>Feature sequence001 <1 821 gene locus_tag LOCUS_00010 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003119007.1:2,3-butanediol dehydrogenase 916 1698 gene locus_tag LOCUS_00020 916 1698 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_00020 2132 1878 gene locus_tag LOCUS_00030 2132 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2342 2193 gene locus_tag LOCUS_00040 2342 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2382 3479 gene locus_tag LOCUS_00050 2382 3479 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816110.1 protein_id gnl|my_center|LOCUS_00050 4655 3903 gene locus_tag LOCUS_00060 4655 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6862 4676 gene locus_tag LOCUS_00070 gene pnp 6862 4676 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_00070 7256 6987 gene locus_tag LOCUS_00080 gene rpsO 7256 6987 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257912.1 protein_id gnl|my_center|LOCUS_00080 7372 8310 gene locus_tag LOCUS_00090 gene trmD 7372 8310 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_00090 8403 8756 gene locus_tag LOCUS_00100 gene rplS 8403 8756 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257535.1 protein_id gnl|my_center|LOCUS_00100 8756 9403 gene locus_tag LOCUS_00110 8756 9403 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_00110 9964 9797 gene locus_tag LOCUS_00120 9964 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10776 9961 gene locus_tag LOCUS_00130 10776 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11803 11123 gene locus_tag LOCUS_00140 11803 11123 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_00140 12452 12027 gene locus_tag LOCUS_00150 12452 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 >Feature sequence002 1303 1680 gene locus_tag LOCUS_00160 1303 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 1726 5187 gene locus_tag LOCUS_00170 1726 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 5349 5143 gene locus_tag LOCUS_00180 5349 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 5391 7817 gene locus_tag LOCUS_00190 5391 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 7949 9958 gene locus_tag LOCUS_00200 7949 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 >Feature sequence003 403 1476 gene locus_tag LOCUS_00210 403 1476 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259751.1 protein_id gnl|my_center|LOCUS_00210 1680 2981 gene locus_tag LOCUS_00220 gene eno 1680 2981 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_00220 5252 3177 gene locus_tag LOCUS_00230 5252 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 5816 6157 gene locus_tag LOCUS_00240 5816 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 6240 7676 gene locus_tag LOCUS_00250 6240 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 7903 9762 gene locus_tag LOCUS_00260 gene uvrC 7903 9762 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257899.1 protein_id gnl|my_center|LOCUS_00260 9774 10292 gene locus_tag LOCUS_00270 9774 10292 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228008.1 protein_id gnl|my_center|LOCUS_00270 11567 10680 gene locus_tag LOCUS_00280 11567 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00280 11944 11558 gene locus_tag LOCUS_00290 11944 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00290 >Feature sequence004 1982 711 gene locus_tag LOCUS_00300 1982 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 2836 1982 gene locus_tag LOCUS_00310 2836 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545127.1 protein_id gnl|my_center|LOCUS_00310 3289 2840 gene locus_tag LOCUS_00320 3289 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546344.1 protein_id gnl|my_center|LOCUS_00320 4248 3286 gene locus_tag LOCUS_00330 gene cmr4 4248 3286 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546538.1 protein_id gnl|my_center|LOCUS_00330 7687 4235 gene locus_tag LOCUS_00340 7687 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 8109 7684 gene locus_tag LOCUS_00350 8109 7684 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846630.1 protein_id gnl|my_center|LOCUS_00350 8627 8106 gene locus_tag LOCUS_00360 8627 8106 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846827.1 protein_id gnl|my_center|LOCUS_00360 10054 8624 gene locus_tag LOCUS_00370 10054 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 11253 10051 gene locus_tag LOCUS_00380 gene cmr1 11253 10051 CDS product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855653.1 protein_id gnl|my_center|LOCUS_00380 >Feature sequence005 92 1102 gene locus_tag LOCUS_00390 92 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876151.1 protein_id gnl|my_center|LOCUS_00390 1099 2202 gene locus_tag LOCUS_00400 1099 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 2688 4034 gene locus_tag LOCUS_00410 2688 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 4243 5583 gene locus_tag LOCUS_00420 4243 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 5540 5719 gene locus_tag LOCUS_00430 5540 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 5894 5709 gene locus_tag LOCUS_00440 5894 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 6148 5903 gene locus_tag LOCUS_00450 6148 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 7121 6381 gene locus_tag LOCUS_00460 7121 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 9124 7118 gene locus_tag LOCUS_00470 gene pglZ 9124 7118 CDS product BREX-3 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870227.1 protein_id gnl|my_center|LOCUS_00470 9702 9292 gene locus_tag LOCUS_00480 9702 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 9971 9699 gene locus_tag LOCUS_00490 9971 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 10716 9976 gene locus_tag LOCUS_00500 10716 9976 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929490.1 protein_id gnl|my_center|LOCUS_00500 11246 10905 gene locus_tag LOCUS_00510 11246 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 >Feature sequence006 <1 581 gene locus_tag LOCUS_00520 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258554.1:fused MFS/spermidine synthase 881 2827 gene locus_tag LOCUS_00530 881 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 3262 2885 gene locus_tag LOCUS_00540 3262 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809191.1 protein_id gnl|my_center|LOCUS_00540 4081 4314 gene locus_tag LOCUS_00550 4081 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 4483 4740 gene locus_tag LOCUS_00560 4483 4740 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_00560 4733 5230 gene locus_tag LOCUS_00570 4733 5230 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 protein_id gnl|my_center|LOCUS_00570 6443 5310 gene locus_tag LOCUS_00580 6443 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 6655 7014 gene locus_tag LOCUS_00590 6655 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 7650 7240 gene locus_tag LOCUS_00600 7650 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 8310 7861 gene locus_tag LOCUS_00610 8310 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 10235 10405 gene locus_tag LOCUS_00620 10235 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00620 10434 10994 gene locus_tag LOCUS_00630 10434 10994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00630 >Feature sequence007 2055 388 gene locus_tag LOCUS_00640 gene hutU 2055 388 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256864.1 protein_id gnl|my_center|LOCUS_00640 2490 4850 gene locus_tag LOCUS_00650 2490 4850 CDS product interleukin-like EMT inducer domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141609734.1 protein_id gnl|my_center|LOCUS_00650 5128 7431 gene locus_tag LOCUS_00660 5128 7431 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00660 7428 7859 gene locus_tag LOCUS_00670 7428 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00670 9084 7912 gene locus_tag LOCUS_00680 9084 7912 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258460.1 protein_id gnl|my_center|LOCUS_00680 >Feature sequence008 1941 517 gene locus_tag LOCUS_00690 1941 517 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_00690 5017 1934 gene locus_tag LOCUS_00700 5017 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 7937 5010 gene locus_tag LOCUS_00710 7937 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 8873 8145 gene locus_tag LOCUS_00720 8873 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 >Feature sequence009 183 49 gene locus_tag LOCUS_00730 183 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 458 667 gene locus_tag LOCUS_00740 458 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 2459 630 gene locus_tag LOCUS_00750 2459 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 3727 2480 gene locus_tag LOCUS_00760 3727 2480 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_00760 4504 3812 gene locus_tag LOCUS_00770 4504 3812 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_00770 6047 5256 gene locus_tag LOCUS_00780 6047 5256 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_00780 7381 6110 gene locus_tag LOCUS_00790 gene larA 7381 6110 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_00790 8828 7557 gene locus_tag LOCUS_00800 8828 7557 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065465.1 protein_id gnl|my_center|LOCUS_00800 9774 8890 gene locus_tag LOCUS_00810 gene dapA 9774 8890 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 protein_id gnl|my_center|LOCUS_00810 >Feature sequence010 5169 196 gene locus_tag LOCUS_00820 5169 196 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230035.1 protein_id gnl|my_center|LOCUS_00820 9029 5193 gene locus_tag LOCUS_00830 9029 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 9267 9034 gene locus_tag LOCUS_00840 9267 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 9943 9353 gene locus_tag LOCUS_00850 9943 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 >Feature sequence011 2084 1374 gene locus_tag LOCUS_00860 2084 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 3067 2081 gene locus_tag LOCUS_00870 3067 2081 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_00870 4370 3129 gene locus_tag LOCUS_00880 gene ftsW 4370 3129 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_00880 5929 4373 gene locus_tag LOCUS_00890 gene murD 5929 4373 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_00890 6315 6004 gene locus_tag LOCUS_00900 6315 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 7321 6344 gene locus_tag LOCUS_00910 gene mraY 7321 6344 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_00910 8706 7321 gene locus_tag LOCUS_00920 8706 7321 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256654.1 protein_id gnl|my_center|LOCUS_00920 <9428 8827 gene locus_tag LOCUS_00930 <9428 8827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943700.1:penicillin-binding protein >Feature sequence012 251 436 gene locus_tag LOCUS_00940 251 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 423 1064 gene locus_tag LOCUS_00950 423 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00950 947 1603 gene locus_tag LOCUS_00960 947 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00960 2794 1610 gene locus_tag LOCUS_00970 2794 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 2968 3951 gene locus_tag LOCUS_00980 gene trpS 2968 3951 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869523.1 protein_id gnl|my_center|LOCUS_00980 3994 4827 gene locus_tag LOCUS_00990 gene pheA 3994 4827 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933330.1 protein_id gnl|my_center|LOCUS_00990 4854 5399 gene locus_tag LOCUS_01000 4854 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 5532 6968 gene locus_tag LOCUS_01010 gene proS 5532 6968 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257194.1 protein_id gnl|my_center|LOCUS_01010 8421 7273 gene locus_tag LOCUS_01020 8421 7273 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257004.1 protein_id gnl|my_center|LOCUS_01020 <9208 8518 gene locus_tag LOCUS_01030 <9208 8518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259441.1:ribose-phosphate pyrophosphokinase >Feature sequence013 1055 354 gene locus_tag LOCUS_01040 1055 354 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_01040 1492 1193 gene locus_tag LOCUS_01050 1492 1193 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_01050 2183 2890 gene locus_tag LOCUS_01060 2183 2890 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868955.1 protein_id gnl|my_center|LOCUS_01060 3640 3888 gene locus_tag LOCUS_01070 3640 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 3985 4299 gene locus_tag LOCUS_01080 3985 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 4336 7281 gene locus_tag LOCUS_01090 4336 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 7367 8296 gene locus_tag LOCUS_01100 7367 8296 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525322.1 protein_id gnl|my_center|LOCUS_01100 >Feature sequence014 964 521 gene locus_tag LOCUS_01110 964 521 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391911.1 protein_id gnl|my_center|LOCUS_01110 1814 1461 gene locus_tag LOCUS_01120 1814 1461 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257356.1 protein_id gnl|my_center|LOCUS_01120 2248 1811 gene locus_tag LOCUS_01130 2248 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 2399 2557 gene locus_tag LOCUS_01140 2399 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 2967 2554 gene locus_tag LOCUS_01150 2967 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 3374 4573 gene locus_tag LOCUS_01160 gene rpoD 3374 4573 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_01160 5555 4662 gene locus_tag LOCUS_01170 gene lgt 5555 4662 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257228.1 protein_id gnl|my_center|LOCUS_01170 5874 6404 gene locus_tag LOCUS_01180 5874 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 6429 8387 gene locus_tag LOCUS_01190 6429 8387 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258668.1 protein_id gnl|my_center|LOCUS_01190 >Feature sequence015 3039 2020 gene locus_tag LOCUS_01200 3039 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 3182 3355 gene locus_tag LOCUS_01210 3182 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 5577 3574 gene locus_tag LOCUS_01220 5577 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 5654 5911 gene locus_tag LOCUS_01230 5654 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 6638 6078 gene locus_tag LOCUS_01240 6638 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 6848 6639 gene locus_tag LOCUS_01250 6848 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 <8863 7219 gene locus_tag LOCUS_01260 <8863 7219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162015845.1:M1 family metallopeptidase >Feature sequence016 4173 1576 gene locus_tag LOCUS_01270 4173 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 6472 4166 gene locus_tag LOCUS_01280 6472 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 8718 6469 gene locus_tag LOCUS_01290 8718 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 >Feature sequence017 19 2208 gene locus_tag LOCUS_01300 19 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 2574 2335 gene locus_tag LOCUS_01310 2574 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 3998 2778 gene locus_tag LOCUS_01320 3998 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 4138 4428 gene locus_tag LOCUS_01330 4138 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 4638 5435 gene locus_tag LOCUS_01340 4638 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 7112 7678 gene locus_tag LOCUS_01350 7112 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 8004 7837 gene locus_tag LOCUS_01360 8004 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 >Feature sequence018 2331 1861 gene locus_tag LOCUS_01370 2331 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 2736 2353 gene locus_tag LOCUS_01380 2736 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 3221 2733 gene locus_tag LOCUS_01390 3221 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 4475 3255 gene locus_tag LOCUS_01400 4475 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 5296 4475 gene locus_tag LOCUS_01410 5296 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 5742 5311 gene locus_tag LOCUS_01420 5742 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 6191 5763 gene locus_tag LOCUS_01430 6191 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 6573 6205 gene locus_tag LOCUS_01440 6573 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 8330 6570 gene locus_tag LOCUS_01450 gene ltrA 8330 6570 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967989.1 protein_id gnl|my_center|LOCUS_01450 >Feature sequence019 <1 755 gene locus_tag LOCUS_01460 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056735.1:FkbM family methyltransferase 4286 876 gene locus_tag LOCUS_01470 4286 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 7490 4290 gene locus_tag LOCUS_01480 7490 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 <8530 7593 gene locus_tag LOCUS_01490 <8530 7593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909443.1:ATP-binding protein >Feature sequence020 2162 3130 gene locus_tag LOCUS_01500 2162 3130 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_01500 3794 3141 gene locus_tag LOCUS_01510 3794 3141 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_01510 5256 3805 gene locus_tag LOCUS_01520 5256 3805 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391571.1 protein_id gnl|my_center|LOCUS_01520 6434 5307 gene locus_tag LOCUS_01530 6434 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 protein_id gnl|my_center|LOCUS_01530 7625 6444 gene locus_tag LOCUS_01540 gene egsA 7625 6444 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229504.1 protein_id gnl|my_center|LOCUS_01540 >Feature sequence021 539 2536 gene locus_tag LOCUS_01550 539 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 2555 4213 gene locus_tag LOCUS_01560 2555 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 4252 6060 gene locus_tag LOCUS_01570 4252 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 6082 6825 gene locus_tag LOCUS_01580 6082 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 7029 7730 gene locus_tag LOCUS_01590 7029 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 7955 8236 gene locus_tag LOCUS_01600 7955 8236 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257420.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence022 7 1878 gene locus_tag LOCUS_01610 7 1878 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_01610 1903 2055 gene locus_tag LOCUS_01620 1903 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 2270 3223 gene locus_tag LOCUS_01630 2270 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 3292 4026 gene locus_tag LOCUS_01640 3292 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 3995 4444 gene locus_tag LOCUS_01650 3995 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 4647 6116 gene locus_tag LOCUS_01660 4647 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 6174 8045 gene locus_tag LOCUS_01670 6174 8045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_01670 >Feature sequence023 515 3475 gene locus_tag LOCUS_01680 515 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 3844 6744 gene locus_tag LOCUS_01690 gene uvrA 3844 6744 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_01690 6970 7674 gene locus_tag LOCUS_01700 gene yycF 6970 7674 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131580.1 protein_id gnl|my_center|LOCUS_01700 7671 8033 gene locus_tag LOCUS_01710 7671 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 >Feature sequence024 1578 3050 gene locus_tag LOCUS_01720 1578 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 3589 4305 gene locus_tag LOCUS_01730 3589 4305 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_01730 4328 4510 gene locus_tag LOCUS_01740 4328 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 4560 5366 gene locus_tag LOCUS_01750 gene sgcQ 4560 5366 CDS product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118626.1 protein_id gnl|my_center|LOCUS_01750 5369 6436 gene locus_tag LOCUS_01760 5369 6436 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459608.1 protein_id gnl|my_center|LOCUS_01760 >Feature sequence025 552 833 gene locus_tag LOCUS_01770 552 833 CDS product LysO family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803434.1 protein_id gnl|my_center|LOCUS_01770 823 1425 gene locus_tag LOCUS_01780 823 1425 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938535.1 protein_id gnl|my_center|LOCUS_01780 1936 1526 gene locus_tag LOCUS_01790 1936 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 2876 4594 gene locus_tag LOCUS_01800 2876 4594 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_01800 4678 5931 gene locus_tag LOCUS_01810 4678 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 6254 6526 gene locus_tag LOCUS_01820 6254 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 7091 6603 gene locus_tag LOCUS_01830 7091 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 >Feature sequence026 340 1440 gene locus_tag LOCUS_01840 gene cax 340 1440 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_01840 1572 2021 gene locus_tag LOCUS_01850 1572 2021 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980328.1 protein_id gnl|my_center|LOCUS_01850 2088 2285 gene locus_tag LOCUS_01860 2088 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 2686 2282 gene locus_tag LOCUS_01870 2686 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 3342 2785 gene locus_tag LOCUS_01880 gene efp 3342 2785 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583400.1 protein_id gnl|my_center|LOCUS_01880 6367 3452 gene locus_tag LOCUS_01890 6367 3452 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_01890 7252 6572 gene locus_tag LOCUS_01900 gene phoU 7252 6572 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_01900 >Feature sequence027 1451 1855 gene locus_tag LOCUS_01910 1451 1855 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_01910 2182 4353 gene locus_tag LOCUS_01920 2182 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 5125 4706 gene locus_tag LOCUS_01930 5125 4706 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020097.1 protein_id gnl|my_center|LOCUS_01930 5301 5125 gene locus_tag LOCUS_01940 5301 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 6484 5477 gene locus_tag LOCUS_01950 6484 5477 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257470.1 protein_id gnl|my_center|LOCUS_01950 6951 6655 gene locus_tag LOCUS_01960 6951 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 >Feature sequence028 392 4531 gene locus_tag LOCUS_01970 392 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 4540 6909 gene locus_tag LOCUS_01980 4540 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence029 <1 1015 gene locus_tag LOCUS_01990 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393493.1:dihydropyrimidinase 1066 2280 gene locus_tag LOCUS_02000 gene preA 1066 2280 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_02000 2501 3415 gene locus_tag LOCUS_02010 2501 3415 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869168.1 protein_id gnl|my_center|LOCUS_02010 3625 4089 gene locus_tag LOCUS_02020 3625 4089 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_02020 4210 6570 gene locus_tag LOCUS_02030 4210 6570 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869170.1 protein_id gnl|my_center|LOCUS_02030 6589 7404 gene locus_tag LOCUS_02040 6589 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence030 910 299 gene locus_tag LOCUS_02050 910 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 1916 1104 gene locus_tag LOCUS_02060 1916 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 2431 2730 gene locus_tag LOCUS_02070 2431 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 2720 3235 gene locus_tag LOCUS_02080 2720 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 3459 4119 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4297 4509 gene locus_tag LOCUS_02090 4297 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 4511 4891 gene locus_tag LOCUS_02100 4511 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 5150 5938 gene locus_tag LOCUS_02110 5150 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 6027 6449 gene locus_tag LOCUS_02120 6027 6449 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_02120 6552 7340 gene locus_tag LOCUS_02130 6552 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence031 465 1649 gene locus_tag LOCUS_02140 465 1649 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_02140 1779 2564 gene locus_tag LOCUS_02150 1779 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 3444 2638 gene locus_tag LOCUS_02160 gene trpA 3444 2638 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_02160 4771 3545 gene locus_tag LOCUS_02170 gene trpB 4771 3545 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258563.1 protein_id gnl|my_center|LOCUS_02170 5501 4782 gene locus_tag LOCUS_02180 5501 4782 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_02180 6309 5485 gene locus_tag LOCUS_02190 gene trpC 6309 5485 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660663.1 protein_id gnl|my_center|LOCUS_02190 <7287 6346 gene locus_tag LOCUS_02200 <7287 6346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025774851.1:anthranilate phosphoribosyltransferase >Feature sequence032 2368 278 gene locus_tag LOCUS_02210 2368 278 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228884.1 protein_id gnl|my_center|LOCUS_02210 3212 2433 gene locus_tag LOCUS_02220 3212 2433 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_02220 3373 3744 gene locus_tag LOCUS_02230 3373 3744 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_02230 3888 4196 gene locus_tag LOCUS_02240 3888 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 4201 5355 gene locus_tag LOCUS_02250 4201 5355 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486144.1 protein_id gnl|my_center|LOCUS_02250 6219 5539 gene locus_tag LOCUS_02260 6219 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 <7266 6244 gene locus_tag LOCUS_02270 <7266 6244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392628.1:DNA mismatch repair endonuclease MutL >Feature sequence033 1329 49 gene locus_tag LOCUS_02280 1329 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 1664 2605 gene locus_tag LOCUS_02290 1664 2605 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_02290 3210 4814 gene locus_tag LOCUS_02300 gene pckA 3210 4814 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_02300 5148 5315 gene locus_tag LOCUS_02310 5148 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence034 <1 502 gene locus_tag LOCUS_02320 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393607.1:carbamate kinase 641 1918 gene locus_tag LOCUS_02330 641 1918 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_02330 1915 2184 gene locus_tag LOCUS_02340 1915 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 2184 2441 gene locus_tag LOCUS_02350 2184 2441 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390944.1 protein_id gnl|my_center|LOCUS_02350 2540 3526 gene locus_tag LOCUS_02360 2540 3526 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_02360 3523 4992 gene locus_tag LOCUS_02370 3523 4992 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_02370 5026 6192 gene locus_tag LOCUS_02380 5026 6192 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_02380 6983 6231 gene locus_tag LOCUS_02390 6983 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 >Feature sequence035 1407 583 gene locus_tag LOCUS_02400 1407 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 2072 1518 gene locus_tag LOCUS_02410 gene def 2072 1518 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965769.1 protein_id gnl|my_center|LOCUS_02410 2287 3948 gene locus_tag LOCUS_02420 2287 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 4060 4854 gene locus_tag LOCUS_02430 4060 4854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_02430 4851 6071 gene locus_tag LOCUS_02440 4851 6071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_02440 >Feature sequence036 380 1006 gene locus_tag LOCUS_02450 380 1006 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_02450 1040 2575 gene locus_tag LOCUS_02460 gene rny 1040 2575 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_02460 2975 3139 gene locus_tag LOCUS_02470 2975 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 3399 3100 gene locus_tag LOCUS_02480 3399 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 4671 3646 gene locus_tag LOCUS_02490 4671 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 5447 4683 gene locus_tag LOCUS_02500 5447 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 6494 5739 gene locus_tag LOCUS_02510 6494 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 >Feature sequence037 368 2371 gene locus_tag LOCUS_02520 368 2371 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_02520 2468 2935 gene locus_tag LOCUS_02530 2468 2935 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932916.1 protein_id gnl|my_center|LOCUS_02530 3009 3905 gene locus_tag LOCUS_02540 3009 3905 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_02540 3998 5062 gene locus_tag LOCUS_02550 3998 5062 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_02550 5113 5943 gene locus_tag LOCUS_02560 5113 5943 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939671.1 protein_id gnl|my_center|LOCUS_02560 >Feature sequence038 862 224 gene locus_tag LOCUS_02570 gene rimI 862 224 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258576.1 protein_id gnl|my_center|LOCUS_02570 1575 874 gene locus_tag LOCUS_02580 gene tsaB 1575 874 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_02580 2085 1582 gene locus_tag LOCUS_02590 gene tsaE 2085 1582 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257860.1 protein_id gnl|my_center|LOCUS_02590 2647 3387 gene locus_tag LOCUS_02600 2647 3387 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_02600 4789 3425 gene locus_tag LOCUS_02610 4789 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 5626 4802 gene locus_tag LOCUS_02620 gene cdaA 5626 4802 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257450.1 protein_id gnl|my_center|LOCUS_02620 6979 5804 gene locus_tag LOCUS_02630 6979 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 >Feature sequence039 374 2536 gene locus_tag LOCUS_02640 374 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 3035 2613 gene locus_tag LOCUS_02650 3035 2613 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_02650 5871 3226 gene locus_tag LOCUS_02660 5871 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 <6945 5916 gene locus_tag LOCUS_02670 <6945 5916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879310.1:aspartate aminotransferase family protein >Feature sequence040 3046 1721 gene locus_tag LOCUS_02680 3046 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 3314 3033 gene locus_tag LOCUS_02690 3314 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 <6906 3357 gene locus_tag LOCUS_02700 <6906 3357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256978.1:DUF11 domain-containing protein >Feature sequence041 1768 212 gene locus_tag LOCUS_02710 1768 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 4313 1806 gene locus_tag LOCUS_02720 4313 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 4294 4548 gene locus_tag LOCUS_02730 4294 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 5975 4590 gene locus_tag LOCUS_02740 5975 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 <6906 6005 gene locus_tag LOCUS_02750 <6906 6005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882798.1:SUMF1/EgtB/PvdO family nonheme iron enzyme >Feature sequence042 124 606 gene locus_tag LOCUS_02760 124 606 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_02760 1101 712 gene locus_tag LOCUS_02770 1101 712 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660457.1 protein_id gnl|my_center|LOCUS_02770 1417 1767 gene locus_tag LOCUS_02780 1417 1767 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_02780 1838 2272 gene locus_tag LOCUS_02790 1838 2272 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_02790 2342 2884 gene locus_tag LOCUS_02800 2342 2884 CDS product DUF6141 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093726791.1 protein_id gnl|my_center|LOCUS_02800 2874 3356 gene locus_tag LOCUS_02810 2874 3356 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771208.1 protein_id gnl|my_center|LOCUS_02810 3396 3980 gene locus_tag LOCUS_02820 3396 3980 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399467.1 protein_id gnl|my_center|LOCUS_02820 4310 4116 gene locus_tag LOCUS_02830 4310 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 6729 4672 gene locus_tag LOCUS_02840 6729 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 >Feature sequence043 456 223 gene locus_tag LOCUS_02850 456 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 876 493 gene locus_tag LOCUS_02860 876 493 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392924.1 protein_id gnl|my_center|LOCUS_02860 1281 949 gene locus_tag LOCUS_02870 1281 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 2252 1872 gene locus_tag LOCUS_02880 2252 1872 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393697.1 protein_id gnl|my_center|LOCUS_02880 2644 3159 gene locus_tag LOCUS_02890 2644 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 3153 4859 gene locus_tag LOCUS_02900 3153 4859 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257697.1 protein_id gnl|my_center|LOCUS_02900 5657 4878 gene locus_tag LOCUS_02910 5657 4878 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_02910 6717 5680 gene locus_tag LOCUS_02920 6717 5680 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence044 396 46 gene locus_tag LOCUS_02930 396 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 1079 645 gene locus_tag LOCUS_02940 1079 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 1963 1076 gene locus_tag LOCUS_02950 gene fabG 1963 1076 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_02950 2401 1967 gene locus_tag LOCUS_02960 2401 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 3293 2445 gene locus_tag LOCUS_02970 3293 2445 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968672.1 protein_id gnl|my_center|LOCUS_02970 3674 3345 gene locus_tag LOCUS_02980 3674 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 3919 3680 gene locus_tag LOCUS_02990 3919 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 4190 3888 gene locus_tag LOCUS_03000 4190 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 <6867 4442 gene locus_tag LOCUS_03010 <6867 4442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_214467688.1:PD40 domain-containing protein >Feature sequence045 2583 1306 gene locus_tag LOCUS_03020 2583 1306 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_03020 3547 2651 gene locus_tag LOCUS_03030 3547 2651 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228638.1 protein_id gnl|my_center|LOCUS_03030 4477 3620 gene locus_tag LOCUS_03040 4477 3620 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582612.1 protein_id gnl|my_center|LOCUS_03040 5549 4548 gene locus_tag LOCUS_03050 5549 4548 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225937.1 protein_id gnl|my_center|LOCUS_03050 <6845 5832 gene locus_tag LOCUS_03060 <6845 5832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583619.1:TrpB-like pyridoxal phosphate-dependent enzyme >Feature sequence046 467 2407 gene locus_tag LOCUS_03070 gene pcrA 467 2407 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836754.1 protein_id gnl|my_center|LOCUS_03070 2607 3677 gene locus_tag LOCUS_03080 2607 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 4809 4540 gene locus_tag LOCUS_03090 4809 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 5033 4812 gene locus_tag LOCUS_03100 5033 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 5261 5046 gene locus_tag LOCUS_03110 5261 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 5707 5258 gene locus_tag LOCUS_03120 5707 5258 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_03120 <6834 6264 gene locus_tag LOCUS_03130 <6834 6264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_077753831.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence047 177 452 gene locus_tag LOCUS_03140 177 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 523 957 gene locus_tag LOCUS_03150 523 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 954 1415 gene locus_tag LOCUS_03160 954 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 1403 1885 gene locus_tag LOCUS_03170 1403 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 1902 2606 gene locus_tag LOCUS_03180 1902 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 3035 3094 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4553 3492 gene locus_tag LOCUS_03190 4553 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4697 6127 gene locus_tag LOCUS_03200 4697 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 6124 6603 gene locus_tag LOCUS_03210 6124 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence048 1254 2603 gene locus_tag LOCUS_03220 gene mgtE 1254 2603 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_03220 3960 2677 gene locus_tag LOCUS_03230 gene serS 3960 2677 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_03230 4260 4343 gene locus_tag LOCUS_t00010 4260 4343 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4511 5605 gene locus_tag LOCUS_03240 4511 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 6118 5897 gene locus_tag LOCUS_03250 6118 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 6189 6198 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6350 6676 gene locus_tag LOCUS_03260 6350 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 >Feature sequence049 887 489 gene locus_tag LOCUS_03270 887 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 1782 892 gene locus_tag LOCUS_03280 gene rsmH 1782 892 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_03280 2246 1830 gene locus_tag LOCUS_03290 gene mraZ 2246 1830 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_03290 2804 3796 gene locus_tag LOCUS_03300 2804 3796 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_03300 3815 4789 gene locus_tag LOCUS_03310 gene gmd 3815 4789 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_03310 4789 5676 gene locus_tag LOCUS_03320 4789 5676 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259435.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence050 247 2712 gene locus_tag LOCUS_03330 247 2712 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256869.1 protein_id gnl|my_center|LOCUS_03330 3101 2892 gene locus_tag LOCUS_03340 3101 2892 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925387.1 protein_id gnl|my_center|LOCUS_03340 3790 3590 gene locus_tag LOCUS_03350 3790 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 3680 4612 gene locus_tag LOCUS_03360 3680 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 4815 5381 gene locus_tag LOCUS_03370 4815 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 6182 5388 gene locus_tag LOCUS_03380 6182 5388 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110588.1 protein_id gnl|my_center|LOCUS_03380 >Feature sequence051 <1 719 gene locus_tag LOCUS_03390 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962309.1:VWA domain-containing protein 683 844 gene locus_tag LOCUS_03400 683 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 1160 1678 gene locus_tag LOCUS_03410 1160 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1745 3085 gene locus_tag LOCUS_03420 1745 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 3202 3774 gene locus_tag LOCUS_03430 3202 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 3784 4176 gene locus_tag LOCUS_03440 3784 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 4285 4428 gene locus_tag LOCUS_03450 4285 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 4458 4994 gene locus_tag LOCUS_03460 4458 4994 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_03460 5042 5139 gene locus_tag LOCUS_t00020 5042 5139 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence052 <1 1041 gene locus_tag LOCUS_03470 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259320.1:cysteine desulfurase 1048 1449 gene locus_tag LOCUS_03480 1048 1449 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_03480 1460 1591 gene locus_tag LOCUS_03490 1460 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 1588 2520 gene locus_tag LOCUS_03500 1588 2520 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480088.1 protein_id gnl|my_center|LOCUS_03500 2550 3002 gene locus_tag LOCUS_03510 2550 3002 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_03510 2966 3457 gene locus_tag LOCUS_03520 2966 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 3779 3408 gene locus_tag LOCUS_03530 3779 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 4922 6163 gene locus_tag LOCUS_03540 4922 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 6294 6530 gene locus_tag LOCUS_03550 6294 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence053 1075 95 gene locus_tag LOCUS_03560 1075 95 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_03560 2055 1072 gene locus_tag LOCUS_03570 gene pdhA 2055 1072 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_03570 3289 2081 gene locus_tag LOCUS_03580 3289 2081 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830479.1 protein_id gnl|my_center|LOCUS_03580 4303 3323 gene locus_tag LOCUS_03590 4303 3323 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_03590 5379 4300 gene locus_tag LOCUS_03600 gene pdhA 5379 4300 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_03600 6158 5433 gene locus_tag LOCUS_03610 6158 5433 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460218.1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence054 428 1237 gene locus_tag LOCUS_03620 428 1237 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_03620 1387 2679 gene locus_tag LOCUS_03630 1387 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 2806 4848 gene locus_tag LOCUS_03640 2806 4848 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_03640 4838 6151 gene locus_tag LOCUS_03650 4838 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence055 103 1953 gene locus_tag LOCUS_03660 103 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence056 1921 1181 gene locus_tag LOCUS_03670 1921 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 3795 2071 gene locus_tag LOCUS_03680 3795 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 <6434 3914 gene locus_tag LOCUS_03690 <6434 3914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865234.1:alpha-2-macroglobulin >Feature sequence057 622 6123 gene locus_tag LOCUS_03700 622 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence058 781 790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 888 2096 gene locus_tag LOCUS_03710 888 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 2327 4711 gene locus_tag LOCUS_03720 2327 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence059 <1 504 gene locus_tag LOCUS_03730 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880959.1:CDP-alcohol phosphatidyltransferase family protein 713 1081 gene locus_tag LOCUS_03740 713 1081 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056657.1 protein_id gnl|my_center|LOCUS_03740 1264 1527 gene locus_tag LOCUS_03750 1264 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2328 1426 gene locus_tag LOCUS_03760 2328 1426 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294680.1 protein_id gnl|my_center|LOCUS_03760 3031 3603 gene locus_tag LOCUS_03770 3031 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 3679 4677 gene locus_tag LOCUS_03780 3679 4677 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256056.1 protein_id gnl|my_center|LOCUS_03780 4706 5485 gene locus_tag LOCUS_03790 4706 5485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256055.1 protein_id gnl|my_center|LOCUS_03790 >Feature sequence060 196 17 gene locus_tag LOCUS_03800 196 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 1910 468 gene locus_tag LOCUS_03810 1910 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 4668 1966 gene locus_tag LOCUS_03820 4668 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 6062 4671 gene locus_tag LOCUS_03830 6062 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 >Feature sequence061 209 136 gene locus_tag LOCUS_t00030 209 136 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 348 1580 gene locus_tag LOCUS_03840 gene dinB 348 1580 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_03840 4195 1679 gene locus_tag LOCUS_03850 gene gyrA 4195 1679 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_03850 <6319 4192 gene locus_tag LOCUS_03860 <6319 4192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080806.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence062 1913 30 gene locus_tag LOCUS_03870 1913 30 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460899.1 protein_id gnl|my_center|LOCUS_03870 2348 1947 gene locus_tag LOCUS_03880 2348 1947 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_03880 2517 2783 gene locus_tag LOCUS_03890 2517 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 2795 3271 gene locus_tag LOCUS_03900 2795 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3202 3211 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3631 4623 gene locus_tag LOCUS_03910 3631 4623 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397776.1 protein_id gnl|my_center|LOCUS_03910 4684 5754 gene locus_tag LOCUS_03920 4684 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence063 2282 1734 gene locus_tag LOCUS_03930 2282 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2762 4192 gene locus_tag LOCUS_03940 2762 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 4221 4670 gene locus_tag LOCUS_03950 4221 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 4688 5020 gene locus_tag LOCUS_03960 4688 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392788.1 protein_id gnl|my_center|LOCUS_03960 <6260 5040 gene locus_tag LOCUS_03970 <6260 5040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861551.1:glycine--tRNA ligase subunit beta >Feature sequence064 432 758 gene locus_tag LOCUS_03980 432 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 2779 779 gene locus_tag LOCUS_03990 2779 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 3402 4958 gene locus_tag LOCUS_04000 gene xylB 3402 4958 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_04000 5001 6056 gene locus_tag LOCUS_04010 gene iolX 5001 6056 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence065 <1 708 gene locus_tag LOCUS_04020 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968486.1:EamA family transporter 909 1574 gene locus_tag LOCUS_04030 909 1574 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_04030 2125 1634 gene locus_tag LOCUS_04040 2125 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258603.1 protein_id gnl|my_center|LOCUS_04040 3348 2137 gene locus_tag LOCUS_04050 3348 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 3901 6207 gene locus_tag LOCUS_04060 3901 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 >Feature sequence066 1690 506 gene locus_tag LOCUS_04070 1690 506 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227876.1 protein_id gnl|my_center|LOCUS_04070 1905 3140 gene locus_tag LOCUS_04080 1905 3140 CDS product damage-control phosphatase ARMT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404091.1 protein_id gnl|my_center|LOCUS_04080 3673 3392 gene locus_tag LOCUS_04090 3673 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence067 <1 858 gene locus_tag LOCUS_04100 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392922.1:ATP-binding protein 855 1799 gene locus_tag LOCUS_04110 855 1799 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_04110 1811 2116 gene locus_tag LOCUS_04120 1811 2116 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583113.1 protein_id gnl|my_center|LOCUS_04120 2359 3135 gene locus_tag LOCUS_04130 2359 3135 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393156.1 protein_id gnl|my_center|LOCUS_04130 3132 4067 gene locus_tag LOCUS_04140 3132 4067 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_04140 5918 4542 gene locus_tag LOCUS_04150 5918 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 >Feature sequence068 1586 174 gene locus_tag LOCUS_04160 1586 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 2126 1719 gene locus_tag LOCUS_04170 2126 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 3129 2689 gene locus_tag LOCUS_04180 3129 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3382 3086 gene locus_tag LOCUS_04190 3382 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3892 3683 gene locus_tag LOCUS_04200 3892 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4333 3902 gene locus_tag LOCUS_04210 4333 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 4880 4593 gene locus_tag LOCUS_04220 4880 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 5185 4976 gene locus_tag LOCUS_04230 5185 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 5820 5263 gene locus_tag LOCUS_04240 5820 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence069 1767 901 gene locus_tag LOCUS_04250 1767 901 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_04250 4331 1788 gene locus_tag LOCUS_04260 4331 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2655 2889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5103 4381 gene locus_tag LOCUS_04270 5103 4381 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243035.1 protein_id gnl|my_center|LOCUS_04270 <6002 5141 gene locus_tag LOCUS_04280 <6002 5141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877115.1:amidohydrolase family protein >Feature sequence070 192 1112 gene locus_tag LOCUS_04290 192 1112 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091310187.1 protein_id gnl|my_center|LOCUS_04290 1109 1948 gene locus_tag LOCUS_04300 1109 1948 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225802.1 protein_id gnl|my_center|LOCUS_04300 2001 3149 gene locus_tag LOCUS_04310 2001 3149 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909136.1 protein_id gnl|my_center|LOCUS_04310 4688 3483 gene locus_tag LOCUS_04320 4688 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence071 202 474 gene locus_tag LOCUS_04330 202 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 1406 3790 gene locus_tag LOCUS_04340 1406 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 3950 5719 gene locus_tag LOCUS_04350 3950 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence072 <1 972 gene locus_tag LOCUS_04360 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003362591.1:signal recognition particle protein 1053 1502 gene locus_tag LOCUS_04370 1053 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 1615 1851 gene locus_tag LOCUS_04380 1615 1851 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546040.1 protein_id gnl|my_center|LOCUS_04380 1852 2427 gene locus_tag LOCUS_04390 gene rimM 1852 2427 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142459073.1 protein_id gnl|my_center|LOCUS_04390 2476 3081 gene locus_tag LOCUS_04400 gene nadD 2476 3081 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_04400 3372 5129 gene locus_tag LOCUS_04410 3372 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence073 1943 66 gene locus_tag LOCUS_04420 1943 66 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173521.1 protein_id gnl|my_center|LOCUS_04420 3001 1943 gene locus_tag LOCUS_04430 3001 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 3444 2998 gene locus_tag LOCUS_04440 3444 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 3583 5394 gene locus_tag LOCUS_04450 3583 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 >Feature sequence074 1674 664 gene locus_tag LOCUS_04460 1674 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 2596 1676 gene locus_tag LOCUS_04470 2596 1676 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532950.1 protein_id gnl|my_center|LOCUS_04470 3633 2812 gene locus_tag LOCUS_04480 3633 2812 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392011.1 protein_id gnl|my_center|LOCUS_04480 4939 3830 gene locus_tag LOCUS_04490 4939 3830 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_04490 5171 4968 gene locus_tag LOCUS_04500 5171 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5874 5428 gene locus_tag LOCUS_04510 5874 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 >Feature sequence075 <1 750 gene locus_tag LOCUS_04520 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461579.1:aspartate/glutamate racemase family protein 931 1818 gene locus_tag LOCUS_04530 931 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 1981 2553 gene locus_tag LOCUS_04540 1981 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 2717 3460 gene locus_tag LOCUS_04550 2717 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 3596 4432 gene locus_tag LOCUS_04560 3596 4432 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_04560 4425 5390 gene locus_tag LOCUS_04570 4425 5390 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence076 2411 66 gene locus_tag LOCUS_04580 2411 66 CDS product TIGR03986 family CRISPR-associated RAMP protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258140.1 protein_id gnl|my_center|LOCUS_04580 3021 2404 gene locus_tag LOCUS_04590 gene csx19 3021 2404 CDS product CRISPR-associated protein Csx19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258139.1 protein_id gnl|my_center|LOCUS_04590 4514 3021 gene locus_tag LOCUS_04600 4514 3021 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258138.1 protein_id gnl|my_center|LOCUS_04600 <5839 4507 gene locus_tag LOCUS_04610 <5839 4507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258137.1:CRISPR-associated RAMP protein Csx10 >Feature sequence077 499 1572 gene locus_tag LOCUS_04620 499 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2780 1707 gene locus_tag LOCUS_04630 2780 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 3802 2822 gene locus_tag LOCUS_04640 3802 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 4031 3780 gene locus_tag LOCUS_04650 4031 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 4728 3937 gene locus_tag LOCUS_04660 gene surE 4728 3937 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878442.1 protein_id gnl|my_center|LOCUS_04660 5682 4813 gene locus_tag LOCUS_04670 5682 4813 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140081.1 protein_id gnl|my_center|LOCUS_04670 >Feature sequence078 1068 1688 gene locus_tag LOCUS_04680 1068 1688 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731458.1 protein_id gnl|my_center|LOCUS_04680 1751 2062 gene locus_tag LOCUS_04690 1751 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 2166 2594 gene locus_tag LOCUS_04700 2166 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 3497 2736 gene locus_tag LOCUS_04710 3497 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 5278 3539 gene locus_tag LOCUS_04720 5278 3539 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence079 <1 622 gene locus_tag LOCUS_04730 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869432.1:UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase 653 1597 gene locus_tag LOCUS_04740 653 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 1658 1819 gene locus_tag LOCUS_04750 1658 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1767 2807 gene locus_tag LOCUS_04760 1767 2807 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459458.1 protein_id gnl|my_center|LOCUS_04760 3088 4329 gene locus_tag LOCUS_04770 3088 4329 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346036.1 protein_id gnl|my_center|LOCUS_04770 4408 5610 gene locus_tag LOCUS_04780 4408 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence080 15 752 gene locus_tag LOCUS_04790 15 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 767 1528 gene locus_tag LOCUS_04800 767 1528 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258938.1 protein_id gnl|my_center|LOCUS_04800 3191 1569 gene locus_tag LOCUS_04810 3191 1569 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_04810 3409 4956 gene locus_tag LOCUS_04820 3409 4956 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_04820 5073 5333 gene locus_tag LOCUS_04830 5073 5333 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 protein_id gnl|my_center|LOCUS_04830 5699 5370 gene locus_tag LOCUS_04840 5699 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence081 141 2810 gene locus_tag LOCUS_04850 141 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2892 4469 gene locus_tag LOCUS_04860 gene tilS 2892 4469 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257904.1 protein_id gnl|my_center|LOCUS_04860 5524 4481 gene locus_tag LOCUS_04870 5524 4481 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384594.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence082 <1 1198 gene locus_tag LOCUS_04880 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811727.1:acetyl-CoA decarbonylase/synthase complex subunit alpha/beta 1381 1782 gene locus_tag LOCUS_04890 1381 1782 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256810.1 protein_id gnl|my_center|LOCUS_04890 2056 3006 gene locus_tag LOCUS_04900 gene cdhD 2056 3006 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_04900 3178 4521 gene locus_tag LOCUS_04910 gene acsC 3178 4521 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence083 8 649 gene locus_tag LOCUS_04920 8 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 646 1848 gene locus_tag LOCUS_04930 gene nagA 646 1848 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582637.1 protein_id gnl|my_center|LOCUS_04930 2264 3052 gene locus_tag LOCUS_04940 2264 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 3100 3378 gene locus_tag LOCUS_04950 3100 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 3403 4152 gene locus_tag LOCUS_04960 3403 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256164.1 protein_id gnl|my_center|LOCUS_04960 4181 4798 gene locus_tag LOCUS_04970 4181 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence084 354 650 gene locus_tag LOCUS_04980 354 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 710 1360 gene locus_tag LOCUS_04990 710 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 2389 2751 gene locus_tag LOCUS_05000 2389 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 2761 3462 gene locus_tag LOCUS_05010 2761 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3569 4090 gene locus_tag LOCUS_05020 3569 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 4197 4994 gene locus_tag LOCUS_05030 4197 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 5085 5522 gene locus_tag LOCUS_05040 5085 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 >Feature sequence085 1124 813 gene locus_tag LOCUS_05050 gene nuoK 1124 813 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_05050 1674 1156 gene locus_tag LOCUS_05060 1674 1156 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_05060 2922 1750 gene locus_tag LOCUS_05070 gene nuoH 2922 1750 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257851.1 protein_id gnl|my_center|LOCUS_05070 3395 3039 gene locus_tag LOCUS_05080 gene ndhC 3395 3039 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_05080 3528 3728 gene locus_tag LOCUS_05090 3528 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 3778 4851 gene locus_tag LOCUS_05100 3778 4851 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence086 <1 966 gene locus_tag LOCUS_05110 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066666688.1:NADH-quinone oxidoreductase subunit NuoF 984 3839 gene locus_tag LOCUS_05120 gene fdhF 984 3839 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:2157..2159,aa:Sec) note codon on position 392 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_05120 4350 4520 gene locus_tag LOCUS_05130 4350 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 4522 4827 gene locus_tag LOCUS_05140 4522 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence087 321 31 gene locus_tag LOCUS_05150 321 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 295 612 gene locus_tag LOCUS_05160 295 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 834 1280 gene locus_tag LOCUS_05170 834 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 1294 1959 gene locus_tag LOCUS_05180 1294 1959 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258352.1 protein_id gnl|my_center|LOCUS_05180 1975 2805 gene locus_tag LOCUS_05190 1975 2805 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086161.1 protein_id gnl|my_center|LOCUS_05190 2817 3293 gene locus_tag LOCUS_05200 2817 3293 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086160.1 protein_id gnl|my_center|LOCUS_05200 3312 4658 gene locus_tag LOCUS_05210 3312 4658 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160700.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence088 225 1247 gene locus_tag LOCUS_05220 225 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 2063 1734 gene locus_tag LOCUS_05230 2063 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 4906 2339 gene locus_tag LOCUS_05240 4906 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 2573 2582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence089 1056 280 gene locus_tag LOCUS_05250 1056 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2346 1408 gene locus_tag LOCUS_05260 2346 1408 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_05260 2242 2676 gene locus_tag LOCUS_05270 2242 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2722 4728 gene locus_tag LOCUS_05280 2722 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 5123 5491 gene locus_tag LOCUS_05290 5123 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence090 2787 1921 gene locus_tag LOCUS_05300 2787 1921 CDS product branched chain amino acid--2-keto-4-methylthiobutyrate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393599.1 protein_id gnl|my_center|LOCUS_05300 2916 3413 gene locus_tag LOCUS_05310 2916 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 4644 3514 gene locus_tag LOCUS_05320 gene queG 4644 3514 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244608.1 protein_id gnl|my_center|LOCUS_05320 <5514 4724 gene locus_tag LOCUS_05330 <5514 4724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256841.1:2-oxoacid:ferredoxin oxidoreductase subunit beta >Feature sequence091 2792 1623 gene locus_tag LOCUS_05340 2792 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 2898 3017 gene locus_tag LOCUS_05350 2898 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3093 3743 gene locus_tag LOCUS_05360 3093 3743 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255966.1 protein_id gnl|my_center|LOCUS_05360 5024 3900 gene locus_tag LOCUS_05370 5024 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 >Feature sequence092 334 1260 gene locus_tag LOCUS_05380 334 1260 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969293.1 protein_id gnl|my_center|LOCUS_05380 1300 2085 gene locus_tag LOCUS_05390 1300 2085 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_05390 2110 2889 gene locus_tag LOCUS_05400 2110 2889 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104791.1 protein_id gnl|my_center|LOCUS_05400 2916 3083 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3102 3803 gene locus_tag LOCUS_05410 3102 3803 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence093 821 597 gene locus_tag LOCUS_05420 821 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 1670 834 gene locus_tag LOCUS_05430 1670 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 3529 2759 gene locus_tag LOCUS_05440 gene istB 3529 2759 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_05440 5046 3532 gene locus_tag LOCUS_05450 gene istA 5046 3532 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 protein_id gnl|my_center|LOCUS_05450 >Feature sequence094 45 1517 gene locus_tag LOCUS_05460 45 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 1691 2479 gene locus_tag LOCUS_05470 1691 2479 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_05470 2492 4747 gene locus_tag LOCUS_05480 2492 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence095 2301 979 gene locus_tag LOCUS_05490 2301 979 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_05490 3115 2930 gene locus_tag LOCUS_05500 3115 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 3346 4830 gene locus_tag LOCUS_05510 3346 4830 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501515.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence096 <1 729 gene locus_tag LOCUS_05520 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259287.1:ABC transporter ATP-binding protein 1181 840 gene locus_tag LOCUS_05530 1181 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 1566 1276 gene locus_tag LOCUS_05540 1566 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 1998 3479 gene locus_tag LOCUS_05550 1998 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 3483 3779 gene locus_tag LOCUS_05560 3483 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 >Feature sequence097 2167 1958 gene locus_tag LOCUS_05570 2167 1958 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730261.1 protein_id gnl|my_center|LOCUS_05570 2650 2372 gene locus_tag LOCUS_05580 2650 2372 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660478.1 protein_id gnl|my_center|LOCUS_05580 3042 3794 gene locus_tag LOCUS_05590 3042 3794 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence098 1576 1953 gene locus_tag LOCUS_05600 gene aroH 1576 1953 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258091.1 protein_id gnl|my_center|LOCUS_05600 2028 3041 gene locus_tag LOCUS_05610 gene aroF 2028 3041 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_05610 3179 4990 gene locus_tag LOCUS_05620 gene thrS 3179 4990 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665762.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence099 2684 1524 gene locus_tag LOCUS_05630 2684 1524 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_05630 4013 2802 gene locus_tag LOCUS_05640 4013 2802 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_05640 4562 4053 gene locus_tag LOCUS_05650 4562 4053 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence100 1739 423 gene locus_tag LOCUS_05660 gene hemA 1739 423 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_05660 2396 1758 gene locus_tag LOCUS_05670 2396 1758 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_05670 2758 2516 gene locus_tag LOCUS_05680 2758 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 <5370 3728 gene locus_tag LOCUS_05690 <5370 3728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888355.1:aconitate hydratase AcnA >Feature sequence101 1989 742 gene locus_tag LOCUS_05700 1989 742 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_05700 3771 2032 gene locus_tag LOCUS_05710 gene fdrA 3771 2032 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_05710 4877 4152 gene locus_tag LOCUS_05720 4877 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence102 292 1602 gene locus_tag LOCUS_05730 292 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 1659 2144 gene locus_tag LOCUS_05740 1659 2144 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528293.1 protein_id gnl|my_center|LOCUS_05740 3232 2156 gene locus_tag LOCUS_05750 3232 2156 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_05750 5190 3232 gene locus_tag LOCUS_05760 5190 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence103 81 398 gene locus_tag LOCUS_05770 81 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 770 627 gene locus_tag LOCUS_05780 770 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 1329 1493 gene locus_tag LOCUS_05790 1329 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 1979 2305 gene locus_tag LOCUS_05800 1979 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 2193 3347 gene locus_tag LOCUS_05810 2193 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 3566 4327 gene locus_tag LOCUS_05820 3566 4327 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767601.1 protein_id gnl|my_center|LOCUS_05820 >Feature sequence104 762 559 gene locus_tag LOCUS_05830 762 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1092 790 gene locus_tag LOCUS_05840 1092 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 1291 1632 gene locus_tag LOCUS_05850 1291 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 2672 1629 gene locus_tag LOCUS_05860 2672 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 4732 3317 gene locus_tag LOCUS_05870 gene glnA 4732 3317 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087603.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence105 <1 3492 gene locus_tag LOCUS_05880 <1 3492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020653583.1:CehA/McbA family metallohydrolase 3607 4782 gene locus_tag LOCUS_05890 3607 4782 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257433.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence106 1674 253 gene locus_tag LOCUS_05900 gene secD 1674 253 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258879.1 protein_id gnl|my_center|LOCUS_05900 1943 3967 gene locus_tag LOCUS_05910 1943 3967 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966065.1 protein_id gnl|my_center|LOCUS_05910 4198 5271 gene locus_tag LOCUS_05920 4198 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence107 <1 1460 gene locus_tag LOCUS_05930 <1 1460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584153.1:ABC transporter substrate-binding protein 1528 2517 gene locus_tag LOCUS_05940 1528 2517 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387854.1 protein_id gnl|my_center|LOCUS_05940 2514 3398 gene locus_tag LOCUS_05950 2514 3398 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584151.1 protein_id gnl|my_center|LOCUS_05950 4050 4373 gene locus_tag LOCUS_05960 4050 4373 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258148.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence108 2651 2067 gene locus_tag LOCUS_05970 2651 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 4458 2947 gene locus_tag LOCUS_05980 4458 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence109 1191 13 gene locus_tag LOCUS_05990 1191 13 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_05990 1834 1310 gene locus_tag LOCUS_06000 gene aroQ 1834 1310 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_06000 3432 1831 gene locus_tag LOCUS_06010 3432 1831 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052140.1 protein_id gnl|my_center|LOCUS_06010 4576 3413 gene locus_tag LOCUS_06020 gene aroC 4576 3413 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879991.1 protein_id gnl|my_center|LOCUS_06020 <5285 4579 gene locus_tag LOCUS_06030 <5285 4579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393067.1:shikimate dehydrogenase >Feature sequence110 1273 137 gene locus_tag LOCUS_06040 1273 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3200 1242 gene locus_tag LOCUS_06050 3200 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 5218 3263 gene locus_tag LOCUS_06060 5218 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence111 <5263 1601 gene locus_tag LOCUS_06070 <5263 1601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257223.1:DUF2298 domain-containing protein >Feature sequence112 491 285 gene locus_tag LOCUS_06080 491 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 996 1805 gene locus_tag LOCUS_06090 996 1805 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258680.1 protein_id gnl|my_center|LOCUS_06090 3080 1968 gene locus_tag LOCUS_06100 3080 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 3386 3622 gene locus_tag LOCUS_06110 3386 3622 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_06110 3679 3798 gene locus_tag LOCUS_06120 3679 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 3795 4892 gene locus_tag LOCUS_06130 3795 4892 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_06130 4978 5163 gene locus_tag LOCUS_06140 4978 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 >Feature sequence113 1421 207 gene locus_tag LOCUS_06150 1421 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 2548 1565 gene locus_tag LOCUS_06160 2548 1565 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_06160 4227 2791 gene locus_tag LOCUS_06170 gene mtgB 4227 2791 CDS product glycine betaine--corrinoid protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816521.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence114 835 668 gene locus_tag LOCUS_06180 835 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 2895 835 gene locus_tag LOCUS_06190 2895 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence115 995 795 gene locus_tag LOCUS_06200 995 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1994 1011 gene locus_tag LOCUS_06210 1994 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3397 2072 gene locus_tag LOCUS_06220 3397 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 5025 3400 gene locus_tag LOCUS_06230 5025 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence116 893 312 gene locus_tag LOCUS_06240 893 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 1361 1029 gene locus_tag LOCUS_06250 1361 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2564 2127 gene locus_tag LOCUS_06260 2564 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3716 2646 gene locus_tag LOCUS_06270 3716 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 4626 3883 gene locus_tag LOCUS_06280 4626 3883 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392941.1 protein_id gnl|my_center|LOCUS_06280 4945 4613 gene locus_tag LOCUS_06290 4945 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence117 1717 1490 gene locus_tag LOCUS_06300 1717 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3232 1850 gene locus_tag LOCUS_06310 gene lpdA 3232 1850 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085912.1 protein_id gnl|my_center|LOCUS_06310 3701 3357 gene locus_tag LOCUS_06320 3701 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 4149 3874 gene locus_tag LOCUS_06330 4149 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06330 <5163 4213 gene locus_tag LOCUS_06340 <5163 4213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256818.1:branched-chain amino acid ABC transporter substrate-binding protein >Feature sequence118 1346 1831 gene locus_tag LOCUS_06350 1346 1831 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111658546.1 protein_id gnl|my_center|LOCUS_06350 2675 2013 gene locus_tag LOCUS_06360 2675 2013 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_06360 3422 2778 gene locus_tag LOCUS_06370 3422 2778 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893113.1 protein_id gnl|my_center|LOCUS_06370 3921 4901 gene locus_tag LOCUS_06380 3921 4901 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198871.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence119 1290 2285 gene locus_tag LOCUS_06390 1290 2285 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966201.1 protein_id gnl|my_center|LOCUS_06390 3004 2330 gene locus_tag LOCUS_06400 3004 2330 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937833.1 protein_id gnl|my_center|LOCUS_06400 3184 4815 gene locus_tag LOCUS_06410 3184 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence120 3597 1405 gene locus_tag LOCUS_06420 3597 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 3973 3758 gene locus_tag LOCUS_06430 3973 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 4949 3921 gene locus_tag LOCUS_06440 gene amrS 4949 3921 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence121 624 1532 gene locus_tag LOCUS_06450 624 1532 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_06450 1540 2265 gene locus_tag LOCUS_06460 1540 2265 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_06460 3436 2471 gene locus_tag LOCUS_06470 3436 2471 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970027.1 protein_id gnl|my_center|LOCUS_06470 4446 3478 gene locus_tag LOCUS_06480 4446 3478 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974651.1 protein_id gnl|my_center|LOCUS_06480 5042 4446 gene locus_tag LOCUS_06490 gene pgiA 5042 4446 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147196.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence122 1872 1063 gene locus_tag LOCUS_06500 1872 1063 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256708.1 protein_id gnl|my_center|LOCUS_06500 3711 2518 gene locus_tag LOCUS_06510 3711 2518 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211128.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence123 1553 579 gene locus_tag LOCUS_06520 1553 579 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088167.1 protein_id gnl|my_center|LOCUS_06520 3515 1575 gene locus_tag LOCUS_06530 3515 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 >Feature sequence124 1252 44 gene locus_tag LOCUS_06540 1252 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 2987 1317 gene locus_tag LOCUS_06550 2987 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 3915 2917 gene locus_tag LOCUS_06560 3915 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence125 2027 63 gene locus_tag LOCUS_06570 2027 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 2789 2436 gene locus_tag LOCUS_06580 2789 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 3438 4235 gene locus_tag LOCUS_06590 3438 4235 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345477.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence126 2163 982 gene locus_tag LOCUS_06600 2163 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 3863 2424 gene locus_tag LOCUS_06610 3863 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 4086 4526 gene locus_tag LOCUS_06620 4086 4526 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence127 2386 419 gene locus_tag LOCUS_06630 2386 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 3609 2533 gene locus_tag LOCUS_06640 3609 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 <5029 3609 gene locus_tag LOCUS_06650 <5029 3609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986845.1:ammonium transporter >Feature sequence128 119 1192 gene locus_tag LOCUS_06660 119 1192 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583224.1 protein_id gnl|my_center|LOCUS_06660 1267 2205 gene locus_tag LOCUS_06670 1267 2205 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723841.1 protein_id gnl|my_center|LOCUS_06670 2373 3704 gene locus_tag LOCUS_06680 2373 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 3735 4475 gene locus_tag LOCUS_06690 3735 4475 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888285.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence129 724 440 gene locus_tag LOCUS_06700 gene cdd1 724 440 CDS product protein Cdd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888450.1 protein_id gnl|my_center|LOCUS_06700 1580 909 gene locus_tag LOCUS_06710 1580 909 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399300.1 protein_id gnl|my_center|LOCUS_06710 2155 1850 gene locus_tag LOCUS_06720 2155 1850 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 protein_id gnl|my_center|LOCUS_06720 3002 2376 gene locus_tag LOCUS_06730 3002 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 2958 3149 gene locus_tag LOCUS_06740 2958 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 4067 3447 gene locus_tag LOCUS_06750 4067 3447 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392339.1 protein_id gnl|my_center|LOCUS_06750 <5013 4170 gene locus_tag LOCUS_06760 <5013 4170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528609.1:aspartate aminotransferase family protein >Feature sequence130 1330 581 gene locus_tag LOCUS_06770 1330 581 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944017.1 protein_id gnl|my_center|LOCUS_06770 1680 2078 gene locus_tag LOCUS_06780 1680 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 2575 2664 gene locus_tag LOCUS_t00040 2575 2664 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2705 2793 gene locus_tag LOCUS_t00050 2705 2793 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2898 4049 gene locus_tag LOCUS_06790 2898 4049 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087075.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence131 1190 144 gene locus_tag LOCUS_06800 1190 144 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_06800 2300 1197 gene locus_tag LOCUS_06810 2300 1197 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728808.1 protein_id gnl|my_center|LOCUS_06810 3006 2290 gene locus_tag LOCUS_06820 gene rpe 3006 2290 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186923.1 protein_id gnl|my_center|LOCUS_06820 3472 3164 gene locus_tag LOCUS_06830 3472 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 <4983 3569 gene locus_tag LOCUS_06840 <4983 3569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808454.1:CapA family protein >Feature sequence132 <1 1104 gene locus_tag LOCUS_06850 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583496.1:ABC transporter substrate-binding protein 1573 2565 gene locus_tag LOCUS_06860 1573 2565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_06860 2580 3569 gene locus_tag LOCUS_06870 2580 3569 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence133 2512 167 gene locus_tag LOCUS_06880 2512 167 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929962.1 protein_id gnl|my_center|LOCUS_06880 3091 2609 gene locus_tag LOCUS_06890 3091 2609 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242999.1 protein_id gnl|my_center|LOCUS_06890 3996 3115 gene locus_tag LOCUS_06900 3996 3115 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_06900 <4968 4000 gene locus_tag LOCUS_06910 <4968 4000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869167.1:cyclase family protein >Feature sequence134 1295 390 gene locus_tag LOCUS_06920 1295 390 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_06920 1719 2594 gene locus_tag LOCUS_06930 1719 2594 CDS product CBU_1789 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958443.1 protein_id gnl|my_center|LOCUS_06930 2620 4410 gene locus_tag LOCUS_06940 2620 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence135 <1 1213 gene locus_tag LOCUS_06950 <1 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393146.1:alanine--tRNA ligase 1250 2545 gene locus_tag LOCUS_06960 1250 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2707 4341 gene locus_tag LOCUS_06970 2707 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 4481 4957 gene locus_tag LOCUS_06980 gene ruvX 4481 4957 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence136 583 176 gene locus_tag LOCUS_06990 583 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 1115 639 gene locus_tag LOCUS_07000 1115 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2326 1250 gene locus_tag LOCUS_07010 2326 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 3131 2319 gene locus_tag LOCUS_07020 3131 2319 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_07020 3428 3204 gene locus_tag LOCUS_07030 3428 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4128 3421 gene locus_tag LOCUS_07040 4128 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 4671 4315 gene locus_tag LOCUS_07050 4671 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 4862 4641 gene locus_tag LOCUS_07060 4862 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence137 283 1542 gene locus_tag LOCUS_07070 283 1542 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259590.1 protein_id gnl|my_center|LOCUS_07070 1613 2911 gene locus_tag LOCUS_07080 1613 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2908 3396 gene locus_tag LOCUS_07090 2908 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 3386 4474 gene locus_tag LOCUS_07100 3386 4474 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_07100 4467 4877 gene locus_tag LOCUS_07110 4467 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence138 1403 54 gene locus_tag LOCUS_07120 1403 54 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184355.1 protein_id gnl|my_center|LOCUS_07120 2386 1616 gene locus_tag LOCUS_07130 2386 1616 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_07130 2693 2400 gene locus_tag LOCUS_07140 2693 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 3683 2847 gene locus_tag LOCUS_07150 3683 2847 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085014.1 protein_id gnl|my_center|LOCUS_07150 4849 3857 gene locus_tag LOCUS_07160 4849 3857 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010022659.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence139 35 976 gene locus_tag LOCUS_07170 35 976 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_07170 1013 1843 gene locus_tag LOCUS_07180 1013 1843 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_07180 1910 3004 gene locus_tag LOCUS_07190 1910 3004 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_07190 3081 3875 gene locus_tag LOCUS_07200 gene fabG 3081 3875 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence140 1194 748 gene locus_tag LOCUS_07210 1194 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 1624 1241 gene locus_tag LOCUS_07220 1624 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 4148 1506 gene locus_tag LOCUS_07230 4148 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 1690 1903 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4829 4434 gene locus_tag LOCUS_07240 4829 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 >Feature sequence141 490 1602 gene locus_tag LOCUS_07250 490 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 1629 2171 gene locus_tag LOCUS_07260 1629 2171 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964817.1 protein_id gnl|my_center|LOCUS_07260 2164 4599 gene locus_tag LOCUS_07270 2164 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence142 809 627 gene locus_tag LOCUS_07280 809 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 2524 1142 gene locus_tag LOCUS_07290 2524 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 4436 3078 gene locus_tag LOCUS_07300 4436 3078 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969261.1 protein_id gnl|my_center|LOCUS_07300 4906 4433 gene locus_tag LOCUS_07310 4906 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence143 510 1868 gene locus_tag LOCUS_07320 510 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2062 2736 gene locus_tag LOCUS_07330 2062 2736 CDS product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 protein_id gnl|my_center|LOCUS_07330 4260 3013 gene locus_tag LOCUS_07340 4260 3013 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754218.1 protein_id gnl|my_center|LOCUS_07340 4405 4611 gene locus_tag LOCUS_07350 4405 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence144 1145 1402 gene locus_tag LOCUS_07360 1145 1402 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392209.1 protein_id gnl|my_center|LOCUS_07360 1378 1845 gene locus_tag LOCUS_07370 1378 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 2268 2020 gene locus_tag LOCUS_07380 2268 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3313 2852 gene locus_tag LOCUS_07390 3313 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 3616 3542 gene locus_tag LOCUS_t00060 3616 3542 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence145 <1 744 gene locus_tag LOCUS_07400 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583285.1:xylulokinase 808 2250 gene locus_tag LOCUS_07410 808 2250 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_07410 2292 3785 gene locus_tag LOCUS_07420 2292 3785 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_07420 4501 4295 gene locus_tag LOCUS_07430 4501 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence146 <1 713 gene locus_tag LOCUS_07440 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941793.1:signal recognition particle-docking protein FtsY 850 1851 gene locus_tag LOCUS_07450 gene prfB 850 1851 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_07450 1936 2805 gene locus_tag LOCUS_07460 1936 2805 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_07460 2810 4627 gene locus_tag LOCUS_07470 2810 4627 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence147 1166 45 gene locus_tag LOCUS_07480 1166 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4666 1163 gene locus_tag LOCUS_07490 4666 1163 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871043.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence148 1272 2387 gene locus_tag LOCUS_07500 1272 2387 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728149.1 protein_id gnl|my_center|LOCUS_07500 2416 2715 gene locus_tag LOCUS_07510 2416 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2864 3769 gene locus_tag LOCUS_07520 2864 3769 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence149 266 1030 gene locus_tag LOCUS_07530 266 1030 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_07530 1357 3075 gene locus_tag LOCUS_07540 1357 3075 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_07540 3047 3187 gene locus_tag LOCUS_07550 3047 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence150 1695 1087 gene locus_tag LOCUS_07560 1695 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2020 1661 gene locus_tag LOCUS_07570 2020 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 2463 2023 gene locus_tag LOCUS_07580 2463 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 3057 2569 gene locus_tag LOCUS_07590 3057 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4387 3113 gene locus_tag LOCUS_07600 4387 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4835 4374 gene locus_tag LOCUS_07610 4835 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence151 <1 1353 gene locus_tag LOCUS_07620 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928938.1:AAA family ATPase 1628 2878 gene locus_tag LOCUS_07630 1628 2878 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494076.1 protein_id gnl|my_center|LOCUS_07630 2856 3944 gene locus_tag LOCUS_07640 gene mutY 2856 3944 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_07640 4185 4015 gene locus_tag LOCUS_07650 4185 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4306 4635 gene locus_tag LOCUS_07660 4306 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence152 <1 751 gene locus_tag LOCUS_07670 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003642429.1:redox-regulated ATPase YchF 858 1145 gene locus_tag LOCUS_07680 gene rpsF 858 1145 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_07680 2042 3376 gene locus_tag LOCUS_07690 2042 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 <4826 3488 gene locus_tag LOCUS_07700 <4826 3488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086042.1:GTP diphosphokinase >Feature sequence153 676 506 gene locus_tag LOCUS_07710 676 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 706 4287 gene locus_tag LOCUS_07720 706 4287 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258122.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence154 1528 554 gene locus_tag LOCUS_07730 1528 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 1704 1901 gene locus_tag LOCUS_07740 1704 1901 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_07740 2527 3027 gene locus_tag LOCUS_07750 2527 3027 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_07750 3177 4547 gene locus_tag LOCUS_07760 gene dnaB 3177 4547 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256839.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence155 222 779 gene locus_tag LOCUS_07770 gene frr 222 779 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_07770 805 1503 gene locus_tag LOCUS_07780 805 1503 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_07780 1519 2322 gene locus_tag LOCUS_07790 1519 2322 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_07790 2532 2744 gene locus_tag LOCUS_07800 2532 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 2776 4053 gene locus_tag LOCUS_07810 2776 4053 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence156 155 805 gene locus_tag LOCUS_07820 155 805 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230987.1 protein_id gnl|my_center|LOCUS_07820 867 1481 gene locus_tag LOCUS_07830 867 1481 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222271.1 protein_id gnl|my_center|LOCUS_07830 1938 1672 gene locus_tag LOCUS_07840 1938 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 3157 1982 gene locus_tag LOCUS_07850 3157 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 <4817 3154 gene locus_tag LOCUS_07860 <4817 3154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256937.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence157 <1 584 gene locus_tag LOCUS_07870 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462098.1:uroporphyrinogen decarboxylase family protein 728 2188 gene locus_tag LOCUS_07880 728 2188 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_07880 2311 3993 gene locus_tag LOCUS_07890 gene araB 2311 3993 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_07890 <4813 4115 gene locus_tag LOCUS_07900 <4813 4115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021374035.1:murein biosynthesis integral membrane protein MurJ >Feature sequence158 4339 4506 gene locus_tag LOCUS_07910 4339 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence159 227 355 gene locus_tag LOCUS_07920 227 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 415 1665 gene locus_tag LOCUS_07930 415 1665 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024078840.1 protein_id gnl|my_center|LOCUS_07930 2135 2299 gene locus_tag LOCUS_07940 2135 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2546 3766 gene locus_tag LOCUS_07950 2546 3766 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705473.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence160 1514 633 gene locus_tag LOCUS_07960 1514 633 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226209.1 protein_id gnl|my_center|LOCUS_07960 2389 1511 gene locus_tag LOCUS_07970 2389 1511 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776866.1 protein_id gnl|my_center|LOCUS_07970 3974 2529 gene locus_tag LOCUS_07980 3974 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 4744 4583 gene locus_tag LOCUS_07990 4744 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence161 1563 1834 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2276 3121 gene locus_tag LOCUS_08000 2276 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence162 1912 869 gene locus_tag LOCUS_08010 gene argC 1912 869 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_08010 2901 1975 gene locus_tag LOCUS_08020 gene lysX 2901 1975 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_08020 3080 2907 gene locus_tag LOCUS_08030 gene lysW 3080 2907 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256239.1 protein_id gnl|my_center|LOCUS_08030 3573 4238 gene locus_tag LOCUS_08040 gene radC 3573 4238 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence163 43 1821 gene locus_tag LOCUS_08050 43 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2048 2683 gene locus_tag LOCUS_08060 2048 2683 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_08060 3221 3012 gene locus_tag LOCUS_08070 3221 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 3377 3724 gene locus_tag LOCUS_08080 3377 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence164 956 2245 gene locus_tag LOCUS_08090 gene thrC 956 2245 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878813.1 protein_id gnl|my_center|LOCUS_08090 2249 3349 gene locus_tag LOCUS_08100 gene asd 2249 3349 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_08100 3413 4522 gene locus_tag LOCUS_08110 3413 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256125.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence165 <1 557 gene locus_tag LOCUS_08120 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889925.1:reductive dehalogenase domain-containing protein 1264 698 gene locus_tag LOCUS_08130 1264 698 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_08130 1606 2772 gene locus_tag LOCUS_08140 1606 2772 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940986.1 protein_id gnl|my_center|LOCUS_08140 4466 3159 gene locus_tag LOCUS_08150 4466 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence166 1448 618 gene locus_tag LOCUS_08160 1448 618 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_08160 2399 1485 gene locus_tag LOCUS_08170 2399 1485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 protein_id gnl|my_center|LOCUS_08170 3572 2409 gene locus_tag LOCUS_08180 3572 2409 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_08180 4711 3548 gene locus_tag LOCUS_08190 4711 3548 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862137.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence167 65 640 gene locus_tag LOCUS_08200 65 640 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_08200 905 1666 gene locus_tag LOCUS_08210 905 1666 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021826.1 protein_id gnl|my_center|LOCUS_08210 1720 3015 gene locus_tag LOCUS_08220 1720 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 3018 3929 gene locus_tag LOCUS_08230 3018 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3979 4320 gene locus_tag LOCUS_08240 3979 4320 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461033.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence168 4705 752 gene locus_tag LOCUS_08250 4705 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence169 814 404 gene locus_tag LOCUS_08260 814 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1533 3260 gene locus_tag LOCUS_08270 gene ilvB 1533 3260 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880257.1 protein_id gnl|my_center|LOCUS_08270 3274 3786 gene locus_tag LOCUS_08280 gene ilvN 3274 3786 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence170 124 906 gene locus_tag LOCUS_08290 124 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_08290 903 1442 gene locus_tag LOCUS_08300 903 1442 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence171 <1 636 gene locus_tag LOCUS_08310 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810095.1:ABC transporter permease 638 1561 gene locus_tag LOCUS_08320 638 1561 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528137.1 protein_id gnl|my_center|LOCUS_08320 1593 2870 gene locus_tag LOCUS_08330 1593 2870 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_08330 3776 2832 gene locus_tag LOCUS_08340 3776 2832 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_08340 4316 3915 gene locus_tag LOCUS_08350 4316 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence172 1269 2693 gene locus_tag LOCUS_08360 1269 2693 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 protein_id gnl|my_center|LOCUS_08360 2789 4117 gene locus_tag LOCUS_08370 2789 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence173 <1 998 gene locus_tag LOCUS_08380 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255969.1:UDP-glucose 4-epimerase GalE 1038 1589 gene locus_tag LOCUS_08390 1038 1589 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_08390 1586 4105 gene locus_tag LOCUS_08400 1586 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence174 3797 480 gene locus_tag LOCUS_08410 3797 480 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_08410 3818 3997 gene locus_tag LOCUS_08420 3818 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 <4673 3933 gene locus_tag LOCUS_08430 <4673 3933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057580.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence175 190 1134 gene locus_tag LOCUS_08440 190 1134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257461.1 protein_id gnl|my_center|LOCUS_08440 1135 2664 gene locus_tag LOCUS_08450 1135 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2740 4053 gene locus_tag LOCUS_08460 2740 4053 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence176 1634 2299 gene locus_tag LOCUS_08470 1634 2299 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407700.1 protein_id gnl|my_center|LOCUS_08470 2314 2577 gene locus_tag LOCUS_08480 2314 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2587 3213 gene locus_tag LOCUS_08490 2587 3213 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_08490 3339 4442 gene locus_tag LOCUS_08500 3339 4442 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence177 375 1274 gene locus_tag LOCUS_08510 375 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1687 1956 gene locus_tag LOCUS_08520 1687 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1956 2186 gene locus_tag LOCUS_08530 1956 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 2473 3468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence178 2817 1600 gene locus_tag LOCUS_08540 gene metK 2817 1600 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258872.1 protein_id gnl|my_center|LOCUS_08540 4225 2960 gene locus_tag LOCUS_08550 gene ahcY 4225 2960 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258873.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence179 <1 1065 gene locus_tag LOCUS_08560 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903114.1:acyl-CoA carboxylase subunit beta 1091 2587 gene locus_tag LOCUS_08570 1091 2587 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870741.1 protein_id gnl|my_center|LOCUS_08570 2602 3099 gene locus_tag LOCUS_08580 2602 3099 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence180 599 378 gene locus_tag LOCUS_08590 599 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1106 675 gene locus_tag LOCUS_08600 1106 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1413 1120 gene locus_tag LOCUS_08610 1413 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1896 1534 gene locus_tag LOCUS_08620 1896 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2422 2027 gene locus_tag LOCUS_08630 2422 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 4526 2493 gene locus_tag LOCUS_08640 4526 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence181 1102 416 gene locus_tag LOCUS_08650 1102 416 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 protein_id gnl|my_center|LOCUS_08650 1757 1281 gene locus_tag LOCUS_08660 1757 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2639 1902 gene locus_tag LOCUS_08670 2639 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2959 2753 gene locus_tag LOCUS_08680 2959 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 3562 3840 gene locus_tag LOCUS_08690 3562 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3843 4241 gene locus_tag LOCUS_08700 3843 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence182 231 446 gene locus_tag LOCUS_08710 231 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence183 >Feature sequence184 199 1404 gene locus_tag LOCUS_08720 199 1404 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975419.1 protein_id gnl|my_center|LOCUS_08720 1401 2432 gene locus_tag LOCUS_08730 1401 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2542 3285 gene locus_tag LOCUS_08740 2542 3285 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_08740 3300 4058 gene locus_tag LOCUS_08750 3300 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence185 123 446 gene locus_tag LOCUS_08760 123 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 625 978 gene locus_tag LOCUS_08770 625 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08770 988 1113 gene locus_tag LOCUS_08780 988 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 1118 1585 gene locus_tag LOCUS_08790 1118 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1578 2984 gene locus_tag LOCUS_08800 1578 2984 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877655.1 protein_id gnl|my_center|LOCUS_08800 2988 4010 gene locus_tag LOCUS_08810 2988 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 4128 4376 gene locus_tag LOCUS_08820 4128 4376 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014628886.1 protein_id gnl|my_center|LOCUS_08820 4377 4589 gene locus_tag LOCUS_08830 4377 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence186 <1 643 gene locus_tag LOCUS_08840 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918711.1:class I SAM-dependent DNA methyltransferase 702 2048 gene locus_tag LOCUS_08850 702 2048 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531638.1 protein_id gnl|my_center|LOCUS_08850 2812 3003 gene locus_tag LOCUS_08860 2812 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 3013 3327 gene locus_tag LOCUS_08870 3013 3327 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence187 1458 301 gene locus_tag LOCUS_08880 1458 301 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533549.1 protein_id gnl|my_center|LOCUS_08880 4243 1955 gene locus_tag LOCUS_08890 4243 1955 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144184.1 protein_id gnl|my_center|LOCUS_08890 4594 4439 gene locus_tag LOCUS_08900 4594 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence188 981 127 gene locus_tag LOCUS_08910 981 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2158 1025 gene locus_tag LOCUS_08920 gene hybB 2158 1025 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941443.1 protein_id gnl|my_center|LOCUS_08920 2965 2162 gene locus_tag LOCUS_08930 2965 2162 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_08930 <4563 2976 gene locus_tag LOCUS_08940 <4563 2976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546362.1:formate dehydrogenase-N subunit alpha >Feature sequence189 <1 1180 gene locus_tag LOCUS_08950 <1 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583645.1:Ig-like domain-containing protein 1227 1988 gene locus_tag LOCUS_08960 gene surE 1227 1988 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258539.1 protein_id gnl|my_center|LOCUS_08960 3122 2226 gene locus_tag LOCUS_08970 gene galU 3122 2226 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_08970 <4558 3288 gene locus_tag LOCUS_08980 <4558 3288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257583.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence190 <1 500 gene locus_tag LOCUS_08990 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393499.1:molybdenum cofactor cytidylyltransferase 1113 544 gene locus_tag LOCUS_09000 gene raiA 1113 544 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_09000 1686 1189 gene locus_tag LOCUS_09010 1686 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1958 2131 gene locus_tag LOCUS_09020 1958 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3062 2124 gene locus_tag LOCUS_09030 3062 2124 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_09030 4062 3091 gene locus_tag LOCUS_09040 4062 3091 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_09040 4556 4146 gene locus_tag LOCUS_09050 4556 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence191 >Feature sequence192 2756 1014 gene locus_tag LOCUS_09060 gene cydC 2756 1014 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974886.1 protein_id gnl|my_center|LOCUS_09060 4043 3000 gene locus_tag LOCUS_09070 gene pheS 4043 3000 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence193 151 2001 gene locus_tag LOCUS_09080 151 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2823 2278 gene locus_tag LOCUS_09090 2823 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2968 3723 gene locus_tag LOCUS_09100 2968 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3716 3946 gene locus_tag LOCUS_09110 3716 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence194 2951 2292 gene locus_tag LOCUS_09120 gene hypB 2951 2292 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_09120 3294 2911 gene locus_tag LOCUS_09130 gene hypA 3294 2911 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388923.1 protein_id gnl|my_center|LOCUS_09130 4146 3385 gene locus_tag LOCUS_09140 4146 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence195 3463 1904 gene locus_tag LOCUS_09150 gene guaA 3463 1904 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_09150 4039 3470 gene locus_tag LOCUS_09160 gene xpt 4039 3470 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888255.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence196 67 1920 gene locus_tag LOCUS_09170 67 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2787 1939 gene locus_tag LOCUS_09180 2787 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3946 2807 gene locus_tag LOCUS_09190 3946 2807 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027527.1 protein_id gnl|my_center|LOCUS_09190 <4512 3983 gene locus_tag LOCUS_09200 <4512 3983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257673.1:cysteine desulfurase-like protein >Feature sequence197 336 13 gene locus_tag LOCUS_09210 336 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1526 648 gene locus_tag LOCUS_09220 1526 648 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532185.1 protein_id gnl|my_center|LOCUS_09220 2463 1546 gene locus_tag LOCUS_09230 2463 1546 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531801.1 protein_id gnl|my_center|LOCUS_09230 4195 2636 gene locus_tag LOCUS_09240 4195 2636 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532183.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence198 <1 1128 gene locus_tag LOCUS_09250 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256764.1:ATP-binding protein 1257 2096 gene locus_tag LOCUS_09260 1257 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3228 2398 gene locus_tag LOCUS_09270 3228 2398 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099768.1 protein_id gnl|my_center|LOCUS_09270 4345 3419 gene locus_tag LOCUS_09280 4345 3419 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978799.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence199 2067 1261 gene locus_tag LOCUS_09290 gene iolO 2067 1261 CDS product 5-keto-L-gluconate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083268.1 protein_id gnl|my_center|LOCUS_09290 2821 2174 gene locus_tag LOCUS_09300 2821 2174 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence200 860 567 gene locus_tag LOCUS_09310 860 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2884 860 gene locus_tag LOCUS_09320 gene dndD 2884 860 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_09320 4310 2889 gene locus_tag LOCUS_09330 gene dndC 4310 2889 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence201 25 780 gene locus_tag LOCUS_09340 25 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1057 2400 gene locus_tag LOCUS_09350 1057 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2586 4325 gene locus_tag LOCUS_09360 2586 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence202 916 1599 gene locus_tag LOCUS_09370 916 1599 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_09370 1769 3160 gene locus_tag LOCUS_09380 1769 3160 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256764.1 protein_id gnl|my_center|LOCUS_09380 <4476 3178 gene locus_tag LOCUS_09390 <4476 3178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943319.1:4Fe-4S binding protein >Feature sequence203 1712 624 gene locus_tag LOCUS_09400 1712 624 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389953.1 protein_id gnl|my_center|LOCUS_09400 2385 3407 gene locus_tag LOCUS_09410 2385 3407 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence204 1773 253 gene locus_tag LOCUS_09420 1773 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3725 2001 gene locus_tag LOCUS_09430 3725 2001 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_09430 <4467 3842 gene locus_tag LOCUS_09440 <4467 3842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798976.1:electron transfer flavoprotein subunit alpha/FixB family protein >Feature sequence205 1531 617 gene locus_tag LOCUS_09450 1531 617 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768681.1 protein_id gnl|my_center|LOCUS_09450 2909 1620 gene locus_tag LOCUS_09460 2909 1620 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_09460 4328 3012 gene locus_tag LOCUS_09470 gene rpoD 4328 3012 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence206 471 1484 gene locus_tag LOCUS_09480 471 1484 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_09480 1605 2150 gene locus_tag LOCUS_09490 1605 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2220 3794 gene locus_tag LOCUS_09500 2220 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 4023 4331 gene locus_tag LOCUS_09510 4023 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence207 1227 22 gene locus_tag LOCUS_09520 gene tyrS 1227 22 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081488.1 protein_id gnl|my_center|LOCUS_09520 1384 4077 gene locus_tag LOCUS_09530 1384 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence208 1536 52 gene locus_tag LOCUS_09540 gene glgA 1536 52 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_09540 2466 1723 gene locus_tag LOCUS_09550 gene yjjG 2466 1723 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870703.1 protein_id gnl|my_center|LOCUS_09550 3033 2752 gene locus_tag LOCUS_09560 3033 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 4346 3135 gene locus_tag LOCUS_09570 gene purH 4346 3135 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09570 >Feature sequence209 <1 1085 gene locus_tag LOCUS_09580 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256646.1:UDP-N-acetylmuramate dehydrogenase 1078 2232 gene locus_tag LOCUS_09590 1078 2232 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_09590 2375 3052 gene locus_tag LOCUS_09600 2375 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence210 111 923 gene locus_tag LOCUS_09610 111 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 966 1484 gene locus_tag LOCUS_09620 966 1484 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877376.1 protein_id gnl|my_center|LOCUS_09620 1535 2794 gene locus_tag LOCUS_09630 gene proA 1535 2794 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704510.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence211 1525 671 gene locus_tag LOCUS_09640 1525 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 3299 1575 gene locus_tag LOCUS_09650 3299 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence212 118 714 gene locus_tag LOCUS_09660 118 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 939 2411 gene locus_tag LOCUS_09670 939 2411 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 protein_id gnl|my_center|LOCUS_09670 2475 3590 gene locus_tag LOCUS_09680 2475 3590 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142948.1 protein_id gnl|my_center|LOCUS_09680 3611 4348 gene locus_tag LOCUS_09690 3611 4348 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142947.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence213 2623 476 gene locus_tag LOCUS_09700 2623 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 3536 2616 gene locus_tag LOCUS_09710 3536 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 <4411 3546 gene locus_tag LOCUS_09720 <4411 3546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244880.1:L-threonine 3-dehydrogenase >Feature sequence214 639 457 gene locus_tag LOCUS_09730 639 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 674 925 gene locus_tag LOCUS_09740 674 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1345 1542 gene locus_tag LOCUS_09750 1345 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1542 1934 gene locus_tag LOCUS_09760 1542 1934 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_09760 2699 3904 gene locus_tag LOCUS_09770 2699 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence215 1707 400 gene locus_tag LOCUS_09780 1707 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2830 1796 gene locus_tag LOCUS_09790 2830 1796 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527657.1 protein_id gnl|my_center|LOCUS_09790 3890 3027 gene locus_tag LOCUS_09800 3890 3027 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257265.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence216 295 1047 gene locus_tag LOCUS_09810 gene phnC 295 1047 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_09810 1053 2885 gene locus_tag LOCUS_09820 1053 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2942 3226 gene locus_tag LOCUS_09830 2942 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3213 3482 gene locus_tag LOCUS_09840 3213 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3629 4300 gene locus_tag LOCUS_09850 3629 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence217 <1 1141 gene locus_tag LOCUS_09860 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392705.1:methylenetetrahydrofolate reductase 1188 1886 gene locus_tag LOCUS_09870 1188 1886 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080265.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence218 1798 590 gene locus_tag LOCUS_09880 1798 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 2872 1958 gene locus_tag LOCUS_09890 2872 1958 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146936.1 protein_id gnl|my_center|LOCUS_09890 4387 3161 gene locus_tag LOCUS_09900 4387 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence219 2 232 gene locus_tag LOCUS_09910 2 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 275 1369 gene locus_tag LOCUS_09920 275 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1560 1633 gene locus_tag LOCUS_t00070 1560 1633 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1860 2108 gene locus_tag LOCUS_09930 1860 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3348 2200 gene locus_tag LOCUS_09940 3348 2200 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_09940 3577 3332 gene locus_tag LOCUS_09950 3577 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 4303 3686 gene locus_tag LOCUS_09960 4303 3686 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence220 63 623 gene locus_tag LOCUS_09970 63 623 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence221 85 330 gene locus_tag LOCUS_09980 85 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2391 442 gene locus_tag LOCUS_09990 gene gyrB 2391 442 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_09990 <4384 2908 gene locus_tag LOCUS_10000 <4384 2908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122418.1:VIT domain-containing protein >Feature sequence222 <1 896 gene locus_tag LOCUS_10010 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393855.1:F0F1 ATP synthase subunit beta 920 1372 gene locus_tag LOCUS_10020 920 1372 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258892.1 protein_id gnl|my_center|LOCUS_10020 1388 2392 gene locus_tag LOCUS_10030 1388 2392 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_10030 <4367 2531 gene locus_tag LOCUS_10040 <4367 2531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_141609734.1:interleukin-like EMT inducer domain-containing protein >Feature sequence223 922 2166 gene locus_tag LOCUS_10050 gene rhaI 922 2166 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 protein_id gnl|my_center|LOCUS_10050 2362 2697 gene locus_tag LOCUS_10060 2362 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence224 722 1006 gene locus_tag LOCUS_10070 722 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 999 1259 gene locus_tag LOCUS_10080 999 1259 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_10080 1402 1596 gene locus_tag LOCUS_10090 1402 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10090 1597 1896 gene locus_tag LOCUS_10100 1597 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10100 2239 2045 gene locus_tag LOCUS_10110 2239 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2323 2658 gene locus_tag LOCUS_10120 2323 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3353 3562 gene locus_tag LOCUS_10130 3353 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 3740 3904 gene locus_tag LOCUS_10140 3740 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence225 >Feature sequence226 775 1263 gene locus_tag LOCUS_10150 775 1263 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808186.1 protein_id gnl|my_center|LOCUS_10150 1265 1924 gene locus_tag LOCUS_10160 gene qcrB 1265 1924 CDS product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225560.1 protein_id gnl|my_center|LOCUS_10160 1944 3086 gene locus_tag LOCUS_10170 1944 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3603 3415 gene locus_tag LOCUS_10180 3603 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 <4342 3618 gene locus_tag LOCUS_10190 <4342 3618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228693.1:succinate dehydrogenase iron-sulfur subunit >Feature sequence227 9 809 gene locus_tag LOCUS_10200 9 809 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_10200 1599 886 gene locus_tag LOCUS_10210 gene thyX 1599 886 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142318.1 protein_id gnl|my_center|LOCUS_10210 3086 2058 gene locus_tag LOCUS_10220 3086 2058 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_10220 3552 3088 gene locus_tag LOCUS_10230 gene greA 3552 3088 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence228 932 174 gene locus_tag LOCUS_10240 932 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1123 1596 gene locus_tag LOCUS_10250 1123 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1874 3445 gene locus_tag LOCUS_10260 1874 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence229 1043 24 gene locus_tag LOCUS_10270 1043 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1937 1137 gene locus_tag LOCUS_10280 1937 1137 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990032.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence230 1712 2743 gene locus_tag LOCUS_10290 1712 2743 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861524.1 protein_id gnl|my_center|LOCUS_10290 2830 3870 gene locus_tag LOCUS_10300 2830 3870 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684567.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence231 184 96 gene locus_tag LOCUS_t00080 184 96 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 339 251 gene locus_tag LOCUS_t00090 339 251 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 507 1934 gene locus_tag LOCUS_10310 507 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 2012 3271 gene locus_tag LOCUS_10320 2012 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 3574 4170 gene locus_tag LOCUS_10330 3574 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence232 1150 2832 gene locus_tag LOCUS_10340 1150 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence233 371 1303 gene locus_tag LOCUS_10350 371 1303 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256099.1 protein_id gnl|my_center|LOCUS_10350 1773 1351 gene locus_tag LOCUS_10360 1773 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1969 2145 gene locus_tag LOCUS_10370 1969 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 2460 4175 gene locus_tag LOCUS_10380 2460 4175 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530882.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence234 2867 480 gene locus_tag LOCUS_10390 2867 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 4146 3262 gene locus_tag LOCUS_10400 4146 3262 CDS product CRISPR-associated ring nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258133.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence235 1120 773 gene locus_tag LOCUS_10410 1120 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1145 1437 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1864 2208 gene locus_tag LOCUS_10420 1864 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2192 2998 gene locus_tag LOCUS_10430 2192 2998 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392692.1 protein_id gnl|my_center|LOCUS_10430 3056 4066 gene locus_tag LOCUS_10440 3056 4066 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966367.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence236 208 456 gene locus_tag LOCUS_10450 208 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 457 807 gene locus_tag LOCUS_10460 457 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 883 1227 gene locus_tag LOCUS_10470 883 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1333 1713 gene locus_tag LOCUS_10480 1333 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1713 2699 gene locus_tag LOCUS_10490 1713 2699 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_10490 <4282 2871 gene locus_tag LOCUS_10500 <4282 2871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393521.1:xylulokinase >Feature sequence237 2285 1446 gene locus_tag LOCUS_10510 2285 1446 CDS product DUF1670 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860303.1 protein_id gnl|my_center|LOCUS_10510 3085 2282 gene locus_tag LOCUS_10520 3085 2282 CDS product DUF1670 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279092.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence238 2275 581 gene locus_tag LOCUS_10530 2275 581 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932359.1 protein_id gnl|my_center|LOCUS_10530 2472 2272 gene locus_tag LOCUS_10540 2472 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3117 2665 gene locus_tag LOCUS_10550 3117 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 4229 3129 gene locus_tag LOCUS_10560 4229 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence239 <1 1151 gene locus_tag LOCUS_10570 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256976.1:C25 family cysteine peptidase 1960 1367 gene locus_tag LOCUS_10580 1960 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence240 1550 600 gene locus_tag LOCUS_10590 1550 600 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392260.1 protein_id gnl|my_center|LOCUS_10590 2325 1681 gene locus_tag LOCUS_10600 2325 1681 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022229.1 protein_id gnl|my_center|LOCUS_10600 2835 2497 gene locus_tag LOCUS_10610 2835 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4189 3218 gene locus_tag LOCUS_10620 4189 3218 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence241 1489 854 gene locus_tag LOCUS_10630 1489 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 2320 1577 gene locus_tag LOCUS_10640 2320 1577 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875837.1 protein_id gnl|my_center|LOCUS_10640 3295 2378 gene locus_tag LOCUS_10650 3295 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4252 3614 gene locus_tag LOCUS_10660 4252 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence242 131 310 gene locus_tag LOCUS_10670 131 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1849 377 gene locus_tag LOCUS_10680 1849 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2074 1877 gene locus_tag LOCUS_10690 2074 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2272 2078 gene locus_tag LOCUS_10700 2272 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3493 2354 gene locus_tag LOCUS_10710 3493 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4246 3761 gene locus_tag LOCUS_10720 4246 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence243 1939 1046 gene locus_tag LOCUS_10730 1939 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2017 2466 gene locus_tag LOCUS_10740 gene dtd 2017 2466 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_10740 3750 2467 gene locus_tag LOCUS_10750 3750 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence244 1060 1857 gene locus_tag LOCUS_10760 1060 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1854 2108 gene locus_tag LOCUS_10770 1854 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2111 2320 gene locus_tag LOCUS_10780 2111 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2459 2695 gene locus_tag LOCUS_10790 2459 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 2848 3294 gene locus_tag LOCUS_10800 2848 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence245 543 400 gene locus_tag LOCUS_10810 543 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 2964 823 gene locus_tag LOCUS_10820 2964 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3659 3051 gene locus_tag LOCUS_10830 3659 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4100 3825 gene locus_tag LOCUS_10840 4100 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence246 <1 552 gene locus_tag LOCUS_10850 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000603535.1:2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD 704 1495 gene locus_tag LOCUS_10860 704 1495 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878760.1 protein_id gnl|my_center|LOCUS_10860 3055 2147 gene locus_tag LOCUS_10870 3055 2147 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228102.1 protein_id gnl|my_center|LOCUS_10870 3680 3462 gene locus_tag LOCUS_10880 3680 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 3895 3677 gene locus_tag LOCUS_10890 3895 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence247 <1 879 gene locus_tag LOCUS_10900 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809114.1:NADH:flavin oxidoreductase 928 1599 gene locus_tag LOCUS_10910 928 1599 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257323.1 protein_id gnl|my_center|LOCUS_10910 1777 2193 gene locus_tag LOCUS_10920 1777 2193 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_10920 2255 3295 gene locus_tag LOCUS_10930 gene gutB 2255 3295 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_10930 <4172 3436 gene locus_tag LOCUS_10940 <4172 3436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532193.1:pyridoxal-dependent decarboxylase >Feature sequence248 247 1230 gene locus_tag LOCUS_10950 247 1230 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529215.1 protein_id gnl|my_center|LOCUS_10950 1339 2685 gene locus_tag LOCUS_10960 1339 2685 CDS product RuBisCO large subunit C-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879084.1 protein_id gnl|my_center|LOCUS_10960 2851 3834 gene locus_tag LOCUS_10970 gene pdhA 2851 3834 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence249 2202 469 gene locus_tag LOCUS_10980 2202 469 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_10980 3019 2210 gene locus_tag LOCUS_10990 gene cobB2 3019 2210 CDS product NAD-dependent protein deacylase Cob2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877626.1 protein_id gnl|my_center|LOCUS_10990 3666 3115 gene locus_tag LOCUS_11000 3666 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence250 <1 685 gene locus_tag LOCUS_11010 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257378.1:sugar transferase 812 2260 gene locus_tag LOCUS_11020 812 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3419 2358 gene locus_tag LOCUS_11030 3419 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence251 2253 3491 gene locus_tag LOCUS_11040 gene fabF 2253 3491 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence252 <1 853 gene locus_tag LOCUS_11050 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250430.1:uridine phosphorylase 974 1378 gene locus_tag LOCUS_11060 974 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1444 1845 gene locus_tag LOCUS_11070 1444 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2035 3186 gene locus_tag LOCUS_11080 2035 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence253 515 267 gene locus_tag LOCUS_11090 515 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 740 1012 gene locus_tag LOCUS_11100 740 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 <4144 982 gene locus_tag LOCUS_11110 <4144 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228376.1:DUF499 domain-containing protein >Feature sequence254 <1 2223 gene locus_tag LOCUS_11120 <1 2223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258550.1:isoleucine--tRNA ligase >Feature sequence255 >Feature sequence256 >Feature sequence257 1432 374 gene locus_tag LOCUS_11130 1432 374 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 protein_id gnl|my_center|LOCUS_11130 2625 1435 gene locus_tag LOCUS_11140 2625 1435 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259080.1 protein_id gnl|my_center|LOCUS_11140 3792 2719 gene locus_tag LOCUS_11150 3792 2719 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence258 1531 809 gene locus_tag LOCUS_11160 1531 809 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929229.1 protein_id gnl|my_center|LOCUS_11160 2753 1662 gene locus_tag LOCUS_11170 2753 1662 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence259 296 460 gene locus_tag LOCUS_11180 296 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1638 613 gene locus_tag LOCUS_11190 1638 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1950 2174 gene locus_tag LOCUS_11200 1950 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 3961 2675 gene locus_tag LOCUS_11210 3961 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence260 <1 856 gene locus_tag LOCUS_11220 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391605.1:extracellular solute-binding protein 1023 1886 gene locus_tag LOCUS_11230 1023 1886 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331879.1 protein_id gnl|my_center|LOCUS_11230 1899 2753 gene locus_tag LOCUS_11240 1899 2753 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532185.1 protein_id gnl|my_center|LOCUS_11240 2926 3882 gene locus_tag LOCUS_11250 gene miaA 2926 3882 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256258.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence261 3530 141 gene locus_tag LOCUS_11260 3530 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence262 447 1721 gene locus_tag LOCUS_11270 gene hisS 447 1721 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_11270 1724 2356 gene locus_tag LOCUS_11280 1724 2356 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_11280 2340 3275 gene locus_tag LOCUS_11290 2340 3275 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_11290 3276 3788 gene locus_tag LOCUS_11300 3276 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence263 480 665 gene locus_tag LOCUS_11310 480 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11310 669 854 gene locus_tag LOCUS_11320 669 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence264 2174 2660 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence265 483 692 gene locus_tag LOCUS_11330 483 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1255 3432 gene locus_tag LOCUS_11340 1255 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3516 3794 gene locus_tag LOCUS_11350 3516 3794 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202715939.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence266 2285 1359 gene locus_tag LOCUS_11360 2285 1359 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096410.1 protein_id gnl|my_center|LOCUS_11360 3265 2297 gene locus_tag LOCUS_11370 3265 2297 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031697.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence267 2139 1174 gene locus_tag LOCUS_11380 2139 1174 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 protein_id gnl|my_center|LOCUS_11380 2527 2267 gene locus_tag LOCUS_11390 2527 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3689 2592 gene locus_tag LOCUS_11400 3689 2592 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256755.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence268 2130 1684 gene locus_tag LOCUS_11410 2130 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2687 2127 gene locus_tag LOCUS_11420 2687 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 3759 2701 gene locus_tag LOCUS_11430 3759 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence269 213 1454 gene locus_tag LOCUS_11440 213 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1830 2942 gene locus_tag LOCUS_11450 1830 2942 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257269.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence270 533 805 gene locus_tag LOCUS_11460 533 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11460 1238 3046 gene locus_tag LOCUS_11470 1238 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 3251 3496 gene locus_tag LOCUS_11480 3251 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 3624 3929 gene locus_tag LOCUS_11490 3624 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11490 >Feature sequence271 2647 2063 gene locus_tag LOCUS_11500 gene grpE 2647 2063 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257941.1 protein_id gnl|my_center|LOCUS_11500 3696 2716 gene locus_tag LOCUS_11510 gene hrcA 3696 2716 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence272 388 1023 gene locus_tag LOCUS_11520 388 1023 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_11520 1023 1601 gene locus_tag LOCUS_11530 1023 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1710 2723 gene locus_tag LOCUS_11540 1710 2723 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258376.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence273 1990 884 gene locus_tag LOCUS_11550 1990 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2886 2290 gene locus_tag LOCUS_11560 2886 2290 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957729.1 protein_id gnl|my_center|LOCUS_11560 <3988 3024 gene locus_tag LOCUS_11570 <3988 3024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259581.1:GHMP kinase >Feature sequence274 916 3051 gene locus_tag LOCUS_11580 916 3051 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875951.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence275 865 482 gene locus_tag LOCUS_11590 865 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2081 867 gene locus_tag LOCUS_11600 2081 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2915 2448 gene locus_tag LOCUS_11610 2915 2448 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_11610 <3984 2919 gene locus_tag LOCUS_11620 <3984 2919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021291.1:PAS domain S-box protein >Feature sequence276 840 613 gene locus_tag LOCUS_11630 840 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1032 1634 gene locus_tag LOCUS_11640 1032 1634 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_11640 1631 1810 gene locus_tag LOCUS_11650 1631 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2080 2343 gene locus_tag LOCUS_11660 2080 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2340 2552 gene locus_tag LOCUS_11670 2340 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 3133 2783 gene locus_tag LOCUS_11680 3133 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3792 3400 gene locus_tag LOCUS_11690 gene tsaA 3792 3400 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064869.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence277 3950 2169 gene locus_tag LOCUS_11700 3950 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence278 111 1079 gene locus_tag LOCUS_11710 111 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1190 2326 gene locus_tag LOCUS_11720 gene dnaN 1190 2326 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_11720 3877 2486 gene locus_tag LOCUS_11730 3877 2486 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence279 185 493 gene locus_tag LOCUS_11740 185 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1806 469 gene locus_tag LOCUS_11750 1806 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1999 3600 gene locus_tag LOCUS_11760 1999 3600 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256102.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence280 144 965 gene locus_tag LOCUS_11770 144 965 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876384.1 protein_id gnl|my_center|LOCUS_11770 1056 2645 gene locus_tag LOCUS_11780 1056 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence281 3270 535 gene locus_tag LOCUS_11790 3270 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence282 294 617 gene locus_tag LOCUS_11800 294 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1381 629 gene locus_tag LOCUS_11810 1381 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1630 2718 gene locus_tag LOCUS_11820 gene prfA 1630 2718 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227645.1 protein_id gnl|my_center|LOCUS_11820 2838 3764 gene locus_tag LOCUS_11830 gene prmC 2838 3764 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence283 458 1891 gene locus_tag LOCUS_11840 gene uxaC 458 1891 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338259.1 protein_id gnl|my_center|LOCUS_11840 3943 1904 gene locus_tag LOCUS_11850 3943 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence284 1057 71 gene locus_tag LOCUS_11860 1057 71 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083281.1 protein_id gnl|my_center|LOCUS_11860 2284 1121 gene locus_tag LOCUS_11870 2284 1121 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095809.1 protein_id gnl|my_center|LOCUS_11870 3396 2392 gene locus_tag LOCUS_11880 3396 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence285 511 1212 gene locus_tag LOCUS_11890 511 1212 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975840.1 protein_id gnl|my_center|LOCUS_11890 1354 2319 gene locus_tag LOCUS_11900 1354 2319 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_11900 2465 3268 gene locus_tag LOCUS_11910 2465 3268 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898170.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence286 739 1215 gene locus_tag LOCUS_11920 739 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2058 1207 gene locus_tag LOCUS_11930 2058 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11930 3266 2154 gene locus_tag LOCUS_11940 3266 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11940 >Feature sequence287 1402 3003 gene locus_tag LOCUS_11950 gene trpE 1402 3003 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence288 533 459 gene locus_tag LOCUS_t00100 533 459 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 858 1820 gene locus_tag LOCUS_11960 858 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1878 2126 gene locus_tag LOCUS_11970 1878 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2890 2219 gene locus_tag LOCUS_11980 2890 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 <3927 2947 gene locus_tag LOCUS_11990 <3927 2947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939361.1:peptide-binding protein >Feature sequence289 722 1222 gene locus_tag LOCUS_12000 722 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1224 1937 gene locus_tag LOCUS_12010 1224 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1934 2164 gene locus_tag LOCUS_12020 1934 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence290 1194 838 gene locus_tag LOCUS_12030 1194 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12030 1662 2033 gene locus_tag LOCUS_12040 1662 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3326 2250 gene locus_tag LOCUS_12050 3326 2250 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776452.1 protein_id gnl|my_center|LOCUS_12050 3887 3354 gene locus_tag LOCUS_12060 3887 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence291 375 707 gene locus_tag LOCUS_12070 375 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 745 1269 gene locus_tag LOCUS_12080 745 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1307 3568 gene locus_tag LOCUS_12090 1307 3568 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082373898.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence292 669 4 gene locus_tag LOCUS_12100 669 4 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583302.1 protein_id gnl|my_center|LOCUS_12100 2884 785 gene locus_tag LOCUS_12110 2884 785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530885.1 protein_id gnl|my_center|LOCUS_12110 <3898 3010 gene locus_tag LOCUS_12120 <3898 3010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000453817.1:ABC transporter permease >Feature sequence293 1601 846 gene locus_tag LOCUS_12130 1601 846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024285.1 protein_id gnl|my_center|LOCUS_12130 2126 1866 gene locus_tag LOCUS_12140 2126 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence294 88 1437 gene locus_tag LOCUS_12150 gene pyk 88 1437 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_12150 1484 2878 gene locus_tag LOCUS_12160 1484 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence295 1008 766 gene locus_tag LOCUS_12170 1008 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1693 1298 gene locus_tag LOCUS_12180 1693 1298 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249914.1 protein_id gnl|my_center|LOCUS_12180 1991 1674 gene locus_tag LOCUS_12190 1991 1674 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_12190 2306 3250 gene locus_tag LOCUS_12200 gene fba 2306 3250 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_12200 3443 3697 gene locus_tag LOCUS_12210 3443 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence296 1406 1155 gene locus_tag LOCUS_12220 1406 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 2819 1578 gene locus_tag LOCUS_12230 2819 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2990 3139 gene locus_tag LOCUS_12240 2990 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence297 1105 326 gene locus_tag LOCUS_12250 1105 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1750 1151 gene locus_tag LOCUS_12260 1750 1151 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930436.1 protein_id gnl|my_center|LOCUS_12260 2510 1728 gene locus_tag LOCUS_12270 2510 1728 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858941.1 protein_id gnl|my_center|LOCUS_12270 3181 2507 gene locus_tag LOCUS_12280 3181 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 3491 3318 gene locus_tag LOCUS_12290 3491 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence298 502 1743 gene locus_tag LOCUS_12300 502 1743 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143789.1 protein_id gnl|my_center|LOCUS_12300 1752 2597 gene locus_tag LOCUS_12310 1752 2597 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_12310 2725 3057 gene locus_tag LOCUS_12320 gene trxA 2725 3057 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence299 >Feature sequence300 757 470 gene locus_tag LOCUS_12330 757 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3248 861 gene locus_tag LOCUS_12340 3248 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence301 <3839 1485 gene locus_tag LOCUS_12350 <3839 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151756788.1:type IV secretion system DNA-binding domain-containing protein >Feature sequence302 401 607 gene locus_tag LOCUS_12360 401 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 627 941 gene locus_tag LOCUS_12370 627 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 938 1276 gene locus_tag LOCUS_12380 938 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1378 1575 gene locus_tag LOCUS_12390 1378 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1568 1726 gene locus_tag LOCUS_12400 1568 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1882 2853 gene locus_tag LOCUS_12410 1882 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2951 3157 gene locus_tag LOCUS_12420 2951 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 3154 3306 gene locus_tag LOCUS_12430 3154 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3311 3490 gene locus_tag LOCUS_12440 3311 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3509 3661 gene locus_tag LOCUS_12450 3509 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3624 3782 gene locus_tag LOCUS_12460 3624 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence303 2005 731 gene locus_tag LOCUS_12470 2005 731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259763.1 protein_id gnl|my_center|LOCUS_12470 <3835 2009 gene locus_tag LOCUS_12480 <3835 2009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256434.1:ABC transporter permease >Feature sequence304 454 1950 gene locus_tag LOCUS_12490 454 1950 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583152.1 protein_id gnl|my_center|LOCUS_12490 1995 2633 gene locus_tag LOCUS_12500 gene tmk 1995 2633 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_12500 2626 3696 gene locus_tag LOCUS_12510 gene mnmA 2626 3696 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence305 278 733 gene locus_tag LOCUS_12520 278 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 778 1224 gene locus_tag LOCUS_12530 778 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1259 1723 gene locus_tag LOCUS_12540 1259 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1752 2594 gene locus_tag LOCUS_12550 1752 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence306 <1 678 gene locus_tag LOCUS_12560 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228344.1:trehalase family glycosidase 675 2216 gene locus_tag LOCUS_12570 675 2216 CDS product glycosyltransferase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877359.1 protein_id gnl|my_center|LOCUS_12570 2308 3498 gene locus_tag LOCUS_12580 2308 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence307 1934 1029 gene locus_tag LOCUS_12590 1934 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3773 2238 gene locus_tag LOCUS_12600 3773 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence308 136 792 gene locus_tag LOCUS_12610 136 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12610 840 2852 gene locus_tag LOCUS_12620 gene fdhF 840 2852 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_12620 3076 3564 gene locus_tag LOCUS_12630 3076 3564 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence309 <1 1016 gene locus_tag LOCUS_12640 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957475.1:uroporphyrinogen decarboxylase 1102 1680 gene locus_tag LOCUS_12650 1102 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12650 1717 1899 gene locus_tag LOCUS_12660 1717 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2006 3028 gene locus_tag LOCUS_12670 2006 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978822.1 protein_id gnl|my_center|LOCUS_12670 3034 3795 gene locus_tag LOCUS_12680 3034 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence310 319 882 gene locus_tag LOCUS_12690 319 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1308 2408 gene locus_tag LOCUS_12700 1308 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2435 3028 gene locus_tag LOCUS_12710 2435 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3166 3396 gene locus_tag LOCUS_12720 3166 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence311 2010 94 gene locus_tag LOCUS_12730 gene selB 2010 94 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_12730 3179 2013 gene locus_tag LOCUS_12740 3179 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence312 67 969 gene locus_tag LOCUS_12750 67 969 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459812.1 protein_id gnl|my_center|LOCUS_12750 1108 1656 gene locus_tag LOCUS_12760 1108 1656 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814921.1 protein_id gnl|my_center|LOCUS_12760 1721 2092 gene locus_tag LOCUS_12770 1721 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 <3793 2567 gene locus_tag LOCUS_12780 <3793 2567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191270.1:leucyl aminopeptidase >Feature sequence313 565 245 gene locus_tag LOCUS_12790 565 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 642 1841 gene locus_tag LOCUS_12800 642 1841 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_12800 2065 1838 gene locus_tag LOCUS_12810 2065 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 2211 2396 gene locus_tag LOCUS_12820 2211 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence314 1080 31 gene locus_tag LOCUS_12830 1080 31 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_12830 1624 1106 gene locus_tag LOCUS_12840 1624 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761769.1 protein_id gnl|my_center|LOCUS_12840 2169 1648 gene locus_tag LOCUS_12850 2169 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 <3790 2288 gene locus_tag LOCUS_12860 <3790 2288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223053.1:DUF2207 domain-containing protein >Feature sequence315 493 1887 gene locus_tag LOCUS_12870 493 1887 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 protein_id gnl|my_center|LOCUS_12870 1884 2906 gene locus_tag LOCUS_12880 1884 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence316 2008 524 gene locus_tag LOCUS_12890 2008 524 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947418.1 protein_id gnl|my_center|LOCUS_12890 3780 2089 gene locus_tag LOCUS_12900 3780 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence317 1 585 gene locus_tag LOCUS_12910 1 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 801 2273 gene locus_tag LOCUS_12920 801 2273 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207383.1 protein_id gnl|my_center|LOCUS_12920 2544 2422 gene locus_tag LOCUS_12930 2544 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 2686 3576 gene locus_tag LOCUS_12940 2686 3576 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339520.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence318 3485 3222 gene locus_tag LOCUS_12950 3485 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence319 2104 908 gene locus_tag LOCUS_12960 2104 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 3343 2123 gene locus_tag LOCUS_12970 3343 2123 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence320 476 105 gene locus_tag LOCUS_12980 gene rplN 476 105 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892852.1 protein_id gnl|my_center|LOCUS_12980 863 627 gene locus_tag LOCUS_12990 gene rpsQ 863 627 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869920.1 protein_id gnl|my_center|LOCUS_12990 1137 934 gene locus_tag LOCUS_13000 gene rpmC 1137 934 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_13000 1564 1142 gene locus_tag LOCUS_13010 gene rplP 1564 1142 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_13010 2250 1585 gene locus_tag LOCUS_13020 gene rpsC 2250 1585 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258237.1 protein_id gnl|my_center|LOCUS_13020 2751 2386 gene locus_tag LOCUS_13030 gene rplV 2751 2386 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143910.1 protein_id gnl|my_center|LOCUS_13030 3062 2781 gene locus_tag LOCUS_13040 gene rpsS 3062 2781 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909214.1 protein_id gnl|my_center|LOCUS_13040 <3770 3068 gene locus_tag LOCUS_13050 <3770 3068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258234.1:50S ribosomal protein L2 >Feature sequence321 473 835 gene locus_tag LOCUS_13060 473 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2119 845 gene locus_tag LOCUS_13070 2119 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2675 2181 gene locus_tag LOCUS_13080 2675 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3163 3729 gene locus_tag LOCUS_13090 3163 3729 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence322 <1 2321 gene locus_tag LOCUS_13100 <1 2321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256976.1:C25 family cysteine peptidase 2327 2968 gene locus_tag LOCUS_13110 2327 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 2952 3239 gene locus_tag LOCUS_13120 2952 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence323 1134 688 gene locus_tag LOCUS_13130 1134 688 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_13130 1751 1170 gene locus_tag LOCUS_13140 gene dcd 1751 1170 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_13140 1994 3220 gene locus_tag LOCUS_13150 1994 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence324 <1 2239 gene locus_tag LOCUS_13160 <1 2239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258333.1:ATP-dependent Clp protease ATP-binding subunit 2296 2625 gene locus_tag LOCUS_13170 gene rsfS 2296 2625 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921947.1 protein_id gnl|my_center|LOCUS_13170 3205 2753 gene locus_tag LOCUS_13180 gene ndk 3205 2753 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_13180 3618 3223 gene locus_tag LOCUS_13190 3618 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence325 3359 525 gene locus_tag LOCUS_13200 3359 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence326 515 18 gene locus_tag LOCUS_13210 515 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1889 519 gene locus_tag LOCUS_13220 1889 519 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_13220 3115 1919 gene locus_tag LOCUS_13230 3115 1919 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 protein_id gnl|my_center|LOCUS_13230 <3742 3149 gene locus_tag LOCUS_13240 <3742 3149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_129610996.1:CaiB/BaiF CoA-transferase family protein >Feature sequence327 357 1106 gene locus_tag LOCUS_13250 357 1106 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887469.1 protein_id gnl|my_center|LOCUS_13250 2118 1162 gene locus_tag LOCUS_13260 2118 1162 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_13260 2535 2888 gene locus_tag LOCUS_13270 2535 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence328 132 1385 gene locus_tag LOCUS_13280 132 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1415 1951 gene locus_tag LOCUS_13290 1415 1951 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963441.1 protein_id gnl|my_center|LOCUS_13290 2103 2252 gene locus_tag LOCUS_13300 2103 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence329 572 390 gene locus_tag LOCUS_13310 572 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 884 654 gene locus_tag LOCUS_13320 884 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3575 1026 gene locus_tag LOCUS_13330 3575 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence330 <1 2452 gene locus_tag LOCUS_13340 <1 2452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256770.1:phenylalanine--tRNA ligase subunit beta 2790 2578 gene locus_tag LOCUS_13350 2790 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 3032 2787 gene locus_tag LOCUS_13360 3032 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence331 2343 1012 gene locus_tag LOCUS_13370 gene obgE 2343 1012 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence332 <1 1161 gene locus_tag LOCUS_13380 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256386.1:LCP family protein 1244 1618 gene locus_tag LOCUS_13390 gene acpS 1244 1618 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256379.1 protein_id gnl|my_center|LOCUS_13390 1624 1815 gene locus_tag LOCUS_13400 1624 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1869 1943 gene locus_tag LOCUS_t00110 1869 1943 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence333 3278 435 gene locus_tag LOCUS_13410 gene fdhF 3278 435 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:complement(2154..2156),aa:Sec) note codon on position 375 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_13410 >Feature sequence334 65 541 gene locus_tag LOCUS_13420 65 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 581 1159 gene locus_tag LOCUS_13430 581 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1226 1381 gene locus_tag LOCUS_13440 1226 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1378 2259 gene locus_tag LOCUS_13450 gene ubiA 1378 2259 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_13450 2335 3120 gene locus_tag LOCUS_13460 2335 3120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391646.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence335 <3704 1 gene locus_tag LOCUS_13470 <3704 1 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942751.1:BREX-1 system adenine-specific DNA-methyltransferase PglX >Feature sequence336 1807 383 gene locus_tag LOCUS_13480 1807 383 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_13480 2699 2115 gene locus_tag LOCUS_13490 2699 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 3519 2773 gene locus_tag LOCUS_13500 3519 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence337 332 341 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 530 2080 gene locus_tag LOCUS_13510 530 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13510 2266 2694 gene locus_tag LOCUS_13520 2266 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2682 3278 gene locus_tag LOCUS_13530 2682 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence338 464 1090 gene locus_tag LOCUS_13540 464 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1139 1429 gene locus_tag LOCUS_13550 1139 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1885 3570 gene locus_tag LOCUS_13560 1885 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence339 85 609 gene locus_tag LOCUS_13570 85 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 805 3321 gene locus_tag LOCUS_13580 805 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence340 375 55 gene locus_tag LOCUS_13590 375 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1409 1137 gene locus_tag LOCUS_13600 1409 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1651 1944 gene locus_tag LOCUS_13610 1651 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1931 2143 gene locus_tag LOCUS_13620 1931 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence341 640 1452 gene locus_tag LOCUS_13630 640 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1457 2452 gene locus_tag LOCUS_13640 1457 2452 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_13640 2717 2863 gene locus_tag LOCUS_13650 2717 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence342 371 1135 gene locus_tag LOCUS_13660 gene tmk 371 1135 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_13660 1240 1830 gene locus_tag LOCUS_13670 1240 1830 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258339.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence343 183 2501 gene locus_tag LOCUS_13680 gene pglZ 183 2501 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence344 136 2031 gene locus_tag LOCUS_13690 136 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 2049 2918 gene locus_tag LOCUS_13700 2049 2918 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052303786.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence345 371 2185 gene locus_tag LOCUS_13710 371 2185 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227739.1 protein_id gnl|my_center|LOCUS_13710 2470 3507 gene locus_tag LOCUS_13720 2470 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence346 >Feature sequence347 643 849 gene locus_tag LOCUS_13730 643 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1120 1317 gene locus_tag LOCUS_13740 1120 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1310 1534 gene locus_tag LOCUS_13750 1310 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1624 2025 gene locus_tag LOCUS_13760 gene tsaA 1624 2025 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064869.1 protein_id gnl|my_center|LOCUS_13760 2063 2722 gene locus_tag LOCUS_13770 2063 2722 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence348 1320 466 gene locus_tag LOCUS_13780 1320 466 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705115.1 protein_id gnl|my_center|LOCUS_13780 1855 3222 gene locus_tag LOCUS_13790 1855 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence349 <1 754 gene locus_tag LOCUS_13800 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012660626.1:endonuclease MutS2 784 1821 gene locus_tag LOCUS_13810 784 1821 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257404.1 protein_id gnl|my_center|LOCUS_13810 3229 2072 gene locus_tag LOCUS_13820 3229 2072 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence350 645 199 gene locus_tag LOCUS_13830 645 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1519 713 gene locus_tag LOCUS_13840 1519 713 CDS product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920868.1 protein_id gnl|my_center|LOCUS_13840 2386 1904 gene locus_tag LOCUS_13850 2386 1904 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_13850 2738 2289 gene locus_tag LOCUS_13860 2738 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2916 2749 gene locus_tag LOCUS_13870 2916 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence351 790 140 gene locus_tag LOCUS_13880 790 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1116 925 gene locus_tag LOCUS_13890 1116 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1269 1659 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1709 1939 gene locus_tag LOCUS_13900 1709 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2288 2614 gene locus_tag LOCUS_13910 2288 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3125 3316 gene locus_tag LOCUS_13920 3125 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence352 259 3003 gene locus_tag LOCUS_13930 259 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence353 <1 1767 gene locus_tag LOCUS_13940 <1 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase 1893 2081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence354 292 146 gene locus_tag LOCUS_13950 292 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2020 467 gene locus_tag LOCUS_13960 2020 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 2645 2052 gene locus_tag LOCUS_13970 gene cofC 2645 2052 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415094.1 protein_id gnl|my_center|LOCUS_13970 <3606 2723 gene locus_tag LOCUS_13980 <3606 2723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256113.1:2-phospho-L-lactate transferase >Feature sequence355 175 429 gene locus_tag LOCUS_13990 175 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 938 2746 gene locus_tag LOCUS_14000 938 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2766 3206 gene locus_tag LOCUS_14010 gene rbfA 2766 3206 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence356 804 1553 gene locus_tag LOCUS_14020 804 1553 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392941.1 protein_id gnl|my_center|LOCUS_14020 1980 1684 gene locus_tag LOCUS_14030 gene hisE 1980 1684 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964261.1 protein_id gnl|my_center|LOCUS_14030 3059 1977 gene locus_tag LOCUS_14040 3059 1977 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence357 3429 1489 gene locus_tag LOCUS_14050 3429 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence358 3575 123 gene locus_tag LOCUS_14060 3575 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence359 411 1244 gene locus_tag LOCUS_14070 411 1244 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615599.1 protein_id gnl|my_center|LOCUS_14070 2461 1403 gene locus_tag LOCUS_14080 2461 1403 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530209.1 protein_id gnl|my_center|LOCUS_14080 3336 2458 gene locus_tag LOCUS_14090 3336 2458 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530210.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence360 556 3483 gene locus_tag LOCUS_14100 556 3483 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148590534.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence361 >Feature sequence362 >Feature sequence363 542 1840 gene locus_tag LOCUS_14110 542 1840 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_14110 1872 2855 gene locus_tag LOCUS_14120 gene ilvA 1872 2855 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 protein_id gnl|my_center|LOCUS_14120 2872 3570 gene locus_tag LOCUS_14130 2872 3570 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391090.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence364 1765 752 gene locus_tag LOCUS_14140 1765 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence365 <1 1171 gene locus_tag LOCUS_14150 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392070.1:folylpolyglutamate synthase/dihydrofolate synthase family protein 1193 1666 gene locus_tag LOCUS_14160 1193 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14160 1688 1945 gene locus_tag LOCUS_14170 1688 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14170 2031 2411 gene locus_tag LOCUS_14180 2031 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14180 2661 2503 gene locus_tag LOCUS_14190 2661 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2789 2995 gene locus_tag LOCUS_14200 2789 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence366 1612 767 gene locus_tag LOCUS_14210 1612 767 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015918758.1 protein_id gnl|my_center|LOCUS_14210 2678 1656 gene locus_tag LOCUS_14220 2678 1656 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083273.1 protein_id gnl|my_center|LOCUS_14220 <3583 2675 gene locus_tag LOCUS_14230 <3583 2675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083271.1:extracellular solute-binding protein >Feature sequence367 1297 908 gene locus_tag LOCUS_14240 1297 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2047 1415 gene locus_tag LOCUS_14250 2047 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 2648 2136 gene locus_tag LOCUS_14260 2648 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence368 1233 886 gene locus_tag LOCUS_14270 1233 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 2851 1592 gene locus_tag LOCUS_14280 2851 1592 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258538.1 protein_id gnl|my_center|LOCUS_14280 <3570 3021 gene locus_tag LOCUS_14290 <3570 3021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258512.1:Stp1/IreP family PP2C-type Ser/Thr phosphatase >Feature sequence369 700 996 gene locus_tag LOCUS_14300 700 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 965 1354 gene locus_tag LOCUS_14310 965 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1595 1383 gene locus_tag LOCUS_14320 1595 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2005 1601 gene locus_tag LOCUS_14330 2005 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2147 2007 gene locus_tag LOCUS_14340 2147 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2520 2119 gene locus_tag LOCUS_14350 2520 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2646 2906 gene locus_tag LOCUS_14360 2646 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 2893 3015 gene locus_tag LOCUS_14370 2893 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence370 226 1296 gene locus_tag LOCUS_14380 gene ftsZ 226 1296 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_14380 1551 2423 gene locus_tag LOCUS_14390 gene bmt 1551 2423 CDS product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530700.1 protein_id gnl|my_center|LOCUS_14390 2436 3353 gene locus_tag LOCUS_14400 2436 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence371 526 598 gene locus_tag LOCUS_t00120 526 598 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 616 1929 gene locus_tag LOCUS_14410 616 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1896 2687 gene locus_tag LOCUS_14420 1896 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2629 3123 gene locus_tag LOCUS_14430 2629 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence372 1951 911 gene locus_tag LOCUS_14440 gene meaB 1951 911 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_14440 2378 1956 gene locus_tag LOCUS_14450 2378 1956 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_14450 2833 2465 gene locus_tag LOCUS_14460 2833 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3149 3012 gene locus_tag LOCUS_14470 3149 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence373 206 1243 gene locus_tag LOCUS_14480 206 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1483 2178 gene locus_tag LOCUS_14490 1483 2178 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258485.1 protein_id gnl|my_center|LOCUS_14490 2189 3262 gene locus_tag LOCUS_14500 2189 3262 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257187.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence374 1191 10 gene locus_tag LOCUS_14510 1191 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 2301 1195 gene locus_tag LOCUS_14520 2301 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 3553 2291 gene locus_tag LOCUS_14530 3553 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence375 991 191 gene locus_tag LOCUS_14540 gene ccsB 991 191 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_14540 1835 1029 gene locus_tag LOCUS_14550 1835 1029 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022831.1 protein_id gnl|my_center|LOCUS_14550 2970 1867 gene locus_tag LOCUS_14560 2970 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence376 1264 2142 gene locus_tag LOCUS_14570 1264 2142 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330131.1 protein_id gnl|my_center|LOCUS_14570 2597 3517 gene locus_tag LOCUS_14580 2597 3517 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence377 417 1004 gene locus_tag LOCUS_14590 417 1004 CDS product protein-S-isoprenylcysteine O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328453.1 protein_id gnl|my_center|LOCUS_14590 1118 1981 gene locus_tag LOCUS_14600 1118 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2147 3091 gene locus_tag LOCUS_14610 2147 3091 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705863.1 protein_id gnl|my_center|LOCUS_14610 3302 3102 gene locus_tag LOCUS_14620 3302 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence378 14 661 gene locus_tag LOCUS_14630 14 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 713 1630 gene locus_tag LOCUS_14640 713 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1627 1833 gene locus_tag LOCUS_14650 1627 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1947 2729 gene locus_tag LOCUS_14660 1947 2729 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104791.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence379 211 3336 gene locus_tag LOCUS_14670 gene secA 211 3336 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080888.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence380 1912 719 gene locus_tag LOCUS_14680 1912 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14680 <3528 1991 gene locus_tag LOCUS_14690 <3528 1991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107207.1:alpha-xylosidase note possible pseudo, internal stop codon >Feature sequence381 1770 595 gene locus_tag LOCUS_14700 1770 595 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 protein_id gnl|my_center|LOCUS_14700 3079 1805 gene locus_tag LOCUS_14710 3079 1805 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618904.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence382 1464 145 gene locus_tag LOCUS_14720 1464 145 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_14720 2060 2452 gene locus_tag LOCUS_14730 2060 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2835 2443 gene locus_tag LOCUS_14740 2835 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 2883 2892 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence383 <1 1009 gene locus_tag LOCUS_14750 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393009.1:phosphopentomutase 1440 1105 gene locus_tag LOCUS_14760 1440 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2216 1449 gene locus_tag LOCUS_14770 gene hisF 2216 1449 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144298.1 protein_id gnl|my_center|LOCUS_14770 2974 2210 gene locus_tag LOCUS_14780 gene hisA 2974 2210 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_14780 <3516 2952 gene locus_tag LOCUS_14790 <3516 2952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393529.1:imidazole glycerol phosphate synthase subunit HisH >Feature sequence384 1740 391 gene locus_tag LOCUS_14800 1740 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 2075 2446 gene locus_tag LOCUS_14810 2075 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence385 367 122 gene locus_tag LOCUS_14820 367 122 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249666.1 protein_id gnl|my_center|LOCUS_14820 1249 485 gene locus_tag LOCUS_14830 1249 485 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065966.1 protein_id gnl|my_center|LOCUS_14830 2557 1679 gene locus_tag LOCUS_14840 2557 1679 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 protein_id gnl|my_center|LOCUS_14840 3027 2770 gene locus_tag LOCUS_14850 3027 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3428 3135 gene locus_tag LOCUS_14860 3428 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence386 <1 2318 gene locus_tag LOCUS_14870 <1 2318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259111.1:M4 family metallopeptidase >Feature sequence387 1843 2202 gene locus_tag LOCUS_14880 1843 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2349 2975 gene locus_tag LOCUS_14890 2349 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 3016 3237 gene locus_tag LOCUS_14900 3016 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence388 1214 2680 gene locus_tag LOCUS_14910 gene mttB 1214 2680 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:O93658 protein_id gnl|my_center|LOCUS_14910 >Feature sequence389 1539 379 gene locus_tag LOCUS_14920 1539 379 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529510.1 protein_id gnl|my_center|LOCUS_14920 2636 1587 gene locus_tag LOCUS_14930 2636 1587 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_14930 3490 2759 gene locus_tag LOCUS_14940 3490 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence390 3357 283 gene locus_tag LOCUS_14950 3357 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence391 591 1577 gene locus_tag LOCUS_14960 591 1577 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_14960 1587 2216 gene locus_tag LOCUS_14970 1587 2216 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence392 147 1742 gene locus_tag LOCUS_14980 147 1742 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391777.1 protein_id gnl|my_center|LOCUS_14980 1788 2588 gene locus_tag LOCUS_14990 1788 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 2585 3094 gene locus_tag LOCUS_15000 2585 3094 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence393 2331 862 gene locus_tag LOCUS_15010 gene mttB 2331 862 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_15010 3330 2440 gene locus_tag LOCUS_15020 3330 2440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967159.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence394 431 1144 gene locus_tag LOCUS_15030 431 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1347 1943 gene locus_tag LOCUS_15040 1347 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2094 3449 gene locus_tag LOCUS_15050 2094 3449 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582573.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence395 1024 323 gene locus_tag LOCUS_15060 1024 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2276 1164 gene locus_tag LOCUS_15070 2276 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2953 2483 gene locus_tag LOCUS_15080 2953 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3221 3379 gene locus_tag LOCUS_15090 3221 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence396 <1 699 gene locus_tag LOCUS_15100 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941287.1:glycosyltransferase family 4 protein 856 1824 gene locus_tag LOCUS_15110 856 1824 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_15110 2061 1819 gene locus_tag LOCUS_15120 2061 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2418 3296 gene locus_tag LOCUS_15130 2418 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence397 1915 1496 gene locus_tag LOCUS_15140 1915 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15140 2257 1946 gene locus_tag LOCUS_15150 2257 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3144 2317 gene locus_tag LOCUS_15160 3144 2317 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765220.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence398 2049 277 gene locus_tag LOCUS_15170 2049 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2573 2259 gene locus_tag LOCUS_15180 2573 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 3115 2777 gene locus_tag LOCUS_15190 3115 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence399 1334 210 gene locus_tag LOCUS_15200 1334 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2056 1331 gene locus_tag LOCUS_15210 2056 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3298 2081 gene locus_tag LOCUS_15220 3298 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence400 1565 1638 gene locus_tag LOCUS_t00130 1565 1638 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1644 1718 gene locus_tag LOCUS_t00140 1644 1718 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1744 1816 gene locus_tag LOCUS_t00150 1744 1816 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1851 1927 gene locus_tag LOCUS_t00160 1851 1927 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1993 2344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2402 2488 gene locus_tag LOCUS_t00170 2402 2488 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2494 2567 gene locus_tag LOCUS_t00180 2494 2567 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2572 2645 gene locus_tag LOCUS_t00190 2572 2645 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2649 2722 gene locus_tag LOCUS_t00200 2649 2722 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2723 2798 gene locus_tag LOCUS_t00210 2723 2798 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2800 2895 gene locus_tag LOCUS_t00220 2800 2895 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2900 2973 gene locus_tag LOCUS_t00230 2900 2973 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2977 3048 gene locus_tag LOCUS_t00240 2977 3048 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3165 3239 gene locus_tag LOCUS_t00250 3165 3239 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3312 3397 gene locus_tag LOCUS_t00260 3312 3397 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence401 >Feature sequence402 1966 938 gene locus_tag LOCUS_15230 1966 938 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249716.1 protein_id gnl|my_center|LOCUS_15230 2919 1966 gene locus_tag LOCUS_15240 2919 1966 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_15240 <3471 2912 gene locus_tag LOCUS_15250 <3471 2912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003389978.1:transketolase >Feature sequence403 <1 849 gene locus_tag LOCUS_15260 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888771.1:histidinol dehydrogenase note possible pseudo, frameshifted 828 1322 gene locus_tag LOCUS_15270 828 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15270 1332 2429 gene locus_tag LOCUS_15280 gene hisC 1332 2429 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257801.1 protein_id gnl|my_center|LOCUS_15280 2439 3035 gene locus_tag LOCUS_15290 gene hisB 2439 3035 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257804.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence404 559 1596 gene locus_tag LOCUS_15300 559 1596 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582579.1 protein_id gnl|my_center|LOCUS_15300 1747 3156 gene locus_tag LOCUS_15310 1747 3156 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974524.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence405 1056 226 gene locus_tag LOCUS_15320 1056 226 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528984.1 protein_id gnl|my_center|LOCUS_15320 2006 1059 gene locus_tag LOCUS_15330 2006 1059 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528983.1 protein_id gnl|my_center|LOCUS_15330 <3467 2094 gene locus_tag LOCUS_15340 <3467 2094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528982.1:sugar ABC transporter substrate-binding protein >Feature sequence406 >Feature sequence407 <1 2438 gene locus_tag LOCUS_15350 <1 2438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_156276126.1:BMP family ABC transporter substrate-binding protein 2720 3022 gene locus_tag LOCUS_15360 2720 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence408 226 1659 gene locus_tag LOCUS_15370 226 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1785 1858 gene locus_tag LOCUS_t00270 1785 1858 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1864 1936 gene locus_tag LOCUS_t00280 1864 1936 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2331 2564 gene locus_tag LOCUS_15380 2331 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2793 3389 gene locus_tag LOCUS_15390 2793 3389 CDS product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090567.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence409 1562 1996 gene locus_tag LOCUS_15400 1562 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2001 2846 gene locus_tag LOCUS_15410 2001 2846 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870318.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence410 <1 515 gene locus_tag LOCUS_15420 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949161.1:pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha 568 1530 gene locus_tag LOCUS_15430 568 1530 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_15430 1663 1953 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1999 3207 gene locus_tag LOCUS_15440 1999 3207 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence411 3 716 gene locus_tag LOCUS_15450 3 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 952 1449 gene locus_tag LOCUS_15460 952 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3396 1519 gene locus_tag LOCUS_15470 3396 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence412 879 1808 gene locus_tag LOCUS_15480 879 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1907 1916 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence413 3394 1757 gene locus_tag LOCUS_15490 3394 1757 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020540.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence414 1047 2579 gene locus_tag LOCUS_15500 1047 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 <3436 2715 gene locus_tag LOCUS_15510 <3436 2715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479723.1:thiolase family protein >Feature sequence415 <1 924 gene locus_tag LOCUS_15520 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969299.1:hydantoinase B/oxoprolinase family protein 1139 1783 gene locus_tag LOCUS_15530 1139 1783 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_15530 1936 3384 gene locus_tag LOCUS_15540 gene mttB 1936 3384 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_15540 >Feature sequence416 444 3164 gene locus_tag LOCUS_15550 444 3164 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879871.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence417 45 1526 gene locus_tag LOCUS_15560 45 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1523 2653 gene locus_tag LOCUS_15570 1523 2653 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence418 2468 1293 gene locus_tag LOCUS_15580 2468 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3356 2640 gene locus_tag LOCUS_15590 3356 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence419 327 1436 gene locus_tag LOCUS_15600 327 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2067 1447 gene locus_tag LOCUS_15610 2067 1447 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_15610 2255 2340 gene locus_tag LOCUS_t00290 2255 2340 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2346 2419 gene locus_tag LOCUS_t00300 2346 2419 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 <3430 2485 gene locus_tag LOCUS_15620 <3430 2485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095306.1:L-ribulose-5-phosphate 3-epimerase >Feature sequence420 <1 529 gene locus_tag LOCUS_15630 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256965.1:sugar ABC transporter permease 529 1611 gene locus_tag LOCUS_15640 529 1611 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256964.1 protein_id gnl|my_center|LOCUS_15640 1636 3024 gene locus_tag LOCUS_15650 1636 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence421 206 1474 gene locus_tag LOCUS_15660 206 1474 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_15660 1531 2268 gene locus_tag LOCUS_15670 1531 2268 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258224.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence422 232 1023 gene locus_tag LOCUS_15680 232 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1514 2779 gene locus_tag LOCUS_15690 1514 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence423 <1 2265 gene locus_tag LOCUS_15700 <1 2265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963368.1:type VII secretion protein EssC 2283 2906 gene locus_tag LOCUS_15710 2283 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence424 1058 1591 gene locus_tag LOCUS_15720 1058 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1634 2008 gene locus_tag LOCUS_15730 1634 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2085 3029 gene locus_tag LOCUS_15740 2085 3029 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_15740 3033 3338 gene locus_tag LOCUS_15750 3033 3338 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816015.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence425 1744 1067 gene locus_tag LOCUS_15760 1744 1067 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393497.1 protein_id gnl|my_center|LOCUS_15760 2240 2998 gene locus_tag LOCUS_15770 2240 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence426 400 1629 gene locus_tag LOCUS_15780 400 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1629 1808 gene locus_tag LOCUS_15790 1629 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2293 2775 gene locus_tag LOCUS_15800 2293 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence427 1739 834 gene locus_tag LOCUS_15810 1739 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2166 1714 gene locus_tag LOCUS_15820 2166 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2983 2153 gene locus_tag LOCUS_15830 2983 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence428 2129 1458 gene locus_tag LOCUS_15840 2129 1458 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_15840 2568 2888 gene locus_tag LOCUS_15850 2568 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence429 86 1090 gene locus_tag LOCUS_15860 86 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1409 3220 gene locus_tag LOCUS_15870 gene dnaK 1409 3220 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257940.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence430 3 662 gene locus_tag LOCUS_15880 3 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 853 2013 gene locus_tag LOCUS_15890 853 2013 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860963.1 protein_id gnl|my_center|LOCUS_15890 2016 3230 gene locus_tag LOCUS_15900 2016 3230 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence431 202 1143 gene locus_tag LOCUS_15910 202 1143 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_15910 1191 2246 gene locus_tag LOCUS_15920 1191 2246 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525324.1 protein_id gnl|my_center|LOCUS_15920 2288 3070 gene locus_tag LOCUS_15930 2288 3070 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525325.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence432 1507 203 gene locus_tag LOCUS_15940 1507 203 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_15940 2274 1504 gene locus_tag LOCUS_15950 2274 1504 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_15950 3007 2249 gene locus_tag LOCUS_15960 gene cmk 3007 2249 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence433 339 1628 gene locus_tag LOCUS_15970 339 1628 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_15970 1697 3103 gene locus_tag LOCUS_15980 gene purB 1697 3103 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence434 18 266 gene locus_tag LOCUS_15990 18 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 987 328 gene locus_tag LOCUS_16000 987 328 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_16000 3220 1076 gene locus_tag LOCUS_16010 gene glgP 3220 1076 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence435 945 742 gene locus_tag LOCUS_16020 945 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1197 961 gene locus_tag LOCUS_16030 1197 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3053 1476 gene locus_tag LOCUS_16040 3053 1476 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence436 3146 2202 gene locus_tag LOCUS_16050 3146 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence437 576 2000 gene locus_tag LOCUS_16060 576 2000 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210399.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence438 956 3112 gene locus_tag LOCUS_16070 956 3112 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256365.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence439 1704 499 gene locus_tag LOCUS_16080 1704 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2610 1801 gene locus_tag LOCUS_16090 2610 1801 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_16090 <3354 2638 gene locus_tag LOCUS_16100 <3354 2638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941298.1:YfhO family protein >Feature sequence440 173 1243 gene locus_tag LOCUS_16110 173 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16110 1373 2851 gene locus_tag LOCUS_16120 1373 2851 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence441 <1 1505 gene locus_tag LOCUS_16130 <1 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093952556.1:branched-chain amino acid ABC transporter permease 1516 2298 gene locus_tag LOCUS_16140 1516 2298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_16140 2285 3007 gene locus_tag LOCUS_16150 2285 3007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence442 2246 1293 gene locus_tag LOCUS_16160 2246 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2437 2261 gene locus_tag LOCUS_16170 2437 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 <3351 2461 gene locus_tag LOCUS_16180 <3351 2461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240446.1:amino acid ABC transporter substrate-binding protein note possible pseudo, frameshifted >Feature sequence443 235 2691 gene locus_tag LOCUS_16190 235 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence444 <1 2034 gene locus_tag LOCUS_16200 <1 2034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460676.1:glycine cleavage system aminomethyltransferase GcvT 2510 2064 gene locus_tag LOCUS_16210 2510 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3209 2826 gene locus_tag LOCUS_16220 3209 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence445 527 1315 gene locus_tag LOCUS_16230 527 1315 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490886.1 protein_id gnl|my_center|LOCUS_16230 1358 1969 gene locus_tag LOCUS_16240 1358 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1983 3260 gene locus_tag LOCUS_16250 1983 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence446 2271 1549 gene locus_tag LOCUS_16260 gene ubiE 2271 1549 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_16260 2720 2268 gene locus_tag LOCUS_16270 2720 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 3316 2720 gene locus_tag LOCUS_16280 3316 2720 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825682.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence447 692 417 gene locus_tag LOCUS_16290 692 417 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391841.1 protein_id gnl|my_center|LOCUS_16290 922 689 gene locus_tag LOCUS_16300 922 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1538 2284 gene locus_tag LOCUS_16310 1538 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2432 3232 gene locus_tag LOCUS_16320 2432 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16320 >Feature sequence448 631 404 gene locus_tag LOCUS_16330 631 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 <3330 1206 gene locus_tag LOCUS_16340 <3330 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404353.1:DNA mismatch repair protein MutS >Feature sequence449 197 406 gene locus_tag LOCUS_16350 197 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 512 820 gene locus_tag LOCUS_16360 512 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 817 1137 gene locus_tag LOCUS_16370 817 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2168 1257 gene locus_tag LOCUS_16380 2168 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2529 3047 gene locus_tag LOCUS_16390 2529 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence450 <1 2254 gene locus_tag LOCUS_16400 <1 2254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009292939.1:glycoside hydrolase family 65 protein >Feature sequence451 <1 1309 gene locus_tag LOCUS_16410 <1 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031166.1:squalene--hopene cyclase >Feature sequence452 1125 475 gene locus_tag LOCUS_16420 1125 475 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975300.1 protein_id gnl|my_center|LOCUS_16420 2372 1137 gene locus_tag LOCUS_16430 2372 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence453 406 2148 gene locus_tag LOCUS_16440 406 2148 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257008.1 protein_id gnl|my_center|LOCUS_16440 2199 2274 gene locus_tag LOCUS_t00310 2199 2274 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3275 2898 gene locus_tag LOCUS_16450 3275 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence454 368 51 gene locus_tag LOCUS_16460 368 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 582 1664 gene locus_tag LOCUS_16470 gene ruvB 582 1664 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258937.1 protein_id gnl|my_center|LOCUS_16470 1843 3135 gene locus_tag LOCUS_16480 1843 3135 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867786.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence455 3178 1388 gene locus_tag LOCUS_16490 3178 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence456 1280 1603 gene locus_tag LOCUS_16500 1280 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1941 1639 gene locus_tag LOCUS_16510 1941 1639 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence457 1723 887 gene locus_tag LOCUS_16520 1723 887 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461127.1 protein_id gnl|my_center|LOCUS_16520 2821 1745 gene locus_tag LOCUS_16530 2821 1745 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_16530 3298 2840 gene locus_tag LOCUS_16540 3298 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence458 128 1336 gene locus_tag LOCUS_16550 128 1336 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_16550 1967 2157 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence459 <1 1642 gene locus_tag LOCUS_16560 <1 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006101871.1:DUF4114 domain-containing protein 1717 2814 gene locus_tag LOCUS_16570 1717 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence460 >Feature sequence461 995 144 gene locus_tag LOCUS_16580 995 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1090 1467 gene locus_tag LOCUS_16590 1090 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2357 1557 gene locus_tag LOCUS_16600 2357 1557 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258201.1 protein_id gnl|my_center|LOCUS_16600 3154 2354 gene locus_tag LOCUS_16610 3154 2354 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence462 >Feature sequence463 1016 1912 gene locus_tag LOCUS_16620 1016 1912 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260027.1 protein_id gnl|my_center|LOCUS_16620 1978 2889 gene locus_tag LOCUS_16630 1978 2889 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730582.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence464 858 2201 gene locus_tag LOCUS_16640 858 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2380 2679 gene locus_tag LOCUS_16650 2380 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2977 2708 gene locus_tag LOCUS_16660 2977 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2868 3158 gene locus_tag LOCUS_16670 2868 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence465 2092 170 gene locus_tag LOCUS_16680 2092 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2838 2092 gene locus_tag LOCUS_16690 2838 2092 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence466 216 488 gene locus_tag LOCUS_16700 216 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 460 948 gene locus_tag LOCUS_16710 460 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1179 1460 gene locus_tag LOCUS_16720 1179 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1457 2107 gene locus_tag LOCUS_16730 1457 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2240 2581 gene locus_tag LOCUS_16740 2240 2581 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_16740 2686 3024 gene locus_tag LOCUS_16750 2686 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence467 3 392 gene locus_tag LOCUS_16760 3 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 478 1599 gene locus_tag LOCUS_16770 478 1599 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729196.1 protein_id gnl|my_center|LOCUS_16770 1589 3235 gene locus_tag LOCUS_16780 1589 3235 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227966.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence468 3031 1388 gene locus_tag LOCUS_16790 3031 1388 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932359.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence469 192 2987 gene locus_tag LOCUS_16800 192 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence470 405 998 gene locus_tag LOCUS_16810 405 998 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 protein_id gnl|my_center|LOCUS_16810 1134 1367 gene locus_tag LOCUS_16820 1134 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 <3265 1526 gene locus_tag LOCUS_16830 <3265 1526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256318.1:SdrD B-like domain-containing protein >Feature sequence471 415 230 gene locus_tag LOCUS_16840 415 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1389 592 gene locus_tag LOCUS_16850 1389 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2795 1386 gene locus_tag LOCUS_16860 2795 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence472 1483 62 gene locus_tag LOCUS_16870 1483 62 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_16870 <3260 1485 gene locus_tag LOCUS_16880 <3260 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065303.1:DEAD/DEAH box helicase family protein >Feature sequence473 1194 55 gene locus_tag LOCUS_16890 gene citZ 1194 55 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_16890 <3260 1221 gene locus_tag LOCUS_16900 <3260 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942344.1:NADP-dependent malic enzyme >Feature sequence474 790 407 gene locus_tag LOCUS_16910 gene gcvH 790 407 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_16910 1592 2770 gene locus_tag LOCUS_16920 1592 2770 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence475 1614 1258 gene locus_tag LOCUS_16930 1614 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2215 2637 gene locus_tag LOCUS_16940 2215 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 2643 3176 gene locus_tag LOCUS_16950 2643 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence476 2337 1270 gene locus_tag LOCUS_16960 2337 1270 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_16960 <3247 2334 gene locus_tag LOCUS_16970 <3247 2334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584052.1:ABC transporter ATP-binding protein >Feature sequence477 <1 1254 gene locus_tag LOCUS_16980 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973971.1:AAA family ATPase 1278 2618 gene locus_tag LOCUS_16990 1278 2618 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence478 267 998 gene locus_tag LOCUS_17000 267 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1065 1147 gene locus_tag LOCUS_t00320 1065 1147 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1487 1669 gene locus_tag LOCUS_17010 1487 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1722 2459 gene locus_tag LOCUS_17020 1722 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence479 483 1358 gene locus_tag LOCUS_17030 483 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1370 2533 gene locus_tag LOCUS_17040 1370 2533 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141151.1 protein_id gnl|my_center|LOCUS_17040 2530 3126 gene locus_tag LOCUS_17050 2530 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence480 2984 1962 gene locus_tag LOCUS_17060 2984 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence481 1435 683 gene locus_tag LOCUS_17070 1435 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1319 2056 gene locus_tag LOCUS_17080 1319 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2865 2083 gene locus_tag LOCUS_17090 2865 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence482 1014 67 gene locus_tag LOCUS_17100 gene era 1014 67 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 protein_id gnl|my_center|LOCUS_17100 1305 1724 gene locus_tag LOCUS_17110 1305 1724 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349708.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence483 1673 2473 gene locus_tag LOCUS_17120 gene mutM 1673 2473 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640272.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence484 404 1519 gene locus_tag LOCUS_17130 404 1519 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009348598.1 protein_id gnl|my_center|LOCUS_17130 1748 1927 gene locus_tag LOCUS_17140 1748 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1924 3072 gene locus_tag LOCUS_17150 1924 3072 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence485 <3219 273 gene locus_tag LOCUS_17160 <3219 273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667015.1:class I SAM-dependent DNA methyltransferase >Feature sequence486 533 542 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1529 1690 gene locus_tag LOCUS_17170 1529 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2601 1714 gene locus_tag LOCUS_17180 2601 1714 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence487 2250 1393 gene locus_tag LOCUS_17190 2250 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2182 2427 gene locus_tag LOCUS_17200 2182 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 <3216 2513 gene locus_tag LOCUS_17210 <3216 2513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255985.1:DNA adenine methylase >Feature sequence488 >Feature sequence489 2034 2546 gene locus_tag LOCUS_17220 2034 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2603 3157 gene locus_tag LOCUS_17230 2603 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence490 3106 1526 gene locus_tag LOCUS_17240 3106 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence491 >Feature sequence492 163 2901 gene locus_tag LOCUS_17250 163 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence493 881 87 gene locus_tag LOCUS_17260 881 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3128 966 gene locus_tag LOCUS_17270 3128 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence494 <3200 2632 gene locus_tag LOCUS_17280 <3200 2632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001388628.1:VWA domain-containing protein >Feature sequence495 2510 1083 gene locus_tag LOCUS_17290 2510 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 2899 2507 gene locus_tag LOCUS_17300 2899 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence496 <1 966 gene locus_tag LOCUS_17310 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119546.1:four-carbon acid sugar kinase family protein 1145 1990 gene locus_tag LOCUS_17320 1145 1990 CDS product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969407.1 protein_id gnl|my_center|LOCUS_17320 2033 2845 gene locus_tag LOCUS_17330 2033 2845 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969400.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence497 1452 16 gene locus_tag LOCUS_17340 1452 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1933 1523 gene locus_tag LOCUS_17350 1933 1523 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888313.1 protein_id gnl|my_center|LOCUS_17350 2444 2356 gene locus_tag LOCUS_t00330 2444 2356 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence498 169 492 gene locus_tag LOCUS_17360 169 492 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810291.1 protein_id gnl|my_center|LOCUS_17360 492 770 gene locus_tag LOCUS_17370 492 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2115 985 gene locus_tag LOCUS_17380 2115 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2756 2965 gene locus_tag LOCUS_17390 2756 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence499 569 1312 gene locus_tag LOCUS_17400 gene fabG 569 1312 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911782.1 protein_id gnl|my_center|LOCUS_17400 1463 1816 gene locus_tag LOCUS_17410 1463 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1911 2363 gene locus_tag LOCUS_17420 gene nusB 1911 2363 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_17420 2381 2917 gene locus_tag LOCUS_17430 2381 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence500 1629 388 gene locus_tag LOCUS_17440 gene fabF 1629 388 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989923.1 protein_id gnl|my_center|LOCUS_17440 2743 2273 gene locus_tag LOCUS_17450 2743 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 3178 2957 gene locus_tag LOCUS_17460 3178 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence501 550 1452 gene locus_tag LOCUS_17470 gene galU 550 1452 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_17470 1547 2476 gene locus_tag LOCUS_17480 1547 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 <3179 2424 gene locus_tag LOCUS_17490 <3179 2424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392125.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence502 <1 574 gene locus_tag LOCUS_17500 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990695.1:class I SAM-dependent methyltransferase 576 1646 gene locus_tag LOCUS_17510 576 1646 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964780.1 protein_id gnl|my_center|LOCUS_17510 1676 2776 gene locus_tag LOCUS_17520 1676 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence503 1043 327 gene locus_tag LOCUS_17530 1043 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2907 1225 gene locus_tag LOCUS_17540 2907 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence504 1034 234 gene locus_tag LOCUS_17550 gene istB 1034 234 CDS product IS21-like element ISBj11 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018270204.1 protein_id gnl|my_center|LOCUS_17550 2529 1021 gene locus_tag LOCUS_17560 gene istA 2529 1021 CDS product IS21-like element ISBj11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084518.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence505 670 1347 gene locus_tag LOCUS_17570 670 1347 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_17570 1419 1787 gene locus_tag LOCUS_17580 1419 1787 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_17580 1787 2959 gene locus_tag LOCUS_17590 1787 2959 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191212.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence506 430 2709 gene locus_tag LOCUS_17600 430 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence507 1269 2414 gene locus_tag LOCUS_17610 1269 2414 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence508 1019 582 gene locus_tag LOCUS_17620 1019 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17620 1291 1085 gene locus_tag LOCUS_17630 1291 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17630 2620 1379 gene locus_tag LOCUS_17640 2620 1379 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064075.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence509 1786 956 gene locus_tag LOCUS_17650 gene fabG 1786 956 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_17650 2544 1783 gene locus_tag LOCUS_17660 gene hpaI 2544 1783 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889550.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence510 70 420 gene locus_tag LOCUS_17670 70 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 941 2041 gene locus_tag LOCUS_17680 941 2041 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722128.1 protein_id gnl|my_center|LOCUS_17680 2034 2870 gene locus_tag LOCUS_17690 2034 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence511 <1 645 gene locus_tag LOCUS_17700 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976273.1:glycoside hydrolase family 127 protein 779 1018 gene locus_tag LOCUS_17710 779 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence512 >Feature sequence513 1901 621 gene locus_tag LOCUS_17720 1901 621 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_17720 3062 1986 gene locus_tag LOCUS_17730 3062 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence514 400 137 gene locus_tag LOCUS_17740 400 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2901 514 gene locus_tag LOCUS_17750 2901 514 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920015.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence515 <1 1464 gene locus_tag LOCUS_17760 <1 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920852.1:ABC transporter ATP-binding protein/permease 1979 2164 gene locus_tag LOCUS_17770 1979 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2273 2536 gene locus_tag LOCUS_17780 2273 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence516 2095 89 gene locus_tag LOCUS_17790 gene hdrA 2095 89 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_17790 <3138 2128 gene locus_tag LOCUS_17800 <3138 2128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289484.1:heterodisulfide reductase-related iron-sulfur binding cluster >Feature sequence517 1840 359 gene locus_tag LOCUS_17810 1840 359 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_17810 2605 1874 gene locus_tag LOCUS_17820 2605 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence518 <1 1017 gene locus_tag LOCUS_17830 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001580350.1:phosphonate ABC transporter, permease protein PhnE 1114 2667 gene locus_tag LOCUS_17840 1114 2667 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_17840 2654 3097 gene locus_tag LOCUS_17850 2654 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence519 1720 350 gene locus_tag LOCUS_17860 1720 350 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903474.1 protein_id gnl|my_center|LOCUS_17860 1909 1724 gene locus_tag LOCUS_17870 1909 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2120 1896 gene locus_tag LOCUS_17880 2120 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 <3127 2130 gene locus_tag LOCUS_17890 <3127 2130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990698.1:ABC transporter permease >Feature sequence520 >Feature sequence521 1100 324 gene locus_tag LOCUS_17900 1100 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17900 2129 1173 gene locus_tag LOCUS_17910 2129 1173 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_17910 2341 2162 gene locus_tag LOCUS_17920 2341 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2738 2358 gene locus_tag LOCUS_17930 2738 2358 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250966.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence522 2704 239 gene locus_tag LOCUS_17940 gene gyrA 2704 239 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_17940 2935 2813 gene locus_tag LOCUS_17950 2935 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence523 2816 1149 gene locus_tag LOCUS_17960 2816 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence524 400 1512 gene locus_tag LOCUS_17970 gene ald 400 1512 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_17970 1636 1800 gene locus_tag LOCUS_17980 1636 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1760 3055 gene locus_tag LOCUS_17990 gene larA 1760 3055 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393426.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence525 122 766 gene locus_tag LOCUS_18000 122 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 763 2421 gene locus_tag LOCUS_18010 763 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence526 195 16 gene locus_tag LOCUS_18020 gene rpmB 195 16 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256168.1 protein_id gnl|my_center|LOCUS_18020 331 705 gene locus_tag LOCUS_18030 331 705 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583499.1 protein_id gnl|my_center|LOCUS_18030 718 2397 gene locus_tag LOCUS_18040 718 2397 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289723.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence527 2510 870 gene locus_tag LOCUS_18050 2510 870 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_18050 3051 2560 gene locus_tag LOCUS_18060 3051 2560 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence528 251 1186 gene locus_tag LOCUS_18070 251 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1364 1624 gene locus_tag LOCUS_18080 1364 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1621 2274 gene locus_tag LOCUS_18090 1621 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2612 2857 gene locus_tag LOCUS_18100 2612 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence529 481 642 gene locus_tag LOCUS_18110 481 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1149 670 gene locus_tag LOCUS_18120 1149 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1306 1626 gene locus_tag LOCUS_18130 1306 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 2411 1638 gene locus_tag LOCUS_18140 2411 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 2901 3050 gene locus_tag LOCUS_18150 2901 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence530 <1 2256 gene locus_tag LOCUS_18160 <1 2256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258507.1:valine--tRNA ligase 2465 2540 gene locus_tag LOCUS_t00340 2465 2540 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence531 2071 521 gene locus_tag LOCUS_18170 2071 521 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_18170 2681 2370 gene locus_tag LOCUS_18180 2681 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence532 493 807 gene locus_tag LOCUS_18190 493 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 872 1162 gene locus_tag LOCUS_18200 872 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1216 1635 gene locus_tag LOCUS_18210 1216 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1661 1897 gene locus_tag LOCUS_18220 1661 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1899 2342 gene locus_tag LOCUS_18230 1899 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence533 1866 523 gene locus_tag LOCUS_18240 1866 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 <3092 1859 gene locus_tag LOCUS_18250 <3092 1859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147051.1:serine/threonine protein kinase PpkA >Feature sequence534 75 410 gene locus_tag LOCUS_18260 75 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1282 479 gene locus_tag LOCUS_18270 1282 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1422 1757 gene locus_tag LOCUS_18280 1422 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 2861 1773 gene locus_tag LOCUS_18290 2861 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence535 1535 660 gene locus_tag LOCUS_18300 1535 660 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_18300 1839 2966 gene locus_tag LOCUS_18310 1839 2966 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681602.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence536 500 2890 gene locus_tag LOCUS_18320 500 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence537 2416 821 gene locus_tag LOCUS_18330 2416 821 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_18330 3003 2416 gene locus_tag LOCUS_18340 3003 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence538 1858 377 gene locus_tag LOCUS_18350 gene lysS 1858 377 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257111.1 protein_id gnl|my_center|LOCUS_18350 2065 1880 gene locus_tag LOCUS_18360 2065 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2591 2121 gene locus_tag LOCUS_18370 gene greA 2591 2121 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_18370 2830 2952 gene locus_tag LOCUS_18380 2830 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence539 577 1461 gene locus_tag LOCUS_18390 577 1461 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723883.1 protein_id gnl|my_center|LOCUS_18390 1694 2629 gene locus_tag LOCUS_18400 1694 2629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528534.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence540 603 2003 gene locus_tag LOCUS_18410 603 2003 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036680.1 protein_id gnl|my_center|LOCUS_18410 <3076 2066 gene locus_tag LOCUS_18420 <3076 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050754218.1:DDE-type integrase/transposase/recombinase >Feature sequence541 180 857 gene locus_tag LOCUS_18430 gene cmk 180 857 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_18430 871 2346 gene locus_tag LOCUS_18440 871 2346 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence542 976 68 gene locus_tag LOCUS_18450 976 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1894 1088 gene locus_tag LOCUS_18460 1894 1088 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence543 >Feature sequence544 3043 122 gene locus_tag LOCUS_18470 3043 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence545 264 1325 gene locus_tag LOCUS_18480 264 1325 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339268.1 protein_id gnl|my_center|LOCUS_18480 1357 1995 gene locus_tag LOCUS_18490 1357 1995 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119544.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence546 <1 941 gene locus_tag LOCUS_18500 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257083.1:energy-coupling factor transporter transmembrane component T 982 2616 gene locus_tag LOCUS_18510 982 2616 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence547 915 70 gene locus_tag LOCUS_18520 gene pstA 915 70 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939749.1 protein_id gnl|my_center|LOCUS_18520 1889 915 gene locus_tag LOCUS_18530 gene pstC 1889 915 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_18530 2994 2092 gene locus_tag LOCUS_18540 2994 2092 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence548 <3055 526 gene locus_tag LOCUS_18550 <3055 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162177619.1:DUF3160 domain-containing protein >Feature sequence549 1 786 gene locus_tag LOCUS_18560 1 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 779 3031 gene locus_tag LOCUS_18570 779 3031 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143631.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence550 208 789 gene locus_tag LOCUS_18580 gene ruvA 208 789 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_18580 2302 884 gene locus_tag LOCUS_18590 gene mnmE 2302 884 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence551 <1 656 gene locus_tag LOCUS_18600 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112934.1:agmatinase 1896 724 gene locus_tag LOCUS_18610 1896 724 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393028.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence552 <3047 1333 gene locus_tag LOCUS_18620 <3047 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228230.1:site-2 protease family protein >Feature sequence553 414 423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 472 693 gene locus_tag LOCUS_18630 472 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 686 1693 gene locus_tag LOCUS_18640 686 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence554 705 73 gene locus_tag LOCUS_18650 705 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1117 1551 gene locus_tag LOCUS_18660 1117 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence555 <3039 2254 gene locus_tag LOCUS_18670 <3039 2254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258506.1:alpha/beta hydrolase >Feature sequence556 392 598 gene locus_tag LOCUS_18680 392 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 595 969 gene locus_tag LOCUS_18690 595 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 1698 2396 gene locus_tag LOCUS_18700 1698 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence557 1414 458 gene locus_tag LOCUS_18710 1414 458 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940009.1 protein_id gnl|my_center|LOCUS_18710 2759 1587 gene locus_tag LOCUS_18720 2759 1587 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence558 56 2227 gene locus_tag LOCUS_18730 56 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence559 111 1070 gene locus_tag LOCUS_18740 gene rsmA 111 1070 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256787.1 protein_id gnl|my_center|LOCUS_18740 1102 2268 gene locus_tag LOCUS_18750 1102 2268 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence560 2086 461 gene locus_tag LOCUS_18760 2086 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence561 1842 781 gene locus_tag LOCUS_18770 1842 781 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143092.1 protein_id gnl|my_center|LOCUS_18770 2429 2974 gene locus_tag LOCUS_18780 2429 2974 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence562 1460 861 gene locus_tag LOCUS_18790 1460 861 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036730001.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence563 1164 505 gene locus_tag LOCUS_18800 1164 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18800 1616 1095 gene locus_tag LOCUS_18810 1616 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18810 2520 1600 gene locus_tag LOCUS_18820 gene cbiB 2520 1600 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258432.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence564 <1 1132 gene locus_tag LOCUS_18830 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257055.1:ABC transporter permease 1486 1169 gene locus_tag LOCUS_18840 1486 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1485 2828 gene locus_tag LOCUS_18850 1485 2828 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence565 213 1067 gene locus_tag LOCUS_18860 213 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1228 1983 gene locus_tag LOCUS_18870 1228 1983 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089900.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence566 1739 411 gene locus_tag LOCUS_18880 gene acsC 1739 411 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_18880 <3016 1813 gene locus_tag LOCUS_18890 <3016 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944232.1:acetyl-CoA decarbonylase/synthase complex subunit delta >Feature sequence567 >Feature sequence568 <1 2277 gene locus_tag LOCUS_18900 <1 2277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391785.1:Ig-like domain-containing protein >Feature sequence569 35 1135 gene locus_tag LOCUS_18910 35 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1460 1101 gene locus_tag LOCUS_18920 1460 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18920 2273 1518 gene locus_tag LOCUS_18930 2273 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18930 2689 2270 gene locus_tag LOCUS_18940 2689 2270 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence570 1261 326 gene locus_tag LOCUS_18950 1261 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2065 1526 gene locus_tag LOCUS_18960 2065 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence571 1215 634 gene locus_tag LOCUS_18970 1215 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2934 1480 gene locus_tag LOCUS_18980 2934 1480 CDS product IS91-like element ISCR1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050481.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence572 1241 2884 gene locus_tag LOCUS_18990 1241 2884 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384278.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence573 89 451 gene locus_tag LOCUS_19000 89 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 585 980 gene locus_tag LOCUS_19010 585 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence574 2796 1042 gene locus_tag LOCUS_19020 2796 1042 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398544.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence575 1546 794 gene locus_tag LOCUS_19030 gene lsrF 1546 794 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209188.1 protein_id gnl|my_center|LOCUS_19030 1931 2710 gene locus_tag LOCUS_19040 1931 2710 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977803.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence576 1594 560 gene locus_tag LOCUS_19050 1594 560 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530992.1 protein_id gnl|my_center|LOCUS_19050 <3002 1905 gene locus_tag LOCUS_19060 <3002 1905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226239.1:LacI family DNA-binding transcriptional regulator >Feature sequence577 >Feature sequence578 125 2779 gene locus_tag LOCUS_19070 125 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence579 <1 604 gene locus_tag LOCUS_19080 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403760.1:sulfotransferase 618 1595 gene locus_tag LOCUS_19090 618 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1603 2574 gene locus_tag LOCUS_19100 1603 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence580 36 290 gene locus_tag LOCUS_19110 36 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 793 281 gene locus_tag LOCUS_19120 793 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 1088 786 gene locus_tag LOCUS_19130 1088 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence581 1010 645 gene locus_tag LOCUS_19140 1010 645 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 protein_id gnl|my_center|LOCUS_19140 2005 1079 gene locus_tag LOCUS_19150 2005 1079 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence582 276 2090 gene locus_tag LOCUS_19160 gene ftsH 276 2090 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_19160 2293 2928 gene locus_tag LOCUS_19170 2293 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence583 <2977 250 gene locus_tag LOCUS_19180 <2977 250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256147.1:PAS domain-containing hybrid sensor histidine kinase/response regulator >Feature sequence584 884 273 gene locus_tag LOCUS_19190 884 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2077 881 gene locus_tag LOCUS_19200 2077 881 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 protein_id gnl|my_center|LOCUS_19200 2361 2149 gene locus_tag LOCUS_19210 2361 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2484 2953 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcagccccctactcatcggggatg >Feature sequence585 620 1624 gene locus_tag LOCUS_19220 620 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1821 2744 gene locus_tag LOCUS_19230 1821 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence586 1675 1409 gene locus_tag LOCUS_19240 1675 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2963 1992 gene locus_tag LOCUS_19250 2963 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence587 <1 1205 gene locus_tag LOCUS_19260 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121616.1:sulfatase-like hydrolase/transferase >Feature sequence588 970 1614 gene locus_tag LOCUS_19270 970 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1604 2734 gene locus_tag LOCUS_19280 1604 2734 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence589 1246 1803 gene locus_tag LOCUS_19290 1246 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2289 1915 gene locus_tag LOCUS_19300 2289 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence590 >Feature sequence591 494 2020 gene locus_tag LOCUS_19310 gene xylB 494 2020 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764573.1 protein_id gnl|my_center|LOCUS_19310 2467 2841 gene locus_tag LOCUS_19320 2467 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence592 916 1446 gene locus_tag LOCUS_19330 916 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2650 2354 gene locus_tag LOCUS_19340 gene hgcB 2650 2354 CDS product mercury methylation ferredoxin HgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence593 2032 938 gene locus_tag LOCUS_19350 2032 938 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_19350 <2946 2086 gene locus_tag LOCUS_19360 <2946 2086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250726.1:ABC transporter ATP-binding protein >Feature sequence594 1531 1007 gene locus_tag LOCUS_19370 1531 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 1563 1796 gene locus_tag LOCUS_19380 1563 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2105 1890 gene locus_tag LOCUS_19390 2105 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence595 1452 196 gene locus_tag LOCUS_19400 gene xseA 1452 196 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259569.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence596 <1 1152 gene locus_tag LOCUS_19410 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258675.1:phosphoglycerate kinase 1226 1924 gene locus_tag LOCUS_19420 1226 1924 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889063.1 protein_id gnl|my_center|LOCUS_19420 2266 2766 gene locus_tag LOCUS_19430 2266 2766 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence597 945 1244 gene locus_tag LOCUS_19440 945 1244 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144191.1 protein_id gnl|my_center|LOCUS_19440 1241 1603 gene locus_tag LOCUS_19450 1241 1603 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190909147.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence598 1191 2597 gene locus_tag LOCUS_19460 1191 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence599 644 171 gene locus_tag LOCUS_19470 gene smpB 644 171 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_19470 1876 641 gene locus_tag LOCUS_19480 1876 641 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_19480 <2935 2062 gene locus_tag LOCUS_19490 <2935 2062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942416.1:S41 family peptidase >Feature sequence600 300 34 gene locus_tag LOCUS_19500 300 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 <2934 519 gene locus_tag LOCUS_19510 <2934 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076003404.1:LuxR C-terminal-related transcriptional regulator >Feature sequence601 142 1455 gene locus_tag LOCUS_19520 gene lysA 142 1455 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 protein_id gnl|my_center|LOCUS_19520 1570 2832 gene locus_tag LOCUS_19530 gene megL 1570 2832 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence602 988 1527 gene locus_tag LOCUS_19540 988 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 1646 1975 gene locus_tag LOCUS_19550 1646 1975 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053204416.1 protein_id gnl|my_center|LOCUS_19550 2171 2863 gene locus_tag LOCUS_19560 2171 2863 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969628.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence603 625 1965 gene locus_tag LOCUS_19570 625 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2142 2345 gene locus_tag LOCUS_19580 2142 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2588 2827 gene locus_tag LOCUS_19590 2588 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence604 969 568 gene locus_tag LOCUS_19600 969 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1270 950 gene locus_tag LOCUS_19610 1270 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1638 1429 gene locus_tag LOCUS_19620 1638 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2296 2084 gene locus_tag LOCUS_19630 2296 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence605 <1 925 gene locus_tag LOCUS_19640 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927136.1:Glu/Leu/Phe/Val dehydrogenase 1593 1171 gene locus_tag LOCUS_19650 1593 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence606 540 1487 gene locus_tag LOCUS_19660 540 1487 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812740.1 protein_id gnl|my_center|LOCUS_19660 1513 2559 gene locus_tag LOCUS_19670 1513 2559 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence607 813 1622 gene locus_tag LOCUS_19680 813 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1639 2556 gene locus_tag LOCUS_19690 1639 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence608 <1 1139 gene locus_tag LOCUS_19700 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392748.1:6-phosphofructokinase 1280 2395 gene locus_tag LOCUS_19710 1280 2395 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence609 >Feature sequence610 130 822 gene locus_tag LOCUS_19720 130 822 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_19720 815 2260 gene locus_tag LOCUS_19730 815 2260 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_19730 <2920 2306 gene locus_tag LOCUS_19740 <2920 2306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932386.1:SprT family zinc-dependent metalloprotease >Feature sequence611 1065 460 gene locus_tag LOCUS_19750 gene hisH 1065 460 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_19750 1652 1062 gene locus_tag LOCUS_19760 gene hisB 1652 1062 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257804.1 protein_id gnl|my_center|LOCUS_19760 <2919 1656 gene locus_tag LOCUS_19770 <2919 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257801.1:histidinol-phosphate transaminase >Feature sequence612 580 792 gene locus_tag LOCUS_19780 580 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1107 955 gene locus_tag LOCUS_19790 1107 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2054 1137 gene locus_tag LOCUS_19800 2054 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2107 2358 gene locus_tag LOCUS_19810 2107 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2690 2364 gene locus_tag LOCUS_19820 2690 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence613 2071 659 gene locus_tag LOCUS_19830 gene selA 2071 659 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_19830 2453 2079 gene locus_tag LOCUS_19840 2453 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence614 <2914 1490 gene locus_tag LOCUS_19850 <2914 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272644.1:PEP/pyruvate-binding domain-containing protein >Feature sequence615 <2914 1246 gene locus_tag LOCUS_19860 <2914 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141702.1:S9 family peptidase >Feature sequence616 1600 512 gene locus_tag LOCUS_19870 1600 512 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704465.1 protein_id gnl|my_center|LOCUS_19870 <2910 1638 gene locus_tag LOCUS_19880 <2910 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763429.1:MmgE/PrpD family protein >Feature sequence617 629 1519 gene locus_tag LOCUS_19890 629 1519 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898106.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence618 1141 689 gene locus_tag LOCUS_19900 1141 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 1416 1162 gene locus_tag LOCUS_19910 1416 1162 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_19910 <2905 2220 gene locus_tag LOCUS_19920 <2905 2220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089665.1:hydrogenase expression/formation protein HypE >Feature sequence619 <1 1423 gene locus_tag LOCUS_19930 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072774369.1:DNA mismatch repair protein MutS >Feature sequence620 <1 757 gene locus_tag LOCUS_19940 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258104.1:pyrroline-5-carboxylate reductase 750 1040 gene locus_tag LOCUS_19950 750 1040 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545961.1 protein_id gnl|my_center|LOCUS_19950 1095 1394 gene locus_tag LOCUS_19960 1095 1394 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_19960 1518 2036 gene locus_tag LOCUS_19970 1518 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2816 2115 gene locus_tag LOCUS_19980 2816 2115 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047987.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence621 2897 1797 gene locus_tag LOCUS_19990 2897 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence622 1604 273 gene locus_tag LOCUS_20000 1604 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 1855 2136 gene locus_tag LOCUS_20010 1855 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20010 >Feature sequence623 1314 397 gene locus_tag LOCUS_20020 1314 397 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227916.1 protein_id gnl|my_center|LOCUS_20020 1466 1738 gene locus_tag LOCUS_20030 1466 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence624 51 488 gene locus_tag LOCUS_20040 51 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 511 960 gene locus_tag LOCUS_20050 511 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 918 1535 gene locus_tag LOCUS_20060 918 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 1609 2325 gene locus_tag LOCUS_20070 1609 2325 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_20070 2446 2631 gene locus_tag LOCUS_20080 2446 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20080 >Feature sequence625 2047 1577 gene locus_tag LOCUS_20090 2047 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2273 2070 gene locus_tag LOCUS_20100 2273 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2652 2263 gene locus_tag LOCUS_20110 2652 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2867 2649 gene locus_tag LOCUS_20120 2867 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence626 2383 1172 gene locus_tag LOCUS_20130 2383 1172 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence627 2458 1988 gene locus_tag LOCUS_20140 gene rpsG 2458 1988 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence628 556 1107 gene locus_tag LOCUS_20150 556 1107 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_20150 1276 1692 gene locus_tag LOCUS_20160 1276 1692 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_20160 1689 2774 gene locus_tag LOCUS_20170 1689 2774 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164689163.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence629 1129 86 gene locus_tag LOCUS_20180 1129 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2667 1126 gene locus_tag LOCUS_20190 gene istA 2667 1126 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917171.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence630 1476 409 gene locus_tag LOCUS_20200 1476 409 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence631 1488 22 gene locus_tag LOCUS_20210 gene mttB 1488 22 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_20210 1713 1540 gene locus_tag LOCUS_20220 1713 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2265 1732 gene locus_tag LOCUS_20230 2265 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20230 >Feature sequence632 3 467 gene locus_tag LOCUS_20240 3 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 476 1690 gene locus_tag LOCUS_20250 476 1690 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_20250 1715 2728 gene locus_tag LOCUS_20260 1715 2728 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence633 <1 670 gene locus_tag LOCUS_20270 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986694.1:putative isocaproyl-CoA dehydrogenase AcdB 698 1495 gene locus_tag LOCUS_20280 698 1495 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048185.1 protein_id gnl|my_center|LOCUS_20280 1535 2539 gene locus_tag LOCUS_20290 1535 2539 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence634 >Feature sequence635 2178 931 gene locus_tag LOCUS_20300 2178 931 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence636 2001 124 gene locus_tag LOCUS_20310 2001 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence637 2133 832 gene locus_tag LOCUS_20320 2133 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence638 <1 560 gene locus_tag LOCUS_20330 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021751.1:ABC transporter ATP-binding protein 579 2675 gene locus_tag LOCUS_20340 579 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence639 1637 636 gene locus_tag LOCUS_20350 1637 636 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389115.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence640 >Feature sequence641 1142 2509 gene locus_tag LOCUS_20360 gene trmFO 1142 2509 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056303.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence642 1503 301 gene locus_tag LOCUS_20370 1503 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 1978 1580 gene locus_tag LOCUS_20380 1978 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 <2854 1990 gene locus_tag LOCUS_20390 <2854 1990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027527.1:aminotransferase >Feature sequence643 1222 221 gene locus_tag LOCUS_20400 1222 221 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259505.1 protein_id gnl|my_center|LOCUS_20400 2387 1371 gene locus_tag LOCUS_20410 2387 1371 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence644 <1 2690 gene locus_tag LOCUS_20420 <1 2690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase >Feature sequence645 2519 984 gene locus_tag LOCUS_20430 2519 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence646 2493 1378 gene locus_tag LOCUS_20440 2493 1378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081444.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence647 1147 2007 gene locus_tag LOCUS_20450 1147 2007 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178283.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence648 1738 758 gene locus_tag LOCUS_20460 1738 758 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092876.1 protein_id gnl|my_center|LOCUS_20460 2781 1789 gene locus_tag LOCUS_20470 2781 1789 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092876.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence649 1164 1403 gene locus_tag LOCUS_20480 1164 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1426 2028 gene locus_tag LOCUS_20490 1426 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2012 2317 gene locus_tag LOCUS_20500 2012 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence650 346 1212 gene locus_tag LOCUS_20510 346 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1248 1568 gene locus_tag LOCUS_20520 1248 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence651 222 1505 gene locus_tag LOCUS_20530 gene hemL 222 1505 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence652 >Feature sequence653 1448 2470 gene locus_tag LOCUS_20540 1448 2470 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523134.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence654 1351 158 gene locus_tag LOCUS_20550 1351 158 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_20550 2364 1366 gene locus_tag LOCUS_20560 2364 1366 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972408.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence655 1690 1490 gene locus_tag LOCUS_20570 1690 1490 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008132970.1 protein_id gnl|my_center|LOCUS_20570 <2839 1662 gene locus_tag LOCUS_20580 <2839 1662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259569.1:exodeoxyribonuclease VII large subunit >Feature sequence656 898 155 gene locus_tag LOCUS_20590 898 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20590 1575 943 gene locus_tag LOCUS_20600 1575 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20600 2600 1788 gene locus_tag LOCUS_20610 2600 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence657 1027 1692 gene locus_tag LOCUS_20620 1027 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 1682 2380 gene locus_tag LOCUS_20630 1682 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence658 328 89 gene locus_tag LOCUS_20640 328 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 1030 632 gene locus_tag LOCUS_20650 1030 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1711 1037 gene locus_tag LOCUS_20660 1711 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2601 1714 gene locus_tag LOCUS_20670 2601 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence659 157 483 gene locus_tag LOCUS_20680 gene hisE 157 483 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964261.1 protein_id gnl|my_center|LOCUS_20680 1876 518 gene locus_tag LOCUS_20690 gene thrC 1876 518 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257816.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence660 59 655 gene locus_tag LOCUS_20700 59 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 776 1663 gene locus_tag LOCUS_20710 776 1663 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213188.1 protein_id gnl|my_center|LOCUS_20710 1666 2493 gene locus_tag LOCUS_20720 1666 2493 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence661 1210 2034 gene locus_tag LOCUS_20730 1210 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence662 360 569 gene locus_tag LOCUS_20740 360 569 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_20740 713 537 gene locus_tag LOCUS_20750 713 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1484 837 gene locus_tag LOCUS_20760 1484 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2626 1481 gene locus_tag LOCUS_20770 2626 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence663 651 307 gene locus_tag LOCUS_20780 651 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 <2823 1150 gene locus_tag LOCUS_20790 <2823 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883981.1:DEAD/DEAH box helicase >Feature sequence664 <1 794 gene locus_tag LOCUS_20800 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080577540.1:alpha/beta fold hydrolase 841 2175 gene locus_tag LOCUS_20810 841 2175 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867786.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence665 299 481 gene locus_tag LOCUS_20820 299 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1371 514 gene locus_tag LOCUS_20830 1371 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2449 1652 gene locus_tag LOCUS_20840 2449 1652 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940312.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence666 287 2341 gene locus_tag LOCUS_20850 287 2341 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223224.1 protein_id gnl|my_center|LOCUS_20850 2350 2709 gene locus_tag LOCUS_20860 2350 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence667 26 1339 gene locus_tag LOCUS_20870 26 1339 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_20870 1385 2137 gene locus_tag LOCUS_20880 1385 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2112 2282 gene locus_tag LOCUS_20890 2112 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence668 3 1115 gene locus_tag LOCUS_20900 3 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1232 2143 gene locus_tag LOCUS_20910 1232 2143 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026993.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence669 1950 502 gene locus_tag LOCUS_20920 1950 502 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531931.1 protein_id gnl|my_center|LOCUS_20920 2815 2123 gene locus_tag LOCUS_20930 2815 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence670 234 1814 gene locus_tag LOCUS_20940 234 1814 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257054.1 protein_id gnl|my_center|LOCUS_20940 1815 2537 gene locus_tag LOCUS_20950 1815 2537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence671 615 1460 gene locus_tag LOCUS_20960 615 1460 CDS product UDP-galactose-lipid carrier transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427312.1 protein_id gnl|my_center|LOCUS_20960 1463 2266 gene locus_tag LOCUS_20970 1463 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence672 68 244 gene locus_tag LOCUS_20980 68 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 516 1904 gene locus_tag LOCUS_20990 516 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence673 974 153 gene locus_tag LOCUS_21000 974 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2145 985 gene locus_tag LOCUS_21010 gene hutI 2145 985 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256863.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence674 1147 596 gene locus_tag LOCUS_21020 1147 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 1830 1318 gene locus_tag LOCUS_21030 1830 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2039 1890 gene locus_tag LOCUS_21040 2039 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2583 2137 gene locus_tag LOCUS_21050 2583 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence675 147 1952 gene locus_tag LOCUS_21060 147 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21060 >Feature sequence676 2433 1138 gene locus_tag LOCUS_21070 gene rimO 2433 1138 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257724.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence677 585 854 gene locus_tag LOCUS_21080 585 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 987 2411 gene locus_tag LOCUS_21090 987 2411 CDS product IS701-like element ISRba4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921909.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence678 1635 958 gene locus_tag LOCUS_21100 1635 958 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531971.1 protein_id gnl|my_center|LOCUS_21100 2109 2381 gene locus_tag LOCUS_21110 2109 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 2384 2791 gene locus_tag LOCUS_21120 2384 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence679 >Feature sequence680 694 1122 gene locus_tag LOCUS_21130 694 1122 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643467.1 protein_id gnl|my_center|LOCUS_21130 1184 2407 gene locus_tag LOCUS_21140 1184 2407 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582561.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence681 672 2360 gene locus_tag LOCUS_21150 672 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence682 617 447 gene locus_tag LOCUS_21160 617 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 887 960 gene locus_tag LOCUS_t00350 887 960 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1350 1150 gene locus_tag LOCUS_21170 1350 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 2011 2020 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2179 2436 gene locus_tag LOCUS_21180 2179 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence683 2053 137 gene locus_tag LOCUS_21190 2053 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 <2794 2063 gene locus_tag LOCUS_21200 <2794 2063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140254.1:tail fiber domain-containing protein >Feature sequence684 1305 400 gene locus_tag LOCUS_21210 gene atpG 1305 400 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393856.1 protein_id gnl|my_center|LOCUS_21210 <2793 1311 gene locus_tag LOCUS_21220 <2793 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393857.1:F0F1 ATP synthase subunit alpha >Feature sequence685 2252 1377 gene locus_tag LOCUS_21230 2252 1377 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence686 >Feature sequence687 1386 1838 gene locus_tag LOCUS_21240 1386 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence688 1366 2433 gene locus_tag LOCUS_21250 1366 2433 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972373.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence689 258 425 gene locus_tag LOCUS_21260 258 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 422 760 gene locus_tag LOCUS_21270 422 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 762 1322 gene locus_tag LOCUS_21280 762 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2034 1234 gene locus_tag LOCUS_21290 2034 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2710 2027 gene locus_tag LOCUS_21300 2710 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence690 673 1674 gene locus_tag LOCUS_21310 673 1674 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence691 1654 959 gene locus_tag LOCUS_21320 1654 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2297 1647 gene locus_tag LOCUS_21330 2297 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2736 2302 gene locus_tag LOCUS_21340 2736 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence692 1478 753 gene locus_tag LOCUS_21350 1478 753 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258772.1 protein_id gnl|my_center|LOCUS_21350 2757 1471 gene locus_tag LOCUS_21360 2757 1471 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence693 18 995 gene locus_tag LOCUS_21370 18 995 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_21370 1300 1106 gene locus_tag LOCUS_21380 1300 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1439 2275 gene locus_tag LOCUS_21390 1439 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258540.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence694 102 1202 gene locus_tag LOCUS_21400 102 1202 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393336.1 protein_id gnl|my_center|LOCUS_21400 1253 1888 gene locus_tag LOCUS_21410 gene plsY 1253 1888 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence695 211 1425 gene locus_tag LOCUS_21420 211 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1440 2048 gene locus_tag LOCUS_21430 1440 2048 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320694.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence696 2734 461 gene locus_tag LOCUS_21440 2734 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence697 816 887 gene locus_tag LOCUS_t00360 816 887 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 895 967 gene locus_tag LOCUS_t00370 895 967 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence698 105 177 gene locus_tag LOCUS_t00380 105 177 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 232 314 gene locus_tag LOCUS_t00390 232 314 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 320 393 gene locus_tag LOCUS_t00400 320 393 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 507 1709 gene locus_tag LOCUS_21450 gene tuf 507 1709 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258047.1 protein_id gnl|my_center|LOCUS_21450 1782 2090 gene locus_tag LOCUS_21460 gene rpsJ 1782 2090 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258230.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence699 721 125 gene locus_tag LOCUS_21470 721 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 927 1094 gene locus_tag LOCUS_21480 927 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 1545 1213 gene locus_tag LOCUS_21490 1545 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1779 1997 gene locus_tag LOCUS_21500 1779 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence700 >Feature sequence701 753 1526 gene locus_tag LOCUS_21510 gene minC 753 1526 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255923.1 protein_id gnl|my_center|LOCUS_21510 1554 2357 gene locus_tag LOCUS_21520 gene minD 1554 2357 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_21520 2453 2716 gene locus_tag LOCUS_21530 gene minE 2453 2716 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392080.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence702 <2771 1326 gene locus_tag LOCUS_21540 <2771 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005779363.1:L-fucose isomerase >Feature sequence703 198 1718 gene locus_tag LOCUS_21550 198 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1684 2448 gene locus_tag LOCUS_21560 gene istB 1684 2448 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030890.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence704 1504 611 gene locus_tag LOCUS_21570 1504 611 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533025.1 protein_id gnl|my_center|LOCUS_21570 <2770 1653 gene locus_tag LOCUS_21580 <2770 1653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533024.1:sugar ABC transporter substrate-binding protein >Feature sequence705 2333 1437 gene locus_tag LOCUS_21590 2333 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence706 1974 295 gene locus_tag LOCUS_21600 1974 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence707 1041 583 gene locus_tag LOCUS_21610 1041 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2615 1038 gene locus_tag LOCUS_21620 2615 1038 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence708 938 165 gene locus_tag LOCUS_21630 gene istB 938 165 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_21630 2455 929 gene locus_tag LOCUS_21640 gene istA 2455 929 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917171.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence709 253 1080 gene locus_tag LOCUS_21650 253 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 1080 1991 gene locus_tag LOCUS_21660 1080 1991 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414409.1 protein_id gnl|my_center|LOCUS_21660 1975 2268 gene locus_tag LOCUS_21670 1975 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence710 2561 888 gene locus_tag LOCUS_21680 2561 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence711 <1 1731 gene locus_tag LOCUS_21690 <1 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258639.1:peptide ABC transporter substrate-binding protein 1912 2163 gene locus_tag LOCUS_21700 1912 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence712 >Feature sequence713 1029 238 gene locus_tag LOCUS_21710 gene istB 1029 238 CDS product IS21-like element ISBj11 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018270204.1 protein_id gnl|my_center|LOCUS_21710 2521 1019 gene locus_tag LOCUS_21720 2521 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence714 <1 782 gene locus_tag LOCUS_21730 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890528.1:gas vesicle protein GvpL 773 1057 gene locus_tag LOCUS_21740 773 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 1099 1485 gene locus_tag LOCUS_21750 1099 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 1684 1992 gene locus_tag LOCUS_21760 1684 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2116 2508 gene locus_tag LOCUS_21770 2116 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence715 219 737 gene locus_tag LOCUS_21780 219 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 747 1886 gene locus_tag LOCUS_21790 747 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2148 2348 gene locus_tag LOCUS_21800 2148 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence716 <2754 2198 gene locus_tag LOCUS_21810 <2754 2198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529293.1:alkaline phosphatase family protein >Feature sequence717 1572 1 gene locus_tag LOCUS_21820 1572 1 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence718 1528 1112 gene locus_tag LOCUS_21830 1528 1112 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022301.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence719 2388 280 gene locus_tag LOCUS_21840 2388 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence720 135 443 gene locus_tag LOCUS_21850 gene nuoK 135 443 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_21850 476 2431 gene locus_tag LOCUS_21860 gene nuoL 476 2431 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence721 1013 429 gene locus_tag LOCUS_21870 1013 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 1569 1078 gene locus_tag LOCUS_21880 1569 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2035 1778 gene locus_tag LOCUS_21890 2035 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2168 2491 gene locus_tag LOCUS_21900 2168 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence722 135 1733 gene locus_tag LOCUS_21910 135 1733 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015845.1 protein_id gnl|my_center|LOCUS_21910 1839 2414 gene locus_tag LOCUS_21920 gene amrA 1839 2414 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence723 1382 537 gene locus_tag LOCUS_21930 1382 537 CDS product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969407.1 protein_id gnl|my_center|LOCUS_21930 2376 1594 gene locus_tag LOCUS_21940 2376 1594 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525325.1 protein_id gnl|my_center|LOCUS_21940 2725 2567 gene locus_tag LOCUS_21950 2725 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence724 493 1218 gene locus_tag LOCUS_21960 493 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1215 1505 gene locus_tag LOCUS_21970 1215 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2192 1509 gene locus_tag LOCUS_21980 gene cmk 2192 1509 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_21980 <2739 2189 gene locus_tag LOCUS_21990 <2739 2189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259088.1:pseudouridine synthase note possible pseudo, internal stop codon >Feature sequence725 >Feature sequence726 <1 591 gene locus_tag LOCUS_22000 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886759.1:dTMP kinase 588 917 gene locus_tag LOCUS_22010 588 917 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258098.1 protein_id gnl|my_center|LOCUS_22010 1313 924 gene locus_tag LOCUS_22020 1313 924 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_22020 1408 2031 gene locus_tag LOCUS_22030 1408 2031 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence727 1752 457 gene locus_tag LOCUS_22040 1752 457 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436698.1 protein_id gnl|my_center|LOCUS_22040 <2737 1795 gene locus_tag LOCUS_22050 <2737 1795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942664.1:Xaa-Pro peptidase family protein >Feature sequence728 1574 228 gene locus_tag LOCUS_22060 1574 228 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259646.1 protein_id gnl|my_center|LOCUS_22060 2487 1696 gene locus_tag LOCUS_22070 2487 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence729 180 1199 gene locus_tag LOCUS_22080 180 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 1246 2058 gene locus_tag LOCUS_22090 1246 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence730 1017 616 gene locus_tag LOCUS_22100 1017 616 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228087.1 protein_id gnl|my_center|LOCUS_22100 1662 1138 gene locus_tag LOCUS_22110 1662 1138 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392537.1 protein_id gnl|my_center|LOCUS_22110 2626 1715 gene locus_tag LOCUS_22120 2626 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence731 <1 947 gene locus_tag LOCUS_22130 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949161.1:pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha 1161 2141 gene locus_tag LOCUS_22140 1161 2141 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence732 119 1306 gene locus_tag LOCUS_22150 119 1306 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258551.1 protein_id gnl|my_center|LOCUS_22150 1461 2573 gene locus_tag LOCUS_22160 1461 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence733 >Feature sequence734 >Feature sequence735 968 18 gene locus_tag LOCUS_22170 968 18 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942950.1 protein_id gnl|my_center|LOCUS_22170 2302 1199 gene locus_tag LOCUS_22180 2302 1199 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence736 1733 486 gene locus_tag LOCUS_22190 1733 486 CDS product glucose-1-phosphate adenylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258381.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence737 80 235 gene locus_tag LOCUS_22200 80 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 232 1935 gene locus_tag LOCUS_22210 232 1935 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence738 <1 946 gene locus_tag LOCUS_22220 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966697.1:NAD/NADP-dependent octopine/nopaline dehydrogenase family protein 1253 1765 gene locus_tag LOCUS_22230 gene nrdR 1253 1765 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185666.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence739 371 1843 gene locus_tag LOCUS_22240 371 1843 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence740 553 1464 gene locus_tag LOCUS_22250 553 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence741 405 2261 gene locus_tag LOCUS_22260 405 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence742 508 1773 gene locus_tag LOCUS_22270 508 1773 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989366.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence743 192 1589 gene locus_tag LOCUS_22280 192 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 1593 1976 gene locus_tag LOCUS_22290 1593 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2205 2642 gene locus_tag LOCUS_22300 2205 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence744 <1 1436 gene locus_tag LOCUS_22310 <1 1436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256150.1:NAD-dependent DNA ligase LigA 1464 1946 gene locus_tag LOCUS_22320 gene sixA 1464 1946 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141750.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence745 2486 1599 gene locus_tag LOCUS_22330 2486 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence746 2151 763 gene locus_tag LOCUS_22340 2151 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence747 117 845 gene locus_tag LOCUS_22350 117 845 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_22350 851 2176 gene locus_tag LOCUS_22360 851 2176 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258551.1 protein_id gnl|my_center|LOCUS_22360 2183 2473 gene locus_tag LOCUS_22370 gene gatC 2183 2473 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence748 85 741 gene locus_tag LOCUS_22380 85 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22380 1062 2561 gene locus_tag LOCUS_22390 1062 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence749 <1 1220 gene locus_tag LOCUS_22400 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876334.1:ABC transporter permease 1242 2468 gene locus_tag LOCUS_22410 1242 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence750 3 503 gene locus_tag LOCUS_22420 3 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 689 1837 gene locus_tag LOCUS_22430 689 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence751 2 1003 gene locus_tag LOCUS_22440 2 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258095.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence752 532 188 gene locus_tag LOCUS_22450 532 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1164 670 gene locus_tag LOCUS_22460 1164 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1377 1168 gene locus_tag LOCUS_22470 1377 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 1626 1453 gene locus_tag LOCUS_22480 1626 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2007 1813 gene locus_tag LOCUS_22490 2007 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence753 46 486 gene locus_tag LOCUS_22500 46 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 567 1643 gene locus_tag LOCUS_22510 567 1643 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 protein_id gnl|my_center|LOCUS_22510 1760 2605 gene locus_tag LOCUS_22520 1760 2605 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974400.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence754 865 948 gene locus_tag LOCUS_t00410 865 948 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence755 420 1784 gene locus_tag LOCUS_22530 420 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence756 <2673 1849 gene locus_tag LOCUS_22540 <2673 1849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016180.1:ketoacyl-ACP synthase III >Feature sequence757 >Feature sequence758 1697 1275 gene locus_tag LOCUS_22550 1697 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 1891 1772 gene locus_tag LOCUS_22560 1891 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence759 451 696 gene locus_tag LOCUS_22570 451 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 693 1061 gene locus_tag LOCUS_22580 693 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 1072 1317 gene locus_tag LOCUS_22590 1072 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 1358 1561 gene locus_tag LOCUS_22600 1358 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22600 >Feature sequence760 280 900 gene locus_tag LOCUS_22610 280 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22610 950 1954 gene locus_tag LOCUS_22620 950 1954 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_22620 2049 2630 gene locus_tag LOCUS_22630 2049 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence761 2454 919 gene locus_tag LOCUS_22640 2454 919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456912.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence762 >Feature sequence763 2143 710 gene locus_tag LOCUS_22650 2143 710 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_22650 >Feature sequence764 <2663 1559 gene locus_tag LOCUS_22660 <2663 1559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257312.1:asparagine--tRNA ligase >Feature sequence765 2296 335 gene locus_tag LOCUS_22670 2296 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence766 2489 36 gene locus_tag LOCUS_22680 2489 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence767 <1 1318 gene locus_tag LOCUS_22690 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016360.1:ABC transporter substrate-binding protein 1464 2420 gene locus_tag LOCUS_22700 1464 2420 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267881.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence768 749 961 gene locus_tag LOCUS_22710 749 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 939 1268 gene locus_tag LOCUS_22720 939 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 1660 2319 gene locus_tag LOCUS_22730 1660 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence769 1035 193 gene locus_tag LOCUS_22740 1035 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 1259 1188 gene locus_tag LOCUS_t00420 1259 1188 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence770 <1 718 gene locus_tag LOCUS_22750 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940783.1:ParB/RepB/Spo0J family partition protein 1059 1661 gene locus_tag LOCUS_22760 1059 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence771 1212 127 gene locus_tag LOCUS_22770 1212 127 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339084.1 protein_id gnl|my_center|LOCUS_22770 1396 1214 gene locus_tag LOCUS_22780 1396 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2298 1495 gene locus_tag LOCUS_22790 2298 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence772 192 1652 gene locus_tag LOCUS_22800 192 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1893 2471 gene locus_tag LOCUS_22810 1893 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence773 807 1352 gene locus_tag LOCUS_22820 gene pth 807 1352 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_22820 1368 2381 gene locus_tag LOCUS_22830 1368 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence774 782 45 gene locus_tag LOCUS_22840 782 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2170 971 gene locus_tag LOCUS_22850 2170 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2647 2357 gene locus_tag LOCUS_22860 2647 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence775 404 613 gene locus_tag LOCUS_22870 404 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 635 1729 gene locus_tag LOCUS_22880 635 1729 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269064.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence776 79 1671 gene locus_tag LOCUS_22890 gene serA 79 1671 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_22890 2456 1677 gene locus_tag LOCUS_22900 2456 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence777 232 768 gene locus_tag LOCUS_22910 232 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1229 1798 gene locus_tag LOCUS_22920 1229 1798 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_22920 1816 2013 gene locus_tag LOCUS_22930 gene rpmF 1816 2013 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774376.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence778 433 353 gene locus_tag LOCUS_t00430 433 353 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence779 1862 1392 gene locus_tag LOCUS_22940 gene rpsG 1862 1392 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258227.1 protein_id gnl|my_center|LOCUS_22940 2452 2036 gene locus_tag LOCUS_22950 gene rpsL 2452 2036 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence780 1438 764 gene locus_tag LOCUS_22960 1438 764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_22960 <2644 1440 gene locus_tag LOCUS_22970 <2644 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256886.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence781 >Feature sequence782 2415 1459 gene locus_tag LOCUS_22980 2415 1459 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_22980 >Feature sequence783 1070 591 gene locus_tag LOCUS_22990 gene nuoE 1070 591 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582933.1 protein_id gnl|my_center|LOCUS_22990 1403 1212 gene locus_tag LOCUS_23000 1403 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2486 1413 gene locus_tag LOCUS_23010 2486 1413 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23010 >Feature sequence784 <1 1268 gene locus_tag LOCUS_23020 <1 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944025.1:radical SAM protein 1328 2251 gene locus_tag LOCUS_23030 1328 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence785 2 184 gene locus_tag LOCUS_23040 2 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 285 1037 gene locus_tag LOCUS_23050 285 1037 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_23050 1909 1580 gene locus_tag LOCUS_23060 1909 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 <2633 2128 gene locus_tag LOCUS_23070 <2633 2128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838365.1:TIGR00730 family Rossman fold protein >Feature sequence786 1503 1324 gene locus_tag LOCUS_23080 1503 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2470 1643 gene locus_tag LOCUS_23090 2470 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 >Feature sequence787 166 360 gene locus_tag LOCUS_23100 166 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 507 689 gene locus_tag LOCUS_23110 507 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 767 1342 gene locus_tag LOCUS_23120 767 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1474 2472 gene locus_tag LOCUS_23130 1474 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence788 <1 2563 gene locus_tag LOCUS_23140 <1 2563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259073.1:GAF domain-containing protein >Feature sequence789 >Feature sequence790 >Feature sequence791 174 329 gene locus_tag LOCUS_23150 174 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 502 1050 gene locus_tag LOCUS_23160 502 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 1453 1169 gene locus_tag LOCUS_23170 1453 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence792 618 1418 gene locus_tag LOCUS_23180 618 1418 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259198.1 protein_id gnl|my_center|LOCUS_23180 1491 2594 gene locus_tag LOCUS_23190 1491 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence793 1726 629 gene locus_tag LOCUS_23200 1726 629 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722128.1 protein_id gnl|my_center|LOCUS_23200 <2630 1732 gene locus_tag LOCUS_23210 <2630 1732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530011.1:NB-ARC domain-containing protein >Feature sequence794 <2628 1939 gene locus_tag LOCUS_23220 <2628 1939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258461.1:amidohydrolase >Feature sequence795 1208 219 gene locus_tag LOCUS_23230 gene msrP 1208 219 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257868.1 protein_id gnl|my_center|LOCUS_23230 1538 1254 gene locus_tag LOCUS_23240 1538 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 1836 1522 gene locus_tag LOCUS_23250 1836 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2165 1917 gene locus_tag LOCUS_23260 2165 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence796 <2621 995 gene locus_tag LOCUS_23270 <2621 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258680.1:formylglycine-generating enzyme family protein >Feature sequence797 2475 460 gene locus_tag LOCUS_23280 2475 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 >Feature sequence798 885 100 gene locus_tag LOCUS_23290 885 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 1190 882 gene locus_tag LOCUS_23300 1190 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 <2614 1187 gene locus_tag LOCUS_23310 <2614 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025227807.1:DNA methyltransferase >Feature sequence799 1926 220 gene locus_tag LOCUS_23320 1926 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence800 2083 1328 gene locus_tag LOCUS_23330 2083 1328 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969328.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence801 1052 1588 gene locus_tag LOCUS_23340 1052 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 1603 2445 gene locus_tag LOCUS_23350 1603 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence802 169 597 gene locus_tag LOCUS_23360 169 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 666 890 gene locus_tag LOCUS_23370 666 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23370 1202 978 gene locus_tag LOCUS_23380 1202 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1821 1213 gene locus_tag LOCUS_23390 1821 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence803 14 1369 gene locus_tag LOCUS_23400 14 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 1420 1740 gene locus_tag LOCUS_23410 1420 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23410 >Feature sequence804 >Feature sequence805 <2594 823 gene locus_tag LOCUS_23420 <2594 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392656.1:elongation factor G >Feature sequence806 <1 817 gene locus_tag LOCUS_23430 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246149.1:ATP-dependent helicase MrfA 939 1247 gene locus_tag LOCUS_23440 939 1247 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_23440 1296 2540 gene locus_tag LOCUS_23450 gene mrfB 1296 2540 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence807 1260 1541 gene locus_tag LOCUS_23460 1260 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 1690 2379 gene locus_tag LOCUS_23470 1690 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence808 332 733 gene locus_tag LOCUS_23480 332 733 CDS product DUF5684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028234.1 protein_id gnl|my_center|LOCUS_23480 2272 1310 gene locus_tag LOCUS_23490 2272 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence809 >Feature sequence810 1510 257 gene locus_tag LOCUS_23500 1510 257 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_23500 1811 2536 gene locus_tag LOCUS_23510 1811 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391776.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence811 395 156 gene locus_tag LOCUS_23520 395 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 1701 595 gene locus_tag LOCUS_23530 1701 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 2010 2144 gene locus_tag LOCUS_23540 2010 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence812 1611 664 gene locus_tag LOCUS_23550 gene rffA 1611 664 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23550 1822 1577 gene locus_tag LOCUS_23560 1822 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23560 >Feature sequence813 <1 967 gene locus_tag LOCUS_23570 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970307.1:site-specific DNA-methyltransferase >Feature sequence814 >Feature sequence815 1309 260 gene locus_tag LOCUS_23580 1309 260 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383270.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence816 367 1419 gene locus_tag LOCUS_23590 367 1419 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466843.1 protein_id gnl|my_center|LOCUS_23590 1422 2381 gene locus_tag LOCUS_23600 1422 2381 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002071.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence817 59 2251 gene locus_tag LOCUS_23610 59 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence818 <1 620 gene locus_tag LOCUS_23620 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256394.1:RdgB/HAM1 family non-canonical purine NTP pyrophosphatase 645 1583 gene locus_tag LOCUS_23630 645 1583 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102952112.1 protein_id gnl|my_center|LOCUS_23630 1623 2309 gene locus_tag LOCUS_23640 1623 2309 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028485.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence819 76 1674 gene locus_tag LOCUS_23650 76 1674 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence820 1 771 gene locus_tag LOCUS_23660 1 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 897 2423 gene locus_tag LOCUS_23670 897 2423 CDS product glycosyltransferase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877359.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence821 171 812 gene locus_tag LOCUS_23680 171 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_23680 809 1612 gene locus_tag LOCUS_23690 809 1612 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_23690 2267 1836 gene locus_tag LOCUS_23700 2267 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence822 >Feature sequence823 963 604 gene locus_tag LOCUS_23710 963 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23710 877 1128 gene locus_tag LOCUS_23720 877 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 1398 1183 gene locus_tag LOCUS_23730 1398 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23730 <2572 1432 gene locus_tag LOCUS_23740 <2572 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444410.1:acetoacetate--CoA ligase >Feature sequence824 5 1648 gene locus_tag LOCUS_23750 5 1648 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence825 1334 195 gene locus_tag LOCUS_23760 gene galK 1334 195 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_23760 2383 1340 gene locus_tag LOCUS_23770 gene galT 2383 1340 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097520.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence826 757 263 gene locus_tag LOCUS_23780 757 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 1306 761 gene locus_tag LOCUS_23790 gene sigX 1306 761 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406744.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence827 750 598 gene locus_tag LOCUS_23800 750 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 1425 889 gene locus_tag LOCUS_23810 1425 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2165 1491 gene locus_tag LOCUS_23820 2165 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2527 2456 gene locus_tag LOCUS_t00440 2527 2456 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence828 295 11 gene locus_tag LOCUS_23830 295 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 510 1304 gene locus_tag LOCUS_23840 510 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1454 2224 gene locus_tag LOCUS_23850 1454 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence829 287 838 gene locus_tag LOCUS_23860 gene gmhB 287 838 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_23860 835 1950 gene locus_tag LOCUS_23870 835 1950 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256755.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence830 2221 1844 gene locus_tag LOCUS_23880 2221 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence831 6 989 gene locus_tag LOCUS_23890 gene nuoD 6 989 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_23890 1050 1556 gene locus_tag LOCUS_23900 1050 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence832 435 1364 gene locus_tag LOCUS_23910 435 1364 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065472.1 protein_id gnl|my_center|LOCUS_23910 1947 1462 gene locus_tag LOCUS_23920 1947 1462 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022604.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence833 <2555 1489 gene locus_tag LOCUS_23930 <2555 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228230.1:site-2 protease family protein >Feature sequence834 275 1300 gene locus_tag LOCUS_23940 275 1300 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence835 >Feature sequence836 27 2453 gene locus_tag LOCUS_23950 27 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence837 1212 13 gene locus_tag LOCUS_23960 1212 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence838 >Feature sequence839 950 273 gene locus_tag LOCUS_23970 gene rpe 950 273 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_23970 2004 1015 gene locus_tag LOCUS_23980 2004 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2495 2154 gene locus_tag LOCUS_23990 2495 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence840 1017 94 gene locus_tag LOCUS_24000 1017 94 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_24000 1246 2478 gene locus_tag LOCUS_24010 1246 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence841 752 537 gene locus_tag LOCUS_24020 752 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 745 1491 gene locus_tag LOCUS_24030 745 1491 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_24030 2003 1641 gene locus_tag LOCUS_24040 2003 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence842 2525 1515 gene locus_tag LOCUS_24050 2525 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence843 942 253 gene locus_tag LOCUS_24060 942 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1496 2467 gene locus_tag LOCUS_24070 1496 2467 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047962736.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence844 1416 502 gene locus_tag LOCUS_24080 1416 502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258637.1 protein_id gnl|my_center|LOCUS_24080 2468 1428 gene locus_tag LOCUS_24090 2468 1428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258638.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence845 174 1028 gene locus_tag LOCUS_24100 174 1028 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816295.1 protein_id gnl|my_center|LOCUS_24100 1025 2113 gene locus_tag LOCUS_24110 1025 2113 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138390504.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence846 1802 495 gene locus_tag LOCUS_24120 gene rseP 1802 495 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723454.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence847 1204 335 gene locus_tag LOCUS_24130 gene proC 1204 335 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_24130 2521 1229 gene locus_tag LOCUS_24140 gene ilvD 2521 1229 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence848 906 241 gene locus_tag LOCUS_24150 906 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 1461 1171 gene locus_tag LOCUS_24160 1461 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2398 1535 gene locus_tag LOCUS_24170 2398 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence849 <1 1622 gene locus_tag LOCUS_24180 <1 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393026.1:NADPH-dependent glutamate synthase >Feature sequence850 439 1695 gene locus_tag LOCUS_24190 439 1695 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_24190 1692 2300 gene locus_tag LOCUS_24200 gene metW 1692 2300 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence851 1054 110 gene locus_tag LOCUS_24210 gene hpdA 1054 110 CDS product 4-hydroxyphenylacetate decarboxylase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860651.1 protein_id gnl|my_center|LOCUS_24210 1331 1062 gene locus_tag LOCUS_24220 1331 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 <2521 1335 gene locus_tag LOCUS_24230 <2521 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009901609.1:4-hydroxyphenylacetate decarboxylase large subunit >Feature sequence852 1378 158 gene locus_tag LOCUS_24240 1378 158 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 protein_id gnl|my_center|LOCUS_24240 1656 2036 gene locus_tag LOCUS_24250 1656 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence853 2443 1919 gene locus_tag LOCUS_24260 2443 1919 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879874.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence854 2035 1127 gene locus_tag LOCUS_24270 2035 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2304 2113 gene locus_tag LOCUS_24280 2304 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence855 <1 614 gene locus_tag LOCUS_24290 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258274.1:AAA family ATPase 619 1719 gene locus_tag LOCUS_24300 619 1719 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_24300 >Feature sequence856 >Feature sequence857 286 1998 gene locus_tag LOCUS_24310 286 1998 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence858 1536 1114 gene locus_tag LOCUS_24320 1536 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 1945 1553 gene locus_tag LOCUS_24330 gene sdhC 1945 1553 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173507.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence859 991 23 gene locus_tag LOCUS_24340 991 23 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_24340 2058 1105 gene locus_tag LOCUS_24350 2058 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2247 2492 gene locus_tag LOCUS_24360 2247 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence860 672 91 gene locus_tag LOCUS_24370 672 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 1169 957 gene locus_tag LOCUS_24380 1169 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 1320 1135 gene locus_tag LOCUS_24390 1320 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 <2512 1323 gene locus_tag LOCUS_24400 <2512 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228376.1:DUF499 domain-containing protein >Feature sequence861 <2508 453 gene locus_tag LOCUS_24410 <2508 453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041271940.1:hydantoinase/oxoprolinase family protein >Feature sequence862 1503 1742 gene locus_tag LOCUS_24420 1503 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence863 642 358 gene locus_tag LOCUS_24430 642 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 1853 873 gene locus_tag LOCUS_24440 1853 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24440 2243 1926 gene locus_tag LOCUS_24450 2243 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence864 1490 957 gene locus_tag LOCUS_24460 1490 957 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256063.1 protein_id gnl|my_center|LOCUS_24460 1726 2427 gene locus_tag LOCUS_24470 1726 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence865 293 1378 gene locus_tag LOCUS_24480 293 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence866 928 674 gene locus_tag LOCUS_24490 928 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 2118 958 gene locus_tag LOCUS_24500 2118 958 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259193.1 protein_id gnl|my_center|LOCUS_24500