 gene locus_tag LOCUS_33400 <2397 1828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933494.1:citrate synthase >Feature sequence0839 1063 167 gene locus_tag LOCUS_33410 gene dapF 1063 167 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_33410 1662 1096 gene locus_tag LOCUS_33420 1662 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 <2394 1770 gene locus_tag LOCUS_33430 <2394 1770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399303.1:D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase >Feature sequence0840 >Feature sequence0841 <1 1239 gene locus_tag LOCUS_33440 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640527.1:pitrilysin family protein 1517 1341 gene locus_tag LOCUS_33450 1517 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 <2391 1726 gene locus_tag LOCUS_33460 <2391 1726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459864.1:ribosome small subunit-dependent GTPase A >Feature sequence0842 7 612 gene locus_tag LOCUS_33470 7 612 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_33470 612 1607 gene locus_tag LOCUS_33480 612 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence0843 1155 715 gene locus_tag LOCUS_33490 1155 715 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732458.1 protein_id gnl|my_center|LOCUS_33490 1864 1130 gene locus_tag LOCUS_33500 1864 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence0844 <1 934 gene locus_tag LOCUS_33510 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404855.1:histidinol dehydrogenase 1008 2087 gene locus_tag LOCUS_33520 gene hisC 1008 2087 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927011.1 protein_id gnl|my_center|LOCUS_33520 >Feature sequence0845 402 1037 gene locus_tag LOCUS_33530 402 1037 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_33530 1101 1739 gene locus_tag LOCUS_33540 1101 1739 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742094.1 protein_id gnl|my_center|LOCUS_33540 1761 2066 gene locus_tag LOCUS_33550 1761 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 2370 2080 gene locus_tag LOCUS_33560 2370 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 >Feature sequence0846 1 195 gene locus_tag LOCUS_33570 1 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 239 1396 gene locus_tag LOCUS_33580 239 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 >Feature sequence0847 1316 2095 gene locus_tag LOCUS_33590 1316 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence0848 473 2227 gene locus_tag LOCUS_33600 473 2227 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_33600 >Feature sequence0849 <1 789 gene locus_tag LOCUS_33610 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035598.1:integron integrase 1005 853 gene locus_tag LOCUS_33620 1005 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 2146 1007 gene locus_tag LOCUS_33630 2146 1007 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_33630 >Feature sequence0850 <1 510 gene locus_tag LOCUS_33640 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257665.1:L-glutamate gamma-semialdehyde dehydrogenase 544 1488 gene locus_tag LOCUS_33650 544 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence0851 <1 957 gene locus_tag LOCUS_33660 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943657.1:amidohydrolase family protein 1029 1514 gene locus_tag LOCUS_33670 1029 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 2041 1733 gene locus_tag LOCUS_33680 2041 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence0852 1079 450 gene locus_tag LOCUS_33690 gene pyrE 1079 450 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583288.1 protein_id gnl|my_center|LOCUS_33690 1703 1257 gene locus_tag LOCUS_33700 1703 1257 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326890.1 protein_id gnl|my_center|LOCUS_33700 >Feature sequence0853 1904 1197 gene locus_tag LOCUS_33710 1904 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 >Feature sequence0854 26 259 gene locus_tag LOCUS_33720 26 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 >Feature sequence0855 918 124 gene locus_tag LOCUS_33730 918 124 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_33730 1597 983 gene locus_tag LOCUS_33740 1597 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 2031 1588 gene locus_tag LOCUS_33750 2031 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 2092 2283 gene locus_tag LOCUS_33760 2092 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 >Feature sequence0856 131 1630 gene locus_tag LOCUS_33770 131 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 <2349 1716 gene locus_tag LOCUS_33780 <2349 1716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030985.1:MBL fold metallo-hydrolase >Feature sequence0857 1753 974 gene locus_tag LOCUS_33790 1753 974 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_33790 <2349 1832 gene locus_tag LOCUS_33800 <2349 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925700.1:S9 family peptidase >Feature sequence0858 3 629 gene locus_tag LOCUS_33810 3 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 1228 788 gene locus_tag LOCUS_33820 1228 788 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 protein_id gnl|my_center|LOCUS_33820 <2343 1383 gene locus_tag LOCUS_33830 <2343 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659480.1:type II CAAX endopeptidase family protein >Feature sequence0859 719 1513 gene locus_tag LOCUS_33840 gene surE 719 1513 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880503.1 protein_id gnl|my_center|LOCUS_33840 1611 2228 gene locus_tag LOCUS_33850 1611 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 >Feature sequence0860 1424 888 gene locus_tag LOCUS_33860 1424 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 >Feature sequence0861 >Feature sequence0862 117 2198 gene locus_tag LOCUS_33870 117 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 >Feature sequence0863 533 997 gene locus_tag LOCUS_33880 533 997 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172656.1 protein_id gnl|my_center|LOCUS_33880 >Feature sequence0864 <1 1702 gene locus_tag LOCUS_33890 <1 1702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942427.1:GspE/PulE family protein >Feature sequence0865 1410 454 gene locus_tag LOCUS_33900 1410 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 <2304 1462 gene locus_tag LOCUS_33910 <2304 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941294.1:glycosyltransferase family 2 protein >Feature sequence0866 233 1261 gene locus_tag LOCUS_33920 233 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 1297 2064 gene locus_tag LOCUS_33930 1297 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 >Feature sequence0867 >Feature sequence0868 >Feature sequence0869 234 1925 gene locus_tag LOCUS_33940 234 1925 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_33940 >Feature sequence0870 2184 1540 gene locus_tag LOCUS_33950 2184 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 >Feature sequence0871 1 408 gene locus_tag LOCUS_33960 1 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 411 1673 gene locus_tag LOCUS_33970 411 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_33970 >Feature sequence0872 431 1636 gene locus_tag LOCUS_33980 431 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 >Feature sequence0873 2024 1068 gene locus_tag LOCUS_33990 2024 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 >Feature sequence0874 785 1810 gene locus_tag LOCUS_34000 785 1810 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_34000 >Feature sequence0875 1236 208 gene locus_tag LOCUS_34010 1236 208 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_34010 1929 1366 gene locus_tag LOCUS_34020 gene hpt 1929 1366 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_34020 >Feature sequence0876 1009 557 gene locus_tag LOCUS_34030 1009 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 1448 1026 gene locus_tag LOCUS_34040 gene cdd 1448 1026 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_34040 2120 1449 gene locus_tag LOCUS_34050 gene udk 2120 1449 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403303.1 protein_id gnl|my_center|LOCUS_34050 >Feature sequence0877 <2266 1677 gene locus_tag LOCUS_34060 <2266 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096587.1:chromate efflux transporter >Feature sequence0878 880 251 gene locus_tag LOCUS_34070 880 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 1370 1035 gene locus_tag LOCUS_34080 1370 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 1722 1504 gene locus_tag LOCUS_34090 1722 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 >Feature sequence0879 100 1152 gene locus_tag LOCUS_34100 100 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 >Feature sequence0880 393 953 gene locus_tag LOCUS_34110 393 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 1492 1037 gene locus_tag LOCUS_34120 1492 1037 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_34120 >Feature sequence0881 >Feature sequence0882 2187 1054 gene locus_tag LOCUS_34130 2187 1054 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 protein_id gnl|my_center|LOCUS_34130 >Feature sequence0883 1233 250 gene locus_tag LOCUS_34140 1233 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 2180 1248 gene locus_tag LOCUS_34150 2180 1248 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335393.1 protein_id gnl|my_center|LOCUS_34150 >Feature sequence0884 <1 2196 gene locus_tag LOCUS_34160 <1 2196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_095512366.1:endopeptidase La >Feature sequence0885 596 144 gene locus_tag LOCUS_34170 gene bcp 596 144 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257872.1 protein_id gnl|my_center|LOCUS_34170 1499 705 gene locus_tag LOCUS_34180 1499 705 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821952.1 protein_id gnl|my_center|LOCUS_34180 <2245 1496 gene locus_tag LOCUS_34190 <2245 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066875.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0886 >Feature sequence0887 665 204 gene locus_tag LOCUS_34200 665 204 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113663.1 protein_id gnl|my_center|LOCUS_34200 >Feature sequence0888 657 1706 gene locus_tag LOCUS_34210 657 1706 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538885.1 protein_id gnl|my_center|LOCUS_34210 >Feature sequence0889 <1 666 gene locus_tag LOCUS_34220 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259064.1:thiolase family protein 679 1128 gene locus_tag LOCUS_34230 679 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 >Feature sequence0890 851 627 gene locus_tag LOCUS_34240 851 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 1274 933 gene locus_tag LOCUS_34250 1274 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 1418 2122 gene locus_tag LOCUS_34260 1418 2122 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence0891 907 1857 gene locus_tag LOCUS_34270 907 1857 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232400.1 protein_id gnl|my_center|LOCUS_34270 >Feature sequence0892 619 2163 gene locus_tag LOCUS_34280 619 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 >Feature sequence0893 <1 879 gene locus_tag LOCUS_34290 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191270.1:leucyl aminopeptidase 883 1599 gene locus_tag LOCUS_34300 883 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 >Feature sequence0894 718 314 gene locus_tag LOCUS_34310 718 314 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_34310 1069 1914 gene locus_tag LOCUS_34320 1069 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 >Feature sequence0895 216 692 gene locus_tag LOCUS_34330 216 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 >Feature sequence0896 2109 766 gene locus_tag LOCUS_34340 2109 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence0897 57 824 gene locus_tag LOCUS_34350 57 824 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_34350 1487 864 gene locus_tag LOCUS_34360 1487 864 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_34360 1888 1484 gene locus_tag LOCUS_34370 1888 1484 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_34370 >Feature sequence0898 <1 1040 gene locus_tag LOCUS_34380 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942688.1:valine--tRNA ligase 1040 1894 gene locus_tag LOCUS_34390 gene nadC 1040 1894 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 protein_id gnl|my_center|LOCUS_34390 >Feature sequence0899 1008 1928 gene locus_tag LOCUS_34400 1008 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 >Feature sequence0900 1686 784 gene locus_tag LOCUS_34410 gene lepB 1686 784 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933117.1 protein_id gnl|my_center|LOCUS_34410 2071 1694 gene locus_tag LOCUS_34420 2071 1694 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222744.1 protein_id gnl|my_center|LOCUS_34420 >Feature sequence0901 <2196 545 gene locus_tag LOCUS_34430 <2196 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839612.1:TonB-dependent receptor >Feature sequence0902 >Feature sequence0903 >Feature sequence0904 1220 120 gene locus_tag LOCUS_34440 1220 120 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897464.1 protein_id gnl|my_center|LOCUS_34440 2080 1265 gene locus_tag LOCUS_34450 2080 1265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761990.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence0905 1417 200 gene locus_tag LOCUS_34460 1417 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34460 >Feature sequence0906 >Feature sequence0907 402 160 gene locus_tag LOCUS_34470 402 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 1210 479 gene locus_tag LOCUS_34480 1210 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34480 1197 1394 gene locus_tag LOCUS_34490 1197 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 >Feature sequence0908 232 489 gene locus_tag LOCUS_34500 232 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 477 845 gene locus_tag LOCUS_34510 477 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 >Feature sequence0909 <1 952 gene locus_tag LOCUS_34520 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259376.1:magnesium/cobalt transporter CorA 949 1299 gene locus_tag LOCUS_34530 949 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 <2164 1381 gene locus_tag LOCUS_34540 <2164 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942919.1:hemolysin family protein >Feature sequence0910 664 59 gene locus_tag LOCUS_34550 664 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 2052 679 gene locus_tag LOCUS_34560 2052 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 >Feature sequence0911 294 1496 gene locus_tag LOCUS_34570 294 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 >Feature sequence0912 322 1236 gene locus_tag LOCUS_34580 322 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 1260 1955 gene locus_tag LOCUS_34590 1260 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence0913 955 185 gene locus_tag LOCUS_34600 955 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 1929 1093 gene locus_tag LOCUS_34610 1929 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 >Feature sequence0914 2 967 gene locus_tag LOCUS_34620 2 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 >Feature sequence0915 536 1543 gene locus_tag LOCUS_34630 536 1543 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_34630 >Feature sequence0916 1451 447 gene locus_tag LOCUS_34640 1451 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 <2153 1505 gene locus_tag LOCUS_34650 <2153 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706971.1:PBP1A family penicillin-binding protein >Feature sequence0917 2043 865 gene locus_tag LOCUS_34660 2043 865 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_34660 >Feature sequence0918 >Feature sequence0919 3 704 gene locus_tag LOCUS_34670 3 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 734 1456 gene locus_tag LOCUS_34680 734 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 >Feature sequence0920 1867 938 gene locus_tag LOCUS_34690 1867 938 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431317.1 protein_id gnl|my_center|LOCUS_34690 >Feature sequence0921 1349 951 gene locus_tag LOCUS_34700 gene nuoK 1349 951 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813222.1 protein_id gnl|my_center|LOCUS_34700 2043 1366 gene locus_tag LOCUS_34710 2043 1366 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888135.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence0922 633 370 gene locus_tag LOCUS_34720 633 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 >Feature sequence0923 <2125 1465 gene locus_tag LOCUS_34730 <2125 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109265.1:VWA domain-containing protein >Feature sequence0924 <2118 335 gene locus_tag LOCUS_34740 <2118 335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141201.1:ABC transporter permease >Feature sequence0925 3 1508 gene locus_tag LOCUS_34750 3 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 >Feature sequence0926 365 1738 gene locus_tag LOCUS_34760 365 1738 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303183.1 protein_id gnl|my_center|LOCUS_34760 >Feature sequence0927 <2104 423 gene locus_tag LOCUS_34770 <2104 423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089497.1:bifunctional transaldolase/phosoglucose isomerase >Feature sequence0928 >Feature sequence0929 2008 1034 gene locus_tag LOCUS_34780 2008 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34780 >Feature sequence0930 667 218 gene locus_tag LOCUS_34790 667 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 1870 707 gene locus_tag LOCUS_34800 1870 707 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838120.1 protein_id gnl|my_center|LOCUS_34800 >Feature sequence0931 1522 1034 gene locus_tag LOCUS_34810 1522 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 >Feature sequence0932 <1 673 gene locus_tag LOCUS_34820 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000551259.1:lipid A ABC transporter ATP-binding protein/permease MsbA 826 1911 gene locus_tag LOCUS_34830 gene serC 826 1911 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_34830 >Feature sequence0933 665 1051 gene locus_tag LOCUS_34840 665 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence0934 312 662 gene locus_tag LOCUS_34850 312 662 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812220.1 protein_id gnl|my_center|LOCUS_34850 659 1099 gene locus_tag LOCUS_34860 659 1099 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035332.1 protein_id gnl|my_center|LOCUS_34860 1542 1390 gene locus_tag LOCUS_34870 1542 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 >Feature sequence0935 >Feature sequence0936 >Feature sequence0937 <1 1278 gene locus_tag LOCUS_34880 <1 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969512.1:TolB family protein <2067 1271 gene locus_tag LOCUS_34890 <2067 1271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015839.1:DMT family transporter >Feature sequence0938 514 1446 gene locus_tag LOCUS_34900 514 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 <2064 1508 gene locus_tag LOCUS_34910 <2064 1508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203082.1:SpoIIE family protein phosphatase >Feature sequence0939 1107 397 gene locus_tag LOCUS_34920 1107 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 <2059 1130 gene locus_tag LOCUS_34930 <2059 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256756.1:M20/M25/M40 family metallo-hydrolase >Feature sequence0940 >Feature sequence0941 272 781 gene locus_tag LOCUS_34940 272 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 1027 797 gene locus_tag LOCUS_34950 1027 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 <2051 1127 gene locus_tag LOCUS_34960 <2051 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010080872.1:quinolinate synthase NadA >Feature sequence0942 194 1189 gene locus_tag LOCUS_34970 194 1189 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479569.1 protein_id gnl|my_center|LOCUS_34970 1512 1721 gene locus_tag LOCUS_34980 1512 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 >Feature sequence0943 194 589 gene locus_tag LOCUS_34990 194 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 655 1362 gene locus_tag LOCUS_35000 655 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 >Feature sequence0944 1914 370 gene locus_tag LOCUS_35010 gene malQ 1914 370 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_35010 >Feature sequence0945 1618 443 gene locus_tag LOCUS_35020 1618 443 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_35020 2044 1685 gene locus_tag LOCUS_35030 2044 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 >Feature sequence0946 211 1875 gene locus_tag LOCUS_35040 211 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 >Feature sequence0947 >Feature sequence0948 1021 410 gene locus_tag LOCUS_35050 1021 410 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_35050 1709 1098 gene locus_tag LOCUS_35060 1709 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 2035 1808 gene locus_tag LOCUS_35070 2035 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 >Feature sequence0949 2036 1659 gene locus_tag LOCUS_35080 2036 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 >Feature sequence0950 788 111 gene locus_tag LOCUS_35090 788 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 1846 848 gene locus_tag LOCUS_35100 1846 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 >Feature sequence0951 >Feature sequence0952 665 339 gene locus_tag LOCUS_35110 665 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 867 640 gene locus_tag LOCUS_35120 867 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 <2032 906 gene locus_tag LOCUS_35130 <2032 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877513.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence0953 133 582 gene locus_tag LOCUS_35140 133 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 599 934 gene locus_tag LOCUS_35150 599 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 >Feature sequence0954 <1 1762 gene locus_tag LOCUS_35160 <1 1762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256937.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence0955 1359 580 gene locus_tag LOCUS_35170 1359 580 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447223.1 protein_id gnl|my_center|LOCUS_35170 1800 1504 gene locus_tag LOCUS_35180 1800 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 >Feature sequence0956 760 125 gene locus_tag LOCUS_35190 760 125 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_35190 1819 1112 gene locus_tag LOCUS_35200 1819 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 >Feature sequence0957 >Feature sequence0958 >Feature sequence0959 >Feature sequence0960 597 1352 gene locus_tag LOCUS_35210 597 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922325.1 protein_id gnl|my_center|LOCUS_35210 >Feature sequence0961 <1 1013 gene locus_tag LOCUS_35220 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060909.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) >Feature sequence0962 <1 1071 gene locus_tag LOCUS_35230 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202701.1:sensor histidine kinase 1225 1914 gene locus_tag LOCUS_35240 1225 1914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_35240 >Feature sequence0963 <1998 1349 gene locus_tag LOCUS_35250 <1998 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013844854.1:tetratricopeptide repeat protein >Feature sequence0964 1499 450 gene locus_tag LOCUS_35260 gene ruvB 1499 450 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_35260 >Feature sequence0965 >Feature sequence0966 <1 646 gene locus_tag LOCUS_35270 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943689.1:cell division protein FtsA 791 1933 gene locus_tag LOCUS_35280 gene ftsZ 791 1933 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_35280 >Feature sequence0967 <1 526 gene locus_tag LOCUS_35290 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058107.1:serine hydrolase 1303 647 gene locus_tag LOCUS_35300 1303 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence0968 321 1196 gene locus_tag LOCUS_35310 gene galU 321 1196 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_35310 1215 1973 gene locus_tag LOCUS_35320 gene fabG 1215 1973 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_35320 >Feature sequence0969 700 407 gene locus_tag LOCUS_35330 700 407 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530048.1 protein_id gnl|my_center|LOCUS_35330 1325 738 gene locus_tag LOCUS_35340 1325 738 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073224.1 protein_id gnl|my_center|LOCUS_35340 <1977 1374 gene locus_tag LOCUS_35350 <1977 1374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256816.1:YggS family pyridoxal phosphate-dependent enzyme >Feature sequence0970 845 78 gene locus_tag LOCUS_35360 845 78 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258719.1 protein_id gnl|my_center|LOCUS_35360 1228 1533 gene locus_tag LOCUS_35370 1228 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence0971 <1 1903 gene locus_tag LOCUS_35380 <1 1903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541506.1:translation initiation factor IF-2 >Feature sequence0972 <1 1250 gene locus_tag LOCUS_35390 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967087.1:type II and III secretion system protein family protein >Feature sequence0973 884 264 gene locus_tag LOCUS_35400 884 264 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_35400 1510 968 gene locus_tag LOCUS_35410 1510 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 >Feature sequence0974 <1966 1245 gene locus_tag LOCUS_35420 <1966 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480304.1:SDR family oxidoreductase >Feature sequence0975 >Feature sequence0976 810 34 gene locus_tag LOCUS_35430 810 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 <1958 1049 gene locus_tag LOCUS_35440 <1958 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813606.1:beta-N-acetylhexosaminidase >Feature sequence0977 >Feature sequence0978 >Feature sequence0979 1651 236 gene locus_tag LOCUS_35450 1651 236 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_35450 >Feature sequence0980 85 483 gene locus_tag LOCUS_35460 85 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 >Feature sequence0981 1536 187 gene locus_tag LOCUS_35470 1536 187 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_35470 >Feature sequence0982 930 676 gene locus_tag LOCUS_35480 930 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 1836 934 gene locus_tag LOCUS_35490 1836 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence0983 1221 442 gene locus_tag LOCUS_35500 gene queC 1221 442 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_35500 1928 1221 gene locus_tag LOCUS_35510 gene queE 1928 1221 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_35510 >Feature sequence0984 989 303 gene locus_tag LOCUS_35520 989 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 1780 989 gene locus_tag LOCUS_35530 1780 989 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_35530 >Feature sequence0985 <1 1254 gene locus_tag LOCUS_35540 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941019.1:NADH-quinone oxidoreductase subunit N 1429 1247 gene locus_tag LOCUS_35550 1429 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence0986 455 904 gene locus_tag LOCUS_35560 455 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_35560 951 1505 gene locus_tag LOCUS_35570 951 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 >Feature sequence0987 612 199 gene locus_tag LOCUS_35580 612 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 <1893 664 gene locus_tag LOCUS_35590 <1893 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969255.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence0988 >Feature sequence0989 <1 1494 gene locus_tag LOCUS_35600 <1 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250640.1:S8 family serine peptidase >Feature sequence0990 <1885 783 gene locus_tag LOCUS_35610 <1885 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421524.1:amidase >Feature sequence0991 935 1165 gene locus_tag LOCUS_35620 935 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142425.1 protein_id gnl|my_center|LOCUS_35620 1162 1581 gene locus_tag LOCUS_35630 1162 1581 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_35630 >Feature sequence0992 >Feature sequence0993 1581 1099 gene locus_tag LOCUS_35640 1581 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 >Feature sequence0994 1519 1292 gene locus_tag LOCUS_35650 1519 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 1709 1503 gene locus_tag LOCUS_35660 1709 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 >Feature sequence0995 229 1488 gene locus_tag LOCUS_35670 gene tyrS 229 1488 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_35670 >Feature sequence0996 >Feature sequence0997 830 1069 gene locus_tag LOCUS_35680 830 1069 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_35680 1284 1847 gene locus_tag LOCUS_35690 gene efp 1284 1847 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_35690 >Feature sequence0998 <1857 869 gene locus_tag LOCUS_35700 <1857 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839930.1:N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase >Feature sequence0999 <1856 671 gene locus_tag LOCUS_35710 <1856 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838717.1:prolyl oligopeptidase family serine peptidase >Feature sequence1000 753 361 gene locus_tag LOCUS_35720 753 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 1500 901 gene locus_tag LOCUS_35730 gene rsmD 1500 901 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_35730 >Feature sequence1001 568 365 gene locus_tag LOCUS_35740 568 365 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_35740 838 1146 gene locus_tag LOCUS_35750 gene clpS 838 1146 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 protein_id gnl|my_center|LOCUS_35750 >Feature sequence1002 >Feature sequence1003 <1848 406 gene locus_tag LOCUS_35760 <1848 406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793715.1:S41 family peptidase >Feature sequence1004 <1847 142 gene locus_tag LOCUS_35770 <1847 142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226381.1:rhamnose ABC transporter substrate-binding protein >Feature sequence1005 3 356 gene locus_tag LOCUS_35780 3 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 431 1075 gene locus_tag LOCUS_35790 431 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 1409 1170 gene locus_tag LOCUS_35800 1409 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 1747 1664 gene locus_tag LOCUS_t00500 1747 1664 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1006 594 151 gene locus_tag LOCUS_35810 594 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 <1845 630 gene locus_tag LOCUS_35820 <1845 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000823087.1:ribonuclease J >Feature sequence1007 >Feature sequence1008 107 1135 gene locus_tag LOCUS_35830 107 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 1336 1779 gene locus_tag LOCUS_35840 gene nuoA 1336 1779 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179272.1 protein_id gnl|my_center|LOCUS_35840 >Feature sequence1009 1269 340 gene locus_tag LOCUS_35850 1269 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 >Feature sequence1010 <1828 933 gene locus_tag LOCUS_35860 <1828 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001291001.1:CHASE2 domain-containing protein >Feature sequence1011 >Feature sequence1012 1157 1411 gene locus_tag LOCUS_35870 1157 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 >Feature sequence1013 420 1127 gene locus_tag LOCUS_35880 gene rplA 420 1127 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_35880 1145 1678 gene locus_tag LOCUS_35890 gene rplJ 1145 1678 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048982.1 protein_id gnl|my_center|LOCUS_35890 >Feature sequence1014 509 1144 gene locus_tag LOCUS_35900 509 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 >Feature sequence1015 >Feature sequence1016 689 309 gene locus_tag LOCUS_35910 689 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 >Feature sequence1017 <1811 844 gene locus_tag LOCUS_35920 <1811 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459135.1:sigma-54 dependent transcriptional regulator >Feature sequence1018 >Feature sequence1019 236 859 gene locus_tag LOCUS_35930 236 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 1160 945 gene locus_tag LOCUS_35940 1160 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 1666 1244 gene locus_tag LOCUS_35950 1666 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 >Feature sequence1020 <1798 750 gene locus_tag LOCUS_35960 <1798 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482575.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD >Feature sequence1021 1638 955 gene locus_tag LOCUS_35970 1638 955 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887744.1 protein_id gnl|my_center|LOCUS_35970 >Feature sequence1022 170 913 gene locus_tag LOCUS_35980 170 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 938 1405 gene locus_tag LOCUS_35990 938 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 >Feature sequence1023 <1785 278 gene locus_tag LOCUS_36000 <1785 278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929471.1:signal peptide peptidase SppA >Feature sequence1024 >Feature sequence1025 1580 678 gene locus_tag LOCUS_36010 1580 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928996.1 protein_id gnl|my_center|LOCUS_36010 >Feature sequence1026 1614 304 gene locus_tag LOCUS_36020 1614 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 >Feature sequence1027 1 414 gene locus_tag LOCUS_36030 1 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 514 915 gene locus_tag LOCUS_36040 514 915 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_36040 1689 946 gene locus_tag LOCUS_36050 1689 946 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258173.1 protein_id gnl|my_center|LOCUS_36050 >Feature sequence1028 522 1298 gene locus_tag LOCUS_36060 522 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 >Feature sequence1029 <1 931 gene locus_tag LOCUS_36070 <1 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250243.1:phosphoenolpyruvate synthase 1059 1499 gene locus_tag LOCUS_36080 1059 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence1030 >Feature sequence1031 578 267 gene locus_tag LOCUS_36090 578 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 <1756 633 gene locus_tag LOCUS_36100 <1756 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028539.1:VWA domain-containing protein >Feature sequence1032 <1 1219 gene locus_tag LOCUS_36110 <1 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920029.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha >Feature sequence1033 <1 684 gene locus_tag LOCUS_36120 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877391.1:dTDP-glucose 4,6-dehydratase 804 1664 gene locus_tag LOCUS_36130 gene rfbD 804 1664 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_36130 >Feature sequence1034 83 1501 gene locus_tag LOCUS_36140 83 1501 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_36140 >Feature sequence1035 125 907 gene locus_tag LOCUS_36150 125 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 >Feature sequence1036 <1 567 gene locus_tag LOCUS_36160 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460653.1:orotate phosphoribosyltransferase 698 1447 gene locus_tag LOCUS_36170 gene truA 698 1447 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970846.1 protein_id gnl|my_center|LOCUS_36170 >Feature sequence1037 >Feature sequence1038 >Feature sequence1039 991 650 gene locus_tag LOCUS_36180 991 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 <1740 1107 gene locus_tag LOCUS_36190 <1740 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976090.1:CBS domain-containing protein >Feature sequence1040 1133 540 gene locus_tag LOCUS_36200 1133 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 1322 1651 gene locus_tag LOCUS_36210 1322 1651 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941967.1 protein_id gnl|my_center|LOCUS_36210 >Feature sequence1041 >Feature sequence1042 >Feature sequence1043 1194 556 gene locus_tag LOCUS_36220 gene hisG 1194 556 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393532.1 protein_id gnl|my_center|LOCUS_36220 >Feature sequence1044 >Feature sequence1045 >Feature sequence1046 <1 1577 gene locus_tag LOCUS_36230 <1 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546627.1:DNA-directed RNA polymerase subunit beta >Feature sequence1047 >Feature sequence1048 346 1437 gene locus_tag LOCUS_36240 346 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 >Feature sequence1049 >Feature sequence1050 <1 1088 gene locus_tag LOCUS_36250 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143163.1:amidohydrolase family protein >Feature sequence1051 3 230 gene locus_tag LOCUS_36260 3 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 320 553 gene locus_tag LOCUS_36270 320 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 550 876 gene locus_tag LOCUS_36280 gene mazF3 550 876 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405820.1 protein_id gnl|my_center|LOCUS_36280 >Feature sequence1052 <1 824 gene locus_tag LOCUS_36290 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942302.1:diguanylate cyclase >Feature sequence1053 1126 281 gene locus_tag LOCUS_36300 1126 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 <1699 1166 gene locus_tag LOCUS_36310 <1699 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021695.1:PFL family protein >Feature sequence1054 1125 184 gene locus_tag LOCUS_36320 1125 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 <1695 1141 gene locus_tag LOCUS_36330 <1695 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246108.1:segregation/condensation protein A >Feature sequence1055 <1 1243 gene locus_tag LOCUS_36340 <1 1243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207301211.1:transketolase 1689 1252 gene locus_tag LOCUS_36350 1689 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 >Feature sequence1056 1437 229 gene locus_tag LOCUS_36360 1437 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 >Feature sequence1057 <1 1177 gene locus_tag LOCUS_36370 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626057.1:caspase family protein >Feature sequence1058 575 1090 gene locus_tag LOCUS_36380 gene def 575 1090 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_36380 >Feature sequence1059 943 89 gene locus_tag LOCUS_36390 gene ccsB 943 89 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_36390 1089 1667 gene locus_tag LOCUS_36400 1089 1667 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_36400 >Feature sequence1060 835 299 gene locus_tag LOCUS_36410 835 299 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974105.1 protein_id gnl|my_center|LOCUS_36410 1302 1144 gene locus_tag LOCUS_36420 1302 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 >Feature sequence1061 <1680 892 gene locus_tag LOCUS_36430 <1680 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546244.1:acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase >Feature sequence1062 1078 95 gene locus_tag LOCUS_36440 1078 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 <1677 1159 gene locus_tag LOCUS_36450 <1677 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943082.1:pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha >Feature sequence1063 <1 1167 gene locus_tag LOCUS_36460 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966601.1:Nramp family divalent metal transporter >Feature sequence1064 235 1635 gene locus_tag LOCUS_36470 235 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 >Feature sequence1065 <1667 584 gene locus_tag LOCUS_36480 <1667 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140133.1:oligopeptidase B >Feature sequence1066 3 506 gene locus_tag LOCUS_36490 3 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 >Feature sequence1067 259 1125 gene locus_tag LOCUS_36500 259 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 >Feature sequence1068 1426 473 gene locus_tag LOCUS_36510 1426 473 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798653.1 protein_id gnl|my_center|LOCUS_36510 >Feature sequence1069 67 1272 gene locus_tag LOCUS_36520 67 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 >Feature sequence1070 <1 519 gene locus_tag LOCUS_36530 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324826.1:50S ribosomal protein L25 591 1154 gene locus_tag LOCUS_36540 gene pth 591 1154 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_36540 >Feature sequence1071 <1 1263 gene locus_tag LOCUS_36550 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000677374.1:NTPase >Feature sequence1072 >Feature sequence1073 >Feature sequence1074 284 985 gene locus_tag LOCUS_36560 284 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence1075 >Feature sequence1076 >Feature sequence1077 <1 861 gene locus_tag LOCUS_36570 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941921.1:translation elongation factor 4 861 1112 gene locus_tag LOCUS_36580 861 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 1109 1471 gene locus_tag LOCUS_36590 1109 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 >Feature sequence1078 <1631 125 gene locus_tag LOCUS_36600 <1631 125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141364.1:DEAD/DEAH box helicase family protein >Feature sequence1079 20 1009 gene locus_tag LOCUS_36610 gene msrP 20 1009 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065083.1 protein_id gnl|my_center|LOCUS_36610 >Feature sequence1080 >Feature sequence1081 >Feature sequence1082 >Feature sequence1083 >Feature sequence1084 1380 184 gene locus_tag LOCUS_36620 1380 184 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 protein_id gnl|my_center|LOCUS_36620 >Feature sequence1085 375 953 gene locus_tag LOCUS_36630 gene kdpC 375 953 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529646.1 protein_id gnl|my_center|LOCUS_36630 >Feature sequence1086 >Feature sequence1087 86 1225 gene locus_tag LOCUS_36640 86 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 >Feature sequence1088 635 1438 gene locus_tag LOCUS_36650 635 1438 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928448.1 protein_id gnl|my_center|LOCUS_36650 >Feature sequence1089 820 1338 gene locus_tag LOCUS_36660 820 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 >Feature sequence1090 <1 1304 gene locus_tag LOCUS_36670 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141470.1:S9 family peptidase >Feature sequence1091 719 1210 gene locus_tag LOCUS_36680 719 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 >Feature sequence1092 <1 1347 gene locus_tag LOCUS_36690 <1 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869951.1:penicillin-binding protein 2 >Feature sequence1093 >Feature sequence1094 407 985 gene locus_tag LOCUS_36700 407 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 >Feature sequence1095 >Feature sequence1096 773 468 gene locus_tag LOCUS_36710 773 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 <1549 779 gene locus_tag LOCUS_36720 <1549 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942541.1:3-deoxy-manno-octulosonate cytidylyltransferase >Feature sequence1097 <1548 770 gene locus_tag LOCUS_36730 <1548 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938754.1:glutamyl-tRNA reductase >Feature sequence1098 <1 1458 gene locus_tag LOCUS_36740 <1 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546857.1:outer membrane protein assembly factor BamA >Feature sequence1099 901 1428 gene locus_tag LOCUS_36750 901 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 >Feature sequence1100 >Feature sequence1101 426 743 gene locus_tag LOCUS_36760 426 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 747 1214 gene locus_tag LOCUS_36770 747 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence1102 1436 42 gene locus_tag LOCUS_36780 1436 42 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454549.1 protein_id gnl|my_center|LOCUS_36780 >Feature sequence1103 >Feature sequence1104 <1 1366 gene locus_tag LOCUS_36790 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943687.1:radical SAM protein >Feature sequence1105 >Feature sequence1106 <1 753 gene locus_tag LOCUS_36800 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975270.1:xanthine dehydrogenase family protein subunit M 825 1124 gene locus_tag LOCUS_36810 825 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810