>Feature sequence0001 1568 348 gene locus_tag LOCUS_00010 1568 348 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941780.1 protein_id gnl|my_center|LOCUS_00010 6840 1822 gene locus_tag LOCUS_00020 6840 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 >Feature sequence0002 1861 1292 gene locus_tag LOCUS_00030 1861 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2387 1869 gene locus_tag LOCUS_00040 2387 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2929 2450 gene locus_tag LOCUS_00050 gene ispF 2929 2450 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_00050 3049 3363 gene locus_tag LOCUS_00060 3049 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4184 3489 gene locus_tag LOCUS_00070 gene trmD 4184 3489 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057450.1 protein_id gnl|my_center|LOCUS_00070 4517 5410 gene locus_tag LOCUS_00080 4517 5410 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058003.1 protein_id gnl|my_center|LOCUS_00080 >Feature sequence0003 88 2283 gene locus_tag LOCUS_00090 88 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 3890 2457 gene locus_tag LOCUS_00100 3890 2457 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345479.1 protein_id gnl|my_center|LOCUS_00100 <6340 4220 gene locus_tag LOCUS_00110 <6340 4220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099797719.1:GH116 family glycosyl hydrolase >Feature sequence0004 555 172 gene locus_tag LOCUS_00120 555 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 4513 992 gene locus_tag LOCUS_00130 4513 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 >Feature sequence0005 641 195 gene locus_tag LOCUS_00140 641 195 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_00140 3325 689 gene locus_tag LOCUS_00150 3325 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 <5931 3993 gene locus_tag LOCUS_00160 <5931 3993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057707.1:transketolase >Feature sequence0006 3395 24 gene locus_tag LOCUS_00170 gene treS 3395 24 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_00170 3830 4060 gene locus_tag LOCUS_00180 3830 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 <5769 4301 gene locus_tag LOCUS_00190 <5769 4301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058284.1:ATP-dependent chaperone ClpB >Feature sequence0007 164 355 gene locus_tag LOCUS_00200 164 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 549 839 gene locus_tag LOCUS_00210 549 839 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_00210 826 1122 gene locus_tag LOCUS_00220 826 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 1506 1240 gene locus_tag LOCUS_00230 1506 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 2581 1670 gene locus_tag LOCUS_00240 gene argB 2581 1670 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_00240 2832 3605 gene locus_tag LOCUS_00250 2832 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 4246 3854 gene locus_tag LOCUS_00260 4246 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00260 5049 4243 gene locus_tag LOCUS_00270 5049 4243 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 protein_id gnl|my_center|LOCUS_00270 <5747 5137 gene locus_tag LOCUS_00280 <5747 5137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056782.1:rod shape-determining protein >Feature sequence0008 15 743 gene locus_tag LOCUS_00290 15 743 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_00290 864 936 gene locus_tag LOCUS_t00010 864 936 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1578 2720 gene locus_tag LOCUS_00300 gene urtA 1578 2720 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_00300 3019 4179 gene locus_tag LOCUS_00310 3019 4179 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056963.1 protein_id gnl|my_center|LOCUS_00310 4207 5349 gene locus_tag LOCUS_00320 gene urtC 4207 5349 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_00320 >Feature sequence0009 1794 433 gene locus_tag LOCUS_00330 1794 433 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_00330 1847 4057 gene locus_tag LOCUS_00340 1847 4057 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920752.1 protein_id gnl|my_center|LOCUS_00340 >Feature sequence0010 1397 330 gene locus_tag LOCUS_00350 1397 330 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057667.1 protein_id gnl|my_center|LOCUS_00350 1910 1587 gene locus_tag LOCUS_00360 gene trxA 1910 1587 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_00360 3587 2424 gene locus_tag LOCUS_00370 3587 2424 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_00370 5124 3880 gene locus_tag LOCUS_00380 gene tnpB 5124 3880 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 protein_id gnl|my_center|LOCUS_00380 >Feature sequence0011 <1 891 gene locus_tag LOCUS_00390 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921060.1:F420-0:Gamma-glutamyl ligase 1083 2408 gene locus_tag LOCUS_00400 1083 2408 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056850.1 protein_id gnl|my_center|LOCUS_00400 2657 3115 gene locus_tag LOCUS_00410 gene ruvX 2657 3115 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058162.1 protein_id gnl|my_center|LOCUS_00410 3431 4006 gene locus_tag LOCUS_00420 3431 4006 CDS product DUF3727 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057704.1 protein_id gnl|my_center|LOCUS_00420 >Feature sequence0012 3236 2298 gene locus_tag LOCUS_00430 3236 2298 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_00430 3805 4317 gene locus_tag LOCUS_00440 3805 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00440 4357 5007 gene locus_tag LOCUS_00450 4357 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00450 >Feature sequence0013 176 880 gene locus_tag LOCUS_00460 176 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 1714 2628 gene locus_tag LOCUS_00470 gene chlG 1714 2628 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920891.1 protein_id gnl|my_center|LOCUS_00470 >Feature sequence0014 2467 3753 gene locus_tag LOCUS_00480 2467 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056550.1 protein_id gnl|my_center|LOCUS_00480 >Feature sequence0015 696 2057 gene locus_tag LOCUS_00490 696 2057 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140773.1 protein_id gnl|my_center|LOCUS_00490 2498 3109 gene locus_tag LOCUS_00500 2498 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00500 3113 3811 gene locus_tag LOCUS_00510 3113 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00510 4045 4800 gene locus_tag LOCUS_00520 4045 4800 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_00520 >Feature sequence0016 521 2428 gene locus_tag LOCUS_00530 521 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 3358 4704 gene locus_tag LOCUS_00540 3358 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 >Feature sequence0017 2046 3020 gene locus_tag LOCUS_00550 2046 3020 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_00550 >Feature sequence0018 2187 958 gene locus_tag LOCUS_00560 gene sucC 2187 958 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_00560 4042 2525 gene locus_tag LOCUS_00570 4042 2525 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 protein_id gnl|my_center|LOCUS_00570 4289 4663 gene locus_tag LOCUS_00580 4289 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 protein_id gnl|my_center|LOCUS_00580 >Feature sequence0019 899 582 gene locus_tag LOCUS_00590 gene rpsJ 899 582 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006042265.1 protein_id gnl|my_center|LOCUS_00590 2312 1083 gene locus_tag LOCUS_00600 gene tuf 2312 1083 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057587.1 protein_id gnl|my_center|LOCUS_00600 4486 2414 gene locus_tag LOCUS_00610 gene fusA 4486 2414 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057586.1 protein_id gnl|my_center|LOCUS_00610 >Feature sequence0020 1865 1491 gene locus_tag LOCUS_00620 1865 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 1998 2273 gene locus_tag LOCUS_00630 1998 2273 CDS product DUF6439 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056108.1 protein_id gnl|my_center|LOCUS_00630 3013 2525 gene locus_tag LOCUS_00640 3013 2525 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083625306.1 protein_id gnl|my_center|LOCUS_00640 3714 4625 gene locus_tag LOCUS_00650 3714 4625 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_00650 >Feature sequence0021 77 3172 gene locus_tag LOCUS_00660 77 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 >Feature sequence0022 <1 1357 gene locus_tag LOCUS_00670 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393309.1:malto-oligosyltrehalose trehalohydrolase 1544 4339 gene locus_tag LOCUS_00680 gene treY 1544 4339 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393311.1 protein_id gnl|my_center|LOCUS_00680 >Feature sequence0023 1743 280 gene locus_tag LOCUS_00690 1743 280 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055916.1 protein_id gnl|my_center|LOCUS_00690 4408 1886 gene locus_tag LOCUS_00700 4408 1886 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103760.1 protein_id gnl|my_center|LOCUS_00700 >Feature sequence0024 927 415 gene locus_tag LOCUS_00710 927 415 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 protein_id gnl|my_center|LOCUS_00710 1432 2583 gene locus_tag LOCUS_00720 1432 2583 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_00720 2696 3064 gene locus_tag LOCUS_00730 2696 3064 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_00730 3061 4470 gene locus_tag LOCUS_00740 3061 4470 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_00740 >Feature sequence0025 3375 2839 gene locus_tag LOCUS_00750 gene infC 3375 2839 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106456574.1 protein_id gnl|my_center|LOCUS_00750 >Feature sequence0026 465 1457 gene locus_tag LOCUS_00760 465 1457 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237475.1 protein_id gnl|my_center|LOCUS_00760 1631 3175 gene locus_tag LOCUS_00770 1631 3175 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089388.1 protein_id gnl|my_center|LOCUS_00770 3172 4176 gene locus_tag LOCUS_00780 3172 4176 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095095.1 protein_id gnl|my_center|LOCUS_00780 >Feature sequence0027 334 1161 gene locus_tag LOCUS_00790 gene rpsB 334 1161 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057525.1 protein_id gnl|my_center|LOCUS_00790 1477 2136 gene locus_tag LOCUS_00800 1477 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 2336 3259 gene locus_tag LOCUS_00810 2336 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 >Feature sequence0028 180 1193 gene locus_tag LOCUS_00820 180 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00820 1227 3743 gene locus_tag LOCUS_00830 1227 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00830 3825 4523 gene locus_tag LOCUS_00840 3825 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 >Feature sequence0029 1762 71 gene locus_tag LOCUS_00850 1762 71 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 protein_id gnl|my_center|LOCUS_00850 2505 1840 gene locus_tag LOCUS_00860 gene ntcA 2505 1840 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920910.1 protein_id gnl|my_center|LOCUS_00860 2846 3622 gene locus_tag LOCUS_00870 gene fabI 2846 3622 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057530.1 protein_id gnl|my_center|LOCUS_00870 3810 4469 gene locus_tag LOCUS_00880 gene hisB 3810 4469 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140771.1 protein_id gnl|my_center|LOCUS_00880 >Feature sequence0030 194 946 gene locus_tag LOCUS_00890 194 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 1160 2317 gene locus_tag LOCUS_00900 1160 2317 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056632.1 protein_id gnl|my_center|LOCUS_00900 2895 2422 gene locus_tag LOCUS_00910 2895 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 3262 3819 gene locus_tag LOCUS_00920 3262 3819 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_00920 3822 4433 gene locus_tag LOCUS_00930 3822 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 >Feature sequence0031 526 1896 gene locus_tag LOCUS_00940 gene trxB 526 1896 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057761.1 protein_id gnl|my_center|LOCUS_00940 2137 2958 gene locus_tag LOCUS_00950 2137 2958 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920815.1 protein_id gnl|my_center|LOCUS_00950 3104 4312 gene locus_tag LOCUS_00960 3104 4312 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_00960 >Feature sequence0032 <1 1287 gene locus_tag LOCUS_00970 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_190897490.1:glycosyltransferase family 61 protein >Feature sequence0033 <1 3041 gene locus_tag LOCUS_00980 <1 3041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162890714.1:PAS domain S-box protein 3120 4082 gene locus_tag LOCUS_00990 3120 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00990 >Feature sequence0034 3 3779 gene locus_tag LOCUS_01000 3 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 >Feature sequence0035 141 1838 gene locus_tag LOCUS_01010 141 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 2305 1958 gene locus_tag LOCUS_01020 2305 1958 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055899.1 protein_id gnl|my_center|LOCUS_01020 2990 2436 gene locus_tag LOCUS_01030 2990 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 3261 3869 gene locus_tag LOCUS_01040 gene rpsD 3261 3869 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056002.1 protein_id gnl|my_center|LOCUS_01040 >Feature sequence0036 217 2766 gene locus_tag LOCUS_01050 217 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 >Feature sequence0037 3795 451 gene locus_tag LOCUS_01060 3795 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 >Feature sequence0038 1101 2381 gene locus_tag LOCUS_01070 gene eno 1101 2381 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056505.1 protein_id gnl|my_center|LOCUS_01070 3632 2574 gene locus_tag LOCUS_01080 gene argC 3632 2574 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058053.1 protein_id gnl|my_center|LOCUS_01080 >Feature sequence0039 3800 429 gene locus_tag LOCUS_01090 3800 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 >Feature sequence0040 >Feature sequence0041 407 1795 gene locus_tag LOCUS_01100 407 1795 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057835.1 protein_id gnl|my_center|LOCUS_01100 1860 2705 gene locus_tag LOCUS_01110 gene ntrB 1860 2705 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920965.1 protein_id gnl|my_center|LOCUS_01110 >Feature sequence0042 1 432 gene locus_tag LOCUS_01120 1 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 2557 548 gene locus_tag LOCUS_01130 gene speA 2557 548 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057644.1 protein_id gnl|my_center|LOCUS_01130 >Feature sequence0043 726 653 gene locus_tag LOCUS_t00020 726 653 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3634 827 gene locus_tag LOCUS_01140 3634 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 >Feature sequence0044 <1 3259 gene locus_tag LOCUS_01150 <1 3259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259371.1:EAL domain-containing protein >Feature sequence0045 2668 1097 gene locus_tag LOCUS_01160 2668 1097 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055900.1 protein_id gnl|my_center|LOCUS_01160 2934 3227 gene locus_tag LOCUS_01170 2934 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 3169 3771 gene locus_tag LOCUS_01180 3169 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 >Feature sequence0046 <4020 277 gene locus_tag LOCUS_01190 <4020 277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence0047 1632 352 gene locus_tag LOCUS_01200 gene purD 1632 352 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920939.1 protein_id gnl|my_center|LOCUS_01200 1947 3233 gene locus_tag LOCUS_01210 1947 3233 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141252.1 protein_id gnl|my_center|LOCUS_01210 4010 3624 gene locus_tag LOCUS_01220 4010 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 >Feature sequence0048 523 1371 gene locus_tag LOCUS_01230 523 1371 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887603.1 protein_id gnl|my_center|LOCUS_01230 1703 1963 gene locus_tag LOCUS_01240 1703 1963 CDS product DUF2997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987300.1 protein_id gnl|my_center|LOCUS_01240 2004 2390 gene locus_tag LOCUS_01250 2004 2390 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_01250 2468 2938 gene locus_tag LOCUS_01260 2468 2938 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798060.1 protein_id gnl|my_center|LOCUS_01260 3315 3034 gene locus_tag LOCUS_01270 3315 3034 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897856.1 protein_id gnl|my_center|LOCUS_01270 >Feature sequence0049 1328 726 gene locus_tag LOCUS_01280 1328 726 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140824.1 protein_id gnl|my_center|LOCUS_01280 2164 1370 gene locus_tag LOCUS_01290 gene lpxA 2164 1370 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921189.1 protein_id gnl|my_center|LOCUS_01290 2927 2406 gene locus_tag LOCUS_01300 gene fabZ 2927 2406 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125568.1 protein_id gnl|my_center|LOCUS_01300 3874 3032 gene locus_tag LOCUS_01310 gene lpxC 3874 3032 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057627.1 protein_id gnl|my_center|LOCUS_01310 >Feature sequence0050 1989 841 gene locus_tag LOCUS_01320 1989 841 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_01320 2690 2100 gene locus_tag LOCUS_01330 2690 2100 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057990.1 protein_id gnl|my_center|LOCUS_01330 3646 3209 gene locus_tag LOCUS_01340 3646 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 3777 3649 gene locus_tag LOCUS_01350 3777 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 >Feature sequence0051 685 2172 gene locus_tag LOCUS_01360 685 2172 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 protein_id gnl|my_center|LOCUS_01360 2162 2401 gene locus_tag LOCUS_01370 2162 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 2690 3871 gene locus_tag LOCUS_01380 gene argH 2690 3871 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056221.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01380 >Feature sequence0052 300 1199 gene locus_tag LOCUS_01390 gene trpC 300 1199 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056545.1 protein_id gnl|my_center|LOCUS_01390 1886 2131 gene locus_tag LOCUS_01400 1886 2131 CDS product DUF5340 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058031.1 protein_id gnl|my_center|LOCUS_01400 2210 3367 gene locus_tag LOCUS_01410 2210 3367 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 protein_id gnl|my_center|LOCUS_01410 3638 3423 gene locus_tag LOCUS_01420 3638 3423 CDS product DUF2949 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921037.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence0053 847 329 gene locus_tag LOCUS_01430 847 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 1950 868 gene locus_tag LOCUS_01440 1950 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 >Feature sequence0054 <1 734 gene locus_tag LOCUS_01450 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057061.1:4-hydroxy-tetrahydrodipicolinate synthase 1018 2886 gene locus_tag LOCUS_01460 1018 2886 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057062.1 protein_id gnl|my_center|LOCUS_01460 3015 3803 gene locus_tag LOCUS_01470 3015 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 >Feature sequence0055 349 834 gene locus_tag LOCUS_01480 349 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243886.1 protein_id gnl|my_center|LOCUS_01480 1013 2986 gene locus_tag LOCUS_01490 1013 2986 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_01490 3080 3487 gene locus_tag LOCUS_01500 3080 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 3488 3652 gene locus_tag LOCUS_01510 3488 3652 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_01510 >Feature sequence0056 1685 438 gene locus_tag LOCUS_01520 1685 438 CDS product URC4/urg3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089973.1 protein_id gnl|my_center|LOCUS_01520 2764 1682 gene locus_tag LOCUS_01530 2764 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 <3898 2854 gene locus_tag LOCUS_01540 <3898 2854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729093.1:GTP cyclohydrolase II >Feature sequence0057 1881 268 gene locus_tag LOCUS_01550 1881 268 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 protein_id gnl|my_center|LOCUS_01550 2009 3199 gene locus_tag LOCUS_01560 gene dxr 2009 3199 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_01560 >Feature sequence0058 391 116 gene locus_tag LOCUS_01570 391 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 1237 413 gene locus_tag LOCUS_01580 1237 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 2175 1474 gene locus_tag LOCUS_01590 2175 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 3695 2274 gene locus_tag LOCUS_01600 3695 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 >Feature sequence0059 893 3547 gene locus_tag LOCUS_01610 893 3547 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058103.1 protein_id gnl|my_center|LOCUS_01610 >Feature sequence0060 196 942 gene locus_tag LOCUS_01620 196 942 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 protein_id gnl|my_center|LOCUS_01620 979 1404 gene locus_tag LOCUS_01630 979 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 1438 1881 gene locus_tag LOCUS_01640 1438 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 2299 2123 gene locus_tag LOCUS_01650 2299 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01650 2896 2351 gene locus_tag LOCUS_01660 2896 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01660 3709 3032 gene locus_tag LOCUS_01670 3709 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929428.1 protein_id gnl|my_center|LOCUS_01670 >Feature sequence0061 1059 385 gene locus_tag LOCUS_01680 1059 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 1729 2406 gene locus_tag LOCUS_01690 1729 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 <3851 2523 gene locus_tag LOCUS_01700 <3851 2523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055992.1:peptidylprolyl isomerase >Feature sequence0062 297 905 gene locus_tag LOCUS_01710 297 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01710 958 1584 gene locus_tag LOCUS_01720 958 1584 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105137.1 protein_id gnl|my_center|LOCUS_01720 1592 3475 gene locus_tag LOCUS_01730 1592 3475 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140636.1 protein_id gnl|my_center|LOCUS_01730 >Feature sequence0063 2187 892 gene locus_tag LOCUS_01740 2187 892 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 protein_id gnl|my_center|LOCUS_01740 3506 2646 gene locus_tag LOCUS_01750 3506 2646 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence0064 379 453 gene locus_tag LOCUS_t00030 379 453 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 579 1178 gene locus_tag LOCUS_01760 579 1178 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_01760 1291 1830 gene locus_tag LOCUS_01770 1291 1830 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057129.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence0065 1220 96 gene locus_tag LOCUS_01780 1220 96 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055884.1 protein_id gnl|my_center|LOCUS_01780 1426 3114 gene locus_tag LOCUS_01790 1426 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 >Feature sequence0066 >Feature sequence0067 579 235 gene locus_tag LOCUS_01800 579 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929519.1 protein_id gnl|my_center|LOCUS_01800 692 1585 gene locus_tag LOCUS_01810 692 1585 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_01810 1662 1988 gene locus_tag LOCUS_01820 1662 1988 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142926.1 protein_id gnl|my_center|LOCUS_01820 1992 2333 gene locus_tag LOCUS_01830 1992 2333 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142157.1 protein_id gnl|my_center|LOCUS_01830 2340 2585 gene locus_tag LOCUS_01840 2340 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 2631 3806 gene locus_tag LOCUS_01850 2631 3806 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479813.1 protein_id gnl|my_center|LOCUS_01850 >Feature sequence0068 1387 383 gene locus_tag LOCUS_01860 1387 383 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057751.1 protein_id gnl|my_center|LOCUS_01860 1974 3179 gene locus_tag LOCUS_01870 1974 3179 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057053.1 protein_id gnl|my_center|LOCUS_01870 >Feature sequence0069 109 1440 gene locus_tag LOCUS_01880 109 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 1898 1527 gene locus_tag LOCUS_01890 1898 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 3627 2119 gene locus_tag LOCUS_01900 gene glgA 3627 2119 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_01900 >Feature sequence0070 674 366 gene locus_tag LOCUS_01910 674 366 CDS product DUF2499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_01910 1088 2134 gene locus_tag LOCUS_01920 gene csaB 1088 2134 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140747.1 protein_id gnl|my_center|LOCUS_01920 2148 2858 gene locus_tag LOCUS_01930 2148 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 3018 3650 gene locus_tag LOCUS_01940 gene trmB 3018 3650 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_01940 >Feature sequence0071 1401 712 gene locus_tag LOCUS_01950 1401 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 1740 1417 gene locus_tag LOCUS_01960 1740 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 1995 2261 gene locus_tag LOCUS_01970 1995 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 2354 3055 gene locus_tag LOCUS_01980 2354 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 3117 3485 gene locus_tag LOCUS_01990 3117 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 >Feature sequence0072 493 1182 gene locus_tag LOCUS_02000 gene clpP 493 1182 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056360.1 protein_id gnl|my_center|LOCUS_02000 1192 2535 gene locus_tag LOCUS_02010 gene clpX 1192 2535 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144180.1 protein_id gnl|my_center|LOCUS_02010 2562 3320 gene locus_tag LOCUS_02020 2562 3320 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230740.1 protein_id gnl|my_center|LOCUS_02020 3649 3323 gene locus_tag LOCUS_02030 3649 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 >Feature sequence0073 577 32 gene locus_tag LOCUS_02040 gene atpH 577 32 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056289.1 protein_id gnl|my_center|LOCUS_02040 1108 581 gene locus_tag LOCUS_02050 1108 581 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524128.1 protein_id gnl|my_center|LOCUS_02050 1681 1196 gene locus_tag LOCUS_02060 1681 1196 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056287.1 protein_id gnl|my_center|LOCUS_02060 2024 1779 gene locus_tag LOCUS_02070 gene atpE 2024 1779 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125083.1 protein_id gnl|my_center|LOCUS_02070 2913 2155 gene locus_tag LOCUS_02080 gene atpB 2913 2155 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056285.1 protein_id gnl|my_center|LOCUS_02080 3430 2969 gene locus_tag LOCUS_02090 3430 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 >Feature sequence0074 <1 3418 gene locus_tag LOCUS_02100 <1 3418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057762.1:chromosome segregation protein SMC >Feature sequence0075 3242 741 gene locus_tag LOCUS_02110 3242 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 >Feature sequence0076 1828 1523 gene locus_tag LOCUS_02120 1828 1523 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_02120 2453 2112 gene locus_tag LOCUS_02130 2453 2112 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_02130 2861 2550 gene locus_tag LOCUS_02140 2861 2550 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142094.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence0077 1362 826 gene locus_tag LOCUS_02150 1362 826 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_02150 >Feature sequence0078 <1 866 gene locus_tag LOCUS_02160 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057368.1:DUF4350 domain-containing protein 863 1813 gene locus_tag LOCUS_02170 863 1813 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798653.1 protein_id gnl|my_center|LOCUS_02170 1828 2271 gene locus_tag LOCUS_02180 1828 2271 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140245.1 protein_id gnl|my_center|LOCUS_02180 2629 3018 gene locus_tag LOCUS_02190 2629 3018 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_02190 >Feature sequence0079 1107 940 gene locus_tag LOCUS_02200 1107 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 1137 2798 gene locus_tag LOCUS_02210 1137 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence0080 725 1219 gene locus_tag LOCUS_02220 725 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02220 1303 1605 gene locus_tag LOCUS_02230 1303 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02230 1602 3038 gene locus_tag LOCUS_02240 1602 3038 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013323452.1 protein_id gnl|my_center|LOCUS_02240 >Feature sequence0081 1381 305 gene locus_tag LOCUS_02250 1381 305 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937854.1 protein_id gnl|my_center|LOCUS_02250 2814 1534 gene locus_tag LOCUS_02260 2814 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 3223 3519 gene locus_tag LOCUS_02270 3223 3519 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045874275.1 protein_id gnl|my_center|LOCUS_02270 >Feature sequence0082 <1 806 gene locus_tag LOCUS_02280 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920959.1:MBL fold metallo-hydrolase 1202 2257 gene locus_tag LOCUS_02290 1202 2257 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012163110.1 protein_id gnl|my_center|LOCUS_02290 2430 3338 gene locus_tag LOCUS_02300 2430 3338 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence0083 243 455 gene locus_tag LOCUS_02310 243 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 737 1309 gene locus_tag LOCUS_02320 737 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 1542 2258 gene locus_tag LOCUS_02330 1542 2258 CDS product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 protein_id gnl|my_center|LOCUS_02330 2879 3334 gene locus_tag LOCUS_02340 2879 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 >Feature sequence0084 1984 3021 gene locus_tag LOCUS_02350 gene pdhA 1984 3021 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057011.1 protein_id gnl|my_center|LOCUS_02350 >Feature sequence0085 428 219 gene locus_tag LOCUS_02360 428 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 584 943 gene locus_tag LOCUS_02370 584 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02370 953 1291 gene locus_tag LOCUS_02380 953 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02380 <3492 1709 gene locus_tag LOCUS_02390 <3492 1709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057122.1:PAS domain S-box protein >Feature sequence0086 1449 445 gene locus_tag LOCUS_02400 gene pheS 1449 445 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056537.1 protein_id gnl|my_center|LOCUS_02400 1659 2465 gene locus_tag LOCUS_02410 gene surE 1659 2465 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057623.1 protein_id gnl|my_center|LOCUS_02410 2593 2991 gene locus_tag LOCUS_02420 2593 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 >Feature sequence0087 777 115 gene locus_tag LOCUS_02430 777 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058134.1 protein_id gnl|my_center|LOCUS_02430 1288 821 gene locus_tag LOCUS_02440 1288 821 CDS product phycobilisome protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058133.1 protein_id gnl|my_center|LOCUS_02440 1728 1462 gene locus_tag LOCUS_02450 1728 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 2524 1823 gene locus_tag LOCUS_02460 2524 1823 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799489.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence0088 >Feature sequence0089 419 1852 gene locus_tag LOCUS_02470 419 1852 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057055.1 protein_id gnl|my_center|LOCUS_02470 2260 1964 gene locus_tag LOCUS_02480 2260 1964 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084050946.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence0090 513 133 gene locus_tag LOCUS_02490 513 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 695 814 gene locus_tag LOCUS_02500 gene petG 695 814 CDS product cytochrome b6-f complex subunit PetG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056721.1 protein_id gnl|my_center|LOCUS_02500 2140 1058 gene locus_tag LOCUS_02510 2140 1058 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_02510 3316 2231 gene locus_tag LOCUS_02520 3316 2231 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_02520 >Feature sequence0091 809 3118 gene locus_tag LOCUS_02530 809 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 >Feature sequence0092 3063 244 gene locus_tag LOCUS_02540 3063 244 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 protein_id gnl|my_center|LOCUS_02540 >Feature sequence0093 702 1598 gene locus_tag LOCUS_02550 702 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 1722 2345 gene locus_tag LOCUS_02560 1722 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_02560 >Feature sequence0094 450 2006 gene locus_tag LOCUS_02570 450 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 2220 3191 gene locus_tag LOCUS_02580 2220 3191 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144236.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence0095 >Feature sequence0096 2110 1295 gene locus_tag LOCUS_02590 2110 1295 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920913.1 protein_id gnl|my_center|LOCUS_02590 2573 2184 gene locus_tag LOCUS_02600 2573 2184 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920916.1 protein_id gnl|my_center|LOCUS_02600 3382 2774 gene locus_tag LOCUS_02610 3382 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 >Feature sequence0097 1049 411 gene locus_tag LOCUS_02620 gene nusG 1049 411 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056149.1 protein_id gnl|my_center|LOCUS_02620 1279 1046 gene locus_tag LOCUS_02630 gene secE 1279 1046 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056148.1 protein_id gnl|my_center|LOCUS_02630 1683 1610 gene locus_tag LOCUS_t00040 1683 1610 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2201 1818 gene locus_tag LOCUS_02640 2201 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence0098 1 990 gene locus_tag LOCUS_02650 1 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 965 2623 gene locus_tag LOCUS_02660 965 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 2678 3208 gene locus_tag LOCUS_02670 2678 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 >Feature sequence0099 201 974 gene locus_tag LOCUS_02680 201 974 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_02680 2242 1076 gene locus_tag LOCUS_02690 2242 1076 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_02690 2439 2951 gene locus_tag LOCUS_02700 2439 2951 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence0100 1299 34 gene locus_tag LOCUS_02710 1299 34 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798996.1 protein_id gnl|my_center|LOCUS_02710 1451 2467 gene locus_tag LOCUS_02720 1451 2467 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994644.1 protein_id gnl|my_center|LOCUS_02720 2509 3312 gene locus_tag LOCUS_02730 2509 3312 CDS product DUF3598 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141575.1 protein_id gnl|my_center|LOCUS_02730 >Feature sequence0101 1389 46 gene locus_tag LOCUS_02740 1389 46 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056050.1 protein_id gnl|my_center|LOCUS_02740 1828 2151 gene locus_tag LOCUS_02750 1828 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 3010 2477 gene locus_tag LOCUS_02760 3010 2477 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143752.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence0102 708 1691 gene locus_tag LOCUS_02770 708 1691 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_02770 1877 3274 gene locus_tag LOCUS_02780 gene secD 1877 3274 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056058.1 protein_id gnl|my_center|LOCUS_02780 >Feature sequence0103 1004 408 gene locus_tag LOCUS_02790 1004 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 1105 1584 gene locus_tag LOCUS_02800 1105 1584 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141055.1 protein_id gnl|my_center|LOCUS_02800 1868 2596 gene locus_tag LOCUS_02810 1868 2596 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799326.1 protein_id gnl|my_center|LOCUS_02810 2799 3179 gene locus_tag LOCUS_02820 2799 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 >Feature sequence0104 1849 8 gene locus_tag LOCUS_02830 gene lepA 1849 8 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056160.1 protein_id gnl|my_center|LOCUS_02830 2151 2378 gene locus_tag LOCUS_02840 2151 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 >Feature sequence0105 480 2471 gene locus_tag LOCUS_02850 gene sir 480 2471 CDS product sulfite reductase, ferredoxin dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920675.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence0106 <1 1192 gene locus_tag LOCUS_02860 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256148.1:ATPase domain-containing protein 1633 2004 gene locus_tag LOCUS_02870 1633 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 2001 3161 gene locus_tag LOCUS_02880 2001 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 >Feature sequence0107 1277 354 gene locus_tag LOCUS_02890 1277 354 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143980.1 protein_id gnl|my_center|LOCUS_02890 1661 3100 gene locus_tag LOCUS_02900 1661 3100 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892504.1 protein_id gnl|my_center|LOCUS_02900 >Feature sequence0108 1544 258 gene locus_tag LOCUS_02910 1544 258 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 protein_id gnl|my_center|LOCUS_02910 2152 1778 gene locus_tag LOCUS_02920 2152 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056846.1 protein_id gnl|my_center|LOCUS_02920 2396 3097 gene locus_tag LOCUS_02930 gene rpe 2396 3097 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_02930 >Feature sequence0109 2087 603 gene locus_tag LOCUS_02940 2087 603 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142503.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence0110 687 2270 gene locus_tag LOCUS_02950 687 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 2333 3220 gene locus_tag LOCUS_02960 2333 3220 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_02960 >Feature sequence0111 719 171 gene locus_tag LOCUS_02970 gene rplF 719 171 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_02970 1387 983 gene locus_tag LOCUS_02980 gene rpsH 1387 983 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055949.1 protein_id gnl|my_center|LOCUS_02980 1955 1410 gene locus_tag LOCUS_02990 gene rplE 1955 1410 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055948.1 protein_id gnl|my_center|LOCUS_02990 2461 2102 gene locus_tag LOCUS_03000 gene rplX 2461 2102 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055947.1 protein_id gnl|my_center|LOCUS_03000 2831 2463 gene locus_tag LOCUS_03010 gene rplN 2831 2463 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055946.1 protein_id gnl|my_center|LOCUS_03010 3188 2940 gene locus_tag LOCUS_03020 gene rpsQ 3188 2940 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055945.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence0112 1664 333 gene locus_tag LOCUS_03030 1664 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 2004 2909 gene locus_tag LOCUS_03040 2004 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 >Feature sequence0113 897 664 gene locus_tag LOCUS_03050 897 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 3137 2934 gene locus_tag LOCUS_03060 3137 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence0114 2212 209 gene locus_tag LOCUS_03070 2212 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 2895 2317 gene locus_tag LOCUS_03080 2895 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence0115 1630 392 gene locus_tag LOCUS_03090 1630 392 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_03090 1894 2985 gene locus_tag LOCUS_03100 1894 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 >Feature sequence0116 >Feature sequence0117 1156 734 gene locus_tag LOCUS_03110 1156 734 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_03110 <3154 1655 gene locus_tag LOCUS_03120 <3154 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258470.1:GAF domain-containing protein >Feature sequence0118 608 135 gene locus_tag LOCUS_03130 608 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2068 830 gene locus_tag LOCUS_03140 2068 830 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141757.1 protein_id gnl|my_center|LOCUS_03140 2974 2324 gene locus_tag LOCUS_03150 2974 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 >Feature sequence0119 2334 169 gene locus_tag LOCUS_03160 2334 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 >Feature sequence0120 2054 816 gene locus_tag LOCUS_03170 2054 816 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056200.1 protein_id gnl|my_center|LOCUS_03170 >Feature sequence0121 <3142 1517 gene locus_tag LOCUS_03180 <3142 1517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence0122 455 93 gene locus_tag LOCUS_03190 455 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03190 1238 471 gene locus_tag LOCUS_03200 1238 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03200 1338 1619 gene locus_tag LOCUS_03210 1338 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 1877 2929 gene locus_tag LOCUS_03220 1877 2929 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence0123 3079 437 gene locus_tag LOCUS_03230 3079 437 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 protein_id gnl|my_center|LOCUS_03230 >Feature sequence0124 1795 515 gene locus_tag LOCUS_03240 gene tyrS 1795 515 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055905.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence0125 <1 1907 gene locus_tag LOCUS_03250 <1 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005109923.1:DNA sulfur modification protein DndD 2221 2610 gene locus_tag LOCUS_03260 2221 2610 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_03260 2628 3098 gene locus_tag LOCUS_03270 gene dndE 2628 3098 CDS product DNA sulfur modification protein DndE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296384.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence0126 763 53 gene locus_tag LOCUS_03280 gene rimI 763 53 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_03280 908 2341 gene locus_tag LOCUS_03290 gene lysA 908 2341 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057598.1 protein_id gnl|my_center|LOCUS_03290 >Feature sequence0127 256 1248 gene locus_tag LOCUS_03300 256 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03300 1288 2205 gene locus_tag LOCUS_03310 1288 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03310 2324 2797 gene locus_tag LOCUS_03320 2324 2797 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166277356.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence0128 713 207 gene locus_tag LOCUS_03330 713 207 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_03330 953 1669 gene locus_tag LOCUS_03340 953 1669 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143593.1 protein_id gnl|my_center|LOCUS_03340 2780 1890 gene locus_tag LOCUS_03350 2780 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 >Feature sequence0129 252 641 gene locus_tag LOCUS_03360 252 641 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080552.1 protein_id gnl|my_center|LOCUS_03360 2266 830 gene locus_tag LOCUS_03370 gene lpdA 2266 830 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920772.1 protein_id gnl|my_center|LOCUS_03370 2707 2973 gene locus_tag LOCUS_03380 2707 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence0130 1857 1309 gene locus_tag LOCUS_03390 1857 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 2053 3009 gene locus_tag LOCUS_03400 gene lipA 2053 3009 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056422.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence0131 1695 550 gene locus_tag LOCUS_03410 1695 550 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_03410 1748 1885 gene locus_tag LOCUS_03420 1748 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 >Feature sequence0132 71 784 gene locus_tag LOCUS_03430 gene nadD 71 784 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_03430 977 1996 gene locus_tag LOCUS_03440 977 1996 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057306.1 protein_id gnl|my_center|LOCUS_03440 2421 3017 gene locus_tag LOCUS_03450 2421 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03450 >Feature sequence0133 449 2053 gene locus_tag LOCUS_03460 gene metG 449 2053 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056597.1 protein_id gnl|my_center|LOCUS_03460 2147 2752 gene locus_tag LOCUS_03470 2147 2752 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 protein_id gnl|my_center|LOCUS_03470 >Feature sequence0134 913 275 gene locus_tag LOCUS_03480 913 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 >Feature sequence0135 173 685 gene locus_tag LOCUS_03490 173 685 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921201.1 protein_id gnl|my_center|LOCUS_03490 1205 2113 gene locus_tag LOCUS_03500 1205 2113 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_03500 2187 2753 gene locus_tag LOCUS_03510 2187 2753 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928616.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence0136 363 587 gene locus_tag LOCUS_03520 363 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 589 741 gene locus_tag LOCUS_03530 589 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2177 978 gene locus_tag LOCUS_03540 gene coaBC 2177 978 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921057.1 protein_id gnl|my_center|LOCUS_03540 2628 2416 gene locus_tag LOCUS_03550 2628 2416 CDS product DUF2555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125484.1 protein_id gnl|my_center|LOCUS_03550 >Feature sequence0137 1511 1269 gene locus_tag LOCUS_03560 1511 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1863 1675 gene locus_tag LOCUS_03570 1863 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 2216 2941 gene locus_tag LOCUS_03580 2216 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence0138 <1 2499 gene locus_tag LOCUS_03590 <1 2499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037121.1:ATP-binding protein >Feature sequence0139 1372 560 gene locus_tag LOCUS_03600 1372 560 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921038.1 protein_id gnl|my_center|LOCUS_03600 1453 2691 gene locus_tag LOCUS_03610 1453 2691 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920968.1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence0140 2959 1448 gene locus_tag LOCUS_03620 2959 1448 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015158974.1 protein_id gnl|my_center|LOCUS_03620 >Feature sequence0141 2170 41 gene locus_tag LOCUS_03630 2170 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence0142 <3029 917 gene locus_tag LOCUS_03640 <3029 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921058.1:endonuclease MutS2 >Feature sequence0143 1399 848 gene locus_tag LOCUS_03650 1399 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 <3028 1465 gene locus_tag LOCUS_03660 <3028 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887933.1:ABC transporter substrate-binding protein >Feature sequence0144 2299 1382 gene locus_tag LOCUS_03670 2299 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 >Feature sequence0145 487 1542 gene locus_tag LOCUS_03680 487 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 2174 1659 gene locus_tag LOCUS_03690 2174 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2992 2177 gene locus_tag LOCUS_03700 2992 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence0146 >Feature sequence0147 2336 1758 gene locus_tag LOCUS_03710 2336 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 >Feature sequence0148 >Feature sequence0149 >Feature sequence0150 179 1183 gene locus_tag LOCUS_03720 179 1183 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_03720 1437 2768 gene locus_tag LOCUS_03730 1437 2768 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058264.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence0151 845 1861 gene locus_tag LOCUS_03740 845 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence0152 2314 1637 gene locus_tag LOCUS_03750 gene folE 2314 1637 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence0153 204 1181 gene locus_tag LOCUS_03760 204 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 1258 2337 gene locus_tag LOCUS_03770 1258 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479614.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence0154 398 1546 gene locus_tag LOCUS_03780 398 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 >Feature sequence0155 147 1133 gene locus_tag LOCUS_03790 gene arsS 147 1133 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121078.1 protein_id gnl|my_center|LOCUS_03790 1232 1957 gene locus_tag LOCUS_03800 1232 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence0156 >Feature sequence0157 1011 40 gene locus_tag LOCUS_03810 1011 40 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119289.1 protein_id gnl|my_center|LOCUS_03810 1531 1115 gene locus_tag LOCUS_03820 1531 1115 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056339.1 protein_id gnl|my_center|LOCUS_03820 2144 1698 gene locus_tag LOCUS_03830 2144 1698 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071088.1 protein_id gnl|my_center|LOCUS_03830 <2958 2380 gene locus_tag LOCUS_03840 <2958 2380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393799.1:ATP-binding protein >Feature sequence0158 1118 360 gene locus_tag LOCUS_03850 1118 360 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_03850 2236 1223 gene locus_tag LOCUS_03860 2236 1223 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence0159 <1 1422 gene locus_tag LOCUS_03870 <1 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057481.1:serine/threonine phosphatase note possible pseudo, frameshifted 1512 2054 gene locus_tag LOCUS_03880 1512 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03880 >Feature sequence0160 308 1096 gene locus_tag LOCUS_03890 308 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03890 <2947 1190 gene locus_tag LOCUS_03900 <2947 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence0161 <2946 602 gene locus_tag LOCUS_03910 <2946 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144196.1:PAS domain S-box protein >Feature sequence0162 2220 151 gene locus_tag LOCUS_03920 2220 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence0163 1692 394 gene locus_tag LOCUS_03930 gene hemL 1692 394 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797681.1 protein_id gnl|my_center|LOCUS_03930 2048 2698 gene locus_tag LOCUS_03940 gene hisIE 2048 2698 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056088.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence0164 341 958 gene locus_tag LOCUS_03950 341 958 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530159.1 protein_id gnl|my_center|LOCUS_03950 1868 1026 gene locus_tag LOCUS_03960 1868 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 2161 2736 gene locus_tag LOCUS_03970 2161 2736 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence0165 1336 395 gene locus_tag LOCUS_03980 1336 395 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 protein_id gnl|my_center|LOCUS_03980 <2920 1659 gene locus_tag LOCUS_03990 <2920 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence0166 <1 823 gene locus_tag LOCUS_04000 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056469.1:beta-ketoacyl-ACP synthase 1161 2270 gene locus_tag LOCUS_04010 1161 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 >Feature sequence0167 >Feature sequence0168 237 1802 gene locus_tag LOCUS_04020 237 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_04020 2051 2617 gene locus_tag LOCUS_04030 2051 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929368.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence0169 >Feature sequence0170 501 1907 gene locus_tag LOCUS_04040 501 1907 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929201.1 protein_id gnl|my_center|LOCUS_04040 2445 2227 gene locus_tag LOCUS_04050 2445 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence0171 1344 505 gene locus_tag LOCUS_04060 1344 505 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921244.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence0172 164 2317 gene locus_tag LOCUS_04070 164 2317 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058027.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence0173 1482 481 gene locus_tag LOCUS_04080 1482 481 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056689.1 protein_id gnl|my_center|LOCUS_04080 2659 1646 gene locus_tag LOCUS_04090 gene plsX 2659 1646 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056688.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence0174 <1 2181 gene locus_tag LOCUS_04100 <1 2181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence0175 2269 35 gene locus_tag LOCUS_04110 2269 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 >Feature sequence0176 >Feature sequence0177 302 2518 gene locus_tag LOCUS_04120 302 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence0178 <1 1842 gene locus_tag LOCUS_04130 <1 1842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056768.1:diguanylate cyclase 1990 2622 gene locus_tag LOCUS_04140 1990 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 >Feature sequence0179 688 1686 gene locus_tag LOCUS_04150 gene bchI 688 1686 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920887.1 protein_id gnl|my_center|LOCUS_04150 1782 2315 gene locus_tag LOCUS_04160 gene ruvC 1782 2315 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190407846.1 protein_id gnl|my_center|LOCUS_04160 <2864 2323 gene locus_tag LOCUS_04170 <2864 2323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142465.1:Uma2 family endonuclease >Feature sequence0180 558 1193 gene locus_tag LOCUS_04180 558 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence0181 1124 96 gene locus_tag LOCUS_04190 gene purM 1124 96 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057648.1 protein_id gnl|my_center|LOCUS_04190 1620 2702 gene locus_tag LOCUS_04200 1620 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 >Feature sequence0182 892 74 gene locus_tag LOCUS_04210 892 74 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198405945.1 protein_id gnl|my_center|LOCUS_04210 1386 2078 gene locus_tag LOCUS_04220 1386 2078 CDS product aldehyde oxygenase (deformylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057153.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence0183 792 13 gene locus_tag LOCUS_04230 792 13 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797618.1 protein_id gnl|my_center|LOCUS_04230 936 1262 gene locus_tag LOCUS_04240 gene trxA 936 1262 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 protein_id gnl|my_center|LOCUS_04240 1478 2737 gene locus_tag LOCUS_04250 1478 2737 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124972844.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence0184 926 96 gene locus_tag LOCUS_04260 926 96 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022700.1 protein_id gnl|my_center|LOCUS_04260 2636 1071 gene locus_tag LOCUS_04270 2636 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence0185 1471 98 gene locus_tag LOCUS_04280 gene rlmD 1471 98 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056786.1 protein_id gnl|my_center|LOCUS_04280 1993 2478 gene locus_tag LOCUS_04290 1993 2478 CDS product allophycocyanin subunit alpha-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920894.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence0186 1278 277 gene locus_tag LOCUS_04300 1278 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_04300 1471 2634 gene locus_tag LOCUS_04310 1471 2634 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808454.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence0187 1383 1709 gene locus_tag LOCUS_04320 1383 1709 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 protein_id gnl|my_center|LOCUS_04320 1966 2562 gene locus_tag LOCUS_04330 1966 2562 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140843.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence0188 1186 272 gene locus_tag LOCUS_04340 1186 272 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057233.1 protein_id gnl|my_center|LOCUS_04340 1497 2426 gene locus_tag LOCUS_04350 gene speB 1497 2426 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence0189 534 94 gene locus_tag LOCUS_04360 534 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04360 846 541 gene locus_tag LOCUS_04370 846 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04370 2137 902 gene locus_tag LOCUS_04380 2137 902 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_04380 2753 2154 gene locus_tag LOCUS_04390 2753 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence0190 >Feature sequence0191 465 869 gene locus_tag LOCUS_04400 465 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04400 841 1233 gene locus_tag LOCUS_04410 841 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04410 1436 2584 gene locus_tag LOCUS_04420 gene yidC 1436 2584 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056448.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence0192 >Feature sequence0193 1733 2407 gene locus_tag LOCUS_04430 1733 2407 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence0194 196 981 gene locus_tag LOCUS_04440 196 981 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_04440 1362 1637 gene locus_tag LOCUS_04450 1362 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 1656 2015 gene locus_tag LOCUS_04460 1656 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 2437 2751 gene locus_tag LOCUS_04470 2437 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 >Feature sequence0195 >Feature sequence0196 853 2220 gene locus_tag LOCUS_04480 853 2220 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_04480 2422 2742 gene locus_tag LOCUS_04490 2422 2742 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402966.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence0197 >Feature sequence0198 <1 1420 gene locus_tag LOCUS_04500 <1 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057718.1:type I DNA topoisomerase 1615 1860 gene locus_tag LOCUS_04510 1615 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 1851 2303 gene locus_tag LOCUS_04520 1851 2303 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_04520 >Feature sequence0199 68 1744 gene locus_tag LOCUS_04530 68 1744 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057497.1 protein_id gnl|my_center|LOCUS_04530 1910 2113 gene locus_tag LOCUS_04540 1910 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04540 2132 2326 gene locus_tag LOCUS_04550 2132 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 >Feature sequence0200 1618 1289 gene locus_tag LOCUS_04560 1618 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144163.1 protein_id gnl|my_center|LOCUS_04560 >Feature sequence0201 240 2153 gene locus_tag LOCUS_04570 240 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence0202 <1 552 gene locus_tag LOCUS_04580 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141963.1:NB-ARC domain-containing protein 618 1274 gene locus_tag LOCUS_04590 618 1274 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524131.1 protein_id gnl|my_center|LOCUS_04590 1370 2149 gene locus_tag LOCUS_04600 1370 2149 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057118.1 protein_id gnl|my_center|LOCUS_04600 2658 2188 gene locus_tag LOCUS_04610 2658 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056916.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence0203 438 85 gene locus_tag LOCUS_04620 438 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 674 438 gene locus_tag LOCUS_04630 674 438 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_04630 1476 799 gene locus_tag LOCUS_04640 1476 799 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_04640 1650 2120 gene locus_tag LOCUS_04650 1650 2120 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263922.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence0204 217 1008 gene locus_tag LOCUS_04660 217 1008 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142330.1 protein_id gnl|my_center|LOCUS_04660 2321 1050 gene locus_tag LOCUS_04670 gene ftsZ 2321 1050 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023065873.1 protein_id gnl|my_center|LOCUS_04670 >Feature sequence0205 710 2272 gene locus_tag LOCUS_04680 710 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence0206 1364 783 gene locus_tag LOCUS_04690 1364 783 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144275.1 protein_id gnl|my_center|LOCUS_04690 <2760 1557 gene locus_tag LOCUS_04700 <2760 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103734.1:Wsp signal transduction system regulator diguanylate cyclase WspR >Feature sequence0207 <1 610 gene locus_tag LOCUS_04710 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003529018.1:calcium-binding protein 1519 770 gene locus_tag LOCUS_04720 1519 770 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590223.1 protein_id gnl|my_center|LOCUS_04720 <2759 1485 gene locus_tag LOCUS_04730 <2759 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000649908.1:ABC transporter permease subunit >Feature sequence0208 1107 64 gene locus_tag LOCUS_04740 gene bioB 1107 64 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920732.1 protein_id gnl|my_center|LOCUS_04740 2369 1125 gene locus_tag LOCUS_04750 gene bioA 2369 1125 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence0209 1113 1784 gene locus_tag LOCUS_04760 1113 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04760 1806 2642 gene locus_tag LOCUS_04770 1806 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04770 >Feature sequence0210 985 1725 gene locus_tag LOCUS_04780 985 1725 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_04780 1927 2682 gene locus_tag LOCUS_04790 1927 2682 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence0211 <1 1470 gene locus_tag LOCUS_04800 <1 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase note possible pseudo, internal stop codon 1480 1917 gene locus_tag LOCUS_04810 1480 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04810 >Feature sequence0212 558 259 gene locus_tag LOCUS_04820 558 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1525 728 gene locus_tag LOCUS_04830 gene cobS 1525 728 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057177.1 protein_id gnl|my_center|LOCUS_04830 1785 2234 gene locus_tag LOCUS_04840 1785 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence0213 <2727 294 gene locus_tag LOCUS_04850 <2727 294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037399177.1:response regulator >Feature sequence0214 726 538 gene locus_tag LOCUS_04860 726 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 1662 730 gene locus_tag LOCUS_04870 1662 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence0215 987 433 gene locus_tag LOCUS_04880 987 433 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_04880 2142 1303 gene locus_tag LOCUS_04890 gene murI 2142 1303 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056314.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence0216 1127 357 gene locus_tag LOCUS_04900 1127 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04900 2011 1361 gene locus_tag LOCUS_04910 2011 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence0217 32 1387 gene locus_tag LOCUS_04920 gene aroA 32 1387 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056198.1 protein_id gnl|my_center|LOCUS_04920 2002 1565 gene locus_tag LOCUS_04930 2002 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 <2713 2199 gene locus_tag LOCUS_04940 <2713 2199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973390.1:2-hydroxyacid dehydrogenase >Feature sequence0218 <2712 1931 gene locus_tag LOCUS_04950 <2712 1931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254458.1:RNA-guided endonuclease TnpB family protein >Feature sequence0219 714 493 gene locus_tag LOCUS_04960 714 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2480 711 gene locus_tag LOCUS_04970 2480 711 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928808.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence0220 1252 1025 gene locus_tag LOCUS_04980 1252 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 2706 1660 gene locus_tag LOCUS_04990 2706 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence0221 510 229 gene locus_tag LOCUS_05000 510 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1022 810 gene locus_tag LOCUS_05010 1022 810 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142054.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence0222 19 1584 gene locus_tag LOCUS_05020 19 1584 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 protein_id gnl|my_center|LOCUS_05020 2578 1709 gene locus_tag LOCUS_05030 2578 1709 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence0223 >Feature sequence0224 841 347 gene locus_tag LOCUS_05040 841 347 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_05040 946 2235 gene locus_tag LOCUS_05050 946 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 >Feature sequence0225 451 38 gene locus_tag LOCUS_05060 451 38 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_05060 636 1835 gene locus_tag LOCUS_05070 636 1835 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058101.1 protein_id gnl|my_center|LOCUS_05070 2238 2414 gene locus_tag LOCUS_05080 2238 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 >Feature sequence0226 2034 97 gene locus_tag LOCUS_05090 2034 97 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406026.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence0227 1017 2345 gene locus_tag LOCUS_05100 1017 2345 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence0228 908 582 gene locus_tag LOCUS_05110 908 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 2659 1082 gene locus_tag LOCUS_05120 2659 1082 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141457.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence0229 1840 479 gene locus_tag LOCUS_05130 1840 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 1974 2177 gene locus_tag LOCUS_05140 1974 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence0230 502 11 gene locus_tag LOCUS_05150 502 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1376 585 gene locus_tag LOCUS_05160 1376 585 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057328.1 protein_id gnl|my_center|LOCUS_05160 2301 1582 gene locus_tag LOCUS_05170 gene pgl 2301 1582 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence0231 >Feature sequence0232 1316 2482 gene locus_tag LOCUS_05180 gene rpoD 1316 2482 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920727.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence0233 265 56 gene locus_tag LOCUS_05190 265 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 1641 376 gene locus_tag LOCUS_05200 1641 376 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence0234 1002 34 gene locus_tag LOCUS_05210 gene queG 1002 34 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920720.1 protein_id gnl|my_center|LOCUS_05210 1212 2174 gene locus_tag LOCUS_05220 1212 2174 CDS product orange carotenoid protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140054.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence0235 816 2513 gene locus_tag LOCUS_05230 gene mrdA 816 2513 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530035.1 protein_id gnl|my_center|LOCUS_05230 >Feature sequence0236 1618 614 gene locus_tag LOCUS_05240 1618 614 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143280.1 protein_id gnl|my_center|LOCUS_05240 1919 2608 gene locus_tag LOCUS_05250 1919 2608 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence0237 <1 808 gene locus_tag LOCUS_05260 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963189.1:radical SAM protein 828 1145 gene locus_tag LOCUS_05270 828 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1191 2639 gene locus_tag LOCUS_05280 1191 2639 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence0238 1781 1317 gene locus_tag LOCUS_05290 1781 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920763.1 protein_id gnl|my_center|LOCUS_05290 2531 1971 gene locus_tag LOCUS_05300 2531 1971 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141816.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence0239 >Feature sequence0240 421 1473 gene locus_tag LOCUS_05310 421 1473 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_05310 1627 2580 gene locus_tag LOCUS_05320 1627 2580 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence0241 <1 1100 gene locus_tag LOCUS_05330 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142859.1:glycosyltransferase family 4 protein 1253 2527 gene locus_tag LOCUS_05340 1253 2527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence0242 <1 665 gene locus_tag LOCUS_05350 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058038.1:recombination mediator RecR >Feature sequence0243 3 236 gene locus_tag LOCUS_05360 3 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 243 1751 gene locus_tag LOCUS_05370 243 1751 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_05370 1984 2445 gene locus_tag LOCUS_05380 1984 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 >Feature sequence0244 538 68 gene locus_tag LOCUS_05390 538 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence0245 1956 217 gene locus_tag LOCUS_05400 1956 217 CDS product NAD(P)H-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 protein_id gnl|my_center|LOCUS_05400 >Feature sequence0246 281 616 gene locus_tag LOCUS_05410 281 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 561 878 gene locus_tag LOCUS_05420 561 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05420 986 1909 gene locus_tag LOCUS_05430 986 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 2094 2567 gene locus_tag LOCUS_05440 2094 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence0247 1326 184 gene locus_tag LOCUS_05450 gene cbiD 1326 184 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056612.1 protein_id gnl|my_center|LOCUS_05450 2126 1329 gene locus_tag LOCUS_05460 2126 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05460 >Feature sequence0248 376 2553 gene locus_tag LOCUS_05470 376 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence0249 223 708 gene locus_tag LOCUS_05480 223 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence0250 1052 99 gene locus_tag LOCUS_05490 1052 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 2303 1200 gene locus_tag LOCUS_05500 2303 1200 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141501.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence0251 2528 348 gene locus_tag LOCUS_05510 gene glyS 2528 348 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198128218.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence0252 <1 590 gene locus_tag LOCUS_05520 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002338483.1:CpsD/CapB family tyrosine-protein kinase 988 2382 gene locus_tag LOCUS_05530 988 2382 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485480.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence0253 806 1729 gene locus_tag LOCUS_05540 806 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence0254 191 733 gene locus_tag LOCUS_05550 191 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 730 1029 gene locus_tag LOCUS_05560 730 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 2474 1146 gene locus_tag LOCUS_05570 2474 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 >Feature sequence0255 >Feature sequence0256 1056 631 gene locus_tag LOCUS_05580 gene aroH 1056 631 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057640.1 protein_id gnl|my_center|LOCUS_05580 2128 1310 gene locus_tag LOCUS_05590 gene sppA 2128 1310 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence0257 563 3 gene locus_tag LOCUS_05600 563 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 1148 654 gene locus_tag LOCUS_05610 1148 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 1718 1152 gene locus_tag LOCUS_05620 1718 1152 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142343.1 protein_id gnl|my_center|LOCUS_05620 <2599 1941 gene locus_tag LOCUS_05630 <2599 1941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058010.1:VWA domain-containing protein >Feature sequence0258 429 698 gene locus_tag LOCUS_05640 429 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1542 847 gene locus_tag LOCUS_05650 1542 847 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 protein_id gnl|my_center|LOCUS_05650 <2598 1683 gene locus_tag LOCUS_05660 <2598 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799062.1:TrkH family potassium uptake protein >Feature sequence0259 >Feature sequence0260 1830 844 gene locus_tag LOCUS_05670 gene holA 1830 844 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920898.1 protein_id gnl|my_center|LOCUS_05670 2582 1827 gene locus_tag LOCUS_05680 2582 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence0261 750 253 gene locus_tag LOCUS_05690 750 253 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_05690 1094 1558 gene locus_tag LOCUS_05700 1094 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 <2583 1635 gene locus_tag LOCUS_05710 <2583 1635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143650.1:caspase family protein >Feature sequence0262 >Feature sequence0263 491 1738 gene locus_tag LOCUS_05720 491 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence0264 <1 1406 gene locus_tag LOCUS_05730 <1 1406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869086.1:polyphosphate:AMP phosphotransferase >Feature sequence0265 <1 2390 gene locus_tag LOCUS_05740 <1 2390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289076.1:glycosyltransferase family 2 protein >Feature sequence0266 1600 71 gene locus_tag LOCUS_05750 gene zwf 1600 71 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_05750 2407 1601 gene locus_tag LOCUS_05760 2407 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence0267 <1 2060 gene locus_tag LOCUS_05770 <1 2060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037121.1:ATP-binding protein >Feature sequence0268 573 52 gene locus_tag LOCUS_05780 573 52 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057365.1 protein_id gnl|my_center|LOCUS_05780 1185 2501 gene locus_tag LOCUS_05790 1185 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057293.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence0269 951 70 gene locus_tag LOCUS_05800 gene dapF 951 70 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058127.1 protein_id gnl|my_center|LOCUS_05800 1151 1363 gene locus_tag LOCUS_05810 1151 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 <2562 1435 gene locus_tag LOCUS_05820 <2562 1435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056388.1:cation:proton antiporter >Feature sequence0270 981 76 gene locus_tag LOCUS_05830 981 76 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141368.1 protein_id gnl|my_center|LOCUS_05830 2273 1059 gene locus_tag LOCUS_05840 2273 1059 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence0271 1176 373 gene locus_tag LOCUS_05850 1176 373 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 protein_id gnl|my_center|LOCUS_05850 2407 1307 gene locus_tag LOCUS_05860 gene ruvB 2407 1307 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143112.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence0272 >Feature sequence0273 375 1106 gene locus_tag LOCUS_05870 gene radC 375 1106 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920920.1 protein_id gnl|my_center|LOCUS_05870 1424 1762 gene locus_tag LOCUS_05880 1424 1762 CDS product DUF1815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987665.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence0274 <1 2019 gene locus_tag LOCUS_05890 <1 2019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142087.1:nitrate ABC transporter ATP-binding protein >Feature sequence0275 691 1257 gene locus_tag LOCUS_05900 691 1257 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057228.1 protein_id gnl|my_center|LOCUS_05900 1424 2206 gene locus_tag LOCUS_05910 1424 2206 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055992.1 protein_id gnl|my_center|LOCUS_05910 >Feature sequence0276 2 493 gene locus_tag LOCUS_05920 2 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 494 2401 gene locus_tag LOCUS_05930 494 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence0277 713 1060 gene locus_tag LOCUS_05940 713 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 <2540 1260 gene locus_tag LOCUS_05950 <2540 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461874.1:heavy metal translocating P-type ATPase >Feature sequence0278 1409 114 gene locus_tag LOCUS_05960 1409 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 2009 1455 gene locus_tag LOCUS_05970 2009 1455 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920910.1 protein_id gnl|my_center|LOCUS_05970 2066 2356 gene locus_tag LOCUS_05980 2066 2356 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence0279 2500 320 gene locus_tag LOCUS_05990 2500 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence0280 1254 298 gene locus_tag LOCUS_06000 1254 298 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_06000 2207 1356 gene locus_tag LOCUS_06010 2207 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence0281 >Feature sequence0282 1363 2100 gene locus_tag LOCUS_06020 gene coaE 1363 2100 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172233.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence0283 1122 2414 gene locus_tag LOCUS_06030 1122 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence0284 2272 455 gene locus_tag LOCUS_06040 2272 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence0285 >Feature sequence0286 958 2223 gene locus_tag LOCUS_06050 958 2223 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345474.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence0287 2006 1026 gene locus_tag LOCUS_06060 2006 1026 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172344.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence0288 838 536 gene locus_tag LOCUS_06070 838 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 1127 852 gene locus_tag LOCUS_06080 1127 852 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057702.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence0289 685 11 gene locus_tag LOCUS_06090 685 11 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921118.1 protein_id gnl|my_center|LOCUS_06090 1331 831 gene locus_tag LOCUS_06100 1331 831 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057639.1 protein_id gnl|my_center|LOCUS_06100 1537 1863 gene locus_tag LOCUS_06110 1537 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence0290 <2500 320 gene locus_tag LOCUS_06120 <2500 320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227744.1:TOMM precursor leader peptide-binding protein >Feature sequence0291 1299 115 gene locus_tag LOCUS_06130 1299 115 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057128.1 protein_id gnl|my_center|LOCUS_06130 1540 2424 gene locus_tag LOCUS_06140 gene rsmH 1540 2424 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142921.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence0292 1257 448 gene locus_tag LOCUS_06150 1257 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 1459 2439 gene locus_tag LOCUS_06160 1459 2439 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016873987.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence0293 679 209 gene locus_tag LOCUS_06170 679 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 1191 676 gene locus_tag LOCUS_06180 1191 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1839 1201 gene locus_tag LOCUS_06190 1839 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_06190 <2485 1883 gene locus_tag LOCUS_06200 <2485 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121962.1:DUF1611 domain-containing protein >Feature sequence0294 1839 1156 gene locus_tag LOCUS_06210 1839 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929189.1 protein_id gnl|my_center|LOCUS_06210 <2480 1839 gene locus_tag LOCUS_06220 <2480 1839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143072.1:AAA family ATPase >Feature sequence0295 <1 1425 gene locus_tag LOCUS_06230 <1 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044205562.1:CHAT domain-containing protein 1586 2167 gene locus_tag LOCUS_06240 1586 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 >Feature sequence0296 42 266 gene locus_tag LOCUS_06250 gene infA 42 266 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055956.1 protein_id gnl|my_center|LOCUS_06250 832 1215 gene locus_tag LOCUS_06260 gene rpsM 832 1215 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055958.1 protein_id gnl|my_center|LOCUS_06260 1300 1698 gene locus_tag LOCUS_06270 gene rpsK 1300 1698 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055959.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence0297 1838 180 gene locus_tag LOCUS_06280 1838 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence0298 1040 1558 gene locus_tag LOCUS_06290 1040 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence0299 635 2254 gene locus_tag LOCUS_06300 635 2254 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620446.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence0300 1575 4 gene locus_tag LOCUS_06310 gene cobA 1575 4 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920993.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence0301 434 2443 gene locus_tag LOCUS_06320 434 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence0302 1687 1262 gene locus_tag LOCUS_06330 1687 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 2401 1913 gene locus_tag LOCUS_06340 2401 1913 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171945.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence0303 2241 172 gene locus_tag LOCUS_06350 2241 172 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017711988.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence0304 >Feature sequence0305 286 792 gene locus_tag LOCUS_06360 286 792 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229024.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence0306 <1 2233 gene locus_tag LOCUS_06370 <1 2233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544542.1:histidine kinase >Feature sequence0307 202 2193 gene locus_tag LOCUS_06380 202 2193 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence0308 352 1683 gene locus_tag LOCUS_06390 352 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1797 2255 gene locus_tag LOCUS_06400 1797 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06400 >Feature sequence0309 1177 266 gene locus_tag LOCUS_06410 1177 266 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_06410 2279 1179 gene locus_tag LOCUS_06420 gene aroC 2279 1179 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence0310 1306 713 gene locus_tag LOCUS_06430 1306 713 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056337.1 protein_id gnl|my_center|LOCUS_06430 <2443 1353 gene locus_tag LOCUS_06440 <2443 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056519.1:DUF3326 domain-containing protein >Feature sequence0311 538 996 gene locus_tag LOCUS_06450 538 996 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920902.1 protein_id gnl|my_center|LOCUS_06450 1202 1789 gene locus_tag LOCUS_06460 1202 1789 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence0312 177 1079 gene locus_tag LOCUS_06470 177 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06470 2091 1210 gene locus_tag LOCUS_06480 2091 1210 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence0313 2268 133 gene locus_tag LOCUS_06490 2268 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 >Feature sequence0314 425 1519 gene locus_tag LOCUS_06500 gene pilM 425 1519 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921030.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence0315 784 122 gene locus_tag LOCUS_06510 784 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 1103 858 gene locus_tag LOCUS_06520 1103 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 1460 2002 gene locus_tag LOCUS_06530 1460 2002 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056462.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence0316 580 98 gene locus_tag LOCUS_06540 580 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057906.1 protein_id gnl|my_center|LOCUS_06540 1514 921 gene locus_tag LOCUS_06550 1514 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence0317 212 1492 gene locus_tag LOCUS_06560 212 1492 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 protein_id gnl|my_center|LOCUS_06560 2036 1797 gene locus_tag LOCUS_06570 2036 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06570 2353 2033 gene locus_tag LOCUS_06580 2353 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence0318 264 1274 gene locus_tag LOCUS_06590 gene trpS 264 1274 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057831.1 protein_id gnl|my_center|LOCUS_06590 1450 2340 gene locus_tag LOCUS_06600 1450 2340 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986764.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence0319 >Feature sequence0320 1152 220 gene locus_tag LOCUS_06610 1152 220 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142528.1 protein_id gnl|my_center|LOCUS_06610 2185 1364 gene locus_tag LOCUS_06620 2185 1364 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence0321 1560 196 gene locus_tag LOCUS_06630 1560 196 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056715.1 protein_id gnl|my_center|LOCUS_06630 1741 2376 gene locus_tag LOCUS_06640 1741 2376 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056716.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence0322 <1 2202 gene locus_tag LOCUS_06650 <1 2202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005629687.1:phosphoenolpyruvate synthase >Feature sequence0323 2083 881 gene locus_tag LOCUS_06660 2083 881 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065100.1 protein_id gnl|my_center|LOCUS_06660 >Feature sequence0324 1076 66 gene locus_tag LOCUS_06670 1076 66 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence0325 >Feature sequence0326 466 107 gene locus_tag LOCUS_06680 466 107 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886888.1 protein_id gnl|my_center|LOCUS_06680 2000 486 gene locus_tag LOCUS_06690 2000 486 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_06690 2382 2173 gene locus_tag LOCUS_06700 2382 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06700 >Feature sequence0327 >Feature sequence0328 199 126 gene locus_tag LOCUS_t00050 199 126 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1383 256 gene locus_tag LOCUS_06710 1383 256 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929131.1 protein_id gnl|my_center|LOCUS_06710 <2384 1472 gene locus_tag LOCUS_06720 <2384 1472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124464.1:TM0106 family RecB-like putative nuclease >Feature sequence0329 >Feature sequence0330 >Feature sequence0331 173 454 gene locus_tag LOCUS_06730 gene clpS 173 454 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024123996.1 protein_id gnl|my_center|LOCUS_06730 1023 694 gene locus_tag LOCUS_06740 1023 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence0332 1493 84 gene locus_tag LOCUS_06750 1493 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 1985 1644 gene locus_tag LOCUS_06760 1985 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence0333 1986 28 gene locus_tag LOCUS_06770 1986 28 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920876.1 protein_id gnl|my_center|LOCUS_06770 >Feature sequence0334 >Feature sequence0335 >Feature sequence0336 <1 2276 gene locus_tag LOCUS_06780 <1 2276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142263.1:DEAD/DEAH box helicase >Feature sequence0337 >Feature sequence0338 5 310 gene locus_tag LOCUS_06790 5 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 432 773 gene locus_tag LOCUS_06800 432 773 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920785.1 protein_id gnl|my_center|LOCUS_06800 811 1215 gene locus_tag LOCUS_06810 811 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057414.1 protein_id gnl|my_center|LOCUS_06810 2228 1404 gene locus_tag LOCUS_06820 2228 1404 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence0339 11 469 gene locus_tag LOCUS_06830 11 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 759 2036 gene locus_tag LOCUS_06840 759 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence0340 493 134 gene locus_tag LOCUS_06850 493 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06850 1285 545 gene locus_tag LOCUS_06860 1285 545 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_06860 1458 2003 gene locus_tag LOCUS_06870 1458 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence0341 <1 759 gene locus_tag LOCUS_06880 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_218081317.1:Uma2 family endonuclease >Feature sequence0342 694 1476 gene locus_tag LOCUS_06890 694 1476 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920882.1 protein_id gnl|my_center|LOCUS_06890 1642 2271 gene locus_tag LOCUS_06900 1642 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence0343 361 1479 gene locus_tag LOCUS_06910 gene nuoH 361 1479 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126985484.1 protein_id gnl|my_center|LOCUS_06910 1582 2157 gene locus_tag LOCUS_06920 gene ndhI 1582 2157 CDS product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056515.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence0344 349 1041 gene locus_tag LOCUS_06930 349 1041 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530111.1 protein_id gnl|my_center|LOCUS_06930 1347 1721 gene locus_tag LOCUS_06940 1347 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029512.1 protein_id gnl|my_center|LOCUS_06940 <2346 1729 gene locus_tag LOCUS_06950 <2346 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011381253.1:galactokinase >Feature sequence0345 1419 244 gene locus_tag LOCUS_06960 1419 244 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence0346 1925 141 gene locus_tag LOCUS_06970 1925 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06970 >Feature sequence0347 1057 389 gene locus_tag LOCUS_06980 1057 389 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 protein_id gnl|my_center|LOCUS_06980 1690 1232 gene locus_tag LOCUS_06990 1690 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 >Feature sequence0348 <1 649 gene locus_tag LOCUS_07000 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141990.1:septum site-determining protein MinC 988 1794 gene locus_tag LOCUS_07010 gene minD 988 1794 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057852.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence0349 >Feature sequence0350 <2335 383 gene locus_tag LOCUS_07020 <2335 383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840071.1:zinc-dependent metalloprotease >Feature sequence0351 1 615 gene locus_tag LOCUS_07030 1 615 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_07030 1052 1768 gene locus_tag LOCUS_07040 1052 1768 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939178.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence0352 <2333 1280 gene locus_tag LOCUS_07050 <2333 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005763658.1:choline dehydrogenase >Feature sequence0353 734 132 gene locus_tag LOCUS_07060 gene rplJ 734 132 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056152.1 protein_id gnl|my_center|LOCUS_07060 1758 1045 gene locus_tag LOCUS_07070 gene rplA 1758 1045 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056151.1 protein_id gnl|my_center|LOCUS_07070 2331 2062 gene locus_tag LOCUS_07080 2331 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence0354 1758 154 gene locus_tag LOCUS_07090 1758 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence0355 121 1416 gene locus_tag LOCUS_07100 121 1416 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_07100 1543 2202 gene locus_tag LOCUS_07110 1543 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence0356 297 1763 gene locus_tag LOCUS_07120 gene purF 297 1763 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057521.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence0357 687 238 gene locus_tag LOCUS_07130 687 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 785 1111 gene locus_tag LOCUS_07140 785 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence0358 138 377 gene locus_tag LOCUS_07150 gene secG 138 377 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 protein_id gnl|my_center|LOCUS_07150 709 1215 gene locus_tag LOCUS_07160 709 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1293 1727 gene locus_tag LOCUS_07170 1293 1727 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873391.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence0359 >Feature sequence0360 >Feature sequence0361 1264 200 gene locus_tag LOCUS_07180 gene hemE 1264 200 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125231.1 protein_id gnl|my_center|LOCUS_07180 1580 2083 gene locus_tag LOCUS_07190 1580 2083 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence0362 1038 2147 gene locus_tag LOCUS_07200 1038 2147 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480158.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence0363 >Feature sequence0364 387 1331 gene locus_tag LOCUS_07210 387 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07210 2104 1529 gene locus_tag LOCUS_07220 2104 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence0365 <2297 430 gene locus_tag LOCUS_07230 <2297 430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940320.1:PAS domain-containing protein >Feature sequence0366 <2296 90 gene locus_tag LOCUS_07240 <2296 90 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056271.1:L-glutamate gamma-semialdehyde dehydrogenase >Feature sequence0367 <2295 75 gene locus_tag LOCUS_07250 <2295 75 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921077.1:polyphosphate kinase 1 >Feature sequence0368 518 2272 gene locus_tag LOCUS_07260 gene recN 518 2272 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140275.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence0369 <1 2052 gene locus_tag LOCUS_07270 <1 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058290.1:DNA helicase PcrA >Feature sequence0370 >Feature sequence0371 <1 879 gene locus_tag LOCUS_07280 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057809.1:glycoside hydrolase family 57 protein 1700 1023 gene locus_tag LOCUS_07290 1700 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence0372 980 2095 gene locus_tag LOCUS_07300 980 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence0373 765 61 gene locus_tag LOCUS_07310 765 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence0374 523 2247 gene locus_tag LOCUS_07320 523 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence0375 375 2021 gene locus_tag LOCUS_07330 375 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 >Feature sequence0376 308 766 gene locus_tag LOCUS_07340 gene acpS 308 766 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174182.1 protein_id gnl|my_center|LOCUS_07340 802 1071 gene locus_tag LOCUS_07350 802 1071 CDS product PipX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057448.1 protein_id gnl|my_center|LOCUS_07350 1144 1809 gene locus_tag LOCUS_07360 1144 1809 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140704.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence0377 656 78 gene locus_tag LOCUS_07370 656 78 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056696.1 protein_id gnl|my_center|LOCUS_07370 776 2008 gene locus_tag LOCUS_07380 776 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence0378 378 451 gene locus_tag LOCUS_t00060 378 451 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0379 <2274 205 gene locus_tag LOCUS_07390 <2274 205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122418.1:VIT domain-containing protein >Feature sequence0380 698 93 gene locus_tag LOCUS_07400 698 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 1859 702 gene locus_tag LOCUS_07410 gene cofH 1859 702 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057436.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence0381 >Feature sequence0382 1108 137 gene locus_tag LOCUS_07420 gene sds 1108 137 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence0383 1904 294 gene locus_tag LOCUS_07430 1904 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence0384 <2263 1507 gene locus_tag LOCUS_07440 <2263 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057231.1:MFS transporter >Feature sequence0385 222 1760 gene locus_tag LOCUS_07450 222 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence0386 >Feature sequence0387 <1 973 gene locus_tag LOCUS_07460 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140287.1:homogentisate phytyltransferase >Feature sequence0388 2100 1270 gene locus_tag LOCUS_07470 2100 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence0389 103 258 gene locus_tag LOCUS_07480 103 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 464 940 gene locus_tag LOCUS_07490 464 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 1051 1917 gene locus_tag LOCUS_07500 1051 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence0390 495 1070 gene locus_tag LOCUS_07510 gene pyrE 495 1070 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057665.1 protein_id gnl|my_center|LOCUS_07510 1482 1937 gene locus_tag LOCUS_07520 1482 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence0391 1039 515 gene locus_tag LOCUS_07530 1039 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence0392 1447 1211 gene locus_tag LOCUS_07540 1447 1211 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141646.1 protein_id gnl|my_center|LOCUS_07540 <2254 1681 gene locus_tag LOCUS_07550 <2254 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057553.1:cobyric acid synthase >Feature sequence0393 <1 1697 gene locus_tag LOCUS_07560 <1 1697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941205.1:EAL domain-containing protein >Feature sequence0394 1886 75 gene locus_tag LOCUS_07570 gene thrS 1886 75 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216087114.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence0395 94 384 gene locus_tag LOCUS_07580 94 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 377 721 gene locus_tag LOCUS_07590 377 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 1096 1245 gene locus_tag LOCUS_07600 1096 1245 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_07600 1976 1758 gene locus_tag LOCUS_07610 1976 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence0396 354 1049 gene locus_tag LOCUS_07620 354 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2037 1300 gene locus_tag LOCUS_07630 2037 1300 CDS product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211333.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence0397 1648 671 gene locus_tag LOCUS_07640 1648 671 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence0398 >Feature sequence0399 <2241 279 gene locus_tag LOCUS_07650 <2241 279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056768.1:diguanylate cyclase >Feature sequence0400 476 1201 gene locus_tag LOCUS_07660 476 1201 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142237.1 protein_id gnl|my_center|LOCUS_07660 1310 2131 gene locus_tag LOCUS_07670 1310 2131 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence0401 257 673 gene locus_tag LOCUS_07680 257 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 670 915 gene locus_tag LOCUS_07690 670 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence0402 312 1970 gene locus_tag LOCUS_07700 312 1970 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056613.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence0403 913 1281 gene locus_tag LOCUS_07710 913 1281 CDS product Lin0512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086800.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence0404 >Feature sequence0405 >Feature sequence0406 <2224 144 gene locus_tag LOCUS_07720 <2224 144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056768.1:diguanylate cyclase >Feature sequence0407 >Feature sequence0408 93 299 gene locus_tag LOCUS_07730 93 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 363 1208 gene locus_tag LOCUS_07740 363 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1195 2187 gene locus_tag LOCUS_07750 1195 2187 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268938.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence0409 972 361 gene locus_tag LOCUS_07760 972 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 1301 1513 gene locus_tag LOCUS_07770 1301 1513 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058042.1 protein_id gnl|my_center|LOCUS_07770 1657 2196 gene locus_tag LOCUS_07780 gene psbP 1657 2196 CDS product photosystem II reaction center PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence0410 1664 477 gene locus_tag LOCUS_07790 1664 477 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 protein_id gnl|my_center|LOCUS_07790 2084 1731 gene locus_tag LOCUS_07800 2084 1731 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145104183.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence0411 <2221 570 gene locus_tag LOCUS_07810 <2221 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057189.1:ferredoxin--nitrite reductase >Feature sequence0412 <2217 96 gene locus_tag LOCUS_07820 <2217 96 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920919.1:iron uptake porin >Feature sequence0413 <1 1684 gene locus_tag LOCUS_07830 <1 1684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258301.1:ABC transporter ATP-binding protein 2153 1731 gene locus_tag LOCUS_07840 2153 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence0414 2073 856 gene locus_tag LOCUS_07850 2073 856 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence0415 124 762 gene locus_tag LOCUS_07860 124 762 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839415.1 protein_id gnl|my_center|LOCUS_07860 910 1677 gene locus_tag LOCUS_07870 910 1677 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056030.1 protein_id gnl|my_center|LOCUS_07870 <2210 1688 gene locus_tag LOCUS_07880 <2210 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008274486.1:Uma2 family endonuclease >Feature sequence0416 18 623 gene locus_tag LOCUS_07890 18 623 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056571.1 protein_id gnl|my_center|LOCUS_07890 1386 817 gene locus_tag LOCUS_07900 1386 817 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence0417 1217 135 gene locus_tag LOCUS_07910 1217 135 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence0418 680 1660 gene locus_tag LOCUS_07920 680 1660 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057151.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence0419 2096 381 gene locus_tag LOCUS_07930 2096 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence0420 157 1059 gene locus_tag LOCUS_07940 157 1059 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence0421 1618 644 gene locus_tag LOCUS_07950 1618 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence0422 1136 210 gene locus_tag LOCUS_07960 1136 210 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence0423 475 981 gene locus_tag LOCUS_07970 475 981 CDS product DUF4346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140855.1 protein_id gnl|my_center|LOCUS_07970 1763 1041 gene locus_tag LOCUS_07980 1763 1041 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 protein_id gnl|my_center|LOCUS_07980 1896 2126 gene locus_tag LOCUS_07990 1896 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence0424 295 1278 gene locus_tag LOCUS_08000 gene msrP 295 1278 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_08000 1471 2133 gene locus_tag LOCUS_08010 1471 2133 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence0425 607 359 gene locus_tag LOCUS_08020 607 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 779 1396 gene locus_tag LOCUS_08030 779 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 1396 1572 gene locus_tag LOCUS_08040 1396 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1573 1776 gene locus_tag LOCUS_08050 1573 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence0426 >Feature sequence0427 >Feature sequence0428 191 943 gene locus_tag LOCUS_08060 191 943 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057242.1 protein_id gnl|my_center|LOCUS_08060 1038 2144 gene locus_tag LOCUS_08070 1038 2144 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799067.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence0429 1121 1309 gene locus_tag LOCUS_08080 1121 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08080 1352 2092 gene locus_tag LOCUS_08090 1352 2092 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096831545.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08090 >Feature sequence0430 1247 2182 gene locus_tag LOCUS_08100 1247 2182 CDS product circadian clock protein KaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056332.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence0431 787 581 gene locus_tag LOCUS_08110 787 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 996 1868 gene locus_tag LOCUS_08120 996 1868 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057121.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence0432 893 111 gene locus_tag LOCUS_08130 893 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1958 1008 gene locus_tag LOCUS_08140 1958 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 >Feature sequence0433 >Feature sequence0434 >Feature sequence0435 728 1897 gene locus_tag LOCUS_08150 gene xseA 728 1897 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259569.1 protein_id gnl|my_center|LOCUS_08150 1894 2121 gene locus_tag LOCUS_08160 1894 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 >Feature sequence0436 1910 507 gene locus_tag LOCUS_08170 1910 507 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266612.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence0437 278 1099 gene locus_tag LOCUS_08180 gene cysE 278 1099 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056695.1 protein_id gnl|my_center|LOCUS_08180 1781 1200 gene locus_tag LOCUS_08190 1781 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence0438 235 489 gene locus_tag LOCUS_08200 235 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence0439 1837 1232 gene locus_tag LOCUS_08210 1837 1232 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140402.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence0440 209 676 gene locus_tag LOCUS_08220 gene rimP 209 676 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929303.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence0441 <1 560 gene locus_tag LOCUS_08230 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057690.1:radical SAM protein 514 1968 gene locus_tag LOCUS_08240 514 1968 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence0442 659 474 gene locus_tag LOCUS_08250 659 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1187 735 gene locus_tag LOCUS_08260 1187 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1320 1979 gene locus_tag LOCUS_08270 1320 1979 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920805.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence0443 >Feature sequence0444 >Feature sequence0445 52 318 gene locus_tag LOCUS_08280 52 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1452 382 gene locus_tag LOCUS_08290 1452 382 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403590.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence0446 755 51 gene locus_tag LOCUS_08300 755 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1060 2043 gene locus_tag LOCUS_08310 1060 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence0447 2029 992 gene locus_tag LOCUS_08320 gene glpX 2029 992 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057116.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence0448 281 802 gene locus_tag LOCUS_08330 gene pgsA 281 802 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 protein_id gnl|my_center|LOCUS_08330 <2168 907 gene locus_tag LOCUS_08340 <2168 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141774.1:diflavin flavoprotein >Feature sequence0449 1818 85 gene locus_tag LOCUS_08350 1818 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence0450 >Feature sequence0451 1238 303 gene locus_tag LOCUS_08360 1238 303 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence0452 >Feature sequence0453 599 198 gene locus_tag LOCUS_08370 599 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 <2158 624 gene locus_tag LOCUS_08380 <2158 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058240.1:L-aspartate oxidase >Feature sequence0454 784 1683 gene locus_tag LOCUS_08390 gene hslO 784 1683 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142278.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence0455 197 2119 gene locus_tag LOCUS_08400 gene dnaK 197 2119 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057570.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence0456 >Feature sequence0457 >Feature sequence0458 >Feature sequence0459 788 504 gene locus_tag LOCUS_08410 788 504 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141965.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence0460 242 1153 gene locus_tag LOCUS_08420 242 1153 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_08420 1245 2090 gene locus_tag LOCUS_08430 1245 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence0461 129 536 gene locus_tag LOCUS_08440 gene atpC 129 536 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056376.1 protein_id gnl|my_center|LOCUS_08440 1053 754 gene locus_tag LOCUS_08450 1053 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921006.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence0462 628 1782 gene locus_tag LOCUS_08460 628 1782 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057128.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence0463 >Feature sequence0464 1613 81 gene locus_tag LOCUS_08470 1613 81 CDS product NirA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967420.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence0465 1018 275 gene locus_tag LOCUS_08480 1018 275 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058255.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence0466 955 170 gene locus_tag LOCUS_08490 955 170 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121332.1 protein_id gnl|my_center|LOCUS_08490 1918 1175 gene locus_tag LOCUS_08500 gene rsmG 1918 1175 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140710.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence0467 1657 113 gene locus_tag LOCUS_08510 1657 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08510 >Feature sequence0468 83 1999 gene locus_tag LOCUS_08520 83 1999 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence0469 276 2084 gene locus_tag LOCUS_08530 276 2084 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057670.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence0470 444 1697 gene locus_tag LOCUS_08540 444 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence0471 >Feature sequence0472 <1 978 gene locus_tag LOCUS_08550 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057880.1:4-hydroxythreonine-4-phosphate dehydrogenase PdxA >Feature sequence0473 1069 35 gene locus_tag LOCUS_08560 1069 35 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226536.1 protein_id gnl|my_center|LOCUS_08560 1220 1855 gene locus_tag LOCUS_08570 1220 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence0474 >Feature sequence0475 >Feature sequence0476 512 991 gene locus_tag LOCUS_08580 512 991 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057630.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence0477 1711 623 gene locus_tag LOCUS_08590 gene ald 1711 623 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143957.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence0478 367 215 gene locus_tag LOCUS_08600 367 215 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056299.1 protein_id gnl|my_center|LOCUS_08600 1903 494 gene locus_tag LOCUS_08610 1903 494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406250.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence0479 1878 217 gene locus_tag LOCUS_08620 1878 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence0480 222 833 gene locus_tag LOCUS_08630 222 833 CDS product CPP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_08630 1687 1001 gene locus_tag LOCUS_08640 1687 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence0481 347 2014 gene locus_tag LOCUS_08650 gene cimA 347 2014 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence0482 422 1072 gene locus_tag LOCUS_08660 422 1072 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_08660 1485 2105 gene locus_tag LOCUS_08670 1485 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence0483 1952 114 gene locus_tag LOCUS_08680 gene ftsH3 1952 114 CDS product ATP-dependent zinc metalloprotease FtsH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055986.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence0484 508 20 gene locus_tag LOCUS_08690 508 20 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_08690 619 1500 gene locus_tag LOCUS_08700 619 1500 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence0485 686 147 gene locus_tag LOCUS_08710 686 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence0486 <1 577 gene locus_tag LOCUS_08720 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057950.1:RNA methyltransferase >Feature sequence0487 860 57 gene locus_tag LOCUS_08730 860 57 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067240.1 protein_id gnl|my_center|LOCUS_08730 1154 2080 gene locus_tag LOCUS_08740 1154 2080 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926022.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence0488 <2094 903 gene locus_tag LOCUS_08750 <2094 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267821.1:TauD/TfdA family dioxygenase >Feature sequence0489 309 977 gene locus_tag LOCUS_08760 309 977 CDS product carbon dioxide concentrating mechanism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056787.1 protein_id gnl|my_center|LOCUS_08760 1184 1957 gene locus_tag LOCUS_08770 1184 1957 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048869675.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence0490 1782 130 gene locus_tag LOCUS_08780 1782 130 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928779.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence0491 335 892 gene locus_tag LOCUS_08790 335 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence0492 1931 1179 gene locus_tag LOCUS_08800 1931 1179 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190557989.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence0493 886 161 gene locus_tag LOCUS_08810 886 161 CDS product DUF3120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190832035.1 protein_id gnl|my_center|LOCUS_08810 1463 879 gene locus_tag LOCUS_08820 1463 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence0494 113 1678 gene locus_tag LOCUS_08830 113 1678 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056133.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence0495 363 160 gene locus_tag LOCUS_08840 363 160 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095724389.1 protein_id gnl|my_center|LOCUS_08840 1557 391 gene locus_tag LOCUS_08850 1557 391 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence0496 402 1724 gene locus_tag LOCUS_08860 402 1724 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056513.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence0497 213 1580 gene locus_tag LOCUS_08870 gene opcA 213 1580 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence0498 1539 742 gene locus_tag LOCUS_08880 1539 742 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence0499 1607 111 gene locus_tag LOCUS_08890 1607 111 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057081.1 protein_id gnl|my_center|LOCUS_08890 1998 1675 gene locus_tag LOCUS_08900 1998 1675 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence0500 >Feature sequence0501 >Feature sequence0502 <1 1871 gene locus_tag LOCUS_08910 <1 1871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence0503 552 214 gene locus_tag LOCUS_08920 552 214 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103126030.1 protein_id gnl|my_center|LOCUS_08920 1139 678 gene locus_tag LOCUS_08930 gene psbV2 1139 678 CDS product photosystem II cytochrome PsbV2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057124.1 protein_id gnl|my_center|LOCUS_08930 1909 1421 gene locus_tag LOCUS_08940 gene psbV 1909 1421 CDS product photosystem II cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057125.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence0504 1568 51 gene locus_tag LOCUS_08950 1568 51 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence0505 <1 1206 gene locus_tag LOCUS_08960 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058156.1:DUF3685 domain-containing protein 1426 1911 gene locus_tag LOCUS_08970 1426 1911 CDS product CRR6 family NdhI maturation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057132.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence0506 851 636 gene locus_tag LOCUS_08980 851 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1832 1092 gene locus_tag LOCUS_08990 1832 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence0507 >Feature sequence0508 1514 1438 gene locus_tag LOCUS_t00070 1514 1438 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0509 >Feature sequence0510 132 878 gene locus_tag LOCUS_09000 132 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 1993 971 gene locus_tag LOCUS_09010 1993 971 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence0511 647 1942 gene locus_tag LOCUS_09020 gene purB 647 1942 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057666.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence0512 >Feature sequence0513 1316 342 gene locus_tag LOCUS_09030 1316 342 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_09030 1966 1382 gene locus_tag LOCUS_09040 1966 1382 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence0514 189 917 gene locus_tag LOCUS_09050 gene pyrH 189 917 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_09050 880 1452 gene locus_tag LOCUS_09060 gene frr 880 1452 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_09060 1654 1803 gene locus_tag LOCUS_09070 1654 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09070 >Feature sequence0515 100 1239 gene locus_tag LOCUS_09080 100 1239 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929514.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence0516 387 265 gene locus_tag LOCUS_09090 387 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1691 483 gene locus_tag LOCUS_09100 1691 483 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140500.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence0517 691 254 gene locus_tag LOCUS_09110 691 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1907 702 gene locus_tag LOCUS_09120 1907 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence0518 246 1322 gene locus_tag LOCUS_09130 246 1322 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106290870.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence0519 3 239 gene locus_tag LOCUS_09140 3 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 497 1957 gene locus_tag LOCUS_09150 gene glmM 497 1957 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013191710.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence0520 <2055 972 gene locus_tag LOCUS_09160 <2055 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056757.1:cysteine desulfurase family protein >Feature sequence0521 >Feature sequence0522 172 1377 gene locus_tag LOCUS_09170 172 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence0523 >Feature sequence0524 1146 997 gene locus_tag LOCUS_09180 1146 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2045 1146 gene locus_tag LOCUS_09190 2045 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09190 >Feature sequence0525 <2046 1135 gene locus_tag LOCUS_09200 <2046 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197524123.1:APC family permease >Feature sequence0526 >Feature sequence0527 330 1808 gene locus_tag LOCUS_09210 330 1808 CDS product bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence0528 1218 871 gene locus_tag LOCUS_09220 1218 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1315 1872 gene locus_tag LOCUS_09230 1315 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence0529 >Feature sequence0530 1891 83 gene locus_tag LOCUS_09240 1891 83 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence0531 1433 669 gene locus_tag LOCUS_09250 1433 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1753 1430 gene locus_tag LOCUS_09260 1753 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence0532 <1 1060 gene locus_tag LOCUS_09270 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404851.1:bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase 1765 1163 gene locus_tag LOCUS_09280 1765 1163 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057359.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence0533 137 403 gene locus_tag LOCUS_09290 137 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 751 1494 gene locus_tag LOCUS_09300 751 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence0534 366 626 gene locus_tag LOCUS_09310 366 626 CDS product sulfiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056018.1 protein_id gnl|my_center|LOCUS_09310 724 1275 gene locus_tag LOCUS_09320 gene dps 724 1275 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_09320 1354 1776 gene locus_tag LOCUS_09330 1354 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence0535 <1 906 gene locus_tag LOCUS_09340 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057573.1:mechanosensitive ion channel >Feature sequence0536 1184 414 gene locus_tag LOCUS_09350 gene hisF 1184 414 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799407.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence0537 1001 267 gene locus_tag LOCUS_09360 1001 267 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 protein_id gnl|my_center|LOCUS_09360 <2033 1315 gene locus_tag LOCUS_09370 <2033 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403760.1:sulfotransferase >Feature sequence0538 <2029 1250 gene locus_tag LOCUS_09380 <2029 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254458.1:RNA-guided endonuclease TnpB family protein >Feature sequence0539 99 473 gene locus_tag LOCUS_09390 gene rplP 99 473 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055943.1 protein_id gnl|my_center|LOCUS_09390 477 755 gene locus_tag LOCUS_09400 gene rpmC 477 755 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143907.1 protein_id gnl|my_center|LOCUS_09400 762 1013 gene locus_tag LOCUS_09410 gene rpsQ 762 1013 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055945.1 protein_id gnl|my_center|LOCUS_09410 1100 1468 gene locus_tag LOCUS_09420 gene rplN 1100 1468 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055946.1 protein_id gnl|my_center|LOCUS_09420 1468 1827 gene locus_tag LOCUS_09430 gene rplX 1468 1827 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055947.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence0540 1616 825 gene locus_tag LOCUS_09440 gene sufC 1616 825 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence0541 3 599 gene locus_tag LOCUS_09450 3 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 <2024 828 gene locus_tag LOCUS_09460 <2024 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000849131.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0542 1344 295 gene locus_tag LOCUS_09470 1344 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence0543 1718 354 gene locus_tag LOCUS_09480 1718 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence0544 >Feature sequence0545 454 1938 gene locus_tag LOCUS_09490 454 1938 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence0546 >Feature sequence0547 >Feature sequence0548 381 728 gene locus_tag LOCUS_09500 381 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056501.1 protein_id gnl|my_center|LOCUS_09500 1712 843 gene locus_tag LOCUS_09510 1712 843 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence0549 <2013 389 gene locus_tag LOCUS_09520 <2013 389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056163.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence0550 607 83 gene locus_tag LOCUS_09530 607 83 CDS product DUF4330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920747.1 protein_id gnl|my_center|LOCUS_09530 986 1837 gene locus_tag LOCUS_09540 986 1837 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921020.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence0551 >Feature sequence0552 <1 756 gene locus_tag LOCUS_09550 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122401.1:glycosyltransferase 1777 932 gene locus_tag LOCUS_09560 1777 932 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114245.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence0553 197 1741 gene locus_tag LOCUS_09570 gene crtH 197 1741 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891794.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence0554 108 581 gene locus_tag LOCUS_09580 108 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 588 1073 gene locus_tag LOCUS_09590 588 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1054 1809 gene locus_tag LOCUS_09600 1054 1809 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence0555 231 1220 gene locus_tag LOCUS_09610 gene moaA 231 1220 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143017.1 protein_id gnl|my_center|LOCUS_09610 1628 1383 gene locus_tag LOCUS_09620 1628 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence0556 1888 434 gene locus_tag LOCUS_09630 1888 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence0557 1518 208 gene locus_tag LOCUS_09640 1518 208 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_09640 1784 1563 gene locus_tag LOCUS_09650 1784 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence0558 691 206 gene locus_tag LOCUS_09660 691 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09660 1087 707 gene locus_tag LOCUS_09670 1087 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09670 >Feature sequence0559 5 1270 gene locus_tag LOCUS_09680 5 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence0560 1003 305 gene locus_tag LOCUS_09690 gene urtE 1003 305 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_09690 1814 1068 gene locus_tag LOCUS_09700 gene urtD 1814 1068 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence0561 807 331 gene locus_tag LOCUS_09710 gene ndhN 807 331 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056972.1 protein_id gnl|my_center|LOCUS_09710 1239 1874 gene locus_tag LOCUS_09720 gene rplC 1239 1874 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055936.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence0562 272 201 gene locus_tag LOCUS_t00080 272 201 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 492 632 gene locus_tag LOCUS_09730 492 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence0563 313 1800 gene locus_tag LOCUS_09740 gene glpK 313 1800 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence0564 1096 353 gene locus_tag LOCUS_09750 1096 353 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184994.1 protein_id gnl|my_center|LOCUS_09750 1806 1117 gene locus_tag LOCUS_09760 1806 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence0565 <1 1098 gene locus_tag LOCUS_09770 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000763895.1:D-alanine--D-alanine ligase >Feature sequence0566 1178 291 gene locus_tag LOCUS_09780 1178 291 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017291357.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence0567 >Feature sequence0568 752 96 gene locus_tag LOCUS_09790 752 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1674 745 gene locus_tag LOCUS_09800 1674 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence0569 <1992 452 gene locus_tag LOCUS_09810 <1992 452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920921.1:alpha/beta hydrolase >Feature sequence0570 367 975 gene locus_tag LOCUS_09820 gene clpP 367 975 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056360.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence0571 >Feature sequence0572 >Feature sequence0573 <1 1963 gene locus_tag LOCUS_09830 <1 1963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799131.1:EAL domain-containing protein >Feature sequence0574 442 756 gene locus_tag LOCUS_09840 442 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence0575 241 831 gene locus_tag LOCUS_09850 241 831 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056172.1 protein_id gnl|my_center|LOCUS_09850 828 1265 gene locus_tag LOCUS_09860 828 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1285 1770 gene locus_tag LOCUS_09870 1285 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 >Feature sequence0576 246 665 gene locus_tag LOCUS_09880 gene rsfS 246 665 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057064.1 protein_id gnl|my_center|LOCUS_09880 668 1177 gene locus_tag LOCUS_09890 668 1177 CDS product CGLD27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056906.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence0577 914 246 gene locus_tag LOCUS_09900 gene mtnX 914 246 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027474.1 protein_id gnl|my_center|LOCUS_09900 1872 1048 gene locus_tag LOCUS_09910 1872 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence0578 <1 561 gene locus_tag LOCUS_09920 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056556.1:pentapeptide repeat-containing protein 1671 1237 gene locus_tag LOCUS_09930 1671 1237 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence0579 >Feature sequence0580 <1 864 gene locus_tag LOCUS_09940 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057837.1:nitrate ABC transporter ATP-binding protein 1049 1894 gene locus_tag LOCUS_09950 1049 1894 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142088.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence0581 967 38 gene locus_tag LOCUS_09960 967 38 CDS product TIGR04168 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619519.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence0582 <1974 258 gene locus_tag LOCUS_09970 <1974 258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928427.1:ATP-binding protein >Feature sequence0583 1577 306 gene locus_tag LOCUS_09980 1577 306 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057168.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence0584 1043 1681 gene locus_tag LOCUS_09990 1043 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence0585 446 3 gene locus_tag LOCUS_10000 446 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1457 606 gene locus_tag LOCUS_10010 1457 606 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142803.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence0586 >Feature sequence0587 490 1656 gene locus_tag LOCUS_10020 490 1656 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056136.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence0588 271 1083 gene locus_tag LOCUS_10030 271 1083 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_10030 1434 1952 gene locus_tag LOCUS_10040 gene ilvN 1434 1952 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence0589 576 1322 gene locus_tag LOCUS_10050 576 1322 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence0590 >Feature sequence0591 <1 1538 gene locus_tag LOCUS_10060 <1 1538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057387.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence0592 376 53 gene locus_tag LOCUS_10070 376 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 562 377 gene locus_tag LOCUS_10080 562 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 <1952 826 gene locus_tag LOCUS_10090 <1952 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058306.1:tryptophan synthase subunit beta >Feature sequence0593 <1 603 gene locus_tag LOCUS_10100 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057020.1:nicotinate-nucleotide adenylyltransferase 564 1313 gene locus_tag LOCUS_10110 564 1313 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 protein_id gnl|my_center|LOCUS_10110 1384 1575 gene locus_tag LOCUS_10120 1384 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence0594 1317 91 gene locus_tag LOCUS_10130 1317 91 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056868.1 protein_id gnl|my_center|LOCUS_10130 1751 1521 gene locus_tag LOCUS_10140 gene yidD 1751 1521 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582538.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence0595 1506 958 gene locus_tag LOCUS_10150 1506 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence0596 683 66 gene locus_tag LOCUS_10160 683 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 791 1342 gene locus_tag LOCUS_10170 gene rfbC 791 1342 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence0597 465 1838 gene locus_tag LOCUS_10180 gene dnaA 465 1838 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056451.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence0598 1697 21 gene locus_tag LOCUS_10190 1697 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence0599 >Feature sequence0600 347 57 gene locus_tag LOCUS_10200 347 57 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056384.1 protein_id gnl|my_center|LOCUS_10200 903 580 gene locus_tag LOCUS_10210 903 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1444 1076 gene locus_tag LOCUS_10220 1444 1076 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056500.1 protein_id gnl|my_center|LOCUS_10220 1784 1924 gene locus_tag LOCUS_10230 1784 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence0601 <1 1864 gene locus_tag LOCUS_10240 <1 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197731.1:nitrite reductase large subunit NirB >Feature sequence0602 202 915 gene locus_tag LOCUS_10250 gene rnc 202 915 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142642.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence0603 1368 439 gene locus_tag LOCUS_10260 1368 439 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141699.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence0604 >Feature sequence0605 <1930 109 gene locus_tag LOCUS_10270 <1930 109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057331.1:transglycosylase domain-containing protein >Feature sequence0606 >Feature sequence0607 1721 960 gene locus_tag LOCUS_10280 1721 960 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531081.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence0608 481 1857 gene locus_tag LOCUS_10290 481 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence0609 >Feature sequence0610 239 760 gene locus_tag LOCUS_10300 239 760 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence0611 <1 546 gene locus_tag LOCUS_10310 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000620266.1:adenylate/guanylate cyclase domain-containing protein 823 987 gene locus_tag LOCUS_10320 823 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence0612 251 1279 gene locus_tag LOCUS_10330 gene pstS 251 1279 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence0613 >Feature sequence0614 >Feature sequence0615 >Feature sequence0616 <1908 835 gene locus_tag LOCUS_10340 <1908 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence0617 >Feature sequence0618 378 1850 gene locus_tag LOCUS_10350 378 1850 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence0619 <1 1147 gene locus_tag LOCUS_10360 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104752311.1:AAA domain-containing protein >Feature sequence0620 1633 713 gene locus_tag LOCUS_10370 1633 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence0621 >Feature sequence0622 <1 737 gene locus_tag LOCUS_10380 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057483.1:hydroxymethylbilane synthase >Feature sequence0623 >Feature sequence0624 >Feature sequence0625 270 1766 gene locus_tag LOCUS_10390 270 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence0626 822 40 gene locus_tag LOCUS_10400 822 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 894 1796 gene locus_tag LOCUS_10410 894 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence0627 159 1436 gene locus_tag LOCUS_10420 159 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence0628 680 1822 gene locus_tag LOCUS_10430 680 1822 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence0629 145 786 gene locus_tag LOCUS_10440 145 786 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141001.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence0630 1067 516 gene locus_tag LOCUS_10450 1067 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence0631 <1889 714 gene locus_tag LOCUS_10460 <1889 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044964.1:MFS transporter >Feature sequence0632 713 333 gene locus_tag LOCUS_10470 713 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140108.1 protein_id gnl|my_center|LOCUS_10470 955 1620 gene locus_tag LOCUS_10480 955 1620 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057675.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence0633 1641 256 gene locus_tag LOCUS_10490 gene glmU 1641 256 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920683.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence0634 >Feature sequence0635 734 237 gene locus_tag LOCUS_10500 734 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence0636 924 322 gene locus_tag LOCUS_10510 924 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1686 967 gene locus_tag LOCUS_10520 1686 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence0637 552 1412 gene locus_tag LOCUS_10530 gene aroF 552 1412 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140197.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence0638 >Feature sequence0639 613 20 gene locus_tag LOCUS_10540 613 20 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143183.1 protein_id gnl|my_center|LOCUS_10540 <1882 869 gene locus_tag LOCUS_10550 <1882 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929211.1:DICT sensory domain-containing protein >Feature sequence0640 195 977 gene locus_tag LOCUS_10560 195 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence0641 291 55 gene locus_tag LOCUS_10570 291 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 985 269 gene locus_tag LOCUS_10580 985 269 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057817.1 protein_id gnl|my_center|LOCUS_10580 1138 1617 gene locus_tag LOCUS_10590 1138 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence0642 689 1735 gene locus_tag LOCUS_10600 689 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence0643 329 1792 gene locus_tag LOCUS_10610 329 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence0644 >Feature sequence0645 <1 1634 gene locus_tag LOCUS_10620 <1 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027265337.1:ATP-binding protein >Feature sequence0646 389 895 gene locus_tag LOCUS_10630 389 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1582 1028 gene locus_tag LOCUS_10640 1582 1028 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928679.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence0647 1568 21 gene locus_tag LOCUS_10650 gene guaA 1568 21 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058250.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence0648 215 1444 gene locus_tag LOCUS_10660 gene nagA 215 1444 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057928.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence0649 1460 480 gene locus_tag LOCUS_10670 1460 480 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975769.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence0650 219 479 gene locus_tag LOCUS_10680 219 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1122 613 gene locus_tag LOCUS_10690 1122 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1800 1195 gene locus_tag LOCUS_10700 1800 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence0651 >Feature sequence0652 804 307 gene locus_tag LOCUS_10710 804 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1358 1128 gene locus_tag LOCUS_10720 1358 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1720 1319 gene locus_tag LOCUS_10730 1720 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence0653 724 173 gene locus_tag LOCUS_10740 724 173 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence0654 <1858 312 gene locus_tag LOCUS_10750 <1858 312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962866.1:SPFH domain-containing protein >Feature sequence0655 68 1012 gene locus_tag LOCUS_10760 68 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence0656 <1 594 gene locus_tag LOCUS_10770 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_199341128.1:N-acetylmuramoyl-L-alanine amidase 643 1038 gene locus_tag LOCUS_10780 643 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1715 1155 gene locus_tag LOCUS_10790 1715 1155 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence0657 465 343 gene locus_tag LOCUS_10800 465 343 CDS product photosystem II reaction center protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071823295.1 protein_id gnl|my_center|LOCUS_10800 657 535 gene locus_tag LOCUS_10810 657 535 CDS product photosystem II reaction center protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057383.1 protein_id gnl|my_center|LOCUS_10810 1073 825 gene locus_tag LOCUS_10820 gene psbE 1073 825 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057381.1 protein_id gnl|my_center|LOCUS_10820 1855 1130 gene locus_tag LOCUS_10830 1855 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence0658 480 1742 gene locus_tag LOCUS_10840 480 1742 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776584.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence0659 >Feature sequence0660 234 112 gene locus_tag LOCUS_10850 234 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10850 597 241 gene locus_tag LOCUS_10860 597 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10860 1138 1398 gene locus_tag LOCUS_10870 1138 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007358131.1 protein_id gnl|my_center|LOCUS_10870 1853 1548 gene locus_tag LOCUS_10880 1853 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence0661 485 652 gene locus_tag LOCUS_10890 485 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 668 1585 gene locus_tag LOCUS_10900 668 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence0662 677 351 gene locus_tag LOCUS_10910 677 351 CDS product DUF2488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 protein_id gnl|my_center|LOCUS_10910 792 998 gene locus_tag LOCUS_10920 792 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence0663 1507 782 gene locus_tag LOCUS_10930 gene tpiA 1507 782 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798681.1 protein_id gnl|my_center|LOCUS_10930 1761 1576 gene locus_tag LOCUS_10940 1761 1576 CDS product PCP reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143955.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence0664 1583 102 gene locus_tag LOCUS_10950 1583 102 CDS product bifunctional pantoate--beta-alanine ligase/(d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058282.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence0665 <1848 697 gene locus_tag LOCUS_10960 <1848 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056163.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence0666 1094 411 gene locus_tag LOCUS_10970 1094 411 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144357.1 protein_id gnl|my_center|LOCUS_10970 <1847 1290 gene locus_tag LOCUS_10980 <1847 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053221433.1:serine/threonine-protein kinase >Feature sequence0667 389 769 gene locus_tag LOCUS_10990 389 769 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143794.1 protein_id gnl|my_center|LOCUS_10990 816 1676 gene locus_tag LOCUS_11000 816 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence0668 468 151 gene locus_tag LOCUS_11010 468 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 <1846 630 gene locus_tag LOCUS_11020 <1846 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021779460.1:DEAD/DEAH box helicase family protein >Feature sequence0669 737 96 gene locus_tag LOCUS_11030 737 96 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140756.1 protein_id gnl|my_center|LOCUS_11030 871 1155 gene locus_tag LOCUS_11040 gene psaK 871 1155 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921012.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence0670 346 828 gene locus_tag LOCUS_11050 346 828 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125105.1 protein_id gnl|my_center|LOCUS_11050 1520 942 gene locus_tag LOCUS_11060 1520 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence0671 >Feature sequence0672 >Feature sequence0673 334 260 gene locus_tag LOCUS_t00090 334 260 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 404 1033 gene locus_tag LOCUS_11070 404 1033 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143393.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence0674 1666 530 gene locus_tag LOCUS_11080 gene dndB 1666 530 CDS product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence0675 505 1551 gene locus_tag LOCUS_11090 505 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence0676 803 30 gene locus_tag LOCUS_11100 803 30 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence0677 1701 301 gene locus_tag LOCUS_11110 1701 301 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence0678 64 606 gene locus_tag LOCUS_11120 64 606 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 protein_id gnl|my_center|LOCUS_11120 711 1733 gene locus_tag LOCUS_11130 711 1733 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence0679 374 1693 gene locus_tag LOCUS_11140 374 1693 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187164.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence0680 <1 854 gene locus_tag LOCUS_11150 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056373.1:D-alanine--D-alanine ligase family protein >Feature sequence0681 105 1571 gene locus_tag LOCUS_11160 105 1571 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143635.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence0682 322 870 gene locus_tag LOCUS_11170 322 870 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence0683 >Feature sequence0684 1371 505 gene locus_tag LOCUS_11180 gene bchL 1371 505 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921031.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence0685 700 182 gene locus_tag LOCUS_11190 700 182 CDS product Ycf51 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056935.1 protein_id gnl|my_center|LOCUS_11190 1796 720 gene locus_tag LOCUS_11200 1796 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence0686 426 22 gene locus_tag LOCUS_11210 426 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 <1823 834 gene locus_tag LOCUS_11220 <1823 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057593.1:ATP-binding cassette domain-containing protein >Feature sequence0687 124 978 gene locus_tag LOCUS_11230 gene ylqF 124 978 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057347.1 protein_id gnl|my_center|LOCUS_11230 <1822 998 gene locus_tag LOCUS_11240 <1822 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903268.1:MOSC domain-containing protein >Feature sequence0688 >Feature sequence0689 668 585 gene locus_tag LOCUS_t00100 668 585 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0690 <1820 423 gene locus_tag LOCUS_11250 <1820 423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056852.1:glycosyltransferase >Feature sequence0691 >Feature sequence0692 <1 840 gene locus_tag LOCUS_11260 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056806.1:ABC transporter ATP-binding protein 1011 1226 gene locus_tag LOCUS_11270 1011 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1415 1747 gene locus_tag LOCUS_11280 1415 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence0693 <1818 141 gene locus_tag LOCUS_11290 <1818 141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057331.1:transglycosylase domain-containing protein >Feature sequence0694 106 531 gene locus_tag LOCUS_11300 106 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530034.1 protein_id gnl|my_center|LOCUS_11300 528 1043 gene locus_tag LOCUS_11310 528 1043 CDS product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141893.1 protein_id gnl|my_center|LOCUS_11310 1691 1254 gene locus_tag LOCUS_11320 gene recX 1691 1254 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006855.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence0695 1614 205 gene locus_tag LOCUS_11330 1614 205 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence0696 1535 1149 gene locus_tag LOCUS_11340 1535 1149 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_11340 1713 1522 gene locus_tag LOCUS_11350 1713 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence0697 >Feature sequence0698 >Feature sequence0699 870 1640 gene locus_tag LOCUS_11360 870 1640 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence0700 1150 458 gene locus_tag LOCUS_11370 1150 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1336 1408 gene locus_tag LOCUS_t00110 1336 1408 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0701 1601 909 gene locus_tag LOCUS_11380 gene purN 1601 909 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524113.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence0702 <1810 556 gene locus_tag LOCUS_11390 <1810 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258936.1:DEAD/DEAH box helicase >Feature sequence0703 <1809 951 gene locus_tag LOCUS_11400 <1809 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001022333.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0704 >Feature sequence0705 <1 511 gene locus_tag LOCUS_11410 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021891.1:pentapeptide repeat-containing protein 1618 632 gene locus_tag LOCUS_11420 1618 632 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929219.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence0706 1357 122 gene locus_tag LOCUS_11430 1357 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence0707 1514 171 gene locus_tag LOCUS_11440 gene gor 1514 171 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence0708 465 187 gene locus_tag LOCUS_11450 465 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1379 1152 gene locus_tag LOCUS_11460 1379 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence0709 1436 339 gene locus_tag LOCUS_11470 1436 339 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681105.1 protein_id gnl|my_center|LOCUS_11470 1528 1686 gene locus_tag LOCUS_11480 1528 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence0710 <1 1006 gene locus_tag LOCUS_11490 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527796.1:PDZ domain-containing protein 1160 1594 gene locus_tag LOCUS_11500 1160 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence0711 >Feature sequence0712 <1800 1001 gene locus_tag LOCUS_11510 <1800 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056610.1:phosphoenolpyruvate synthase >Feature sequence0713 1260 121 gene locus_tag LOCUS_11520 gene dnaN 1260 121 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058182.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence0714 632 186 gene locus_tag LOCUS_11530 632 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1482 1126 gene locus_tag LOCUS_11540 1482 1126 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524127.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence0715 <1 1741 gene locus_tag LOCUS_11550 <1 1741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence0716 <1 1490 gene locus_tag LOCUS_11560 <1 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058157.1:iron uptake porin >Feature sequence0717 1474 467 gene locus_tag LOCUS_11570 1474 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence0718 >Feature sequence0719 <1795 67 gene locus_tag LOCUS_11580 <1795 67 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057688.1:preprotein translocase subunit SecA >Feature sequence0720 141 1319 gene locus_tag LOCUS_11590 141 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11590 1344 1679 gene locus_tag LOCUS_11600 1344 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11600 >Feature sequence0721 1269 214 gene locus_tag LOCUS_11610 1269 214 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence0722 >Feature sequence0723 >Feature sequence0724 227 673 gene locus_tag LOCUS_11620 227 673 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056354.1 protein_id gnl|my_center|LOCUS_11620 692 1672 gene locus_tag LOCUS_11630 gene cysK 692 1672 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence0725 >Feature sequence0726 904 1647 gene locus_tag LOCUS_11640 904 1647 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056258.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence0727 1081 248 gene locus_tag LOCUS_11650 1081 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 <1787 1102 gene locus_tag LOCUS_11660 <1787 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012548770.1:flippase-like domain-containing protein >Feature sequence0728 >Feature sequence0729 647 204 gene locus_tag LOCUS_11670 647 204 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_11670 1200 913 gene locus_tag LOCUS_11680 1200 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence0730 <1 870 gene locus_tag LOCUS_11690 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022220.1:tetratricopeptide repeat protein 909 1418 gene locus_tag LOCUS_11700 909 1418 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141970.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence0731 144 875 gene locus_tag LOCUS_11710 gene rpsC 144 875 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055942.1 protein_id gnl|my_center|LOCUS_11710 1039 1410 gene locus_tag LOCUS_11720 gene rplP 1039 1410 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055943.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence0732 >Feature sequence0733 740 354 gene locus_tag LOCUS_11730 740 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045052736.1 protein_id gnl|my_center|LOCUS_11730 1695 1033 gene locus_tag LOCUS_11740 1695 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11740 >Feature sequence0734 >Feature sequence0735 364 861 gene locus_tag LOCUS_11750 364 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1413 928 gene locus_tag LOCUS_11760 1413 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence0736 1616 210 gene locus_tag LOCUS_11770 1616 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 >Feature sequence0737 >Feature sequence0738 >Feature sequence0739 >Feature sequence0740 >Feature sequence0741 41 1336 gene locus_tag LOCUS_11780 41 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence0742 305 1264 gene locus_tag LOCUS_11790 305 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1664 1446 gene locus_tag LOCUS_11800 1664 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence0743 <1 678 gene locus_tag LOCUS_11810 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065910.1:ADP-ribosylglycohydrolase family protein <1769 780 gene locus_tag LOCUS_11820 <1769 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_088430287.1:cation:proton antiporter >Feature sequence0744 1496 360 gene locus_tag LOCUS_11830 gene hrcA 1496 360 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056606.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence0745 >Feature sequence0746 <1 1121 gene locus_tag LOCUS_11840 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057387.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence0747 >Feature sequence0748 <1 555 gene locus_tag LOCUS_11850 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142304.1:ferritin-like domain-containing protein 1078 1581 gene locus_tag LOCUS_11860 1078 1581 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797565.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence0749 >Feature sequence0750 <1 896 gene locus_tag LOCUS_11870 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142799.1:NAD-dependent succinate-semialdehyde dehydrogenase >Feature sequence0751 973 704 gene locus_tag LOCUS_11880 973 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1342 1115 gene locus_tag LOCUS_11890 1342 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11890 1608 1348 gene locus_tag LOCUS_11900 1608 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11900 >Feature sequence0752 211 1584 gene locus_tag LOCUS_11910 211 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11910 >Feature sequence0753 1583 384 gene locus_tag LOCUS_11920 1583 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence0754 >Feature sequence0755 <1754 272 gene locus_tag LOCUS_11930 <1754 272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137908825.1:DNA mismatch repair endonuclease MutL >Feature sequence0756 >Feature sequence0757 764 1645 gene locus_tag LOCUS_11940 764 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence0758 <1 548 gene locus_tag LOCUS_11950 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057907.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH <1753 650 gene locus_tag LOCUS_11960 <1753 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261900.1:ATP-binding protein >Feature sequence0759 267 488 gene locus_tag LOCUS_11970 267 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 625 1575 gene locus_tag LOCUS_11980 gene accD 625 1575 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057480.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence0760 103 819 gene locus_tag LOCUS_11990 103 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence0761 >Feature sequence0762 327 674 gene locus_tag LOCUS_12000 327 674 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929212.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence0763 1243 23 gene locus_tag LOCUS_12010 gene ispG 1243 23 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056840.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence0764 >Feature sequence0765 1236 319 gene locus_tag LOCUS_12020 1236 319 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143656.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence0766 <1 599 gene locus_tag LOCUS_12030 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920717.1:ABC transporter ATP-binding protein >Feature sequence0767 >Feature sequence0768 <1745 334 gene locus_tag LOCUS_12040 <1745 334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126986862.1:phosphoketolase >Feature sequence0769 >Feature sequence0770 >Feature sequence0771 >Feature sequence0772 225 1736 gene locus_tag LOCUS_12050 gene pds 225 1736 CDS product 15-cis-phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057401.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence0773 1357 137 gene locus_tag LOCUS_12060 gene chlP 1357 137 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence0774 1409 156 gene locus_tag LOCUS_12070 1409 156 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057279.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence0775 >Feature sequence0776 <1 1564 gene locus_tag LOCUS_12080 <1 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021891.1:pentapeptide repeat-containing protein >Feature sequence0777 89 1123 gene locus_tag LOCUS_12090 89 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 <1732 1213 gene locus_tag LOCUS_12100 <1732 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929863.1:beta-propeller fold lactonase family protein >Feature sequence0778 <1 1299 gene locus_tag LOCUS_12110 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056162.1:transglutaminase domain-containing protein 1408 1548 gene locus_tag LOCUS_12120 1408 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence0779 488 303 gene locus_tag LOCUS_12130 488 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1072 485 gene locus_tag LOCUS_12140 1072 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1480 1623 gene locus_tag LOCUS_12150 1480 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence0780 295 1005 gene locus_tag LOCUS_12160 295 1005 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987297.1 protein_id gnl|my_center|LOCUS_12160 1096 1593 gene locus_tag LOCUS_12170 1096 1593 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144198.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence0781 513 1709 gene locus_tag LOCUS_12180 513 1709 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence0782 602 213 gene locus_tag LOCUS_12190 602 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence0783 >Feature sequence0784 927 616 gene locus_tag LOCUS_12200 927 616 CDS product DUF2973 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_12200 1415 1086 gene locus_tag LOCUS_12210 1415 1086 CDS product DUF2605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057537.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence0785 93 689 gene locus_tag LOCUS_12220 93 689 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920984.1 protein_id gnl|my_center|LOCUS_12220 715 1650 gene locus_tag LOCUS_12230 715 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence0786 <1 1383 gene locus_tag LOCUS_12240 <1 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000849131.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0787 1711 1502 gene locus_tag LOCUS_12250 1711 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence0788 651 307 gene locus_tag LOCUS_12260 651 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975312.1 protein_id gnl|my_center|LOCUS_12260 1101 1544 gene locus_tag LOCUS_12270 gene cynS 1101 1544 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088475.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence0789 >Feature sequence0790 >Feature sequence0791 688 260 gene locus_tag LOCUS_12280 688 260 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920646.1 protein_id gnl|my_center|LOCUS_12280 <1723 1031 gene locus_tag LOCUS_12290 <1723 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058085.1:histidinol dehydrogenase >Feature sequence0792 >Feature sequence0793 1033 818 gene locus_tag LOCUS_12300 1033 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1297 1611 gene locus_tag LOCUS_12310 gene grxC 1297 1611 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence0794 1719 940 gene locus_tag LOCUS_12320 1719 940 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920864.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence0795 932 261 gene locus_tag LOCUS_12330 932 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1029 1688 gene locus_tag LOCUS_12340 1029 1688 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence0796 846 208 gene locus_tag LOCUS_12350 846 208 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860382.1 protein_id gnl|my_center|LOCUS_12350 1314 853 gene locus_tag LOCUS_12360 1314 853 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086784.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence0797 1296 433 gene locus_tag LOCUS_12370 1296 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence0798 381 55 gene locus_tag LOCUS_12380 381 55 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_12380 533 1633 gene locus_tag LOCUS_12390 533 1633 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921032.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence0799 810 1511 gene locus_tag LOCUS_12400 gene sufR 810 1511 CDS product iron-sulfur cluster biosynthesis transcriptional regulator SufR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence0800 <1709 580 gene locus_tag LOCUS_12410 <1709 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057708.1:beta-ketoacyl-ACP synthase II >Feature sequence0801 1062 31 gene locus_tag LOCUS_12420 1062 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056254.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence0802 >Feature sequence0803 >Feature sequence0804 <1 1633 gene locus_tag LOCUS_12430 <1 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057209.1:DNA gyrase subunit A >Feature sequence0805 <1706 1025 gene locus_tag LOCUS_12440 <1706 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058098.1:aminopeptidase P N-terminal domain-containing protein >Feature sequence0806 270 121 gene locus_tag LOCUS_12450 270 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1339 347 gene locus_tag LOCUS_12460 1339 347 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732470.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence0807 398 1453 gene locus_tag LOCUS_12470 398 1453 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056195.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence0808 >Feature sequence0809 659 228 gene locus_tag LOCUS_12480 659 228 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_12480 671 1483 gene locus_tag LOCUS_12490 671 1483 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550381.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence0810 964 155 gene locus_tag LOCUS_12500 964 155 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence0811 763 1446 gene locus_tag LOCUS_12510 763 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence0812 <1700 172 gene locus_tag LOCUS_12520 <1700 172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_073595568.1:thioredoxin-like domain-containing protein >Feature sequence0813 <1 1454 gene locus_tag LOCUS_12530 <1 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268199.1:type I secretion system permease/ATPase >Feature sequence0814 >Feature sequence0815 722 1282 gene locus_tag LOCUS_12540 722 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence0816 1245 172 gene locus_tag LOCUS_12550 gene fbp 1245 172 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056391.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence0817 784 230 gene locus_tag LOCUS_12560 784 230 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence0818 <1697 711 gene locus_tag LOCUS_12570 <1697 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140727.1:caspase family protein >Feature sequence0819 >Feature sequence0820 >Feature sequence0821 >Feature sequence0822 >Feature sequence0823 >Feature sequence0824 <1 511 gene locus_tag LOCUS_12580 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932301.1:3-isopropylmalate dehydratase large subunit 546 1454 gene locus_tag LOCUS_12590 546 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036226.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence0825 >Feature sequence0826 273 509 gene locus_tag LOCUS_12600 273 509 CDS product Calvin cycle protein CP12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057657.1 protein_id gnl|my_center|LOCUS_12600 910 1530 gene locus_tag LOCUS_12610 910 1530 CDS product DUF3177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057787.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence0827 440 682 gene locus_tag LOCUS_12620 440 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007358131.1 protein_id gnl|my_center|LOCUS_12620 792 1325 gene locus_tag LOCUS_12630 792 1325 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920976.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence0828 >Feature sequence0829 <1683 566 gene locus_tag LOCUS_12640 <1683 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036372.1:ATP-binding protein >Feature sequence0830 199 1395 gene locus_tag LOCUS_12650 199 1395 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence0831 27 431 gene locus_tag LOCUS_12660 27 431 CDS product heme utilization protein HuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920696.1 protein_id gnl|my_center|LOCUS_12660 711 1466 gene locus_tag LOCUS_12670 711 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929385.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence0832 >Feature sequence0833 <1 1530 gene locus_tag LOCUS_12680 <1 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056424.1:NADP-dependent phosphogluconate dehydrogenase >Feature sequence0834 119 685 gene locus_tag LOCUS_12690 119 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1110 1346 gene locus_tag LOCUS_12700 1110 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence0835 >Feature sequence0836 <1 1518 gene locus_tag LOCUS_12710 <1 1518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799342.1:ShlB/FhaC/HecB family hemolysin secretion/activation protein >Feature sequence0837 >Feature sequence0838 487 416 gene locus_tag LOCUS_t00120 487 416 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 643 559 gene locus_tag LOCUS_t00130 643 559 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 <1668 842 gene locus_tag LOCUS_12720 <1668 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142666.1:ABC transporter ATP-binding protein >Feature sequence0839 >Feature sequence0840 1300 440 gene locus_tag LOCUS_12730 1300 440 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence0841 1067 114 gene locus_tag LOCUS_12740 gene mdh 1067 114 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142537.1 protein_id gnl|my_center|LOCUS_12740 1413 1198 gene locus_tag LOCUS_12750 1413 1198 CDS product NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143533.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence0842 >Feature sequence0843 <1665 128 gene locus_tag LOCUS_12760 <1665 128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein >Feature sequence0844 1407 298 gene locus_tag LOCUS_12770 gene proB 1407 298 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057952.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence0845 322 1077 gene locus_tag LOCUS_12780 322 1077 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230740.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence0846 1393 89 gene locus_tag LOCUS_12790 1393 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence0847 306 1274 gene locus_tag LOCUS_12800 306 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence0848 46 966 gene locus_tag LOCUS_12810 46 966 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387903.1 protein_id gnl|my_center|LOCUS_12810 1268 1501 gene locus_tag LOCUS_12820 1268 1501 CDS product ferredoxin-thioredoxin reductase variable chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence0849 >Feature sequence0850 1340 747 gene locus_tag LOCUS_12830 gene cas4 1340 747 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence0851 814 1530 gene locus_tag LOCUS_12840 814 1530 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929061.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence0852 >Feature sequence0853 >Feature sequence0854 1405 566 gene locus_tag LOCUS_12850 gene cysK 1405 566 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence0855 1654 455 gene locus_tag LOCUS_12860 1654 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence0856 >Feature sequence0857 774 577 gene locus_tag LOCUS_12870 774 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1263 844 gene locus_tag LOCUS_12880 1263 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence0858 1002 262 gene locus_tag LOCUS_12890 1002 262 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence0859 1391 393 gene locus_tag LOCUS_12900 1391 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence0860 89 1489 gene locus_tag LOCUS_12910 89 1489 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920957.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence0861 1421 312 gene locus_tag LOCUS_12920 gene rlmN 1421 312 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058257.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence0862 789 286 gene locus_tag LOCUS_12930 789 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence0863 1341 331 gene locus_tag LOCUS_12940 1341 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence0864 1261 152 gene locus_tag LOCUS_12950 1261 152 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence0865 1584 301 gene locus_tag LOCUS_12960 1584 301 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence0866 932 306 gene locus_tag LOCUS_12970 932 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1646 1122 gene locus_tag LOCUS_12980 1646 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence0867 <1 1547 gene locus_tag LOCUS_12990 <1 1547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125444.1:glycosyltransferase family 39 protein >Feature sequence0868 287 997 gene locus_tag LOCUS_13000 287 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence0869 1454 279 gene locus_tag LOCUS_13010 gene ribD 1454 279 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057986.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence0870 >Feature sequence0871 >Feature sequence0872 <1 1470 gene locus_tag LOCUS_13020 <1 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056582.1:ATP-dependent DNA helicase RecG >Feature sequence0873 >Feature sequence0874 257 961 gene locus_tag LOCUS_13030 257 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1025 1309 gene locus_tag LOCUS_13040 1025 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence0875 3 1271 gene locus_tag LOCUS_13050 3 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence0876 >Feature sequence0877 >Feature sequence0878 1145 276 gene locus_tag LOCUS_13060 1145 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence0879 >Feature sequence0880 9 812 gene locus_tag LOCUS_13070 9 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence0881 1095 103 gene locus_tag LOCUS_13080 1095 103 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence0882 <1635 183 gene locus_tag LOCUS_13090 <1635 183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056673.1:mechanosensitive ion channel >Feature sequence0883 >Feature sequence0884 >Feature sequence0885 <1 665 gene locus_tag LOCUS_13100 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057473.1:ammonium transporter 826 1506 gene locus_tag LOCUS_13110 826 1506 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921101.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence0886 721 35 gene locus_tag LOCUS_13120 721 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 <1631 1015 gene locus_tag LOCUS_13130 <1631 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142488.1:SirB1 family protein >Feature sequence0887 >Feature sequence0888 455 84 gene locus_tag LOCUS_13140 455 84 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 protein_id gnl|my_center|LOCUS_13140 966 505 gene locus_tag LOCUS_13150 966 505 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence0889 677 249 gene locus_tag LOCUS_13160 677 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 <1627 658 gene locus_tag LOCUS_13170 <1627 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057486.1:cyclic peptide export ABC transporter >Feature sequence0890 <1627 734 gene locus_tag LOCUS_13180 <1627 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963250.1:cyanophycin synthetase >Feature sequence0891 <1627 172 gene locus_tag LOCUS_13190 <1627 172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482837.1:pseudouridine synthase >Feature sequence0892 >Feature sequence0893 341 1546 gene locus_tag LOCUS_13200 341 1546 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125209.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence0894 >Feature sequence0895 654 187 gene locus_tag LOCUS_13210 654 187 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_13210 <1624 815 gene locus_tag LOCUS_13220 <1624 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962252.1:tetratricopeptide repeat protein >Feature sequence0896 145 1350 gene locus_tag LOCUS_13230 145 1350 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061719.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence0897 >Feature sequence0898 >Feature sequence0899 1174 323 gene locus_tag LOCUS_13240 1174 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence0900 80 694 gene locus_tag LOCUS_13250 80 694 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence0901 1622 78 gene locus_tag LOCUS_13260 1622 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence0902 1051 1425 gene locus_tag LOCUS_13270 1051 1425 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055968.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence0903 <1 1415 gene locus_tag LOCUS_13280 <1 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056029.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence0904 677 108 gene locus_tag LOCUS_13290 677 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13290 1475 687 gene locus_tag LOCUS_13300 1475 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13300 >Feature sequence0905 <1 1038 gene locus_tag LOCUS_13310 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021891.1:pentapeptide repeat-containing protein >Feature sequence0906 194 979 gene locus_tag LOCUS_13320 194 979 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 protein_id gnl|my_center|LOCUS_13320 976 1410 gene locus_tag LOCUS_13330 976 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence0907 >Feature sequence0908 1227 67 gene locus_tag LOCUS_13340 1227 67 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056427.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence0909 396 181 gene locus_tag LOCUS_13350 396 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence0910 >Feature sequence0911 >Feature sequence0912 >Feature sequence0913 >Feature sequence0914 <1 1574 gene locus_tag LOCUS_13360 <1 1574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920844.1:glycoside hydrolase >Feature sequence0915 <1 612 gene locus_tag LOCUS_13370 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005463613.1:sugar O-acetyltransferase 861 1358 gene locus_tag LOCUS_13380 861 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence0916 286 1197 gene locus_tag LOCUS_13390 286 1197 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence0917 >Feature sequence0918 >Feature sequence0919 >Feature sequence0920 >Feature sequence0921 1543 194 gene locus_tag LOCUS_13400 1543 194 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence0922 >Feature sequence0923 <1 962 gene locus_tag LOCUS_13410 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence0924 >Feature sequence0925 <1 689 gene locus_tag LOCUS_13420 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140670.1:TIGR04283 family arsenosugar biosynthesis glycosyltransferase <1605 990 gene locus_tag LOCUS_13430 <1605 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057008.1:ATP synthase F0 subunit B >Feature sequence0926 1419 1180 gene locus_tag LOCUS_13440 1419 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence0927 <1 1139 gene locus_tag LOCUS_13450 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001093155.1:ATP-grasp domain-containing protein 1142 1282 gene locus_tag LOCUS_13460 1142 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence0928 704 1543 gene locus_tag LOCUS_13470 704 1543 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009454959.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence0929 440 1369 gene locus_tag LOCUS_13480 440 1369 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144407.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence0930 <1 1420 gene locus_tag LOCUS_13490 <1 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057509.1:anthranilate synthase component I >Feature sequence0931 333 1535 gene locus_tag LOCUS_13500 333 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence0932 <1 663 gene locus_tag LOCUS_13510 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705617.1:class I SAM-dependent methyltransferase >Feature sequence0933 >Feature sequence0934 1290 55 gene locus_tag LOCUS_13520 1290 55 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence0935 >Feature sequence0936 701 111 gene locus_tag LOCUS_13530 701 111 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_13530 1173 1550 gene locus_tag LOCUS_13540 1173 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence0937 <1 514 gene locus_tag LOCUS_13550 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057808.1:signal recognition particle protein 1207 620 gene locus_tag LOCUS_13560 1207 620 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence0938 167 658 gene locus_tag LOCUS_13570 167 658 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_13570 735 1418 gene locus_tag LOCUS_13580 735 1418 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence0939 440 796 gene locus_tag LOCUS_13590 gene rplT 440 796 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125971.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence0940 321 154 gene locus_tag LOCUS_13600 321 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1422 391 gene locus_tag LOCUS_13610 1422 391 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055920.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence0941 217 147 gene locus_tag LOCUS_t00140 217 147 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <1594 381 gene locus_tag LOCUS_13620 <1594 381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125106.1:excinuclease ABC subunit UvrC >Feature sequence0942 455 1072 gene locus_tag LOCUS_13630 455 1072 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929250.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence0943 1590 220 gene locus_tag LOCUS_13640 1590 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence0944 379 807 gene locus_tag LOCUS_13650 379 807 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144256.1 protein_id gnl|my_center|LOCUS_13650 908 1402 gene locus_tag LOCUS_13660 908 1402 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056636.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence0945 <1591 175 gene locus_tag LOCUS_13670 <1591 175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase note possible pseudo, internal stop codon >Feature sequence0946 331 828 gene locus_tag LOCUS_13680 331 828 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141969.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence0947 890 336 gene locus_tag LOCUS_13690 890 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1144 881 gene locus_tag LOCUS_13700 1144 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1494 1351 gene locus_tag LOCUS_13710 1494 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence0948 >Feature sequence0949 >Feature sequence0950 >Feature sequence0951 35 727 gene locus_tag LOCUS_13720 35 727 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_13720 709 1467 gene locus_tag LOCUS_13730 709 1467 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence0952 1166 1549 gene locus_tag LOCUS_13740 1166 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence0953 973 326 gene locus_tag LOCUS_13750 973 326 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929078.1 protein_id gnl|my_center|LOCUS_13750 <1589 1086 gene locus_tag LOCUS_13760 <1589 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence0954 419 234 gene locus_tag LOCUS_13770 419 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 418 1356 gene locus_tag LOCUS_13780 418 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence0955 93 1367 gene locus_tag LOCUS_13790 93 1367 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057105.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence0956 <1 917 gene locus_tag LOCUS_13800 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046235238.1:RecQ family ATP-dependent DNA helicase note possible pseudo, frameshifted 889 1371 gene locus_tag LOCUS_13810 889 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13810 >Feature sequence0957 <1 1362 gene locus_tag LOCUS_13820 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005092398.1:SagB family peptide dehydrogenase >Feature sequence0958 <1582 61 gene locus_tag LOCUS_13830 <1582 61 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057033.1:molecular chaperone HtpG >Feature sequence0959 >Feature sequence0960 >Feature sequence0961 1579 458 gene locus_tag LOCUS_13840 gene argJ 1579 458 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057748.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence0962 >Feature sequence0963 1498 20 gene locus_tag LOCUS_13850 1498 20 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143058.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence0964 >Feature sequence0965 471 244 gene locus_tag LOCUS_13860 471 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1411 413 gene locus_tag LOCUS_13870 1411 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence0966 >Feature sequence0967 383 967 gene locus_tag LOCUS_13880 383 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence0968 >Feature sequence0969 496 1470 gene locus_tag LOCUS_13890 496 1470 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence0970 >Feature sequence0971 >Feature sequence0972 >Feature sequence0973 <1 1314 gene locus_tag LOCUS_13900 <1 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057727.1:type II CAAX endopeptidase family protein >Feature sequence0974 <1 1464 gene locus_tag LOCUS_13910 <1 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058049.1:Hsp70 family protein >Feature sequence0975 332 186 gene locus_tag LOCUS_13920 332 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13920 875 450 gene locus_tag LOCUS_13930 gene rplK 875 450 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_13930 1519 878 gene locus_tag LOCUS_13940 gene nusG 1519 878 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056149.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence0976 546 959 gene locus_tag LOCUS_13950 546 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence0977 <1 1193 gene locus_tag LOCUS_13960 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144873981.1:TonB-dependent siderophore receptor >Feature sequence0978 >Feature sequence0979 694 482 gene locus_tag LOCUS_13970 694 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence0980 1500 178 gene locus_tag LOCUS_13980 1500 178 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141007.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence0981 618 31 gene locus_tag LOCUS_13990 618 31 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 protein_id gnl|my_center|LOCUS_13990 1344 730 gene locus_tag LOCUS_14000 1344 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence0982 <1567 400 gene locus_tag LOCUS_14010 <1567 400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143551.1:chemotaxis protein CheB >Feature sequence0983 1362 433 gene locus_tag LOCUS_14020 1362 433 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence0984 371 847 gene locus_tag LOCUS_14030 371 847 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056672.1 protein_id gnl|my_center|LOCUS_14030 927 1217 gene locus_tag LOCUS_14040 927 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14040 >Feature sequence0985 173 1393 gene locus_tag LOCUS_14050 173 1393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence0986 >Feature sequence0987 <1 500 gene locus_tag LOCUS_14060 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461896.1:zinc metalloprotease HtpX 634 1080 gene locus_tag LOCUS_14070 634 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929475.1 protein_id gnl|my_center|LOCUS_14070 1077 1466 gene locus_tag LOCUS_14080 1077 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence0988 1182 73 gene locus_tag LOCUS_14090 1182 73 CDS product tocopherol cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530023.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence0989 183 1019 gene locus_tag LOCUS_14100 183 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence0990 >Feature sequence0991 <1562 501 gene locus_tag LOCUS_14110 <1562 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014330482.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0992 <1561 68 gene locus_tag LOCUS_14120 <1561 68 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056087.1:C-3',4' desaturase CrtD >Feature sequence0993 907 350 gene locus_tag LOCUS_14130 907 350 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056726.1 protein_id gnl|my_center|LOCUS_14130 1376 924 gene locus_tag LOCUS_14140 1376 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence0994 767 1294 gene locus_tag LOCUS_14150 767 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence0995 566 225 gene locus_tag LOCUS_14160 566 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 <1553 593 gene locus_tag LOCUS_14170 <1553 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888557.1:exonuclease SbcCD subunit SbcC >Feature sequence0996 1416 493 gene locus_tag LOCUS_14180 1416 493 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920721.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence0997 <1 1437 gene locus_tag LOCUS_14190 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198406273.1:DUF3370 domain-containing protein >Feature sequence0998 >Feature sequence0999 >Feature sequence1000 840 70 gene locus_tag LOCUS_14200 840 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence1001 584 222 gene locus_tag LOCUS_14210 584 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14210 1015 581 gene locus_tag LOCUS_14220 1015 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14220 >Feature sequence1002 <1 633 gene locus_tag LOCUS_14230 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256308.1:response regulator <1550 745 gene locus_tag LOCUS_14240 <1550 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000849131.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence1003 >Feature sequence1004 1241 210 gene locus_tag LOCUS_14250 gene gap 1241 210 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143315.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence1005 79 714 gene locus_tag LOCUS_14260 gene upp 79 714 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947952.1 protein_id gnl|my_center|LOCUS_14260 1034 1180 gene locus_tag LOCUS_14270 1034 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence1006 >Feature sequence1007 <1547 768 gene locus_tag LOCUS_14280 <1547 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141145.1:glycerol acyltransferase >Feature sequence1008 1213 338 gene locus_tag LOCUS_14290 gene crtB 1213 338 CDS product cyanoexosortase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214431335.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence1009 113 817 gene locus_tag LOCUS_14300 113 817 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485755.1 protein_id gnl|my_center|LOCUS_14300 823 1500 gene locus_tag LOCUS_14310 823 1500 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485755.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence1010 >Feature sequence1011 <1545 220 gene locus_tag LOCUS_14320 <1545 220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057447.1:glutathione-disulfide reductase >Feature sequence1012 389 1474 gene locus_tag LOCUS_14330 gene leuB 389 1474 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057439.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence1013 >Feature sequence1014 >Feature sequence1015 >Feature sequence1016 1422 469 gene locus_tag LOCUS_14340 1422 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence1017 >Feature sequence1018 >Feature sequence1019 233 541 gene locus_tag LOCUS_14350 233 541 CDS product DUF3493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143785.1 protein_id gnl|my_center|LOCUS_14350 859 1452 gene locus_tag LOCUS_14360 859 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence1020 <1 1357 gene locus_tag LOCUS_14370 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057081.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence1021 <1 1253 gene locus_tag LOCUS_14380 <1 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:EAL domain-containing protein >Feature sequence1022 1116 142 gene locus_tag LOCUS_14390 1116 142 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057199.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence1023 511 5 gene locus_tag LOCUS_14400 511 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798166.1 protein_id gnl|my_center|LOCUS_14400 801 1406 gene locus_tag LOCUS_14410 801 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence1024 292 681 gene locus_tag LOCUS_14420 292 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence1025 494 1186 gene locus_tag LOCUS_14430 494 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143480.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence1026 <1 1000 gene locus_tag LOCUS_14440 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021891.1:pentapeptide repeat-containing protein >Feature sequence1027 >Feature sequence1028 >Feature sequence1029 <1 1416 gene locus_tag LOCUS_14450 <1 1416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein >Feature sequence1030 >Feature sequence1031 248 175 gene locus_tag LOCUS_t00150 248 175 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 327 848 gene locus_tag LOCUS_14460 gene moaC 327 848 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971801.1 protein_id gnl|my_center|LOCUS_14460 937 1194 gene locus_tag LOCUS_14470 937 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence1032 <1530 98 gene locus_tag LOCUS_14480 <1530 98 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546422.1:elongation factor G >Feature sequence1033 <1529 942 gene locus_tag LOCUS_14490 <1529 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028126.1:Na+/H+ antiporter >Feature sequence1034 >Feature sequence1035 >Feature sequence1036 336 151 gene locus_tag LOCUS_14500 336 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1517 390 gene locus_tag LOCUS_14510 1517 390 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence1037 1396 167 gene locus_tag LOCUS_14520 gene tuf 1396 167 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057587.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence1038 1122 187 gene locus_tag LOCUS_14530 1122 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence1039 591 88 gene locus_tag LOCUS_14540 591 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 <1526 798 gene locus_tag LOCUS_14550 <1526 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920940.1:cobyrinate a,c-diamide synthase >Feature sequence1040 <1 1333 gene locus_tag LOCUS_14560 <1 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920781.1:ABC transporter ATP-binding protein >Feature sequence1041 1398 235 gene locus_tag LOCUS_14570 1398 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence1042 1141 530 gene locus_tag LOCUS_14580 1141 530 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105355.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence1043 329 568 gene locus_tag LOCUS_14590 329 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 537 764 gene locus_tag LOCUS_14600 537 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 906 1376 gene locus_tag LOCUS_14610 gene rpsG 906 1376 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057585.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence1044 <1520 395 gene locus_tag LOCUS_14620 <1520 395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024124637.1:photosystem II reaction center protein CP43 >Feature sequence1045 >Feature sequence1046 >Feature sequence1047 1147 68 gene locus_tag LOCUS_14630 gene fba 1147 68 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 protein_id gnl|my_center|LOCUS_14630 1413 1340 gene locus_tag LOCUS_t00160 1413 1340 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1048 380 144 gene locus_tag LOCUS_14640 380 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 <1520 639 gene locus_tag LOCUS_14650 <1520 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063921601.1:heavy metal translocating P-type ATPase >Feature sequence1049 >Feature sequence1050 <1 542 gene locus_tag LOCUS_14660 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142983.1:Uma2 family endonuclease 598 837 gene locus_tag LOCUS_14670 598 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 <1518 939 gene locus_tag LOCUS_14680 <1518 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141767.1:carbamoyl-phosphate synthase large subunit >Feature sequence1051 >Feature sequence1052 1207 896 gene locus_tag LOCUS_14690 1207 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143670.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence1053 <1516 485 gene locus_tag LOCUS_14700 <1516 485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057749.1:phosphoenolpyruvate carboxylase >Feature sequence1054 >Feature sequence1055 >Feature sequence1056 1164 166 gene locus_tag LOCUS_14710 gene fmt 1164 166 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406043.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence1057 >Feature sequence1058 155 1486 gene locus_tag LOCUS_14720 155 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence1059 1296 355 gene locus_tag LOCUS_14730 1296 355 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence1060 <1 713 gene locus_tag LOCUS_14740 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058182.1:DNA polymerase III subunit beta note possible pseudo, internal stop codon >Feature sequence1061 >Feature sequence1062 153 665 gene locus_tag LOCUS_14750 153 665 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057412.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence1063 >Feature sequence1064 246 1316 gene locus_tag LOCUS_14760 gene ccsB 246 1316 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057454.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence1065 >Feature sequence1066 <1 1335 gene locus_tag LOCUS_14770 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546440.1:efflux RND transporter periplasmic adaptor subunit note possible pseudo, internal stop codon >Feature sequence1067 1235 273 gene locus_tag LOCUS_14780 gene hemF 1235 273 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920736.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence1068 >Feature sequence1069 <1 639 gene locus_tag LOCUS_14790 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125785.1:Na+:solute symporter >Feature sequence1070 >Feature sequence1071 <1 1229 gene locus_tag LOCUS_14800 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase >Feature sequence1072 910 242 gene locus_tag LOCUS_14810 910 242 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143129.1 protein_id gnl|my_center|LOCUS_14810 1380 1090 gene locus_tag LOCUS_14820 1380 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence1073 1176 610 gene locus_tag LOCUS_14830 1176 610 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence1074 <1505 776 gene locus_tag LOCUS_14840 <1505 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057300.1:AAA-like domain-containing protein >Feature sequence1075 304 1305 gene locus_tag LOCUS_14850 304 1305 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence1076 >Feature sequence1077 >Feature sequence1078 >Feature sequence1079 1223 57 gene locus_tag LOCUS_14860 1223 57 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928444.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence1080 1417 71 gene locus_tag LOCUS_14870 1417 71 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143055.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence1081 >Feature sequence1082 1369 98 gene locus_tag LOCUS_14880 1369 98 CDS product FAD-dependent hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921015.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence1083 >Feature sequence1084 350 150 gene locus_tag LOCUS_14890 350 150 CDS product DUF2862 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence1085 1150 191 gene locus_tag LOCUS_14900 1150 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1397 1113 gene locus_tag LOCUS_14910 1397 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence1086 1164 532 gene locus_tag LOCUS_14920 1164 532 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928794.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence1087 >Feature sequence1088 >Feature sequence1089 408 1061 gene locus_tag LOCUS_14930 408 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence1090 1065 130 gene locus_tag LOCUS_14940 1065 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14940 >Feature sequence1091 >Feature sequence1092 380 30 gene locus_tag LOCUS_14950 380 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 <1488 536 gene locus_tag LOCUS_14960 <1488 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056847.1:DUF697 domain-containing protein >Feature sequence1093 1134 1003 gene locus_tag LOCUS_14970 1134 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence1094 149 664 gene locus_tag LOCUS_14980 149 664 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889035.1 protein_id gnl|my_center|LOCUS_14980 914 1312 gene locus_tag LOCUS_14990 914 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence1095 <1 725 gene locus_tag LOCUS_15000 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142403.1:uracil-DNA glycosylase 1405 824 gene locus_tag LOCUS_15010 1405 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence1096 <1 1150 gene locus_tag LOCUS_15020 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057085.1:single-stranded-DNA-specific exonuclease RecJ 1412 1272 gene locus_tag LOCUS_15030 1412 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence1097 405 166 gene locus_tag LOCUS_15040 405 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 <1484 460 gene locus_tag LOCUS_15050 <1484 460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143008.1:methionine gamma-lyase family protein >Feature sequence1098 353 1225 gene locus_tag LOCUS_15060 353 1225 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence1099 945 733 gene locus_tag LOCUS_15070 945 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence1100 1421 165 gene locus_tag LOCUS_15080 1421 165 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence1101 >Feature sequence1102 242 1330 gene locus_tag LOCUS_15090 242 1330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence1103 <1482 753 gene locus_tag LOCUS_15100 <1482 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920966.1:nitrate ABC transporter ATP-binding protein >Feature sequence1104 >Feature sequence1105 723 1385 gene locus_tag LOCUS_15110 723 1385 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003150.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence1106 701 168 gene locus_tag LOCUS_15120 701 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 <1480 856 gene locus_tag LOCUS_15130 <1480 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055897.1:lysophospholipid acyltransferase family protein >Feature sequence1107 823 137 gene locus_tag LOCUS_15140 gene ispD 823 137 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056453.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence1108 60 1100 gene locus_tag LOCUS_15150 gene obgE 60 1100 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058186.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence1109 <1 1393 gene locus_tag LOCUS_15160 <1 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057868.1:excinuclease ABC subunit UvrB >Feature sequence1110 1061 54 gene locus_tag LOCUS_15170 1061 54 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence1111 <1479 419 gene locus_tag LOCUS_15180 <1479 419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143791.1:Hsp70 family protein >Feature sequence1112 >Feature sequence1113 <1 785 gene locus_tag LOCUS_15190 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_088894694.1:AarF/ABC1/UbiB kinase family protein >Feature sequence1114 >Feature sequence1115 951 178 gene locus_tag LOCUS_15200 gene pphC 951 178 CDS product protein-serine/threonine phosphatase PphC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119098.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence1116 146 1162 gene locus_tag LOCUS_15210 146 1162 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057591.1 protein_id gnl|my_center|LOCUS_15210 1257 1448 gene locus_tag LOCUS_15220 1257 1448 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057592.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence1117 >Feature sequence1118 >Feature sequence1119 1084 395 gene locus_tag LOCUS_15230 1084 395 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144237.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence1120 1394 585 gene locus_tag LOCUS_15240 1394 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15240 >Feature sequence1121 <1471 195 gene locus_tag LOCUS_15250 <1471 195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056623.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence1122 >Feature sequence1123 414 193 gene locus_tag LOCUS_15260 414 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 666 594 gene locus_tag LOCUS_t00170 666 594 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1124 35 1177 gene locus_tag LOCUS_15270 35 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence1125 >Feature sequence1126 681 103 gene locus_tag LOCUS_15280 681 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1043 1324 gene locus_tag LOCUS_15290 1043 1324 CDS product DUF565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence1127 634 1023 gene locus_tag LOCUS_15300 634 1023 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_15300 1132 1419 gene locus_tag LOCUS_15310 1132 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence1128 1340 309 gene locus_tag LOCUS_15320 1340 309 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence1129 >Feature sequence1130 343 1338 gene locus_tag LOCUS_15330 343 1338 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence1131 <1467 85 gene locus_tag LOCUS_15340 <1467 85 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037121.1:ATP-binding protein >Feature sequence1132 <1465 687 gene locus_tag LOCUS_15350 <1465 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056834.1:formate C-acetyltransferase >Feature sequence1133 >Feature sequence1134 558 860 gene locus_tag LOCUS_15360 gene ureA 558 860 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 protein_id gnl|my_center|LOCUS_15360 894 1205 gene locus_tag LOCUS_15370 894 1205 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence1135 562 1230 gene locus_tag LOCUS_15380 562 1230 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142596.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence1136 154 834 gene locus_tag LOCUS_15390 gene lipB 154 834 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056676.1 protein_id gnl|my_center|LOCUS_15390 1074 880 gene locus_tag LOCUS_15400 1074 880 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829211.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence1137 >Feature sequence1138 <1459 832 gene locus_tag LOCUS_15410 <1459 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061641.1:calcium-binding protein >Feature sequence1139 >Feature sequence1140 >Feature sequence1141 1272 529 gene locus_tag LOCUS_15420 1272 529 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007353051.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence1142 >Feature sequence1143 >Feature sequence1144 >Feature sequence1145 277 900 gene locus_tag LOCUS_15430 277 900 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_15430 1043 1324 gene locus_tag LOCUS_15440 1043 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480013.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence1146 1115 498 gene locus_tag LOCUS_15450 1115 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence1147 122 634 gene locus_tag LOCUS_15460 122 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence1148 129 1262 gene locus_tag LOCUS_15470 129 1262 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073716.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence1149 >Feature sequence1150 >Feature sequence1151 137 334 gene locus_tag LOCUS_15480 137 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence1152 226 23 gene locus_tag LOCUS_15490 226 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057514.1 protein_id gnl|my_center|LOCUS_15490 783 223 gene locus_tag LOCUS_15500 gene def 783 223 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057513.1 protein_id gnl|my_center|LOCUS_15500 885 1397 gene locus_tag LOCUS_15510 885 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence1153 >Feature sequence1154 1130 186 gene locus_tag LOCUS_15520 gene speE 1130 186 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978308.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence1155 304 879 gene locus_tag LOCUS_15530 304 879 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence1156 382 1128 gene locus_tag LOCUS_15540 382 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15540 >Feature sequence1157 >Feature sequence1158 1326 121 gene locus_tag LOCUS_15550 1326 121 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390740.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence1159 <1447 143 gene locus_tag LOCUS_15560 <1447 143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957840.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence1160 1399 113 gene locus_tag LOCUS_15570 1399 113 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682315.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence1161 >Feature sequence1162 >Feature sequence1163 22 627 gene locus_tag LOCUS_15580 22 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1263 637 gene locus_tag LOCUS_15590 1263 637 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence1164 >Feature sequence1165 >Feature sequence1166 <1 767 gene locus_tag LOCUS_15600 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972257.1:MFS transporter >Feature sequence1167 >Feature sequence1168 517 1062 gene locus_tag LOCUS_15610 517 1062 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928651.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence1169 >Feature sequence1170 74 955 gene locus_tag LOCUS_15620 74 955 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence1171 833 1135 gene locus_tag LOCUS_15630 833 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence1172 >Feature sequence1173 <1 1399 gene locus_tag LOCUS_15640 <1 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921237.1:HAMP domain-containing sensor histidine kinase >Feature sequence1174 68 664 gene locus_tag LOCUS_15650 68 664 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_15650 757 1251 gene locus_tag LOCUS_15660 757 1251 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137906819.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence1175 >Feature sequence1176 <1434 265 gene locus_tag LOCUS_15670 <1434 265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920652.1:ABC transporter ATP-binding protein/permease 796 726 gene locus_tag LOCUS_t00180 796 726 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1177 70 270 gene locus_tag LOCUS_15680 70 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 761 513 gene locus_tag LOCUS_15690 761 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153852.1 protein_id gnl|my_center|LOCUS_15690 1267 923 gene locus_tag LOCUS_15700 1267 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence1178 >Feature sequence1179 >Feature sequence1180 1430 120 gene locus_tag LOCUS_15710 1430 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence1181 154 1248 gene locus_tag LOCUS_15720 154 1248 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence1182 31 1380 gene locus_tag LOCUS_15730 31 1380 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057595.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence1183 >Feature sequence1184 437 718 gene locus_tag LOCUS_15740 437 718 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921010.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence1185 995 1339 gene locus_tag LOCUS_15750 995 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence1186 >Feature sequence1187 46 1323 gene locus_tag LOCUS_15760 46 1323 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140772.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence1188 >Feature sequence1189 1164 91 gene locus_tag LOCUS_15770 1164 91 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence1190 644 213 gene locus_tag LOCUS_15780 644 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence1191 >Feature sequence1192 580 284 gene locus_tag LOCUS_15790 580 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1019 609 gene locus_tag LOCUS_15800 1019 609 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence1193 1298 1131 gene locus_tag LOCUS_15810 1298 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence1194 198 1358 gene locus_tag LOCUS_15820 198 1358 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence1195 272 33 gene locus_tag LOCUS_15830 272 33 CDS product KGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437768.1 protein_id gnl|my_center|LOCUS_15830 <1421 702 gene locus_tag LOCUS_15840 <1421 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056364.1:Fe(3+) ABC transporter substrate-binding protein >Feature sequence1196 <1420 34 gene locus_tag LOCUS_15850 <1420 34 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057909.1:penicillin-binding protein 2 >Feature sequence1197 126 1238 gene locus_tag LOCUS_15860 gene rseP 126 1238 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057479.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence1198 >Feature sequence1199 857 312 gene locus_tag LOCUS_15870 857 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence1200 1147 671 gene locus_tag LOCUS_15880 1147 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence1201 1082 189 gene locus_tag LOCUS_15890 1082 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence1202 1201 701 gene locus_tag LOCUS_15900 1201 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15900 1417 1202 gene locus_tag LOCUS_15910 1417 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence1203 <1416 793 gene locus_tag LOCUS_15920 <1416 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057103.1:response regulator transcription factor >Feature sequence1204 1416 322 gene locus_tag LOCUS_15930 1416 322 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057917.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence1205 109 1065 gene locus_tag LOCUS_15940 gene era 109 1065 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055911.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence1206 190 489 gene locus_tag LOCUS_15950 190 489 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261920.1 protein_id gnl|my_center|LOCUS_15950 605 1411 gene locus_tag LOCUS_15960 605 1411 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence1207 281 1381 gene locus_tag LOCUS_15970 281 1381 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence1208 >Feature sequence1209 <1 1254 gene locus_tag LOCUS_15980 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057931.1:D-alanyl-D-alanine carboxypeptidase >Feature sequence1210 >Feature sequence1211 256 1362 gene locus_tag LOCUS_15990 256 1362 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence1212 660 1007 gene locus_tag LOCUS_16000 660 1007 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence1213 >Feature sequence1214 390 1112 gene locus_tag LOCUS_16010 gene sfsA 390 1112 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141732.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence1215 >Feature sequence1216 >Feature sequence1217 926 1132 gene locus_tag LOCUS_16020 926 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence1218 >Feature sequence1219 1276 1118 gene locus_tag LOCUS_16030 1276 1118 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459942.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence1220 >Feature sequence1221 773 189 gene locus_tag LOCUS_16040 773 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16040 >Feature sequence1222 >Feature sequence1223 <1404 712 gene locus_tag LOCUS_16050 <1404 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056887.1:sulfate adenylyltransferase >Feature sequence1224 125 397 gene locus_tag LOCUS_16060 125 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16060 424 1209 gene locus_tag LOCUS_16070 424 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16070 >Feature sequence1225 502 1089 gene locus_tag LOCUS_16080 502 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence1226 952 689 gene locus_tag LOCUS_16090 gene grxC 952 689 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence1227 498 1346 gene locus_tag LOCUS_16100 498 1346 CDS product DUF3598 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141575.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence1228 <1402 484 gene locus_tag LOCUS_16110 <1402 484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057991.1:prolipoprotein diacylglyceryl transferase >Feature sequence1229 111 1325 gene locus_tag LOCUS_16120 111 1325 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence1230 143 1369 gene locus_tag LOCUS_16130 143 1369 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056182.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence1231 >Feature sequence1232 429 112 gene locus_tag LOCUS_16140 429 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence1233 1107 52 gene locus_tag LOCUS_16150 1107 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence1234 >Feature sequence1235 >Feature sequence1236 1155 859 gene locus_tag LOCUS_16160 1155 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence1237 <1 891 gene locus_tag LOCUS_16170 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920905.1:YaaW family protein >Feature sequence1238 405 70 gene locus_tag LOCUS_16180 405 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 <1397 772 gene locus_tag LOCUS_16190 <1397 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140727.1:caspase family protein >Feature sequence1239 >Feature sequence1240 >Feature sequence1241 <1395 208 gene locus_tag LOCUS_16200 <1395 208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939279.1:cation-transporting P-type ATPase >Feature sequence1242 1173 142 gene locus_tag LOCUS_16210 gene obgE 1173 142 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058186.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence1243 3 920 gene locus_tag LOCUS_16220 3 920 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056369.1 protein_id gnl|my_center|LOCUS_16220 960 1136 gene locus_tag LOCUS_16230 960 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence1244 87 350 gene locus_tag LOCUS_16240 87 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16240 592 1182 gene locus_tag LOCUS_16250 592 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence1245 >Feature sequence1246 >Feature sequence1247 <1 1180 gene locus_tag LOCUS_16260 <1 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058224.1:ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B >Feature sequence1248 >Feature sequence1249 274 113 gene locus_tag LOCUS_16270 274 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 800 528 gene locus_tag LOCUS_16280 800 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1172 912 gene locus_tag LOCUS_16290 1172 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence1250 407 1267 gene locus_tag LOCUS_16300 407 1267 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063667.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence1251 >Feature sequence1252 757 227 gene locus_tag LOCUS_16310 757 227 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142303.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence1253 >Feature sequence1254 >Feature sequence1255 <1389 759 gene locus_tag LOCUS_16320 <1389 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057154.1:nucleotide exchange factor GrpE >Feature sequence1256 >Feature sequence1257 1159 89 gene locus_tag LOCUS_16330 1159 89 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_16330 1323 1156 gene locus_tag LOCUS_16340 1323 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16340 >Feature sequence1258 169 1221 gene locus_tag LOCUS_16350 169 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence1259 115 963 gene locus_tag LOCUS_16360 115 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence1260 645 133 gene locus_tag LOCUS_16370 645 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence1261 1240 278 gene locus_tag LOCUS_16380 1240 278 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143508.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence1262 >Feature sequence1263 >Feature sequence1264 1048 461 gene locus_tag LOCUS_16390 1048 461 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence1265 >Feature sequence1266 >Feature sequence1267 >Feature sequence1268 >Feature sequence1269 <1381 510 gene locus_tag LOCUS_16400 <1381 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057735.1:histidine--tRNA ligase >Feature sequence1270 1305 646 gene locus_tag LOCUS_16410 gene tsf 1305 646 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124978.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence1271 651 70 gene locus_tag LOCUS_16420 651 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 709 1347 gene locus_tag LOCUS_16430 709 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence1272 1145 60 gene locus_tag LOCUS_16440 1145 60 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence1273 >Feature sequence1274 1187 114 gene locus_tag LOCUS_16450 1187 114 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence1275 >Feature sequence1276 <1377 222 gene locus_tag LOCUS_16460 <1377 222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057171.1:8-amino-7-oxononanoate synthase >Feature sequence1277 630 1229 gene locus_tag LOCUS_16470 630 1229 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116682.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence1278 <1376 94 gene locus_tag LOCUS_16480 <1376 94 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056292.1:ATP-binding protein >Feature sequence1279 <1375 730 gene locus_tag LOCUS_16490 <1375 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169047059.1:putative selenate ABC transporter substrate-binding protein >Feature sequence1280 >Feature sequence1281 273 100 gene locus_tag LOCUS_16500 273 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 885 382 gene locus_tag LOCUS_16510 885 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence1282 >Feature sequence1283 >Feature sequence1284 1155 451 gene locus_tag LOCUS_16520 1155 451 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence1285 1244 300 gene locus_tag LOCUS_16530 gene pstC 1244 300 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence1286 <1372 132 gene locus_tag LOCUS_16540 <1372 132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056871.1:glycoside hydrolase family protein >Feature sequence1287 187 807 gene locus_tag LOCUS_16550 187 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 823 1041 gene locus_tag LOCUS_16560 823 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence1288 1121 321 gene locus_tag LOCUS_16570 1121 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence1289 613 1131 gene locus_tag LOCUS_16580 613 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16580 >Feature sequence1290 <1 1175 gene locus_tag LOCUS_16590 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391699.1:lysine--tRNA ligase >Feature sequence1291 >Feature sequence1292 <1367 195 gene locus_tag LOCUS_16600 <1367 195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920751.1:thioredoxin domain-containing protein >Feature sequence1293 >Feature sequence1294 50 1165 gene locus_tag LOCUS_16610 gene trpD 50 1165 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057551.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence1295 >Feature sequence1296 830 357 gene locus_tag LOCUS_16620 830 357 CDS product PAM68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124904.1 protein_id gnl|my_center|LOCUS_16620 1195 926 gene locus_tag LOCUS_16630 gene rpsO 1195 926 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144014.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence1297 <1 588 gene locus_tag LOCUS_16640 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144255.1:bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase 660 1169 gene locus_tag LOCUS_16650 660 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence1298 >Feature sequence1299 693 151 gene locus_tag LOCUS_16660 693 151 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056803.1 protein_id gnl|my_center|LOCUS_16660 908 1225 gene locus_tag LOCUS_16670 908 1225 CDS product DUF3067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence1300 <1 580 gene locus_tag LOCUS_16680 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001031846.1:molybdate ABC transporter substrate-binding protein >Feature sequence1301 1158 22 gene locus_tag LOCUS_16690 1158 22 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence1302 <1 575 gene locus_tag LOCUS_16700 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056976.1:photosystem II biogenesis protein Psp29 >Feature sequence1303 >Feature sequence1304 <1 1244 gene locus_tag LOCUS_16710 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057580.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence1305 933 232 gene locus_tag LOCUS_16720 933 232 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143841.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence1306 >Feature sequence1307 >Feature sequence1308 >Feature sequence1309 >Feature sequence1310 >Feature sequence1311 >Feature sequence1312 >Feature sequence1313 <1 1198 gene locus_tag LOCUS_16730 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799036.1:histidine kinase dimerization/phospho-acceptor domain-containing protein >Feature sequence1314 1193 747 gene locus_tag LOCUS_16740 gene rplO 1193 747 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055953.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence1315 >Feature sequence1316 <1351 809 gene locus_tag LOCUS_16750 <1351 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056180.1:phosphoglycerate dehydrogenase >Feature sequence1317 >Feature sequence1318 1348 155 gene locus_tag LOCUS_16760 1348 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence1319 455 784 gene locus_tag LOCUS_16770 455 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056249.1 protein_id gnl|my_center|LOCUS_16770 1212 910 gene locus_tag LOCUS_16780 gene rpsN 1212 910 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057663.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence1320 >Feature sequence1321 >Feature sequence1322 <1348 83 gene locus_tag LOCUS_16790 <1348 83 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141636.1:ergothioneine biosynthesis protein EgtB >Feature sequence1323 103 390 gene locus_tag LOCUS_16800 103 390 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_16800 1147 659 gene locus_tag LOCUS_16810 1147 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence1324 <1347 289 gene locus_tag LOCUS_16820 <1347 289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010977998.1:selenium-binding family protein >Feature sequence1325 <1 879 gene locus_tag LOCUS_16830 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057885.1:aspartate aminotransferase >Feature sequence1326 <1347 524 gene locus_tag LOCUS_16840 <1347 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057437.1:DUF3352 domain-containing protein >Feature sequence1327 745 5 gene locus_tag LOCUS_16850 gene urtD 745 5 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_16850 <1346 773 gene locus_tag LOCUS_16860 <1346 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056964.1:urea ABC transporter permease subunit UrtC >Feature sequence1328 <1 811 gene locus_tag LOCUS_16870 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003406369.1:amidase >Feature sequence1329 1096 140 gene locus_tag LOCUS_16880 1096 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence1330 1173 415 gene locus_tag LOCUS_16890 gene fghA 1173 415 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144409.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence1331 179 787 gene locus_tag LOCUS_16900 179 787 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530085.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence1332 <1344 205 gene locus_tag LOCUS_16910 <1344 205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056426.1:1,4-alpha-glucan branching enzyme >Feature sequence1333 >Feature sequence1334 >Feature sequence1335 <1343 507 gene locus_tag LOCUS_16920 <1343 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064913.1:threonine ammonia-lyase, biosynthetic >Feature sequence1336 >Feature sequence1337 >Feature sequence1338 >Feature sequence1339 <1 859 gene locus_tag LOCUS_16930 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401213.1:nicotinamide-nucleotide adenylyltransferase >Feature sequence1340 <1341 415 gene locus_tag LOCUS_16940 <1341 415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056634.1:molecular chaperone DnaK >Feature sequence1341 <1 1100 gene locus_tag LOCUS_16950 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143062.1:FAD-linked oxidase C-terminal domain-containing protein >Feature sequence1342 360 1325 gene locus_tag LOCUS_16960 360 1325 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence1343 230 1048 gene locus_tag LOCUS_16970 230 1048 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence1344 >Feature sequence1345 <1337 220 gene locus_tag LOCUS_16980 <1337 220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799340.1:putative peptidoglycan glycosyltransferase FtsW >Feature sequence1346 <1 839 gene locus_tag LOCUS_16990 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056556.1:pentapeptide repeat-containing protein 897 1229 gene locus_tag LOCUS_17000 897 1229 CDS product DUF2834 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892290.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence1347 >Feature sequence1348 <1336 402 gene locus_tag LOCUS_17010 <1336 402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039654.1:pentapeptide repeat-containing protein >Feature sequence1349 <1 1193 gene locus_tag LOCUS_17020 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000270702.1:KdpD-like non-kinase potassium sensor >Feature sequence1350 346 573 gene locus_tag LOCUS_17030 346 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence1351 2 256 gene locus_tag LOCUS_17040 2 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence1352 1332 418 gene locus_tag LOCUS_17050 1332 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence1353 387 956 gene locus_tag LOCUS_17060 387 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17060 >Feature sequence1354 169 1119 gene locus_tag LOCUS_17070 169 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17070 >Feature sequence1355 >Feature sequence1356 220 1119 gene locus_tag LOCUS_17080 220 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence1357 1328 9 gene locus_tag LOCUS_17090 1328 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence1358 >Feature sequence1359 >Feature sequence1360 >Feature sequence1361 >Feature sequence1362 <1 1002 gene locus_tag LOCUS_17100 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058209.1:adenosylcobinamide-phosphate synthase CbiB >Feature sequence1363 <1326 157 gene locus_tag LOCUS_17110 <1326 157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124536.1:DUF2079 domain-containing protein >Feature sequence1364 57 776 gene locus_tag LOCUS_17120 57 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence1365 369 154 gene locus_tag LOCUS_17130 gene ndhL 369 154 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056553.1 protein_id gnl|my_center|LOCUS_17130 566 650 gene locus_tag LOCUS_t00190 566 650 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1366 <1325 58 gene locus_tag LOCUS_17140 <1325 58 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence1367 648 430 gene locus_tag LOCUS_17150 648 430 CDS product DUF3285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057423.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence1368 1324 791 gene locus_tag LOCUS_17160 1324 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence1369 1134 148 gene locus_tag LOCUS_17170 1134 148 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence1370 1009 230 gene locus_tag LOCUS_17180 1009 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence1371 800 78 gene locus_tag LOCUS_17190 800 78 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403082.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence1372 1189 113 gene locus_tag LOCUS_17200 gene acsF 1189 113 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920870.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence1373 1114 383 gene locus_tag LOCUS_17210 1114 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence1374 168 1304 gene locus_tag LOCUS_17220 168 1304 CDS product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence1375 >Feature sequence1376 183 602 gene locus_tag LOCUS_17230 183 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 protein_id gnl|my_center|LOCUS_17230 1203 781 gene locus_tag LOCUS_17240 1203 781 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143244.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence1377 >Feature sequence1378 >Feature sequence1379 409 1146 gene locus_tag LOCUS_17250 409 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence1380 >Feature sequence1381 258 989 gene locus_tag LOCUS_17260 258 989 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920693.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence1382 <1315 175 gene locus_tag LOCUS_17270 <1315 175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225863.1:BTAD domain-containing putative transcriptional regulator >Feature sequence1383 370 1239 gene locus_tag LOCUS_17280 370 1239 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence1384 >Feature sequence1385 718 134 gene locus_tag LOCUS_17290 718 134 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789400.1 protein_id gnl|my_center|LOCUS_17290 <1314 724 gene locus_tag LOCUS_17300 <1314 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055954.1:preprotein translocase subunit SecY >Feature sequence1386 >Feature sequence1387 >Feature sequence1388 1125 235 gene locus_tag LOCUS_17310 1125 235 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence1389 <1 1144 gene locus_tag LOCUS_17320 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140637.1:hybrid sensor histidine kinase/response regulator >Feature sequence1390 254 48 gene locus_tag LOCUS_17330 254 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 437 619 gene locus_tag LOCUS_17340 437 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence1391 >Feature sequence1392 >Feature sequence1393 248 394 gene locus_tag LOCUS_17350 248 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence1394 659 447 gene locus_tag LOCUS_17360 gene thiS 659 447 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056654.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence1395 >Feature sequence1396 1239 223 gene locus_tag LOCUS_17370 1239 223 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683574.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence1397 1119 739 gene locus_tag LOCUS_17380 1119 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence1398 <1310 120 gene locus_tag LOCUS_17390 <1310 120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225866392.1:excinuclease ABC subunit UvrA >Feature sequence1399 >Feature sequence1400 >Feature sequence1401 944 228 gene locus_tag LOCUS_17400 gene rplA 944 228 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056151.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence1402 118 945 gene locus_tag LOCUS_17410 118 945 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142046.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence1403 >Feature sequence1404 595 1041 gene locus_tag LOCUS_17420 595 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1263 1072 gene locus_tag LOCUS_17430 1263 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence1405 <1 1257 gene locus_tag LOCUS_17440 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963645.1:EAL domain-containing protein >Feature sequence1406 >Feature sequence1407 >Feature sequence1408 >Feature sequence1409 824 48 gene locus_tag LOCUS_17450 824 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence1410 1142 642 gene locus_tag LOCUS_17460 1142 642 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence1411 400 107 gene locus_tag LOCUS_17470 400 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence1412 <1303 524 gene locus_tag LOCUS_17480 <1303 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528461.1:LLM class flavin-dependent oxidoreductase >Feature sequence1413 665 1027 gene locus_tag LOCUS_17490 665 1027 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence1414 93 1109 gene locus_tag LOCUS_17500 93 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence1415 >Feature sequence1416 97 216 gene locus_tag LOCUS_17510 97 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 237 527 gene locus_tag LOCUS_17520 237 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 897 1172 gene locus_tag LOCUS_17530 897 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence1417 >Feature sequence1418 >Feature sequence1419 480 64 gene locus_tag LOCUS_17540 480 64 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932411.1 protein_id gnl|my_center|LOCUS_17540 <1298 767 gene locus_tag LOCUS_17550 <1298 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057830.1:M1 family metallopeptidase >Feature sequence1420 >Feature sequence1421 243 641 gene locus_tag LOCUS_17560 243 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence1422 458 168 gene locus_tag LOCUS_17570 458 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1172 501 gene locus_tag LOCUS_17580 1172 501 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence1423 <1295 487 gene locus_tag LOCUS_17590 <1295 487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057141.1:AMP-binding protein >Feature sequence1424 >Feature sequence1425 1272 121 gene locus_tag LOCUS_17600 gene dprA 1272 121 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920872.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence1426 <1 518 gene locus_tag LOCUS_17610 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055935.1:tRNA guanosine(34) transglycosylase Tgt 579 716 gene locus_tag LOCUS_17620 579 716 CDS product photosystem II reaction center protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799777.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence1427 >Feature sequence1428 192 959 gene locus_tag LOCUS_17630 192 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence1429 <1 1136 gene locus_tag LOCUS_17640 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058108.1:pyruvate kinase >Feature sequence1430 <1 1087 gene locus_tag LOCUS_17650 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000422278.1:FMNH2-dependent alkanesulfonate monooxygenase >Feature sequence1431 >Feature sequence1432 908 249 gene locus_tag LOCUS_17660 908 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence1433 764 1273 gene locus_tag LOCUS_17670 764 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence1434 >Feature sequence1435 581 1048 gene locus_tag LOCUS_17680 581 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence1436 <1290 99 gene locus_tag LOCUS_17690 <1290 99 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103760.1:ATP-binding protein >Feature sequence1437 318 521 gene locus_tag LOCUS_17700 318 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 protein_id gnl|my_center|LOCUS_17700 881 1174 gene locus_tag LOCUS_17710 881 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057054.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence1438 <1 1269 gene locus_tag LOCUS_17720 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056145.1:glycoside hydrolase family 38 C-terminal domain-containing protein >Feature sequence1439 245 84 gene locus_tag LOCUS_17730 245 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 735 502 gene locus_tag LOCUS_17740 735 502 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141619.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence1440 >Feature sequence1441 <1 963 gene locus_tag LOCUS_17750 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258514.1:FHA domain-containing protein >Feature sequence1442 324 923 gene locus_tag LOCUS_17760 324 923 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence1443 >Feature sequence1444 >Feature sequence1445 >Feature sequence1446 <1 1188 gene locus_tag LOCUS_17770 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058073.1:DNA mismatch repair protein MutS >Feature sequence1447 <1 1125 gene locus_tag LOCUS_17780 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920846.1:FGGY-family carbohydrate kinase >Feature sequence1448 >Feature sequence1449 113 1123 gene locus_tag LOCUS_17790 113 1123 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence1450 >Feature sequence1451 >Feature sequence1452 <1284 728 gene locus_tag LOCUS_17800 <1284 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055856.1:zinc-dependent alcohol dehydrogenase family protein >Feature sequence1453 >Feature sequence1454 1283 30 gene locus_tag LOCUS_17810 1283 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence1455 <1282 168 gene locus_tag LOCUS_17820 <1282 168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056385.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG >Feature sequence1456 >Feature sequence1457 366 827 gene locus_tag LOCUS_17830 366 827 CDS product photosystem I reaction center subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057561.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence1458 3 938 gene locus_tag LOCUS_17840 3 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence1459 >Feature sequence1460 34 408 gene locus_tag LOCUS_17850 34 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 401 742 gene locus_tag LOCUS_17860 401 742 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142285.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence1461 <1 990 gene locus_tag LOCUS_17870 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876948.1:diaminopimelate decarboxylase >Feature sequence1462 <1 1014 gene locus_tag LOCUS_17880 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057582.1:leucyl aminopeptidase >Feature sequence1463 347 81 gene locus_tag LOCUS_17890 347 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence1464 844 44 gene locus_tag LOCUS_17900 gene pstB 844 44 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124749.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence1465 1277 513 gene locus_tag LOCUS_17910 1277 513 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence1466 >Feature sequence1467 <1277 172 gene locus_tag LOCUS_17920 <1277 172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140787.1:hemolysin family protein >Feature sequence1468 >Feature sequence1469 687 271 gene locus_tag LOCUS_17930 687 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence1470 >Feature sequence1471 <1276 51 gene locus_tag LOCUS_17940 <1276 51 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762567.1:AmpG family muropeptide MFS transporter >Feature sequence1472 139 597 gene locus_tag LOCUS_17950 139 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 <1275 598 gene locus_tag LOCUS_17960 <1275 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920840.1:ATP-dependent sacrificial sulfur transferase LarE >Feature sequence1473 >Feature sequence1474 265 930 gene locus_tag LOCUS_17970 265 930 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064926.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence1475 >Feature sequence1476 >Feature sequence1477 <1274 438 gene locus_tag LOCUS_17980 <1274 438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141063.1:CHAT domain-containing protein >Feature sequence1478 >Feature sequence1479 <1 760 gene locus_tag LOCUS_17990 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920935.1:acetolactate synthase large subunit >Feature sequence1480 <1 1177 gene locus_tag LOCUS_18000 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056119.1:RNA polymerase sigma factor, RpoD/SigA family >Feature sequence1481 >Feature sequence1482 <1271 263 gene locus_tag LOCUS_18010 <1271 263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799709.1:radical SAM family heme chaperone HemW >Feature sequence1483 >Feature sequence1484 646 1002 gene locus_tag LOCUS_18020 646 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence1485 128 1072 gene locus_tag LOCUS_18030 gene uvsE 128 1072 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350019.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence1486 >Feature sequence1487 1268 48 gene locus_tag LOCUS_18040 1268 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence1488 382 1128 gene locus_tag LOCUS_18050 gene uppS 382 1128 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920928.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence1489 270 848 gene locus_tag LOCUS_18060 270 848 CDS product DUF1997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence1490 >Feature sequence1491 32 970 gene locus_tag LOCUS_18070 32 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence1492 >Feature sequence1493 >Feature sequence1494 1006 83 gene locus_tag LOCUS_18080 1006 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence1495 <1266 197 gene locus_tag LOCUS_18090 <1266 197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057605.1:polysaccharide biosynthesis/export family protein >Feature sequence1496 1 213 gene locus_tag LOCUS_18100 1 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 203 373 gene locus_tag LOCUS_18110 203 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence1497 56 853 gene locus_tag LOCUS_18120 56 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence1498 >Feature sequence1499 >Feature sequence1500 >Feature sequence1501 >Feature sequence1502 538 885 gene locus_tag LOCUS_18130 538 885 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_18130 863 1171 gene locus_tag LOCUS_18140 863 1171 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence1503 <1262 545 gene locus_tag LOCUS_18150 <1262 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225190.1:ZIP family zinc transporter >Feature sequence1504 >Feature sequence1505 >Feature sequence1506 465 1133 gene locus_tag LOCUS_18160 465 1133 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence1507 <1 1256 gene locus_tag LOCUS_18170 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056203.1:methyl-accepting chemotaxis protein >Feature sequence1508 >Feature sequence1509 >Feature sequence1510 615 767 gene locus_tag LOCUS_18180 615 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence1511 >Feature sequence1512 >Feature sequence1513 >Feature sequence1514 1100 78 gene locus_tag LOCUS_18190 1100 78 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence1515 66 698 gene locus_tag LOCUS_18200 gene rplD 66 698 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055937.1 protein_id gnl|my_center|LOCUS_18200 691 999 gene locus_tag LOCUS_18210 691 999 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055938.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence1516 >Feature sequence1517 >Feature sequence1518 <1 639 gene locus_tag LOCUS_18220 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144388.1:DUF87 domain-containing protein >Feature sequence1519 362 36 gene locus_tag LOCUS_18230 362 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144163.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence1520 197 1060 gene locus_tag LOCUS_18240 gene rplB 197 1060 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055939.1 protein_id gnl|my_center|LOCUS_18240 1253 1131 gene locus_tag LOCUS_18250 1253 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence1521 >Feature sequence1522 997 239 gene locus_tag LOCUS_18260 997 239 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057799.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence1523 >Feature sequence1524 >Feature sequence1525 <1 1023 gene locus_tag LOCUS_18270 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056617.1:DMT family transporter >Feature sequence1526 1231 758 gene locus_tag LOCUS_18280 1231 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence1527 <1250 216 gene locus_tag LOCUS_18290 <1250 216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165442178.1:glutamate-5-semialdehyde dehydrogenase >Feature sequence1528 1099 188 gene locus_tag LOCUS_18300 1099 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence1529 >Feature sequence1530 >Feature sequence1531 249 641 gene locus_tag LOCUS_18310 249 641 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_18310 1249 710 gene locus_tag LOCUS_18320 1249 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence1532 <1249 215 gene locus_tag LOCUS_18330 <1249 215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143795.1:AAA family ATPase >Feature sequence1533 1246 50 gene locus_tag LOCUS_18340 1246 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence1534 >Feature sequence1535 209 1039 gene locus_tag LOCUS_18350 209 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence1536 >Feature sequence1537 >Feature sequence1538 >Feature sequence1539 <1 1020 gene locus_tag LOCUS_18360 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence1540 <1 821 gene locus_tag LOCUS_18370 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056320.1:transaldolase >Feature sequence1541 <1 1033 gene locus_tag LOCUS_18380 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143279.1:helix-hairpin-helix domain-containing protein >Feature sequence1542 149 1186 gene locus_tag LOCUS_18390 149 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence1543 1 1182 gene locus_tag LOCUS_18400 1 1182 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence1544 >Feature sequence1545 >Feature sequence1546 <1243 438 gene locus_tag LOCUS_18410 <1243 438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111546765.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence1547 565 1239 gene locus_tag LOCUS_18420 565 1239 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence1548 >Feature sequence1549 551 312 gene locus_tag LOCUS_18430 551 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18430 >Feature sequence1550 <1242 50 gene locus_tag LOCUS_18440 <1242 50 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143056.1:cytochrome P450 >Feature sequence1551 1 462 gene locus_tag LOCUS_18450 1 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 533 1027 gene locus_tag LOCUS_18460 gene sixA 533 1027 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057106.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence1552 >Feature sequence1553 1242 19 gene locus_tag LOCUS_18470 1242 19 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056133.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence1554 >Feature sequence1555 >Feature sequence1556 928 371 gene locus_tag LOCUS_18480 928 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence1557 816 139 gene locus_tag LOCUS_18490 816 139 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence1558 >Feature sequence1559 >Feature sequence1560 607 299 gene locus_tag LOCUS_18500 gene rpsT 607 299 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057030.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence1561 404 36 gene locus_tag LOCUS_18510 404 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 513 1193 gene locus_tag LOCUS_18520 513 1193 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973715.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence1562 235 717 gene locus_tag LOCUS_18530 235 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18530 736 1104 gene locus_tag LOCUS_18540 736 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18540 >Feature sequence1563 418 828 gene locus_tag LOCUS_18550 418 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1124 840 gene locus_tag LOCUS_18560 1124 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18560 >Feature sequence1564 >Feature sequence1565 >Feature sequence1566 1008 274 gene locus_tag LOCUS_18570 1008 274 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence1567 654 1067 gene locus_tag LOCUS_18580 654 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence1568 <1235 204 gene locus_tag LOCUS_18590 <1235 204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056822.1:methionine adenosyltransferase >Feature sequence1569 <1235 99 gene locus_tag LOCUS_18600 <1235 99 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057504.1:apolipoprotein N-acyltransferase >Feature sequence1570 218 811 gene locus_tag LOCUS_18610 218 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence1571 >Feature sequence1572 630 1142 gene locus_tag LOCUS_18620 630 1142 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206947.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence1573 >Feature sequence1574 >Feature sequence1575 557 231 gene locus_tag LOCUS_18630 557 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1228 554 gene locus_tag LOCUS_18640 1228 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence1576 <1 730 gene locus_tag LOCUS_18650 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197524124.1:Sll0314/Alr1548 family TPR repeat-containing protein 746 1198 gene locus_tag LOCUS_18660 746 1198 CDS product DUF3531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence1577 <1 1006 gene locus_tag LOCUS_18670 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057229.1:ATP-dependent chaperone ClpB >Feature sequence1578 >Feature sequence1579 >Feature sequence1580 <1 847 gene locus_tag LOCUS_18680 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057246.1:S41 family peptidase >Feature sequence1581 >Feature sequence1582 <1230 264 gene locus_tag LOCUS_18690 <1230 264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141920.1:aromatic ring-hydroxylating dioxygenase subunit alpha >Feature sequence1583 >Feature sequence1584 1228 503 gene locus_tag LOCUS_18700 1228 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18700 >Feature sequence1585 <1 832 gene locus_tag LOCUS_18710 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928735.1:family 10 glycosylhydrolase 833 964 gene locus_tag LOCUS_18720 833 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence1586 131 844 gene locus_tag LOCUS_18730 131 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18730 1005 1202 gene locus_tag LOCUS_18740 1005 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence1587 <1227 582 gene locus_tag LOCUS_18750 <1227 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058186.1:GTPase ObgE >Feature sequence1588 <1227 92 gene locus_tag LOCUS_18760 <1227 92 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence1589 993 157 gene locus_tag LOCUS_18770 993 157 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence1590 563 1141 gene locus_tag LOCUS_18780 563 1141 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406022.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence1591 1224 421 gene locus_tag LOCUS_18790 1224 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence1592 <1 799 gene locus_tag LOCUS_18800 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053221433.1:serine/threonine-protein kinase >Feature sequence1593 <1 1047 gene locus_tag LOCUS_18810 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144168.1:chloride channel protein >Feature sequence1594 547 140 gene locus_tag LOCUS_18820 547 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1087 653 gene locus_tag LOCUS_18830 1087 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence1595 >Feature sequence1596 <1223 234 gene locus_tag LOCUS_18840 <1223 234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142080.1:NADH-quinone oxidoreductase subunit M >Feature sequence1597 <1 659 gene locus_tag LOCUS_18850 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390159.1:EAL domain-containing protein note possible pseudo, internal stop codon >Feature sequence1598 70 828 gene locus_tag LOCUS_18860 70 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence1599 <1 867 gene locus_tag LOCUS_18870 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056358.1:TIGR00300 family protein >Feature sequence1600 988 389 gene locus_tag LOCUS_18880 988 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence1601 >Feature sequence1602 >Feature sequence1603 158 757 gene locus_tag LOCUS_18890 158 757 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144068.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence1604 <1 935 gene locus_tag LOCUS_18900 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002936357.1:sugar transferase >Feature sequence1605 412 1020 gene locus_tag LOCUS_18910 412 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence1606 >Feature sequence1607 >Feature sequence1608 >Feature sequence1609 >Feature sequence1610 >Feature sequence1611 >Feature sequence1612 >Feature sequence1613 <1216 605 gene locus_tag LOCUS_18920 <1216 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057039.1:ABC transporter permease >Feature sequence1614 <1216 24 gene locus_tag LOCUS_18930 <1216 24 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057862.1:esterase-like activity of phytase family protein >Feature sequence1615 29 1123 gene locus_tag LOCUS_18940 gene trpD 29 1123 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057551.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence1616 <1214 13 gene locus_tag LOCUS_18950 <1214 13 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928424.1:alpha-mannosidase >Feature sequence1617 <1214 584 gene locus_tag LOCUS_18960 <1214 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140177.1:ABC transporter permease >Feature sequence1618 >Feature sequence1619 >Feature sequence1620 >Feature sequence1621 >Feature sequence1622 246 407 gene locus_tag LOCUS_18970 246 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 887 579 gene locus_tag LOCUS_18980 gene clpS 887 579 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056930.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence1623 <1 767 gene locus_tag LOCUS_18990 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973999.1:ABC transporter ATP-binding protein >Feature sequence1624 3 449 gene locus_tag LOCUS_19000 3 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence1625 >Feature sequence1626 340 258 gene locus_tag LOCUS_t00200 340 258 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1188 319 gene locus_tag LOCUS_19010 1188 319 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence1627 <1 575 gene locus_tag LOCUS_19020 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073210.1:mechanosensitive ion channel >Feature sequence1628 >Feature sequence1629 <1205 487 gene locus_tag LOCUS_19030 <1205 487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114023.1:precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE >Feature sequence1630 64 930 gene locus_tag LOCUS_19040 64 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19040 >Feature sequence1631 597 55 gene locus_tag LOCUS_19050 597 55 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166172348.1 protein_id gnl|my_center|LOCUS_19050 754 545 gene locus_tag LOCUS_19060 754 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence1632 1 429 gene locus_tag LOCUS_19070 1 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1042 581 gene locus_tag LOCUS_19080 1042 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence1633 >Feature sequence1634 172 738 gene locus_tag LOCUS_19090 172 738 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058121.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence1635 548 297 gene locus_tag LOCUS_19100 gene rpsQ 548 297 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055945.1 protein_id gnl|my_center|LOCUS_19100 782 555 gene locus_tag LOCUS_19110 gene rpmC 782 555 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143907.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence1636 1082 21 gene locus_tag LOCUS_19120 gene hppD 1082 21 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence1637 <1 527 gene locus_tag LOCUS_19130 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142146.1:ACT domain-containing protein >Feature sequence1638 >Feature sequence1639 1199 417 gene locus_tag LOCUS_19140 1199 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence1640 <1200 341 gene locus_tag LOCUS_19150 <1200 341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099798165.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence1641 1044 94 gene locus_tag LOCUS_19160 1044 94 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence1642 <1198 44 gene locus_tag LOCUS_19170 <1198 44 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921151.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence1643 >Feature sequence1644 >Feature sequence1645 458 1048 gene locus_tag LOCUS_19180 gene rdgB 458 1048 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057634.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence1646 727 119 gene locus_tag LOCUS_19190 727 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence1647 979 302 gene locus_tag LOCUS_19200 gene surE 979 302 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence1648 >Feature sequence1649 401 1123 gene locus_tag LOCUS_19210 401 1123 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143369.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence1650 102 344 gene locus_tag LOCUS_19220 102 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence1651 <1 1124 gene locus_tag LOCUS_19230 <1 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057517.1:Ppx/GppA phosphatase family protein >Feature sequence1652 409 1170 gene locus_tag LOCUS_19240 409 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19240 >Feature sequence1653 <1 1011 gene locus_tag LOCUS_19250 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799131.1:EAL domain-containing protein >Feature sequence1654 <1194 76 gene locus_tag LOCUS_19260 <1194 76 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421589.1:acylase >Feature sequence1655 <1194 185 gene locus_tag LOCUS_19270 <1194 185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057307.1:radical SAM protein >Feature sequence1656 555 73 gene locus_tag LOCUS_19280 555 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 <1193 607 gene locus_tag LOCUS_19290 <1193 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920975.1:FAD-dependent oxidoreductase >Feature sequence1657 >Feature sequence1658 >Feature sequence1659 552 112 gene locus_tag LOCUS_19300 552 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence1660 <1 816 gene locus_tag LOCUS_19310 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125901.1:NADP-dependent isocitrate dehydrogenase >Feature sequence1661 3 1112 gene locus_tag LOCUS_19320 3 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence1662 >Feature sequence1663 1130 159 gene locus_tag LOCUS_19330 1130 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence1664 >Feature sequence1665 >Feature sequence1666 156 668 gene locus_tag LOCUS_19340 156 668 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056117.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence1667 969 130 gene locus_tag LOCUS_19350 969 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence1668 384 938 gene locus_tag LOCUS_19360 384 938 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166172348.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence1669 >Feature sequence1670 <1 627 gene locus_tag LOCUS_19370 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921137.1:methionine synthase note possible pseudo, internal stop codon 688 930 gene locus_tag LOCUS_19380 688 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19380 >Feature sequence1671 1146 250 gene locus_tag LOCUS_19390 1146 250 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929260.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence1672 835 762 gene locus_tag LOCUS_t00210 835 762 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1673 302 1030 gene locus_tag LOCUS_19400 302 1030 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920695.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence1674 <1183 215 gene locus_tag LOCUS_19410 <1183 215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056941.1:serine/threonine-protein kinase >Feature sequence1675 367 933 gene locus_tag LOCUS_19420 367 933 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence1676 792 304 gene locus_tag LOCUS_19430 gene cpcA 792 304 CDS product phycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057793.1 protein_id gnl|my_center|LOCUS_19430 1179 895 gene locus_tag LOCUS_19440 1179 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence1677 >Feature sequence1678 1024 431 gene locus_tag LOCUS_19450 1024 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence1679 595 455 gene locus_tag LOCUS_19460 595 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence1680 >Feature sequence1681 393 196 gene locus_tag LOCUS_19470 393 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence1682 >Feature sequence1683 >Feature sequence1684 >Feature sequence1685 927 22 gene locus_tag LOCUS_19480 927 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 >Feature sequence1686 >Feature sequence1687 >Feature sequence1688 >Feature sequence1689 >Feature sequence1690 >Feature sequence1691 <1 626 gene locus_tag LOCUS_19490 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081192.1:lipopolysaccharide biosynthesis protein >Feature sequence1692 50 304 gene locus_tag LOCUS_19500 50 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 588 872 gene locus_tag LOCUS_19510 588 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence1693 >Feature sequence1694 <1 848 gene locus_tag LOCUS_19520 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096249.1:nitrate ABC transporter permease >Feature sequence1695 99 362 gene locus_tag LOCUS_19530 99 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 353 895 gene locus_tag LOCUS_19540 353 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence1696 <1 964 gene locus_tag LOCUS_19550 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056518.1:HhoA/HhoB/HtrA family serine endopeptidase >Feature sequence1697 285 94 gene locus_tag LOCUS_19560 285 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19560 >Feature sequence1698 67 1044 gene locus_tag LOCUS_19570 67 1044 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142163.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence1699 >Feature sequence1700 201 635 gene locus_tag LOCUS_19580 201 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence1701 <1168 47 gene locus_tag LOCUS_19590 <1168 47 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:EAL domain-containing protein >Feature sequence1702 968 213 gene locus_tag LOCUS_19600 968 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence1703 175 567 gene locus_tag LOCUS_19610 175 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence1704 >Feature sequence1705 >Feature sequence1706 <1166 153 gene locus_tag LOCUS_19620 <1166 153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143728.1:molybdopterin molybdotransferase MoeA >Feature sequence1707 >Feature sequence1708 405 112 gene locus_tag LOCUS_19630 405 112 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920842.1 protein_id gnl|my_center|LOCUS_19630 976 506 gene locus_tag LOCUS_19640 976 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence1709 776 1057 gene locus_tag LOCUS_19650 776 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence1710 <1165 370 gene locus_tag LOCUS_19660 <1165 370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_105221568.1:ABC transporter substrate-binding protein >Feature sequence1711 >Feature sequence1712 <1 937 gene locus_tag LOCUS_19670 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057300.1:AAA-like domain-containing protein >Feature sequence1713 133 843 gene locus_tag LOCUS_19680 133 843 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390738.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence1714 >Feature sequence1715 >Feature sequence1716 >Feature sequence1717 >Feature sequence1718 <1 1010 gene locus_tag LOCUS_19690 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141921.1:FAD-dependent oxidoreductase >Feature sequence1719 1160 12 gene locus_tag LOCUS_19700 1160 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence1720 >Feature sequence1721 >Feature sequence1722 878 30 gene locus_tag LOCUS_19710 878 30 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920890.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence1723 168 1124 gene locus_tag LOCUS_19720 168 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence1724 >Feature sequence1725 >Feature sequence1726 >Feature sequence1727 <1 547 gene locus_tag LOCUS_19730 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056117.1:DUF192 domain-containing protein 555 923 gene locus_tag LOCUS_19740 555 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence1728 393 109 gene locus_tag LOCUS_19750 393 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence1729 84 791 gene locus_tag LOCUS_19760 84 791 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056362.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence1730 >Feature sequence1731 214 1149 gene locus_tag LOCUS_19770 214 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence1732 102 797 gene locus_tag LOCUS_19780 102 797 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence1733 >Feature sequence1734 >Feature sequence1735 221 1081 gene locus_tag LOCUS_19790 gene nadC 221 1081 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence1736 >Feature sequence1737 864 37 gene locus_tag LOCUS_19800 864 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19800 >Feature sequence1738 330 878 gene locus_tag LOCUS_19810 330 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence1739 >Feature sequence1740 >Feature sequence1741 <1 589 gene locus_tag LOCUS_19820 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920769.1:DNA-processing protein DprA 602 1021 gene locus_tag LOCUS_19830 602 1021 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056937.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence1742 >Feature sequence1743 >Feature sequence1744 >Feature sequence1745 <1 526 gene locus_tag LOCUS_19840 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140928.1:4a-hydroxytetrahydrobiopterin dehydratase <1152 597 gene locus_tag LOCUS_19850 <1152 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057170.1:response regulator transcription factor >Feature sequence1746 >Feature sequence1747 584 1081 gene locus_tag LOCUS_19860 584 1081 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125616.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence1748 441 752 gene locus_tag LOCUS_19870 441 752 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence1749 >Feature sequence1750 <1148 423 gene locus_tag LOCUS_19880 <1148 423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence1751 518 321 gene locus_tag LOCUS_19890 518 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1133 717 gene locus_tag LOCUS_19900 1133 717 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920771.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence1752 1147 581 gene locus_tag LOCUS_19910 1147 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence1753 >Feature sequence1754 375 241 gene locus_tag LOCUS_19920 375 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence1755 >Feature sequence1756 337 17 gene locus_tag LOCUS_19930 337 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence1757 822 211 gene locus_tag LOCUS_19940 822 211 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929521.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence1758 >Feature sequence1759 <1 1121 gene locus_tag LOCUS_19950 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141365.1:DUF790 family protein >Feature sequence1760 <1 1062 gene locus_tag LOCUS_19960 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147855.1:precorrin-3B C(17)-methyltransferase >Feature sequence1761 971 93 gene locus_tag LOCUS_19970 971 93 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929069.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence1762 >Feature sequence1763 330 887 gene locus_tag LOCUS_19980 330 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence1764 >Feature sequence1765 772 482 gene locus_tag LOCUS_19990 772 482 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056832.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence1766 >Feature sequence1767 <1 706 gene locus_tag LOCUS_20000 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057738.1:ABC transporter ATP-binding protein >Feature sequence1768 794 501 gene locus_tag LOCUS_20010 794 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence1769 >Feature sequence1770 623 33 gene locus_tag LOCUS_20020 623 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence1771 1008 676 gene locus_tag LOCUS_20030 1008 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20030 >Feature sequence1772 >Feature sequence1773 894 163 gene locus_tag LOCUS_20040 894 163 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140962.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence1774 >Feature sequence1775 >Feature sequence1776 <1 876 gene locus_tag LOCUS_20050 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057208.1:glutamate synthase-related protein >Feature sequence1777 >Feature sequence1778 428 1075 gene locus_tag LOCUS_20060 428 1075 CDS product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence1779 >Feature sequence1780 >Feature sequence1781 <1 1035 gene locus_tag LOCUS_20070 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_191315613.1:ABC transporter substrate-binding protein >Feature sequence1782 >Feature sequence1783 >Feature sequence1784 742 269 gene locus_tag LOCUS_20080 742 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence1785 427 969 gene locus_tag LOCUS_20090 427 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence1786 >Feature sequence1787 <1 832 gene locus_tag LOCUS_20100 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056518.1:HhoA/HhoB/HtrA family serine endopeptidase >Feature sequence1788 349 828 gene locus_tag LOCUS_20110 349 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence1789 >Feature sequence1790 >Feature sequence1791 43 927 gene locus_tag LOCUS_20120 43 927 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928875.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence1792 <1132 631 gene locus_tag LOCUS_20130 <1132 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124751.1:phosphate ABC transporter permease subunit PstC >Feature sequence1793 >Feature sequence1794 <1 834 gene locus_tag LOCUS_20140 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928510.1:alpha-amylase family glycosyl hydrolase >Feature sequence1795 >Feature sequence1796 <1 550 gene locus_tag LOCUS_20150 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase >Feature sequence1797 <1 973 gene locus_tag LOCUS_20160 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005767090.1:sulfonate ABC transporter substrate-binding protein >Feature sequence1798 317 1045 gene locus_tag LOCUS_20170 317 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence1799 <1 838 gene locus_tag LOCUS_20180 <1 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125901.1:NADP-dependent isocitrate dehydrogenase >Feature sequence1800 <1128 226 gene locus_tag LOCUS_20190 <1128 226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056082.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase note possible pseudo, internal stop codon >Feature sequence1801 >Feature sequence1802 747 262 gene locus_tag LOCUS_20200 747 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence1803 521 1012 gene locus_tag LOCUS_20210 521 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence1804 764 510 gene locus_tag LOCUS_20220 764 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence1805 <1 582 gene locus_tag LOCUS_20230 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071656.1:macro domain-containing protein <1125 626 gene locus_tag LOCUS_20240 <1125 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143459.1:SagB/ThcOx family dehydrogenase >Feature sequence1806 255 73 gene locus_tag LOCUS_20250 255 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence1807 >Feature sequence1808 281 667 gene locus_tag LOCUS_20260 281 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence1809 >Feature sequence1810 >Feature sequence1811 >Feature sequence1812 >Feature sequence1813 <1 1022 gene locus_tag LOCUS_20270 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140935.1:potassium channel protein >Feature sequence1814 >Feature sequence1815 >Feature sequence1816 >Feature sequence1817 980 195 gene locus_tag LOCUS_20280 980 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence1818 >Feature sequence1819 >Feature sequence1820 287 105 gene locus_tag LOCUS_20290 287 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 277 1014 gene locus_tag LOCUS_20300 gene menA 277 1014 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073592656.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence1821 770 426 gene locus_tag LOCUS_20310 770 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence1822 433 891 gene locus_tag LOCUS_20320 gene rplI 433 891 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058245.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence1823 >Feature sequence1824 >Feature sequence1825 >Feature sequence1826 >Feature sequence1827 >Feature sequence1828 639 100 gene locus_tag LOCUS_20330 639 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928632.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence1829 >Feature sequence1830 <1116 453 gene locus_tag LOCUS_20340 <1116 453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099798964.1:type II secretion system F family protein >Feature sequence1831 <1 1016 gene locus_tag LOCUS_20350 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141018.1:CHASE3 domain-containing protein >Feature sequence1832 1097 330 gene locus_tag LOCUS_20360 1097 330 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921043.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence1833 >Feature sequence1834 >Feature sequence1835 >Feature sequence1836 <1114 27 gene locus_tag LOCUS_20370 <1114 27 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143648.1:CHAT domain-containing protein >Feature sequence1837 <1114 121 gene locus_tag LOCUS_20380 <1114 121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence1838 915 310 gene locus_tag LOCUS_20390 915 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence1839 >Feature sequence1840 <1113 386 gene locus_tag LOCUS_20400 <1113 386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012166094.1:aminomethyl-transferring glycine dehydrogenase >Feature sequence1841 318 788 gene locus_tag LOCUS_20410 318 788 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence1842 <1 947 gene locus_tag LOCUS_20420 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921089.1:phosphomethylpyrimidine synthase >Feature sequence1843 632 102 gene locus_tag LOCUS_20430 632 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence1844 >Feature sequence1845 320 132 gene locus_tag LOCUS_20440 320 132 CDS product DUF2949 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921037.1 protein_id gnl|my_center|LOCUS_20440 938 555 gene locus_tag LOCUS_20450 938 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence1846 260 826 gene locus_tag LOCUS_20460 260 826 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104398.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence1847 >Feature sequence1848 >Feature sequence1849 >Feature sequence1850 >Feature sequence1851 300 1055 gene locus_tag LOCUS_20470 300 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence1852 <1107 209 gene locus_tag LOCUS_20480 <1107 209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035359.1:aldehyde dehydrogenase family protein >Feature sequence1853 >Feature sequence1854 >Feature sequence1855 >Feature sequence1856 932 174 gene locus_tag LOCUS_20490 932 174 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence1857 >Feature sequence1858 >Feature sequence1859 <1 811 gene locus_tag LOCUS_20500 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057243.1:type 2 isopentenyl-diphosphate Delta-isomerase >Feature sequence1860 >Feature sequence1861 521 908 gene locus_tag LOCUS_tm00010 521 908 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1862 >Feature sequence1863 >Feature sequence1864 >Feature sequence1865 >Feature sequence1866 >Feature sequence1867 >Feature sequence1868 >Feature sequence1869 201 671 gene locus_tag LOCUS_20510 201 671 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence1870 >Feature sequence1871 <1100 217 gene locus_tag LOCUS_20520 <1100 217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144367.1:IscS subfamily cysteine desulfurase >Feature sequence1872 946 20 gene locus_tag LOCUS_20530 946 20 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056446.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence1873 204 962 gene locus_tag LOCUS_20540 204 962 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence1874 <1100 387 gene locus_tag LOCUS_20550 <1100 387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058192.1:elongation factor G >Feature sequence1875 946 485 gene locus_tag LOCUS_20560 946 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_20560 1098 1025 gene locus_tag LOCUS_t00220 1098 1025 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1876 >Feature sequence1877 682 140 gene locus_tag LOCUS_20570 682 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence1878 >Feature sequence1879 806 132 gene locus_tag LOCUS_20580 806 132 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence1880 146 784 gene locus_tag LOCUS_20590 146 784 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence1881 <1 615 gene locus_tag LOCUS_20600 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056381.1:adenylosuccinate synthase >Feature sequence1882 <1096 579 gene locus_tag LOCUS_20610 <1096 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056580.1:mechanosensitive ion channel >Feature sequence1883 >Feature sequence1884 106 321 gene locus_tag LOCUS_20620 106 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20620 856 473 gene locus_tag LOCUS_20630 856 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence1885 >Feature sequence1886 <1094 214 gene locus_tag LOCUS_20640 <1094 214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057960.1:CO2 hydration protein >Feature sequence1887 <1094 234 gene locus_tag LOCUS_20650 <1094 234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055985.1:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase >Feature sequence1888 919 11 gene locus_tag LOCUS_20660 gene murG 919 11 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057646.1 protein_id gnl|my_center|LOCUS_20660 919 1044 gene locus_tag LOCUS_20670 919 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence1889 <1093 178 gene locus_tag LOCUS_20680 <1093 178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141482.1:BCD family MFS transporter >Feature sequence1890 760 158 gene locus_tag LOCUS_20690 760 158 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056210.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence1891 194 664 gene locus_tag LOCUS_20700 194 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence1892 >Feature sequence1893 <1 770 gene locus_tag LOCUS_20710 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056722.1:ribosome biogenesis GTPase Der >Feature sequence1894 >Feature sequence1895 >Feature sequence1896 >Feature sequence1897 62 811 gene locus_tag LOCUS_20720 62 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence1898 >Feature sequence1899 <1090 29 gene locus_tag LOCUS_20730 <1090 29 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970521.1:glycosyltransferase family 4 protein >Feature sequence1900 >Feature sequence1901 <1 940 gene locus_tag LOCUS_20740 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001083788.1:heavy metal translocating P-type ATPase >Feature sequence1902 >Feature sequence1903 <1 924 gene locus_tag LOCUS_20750 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056229.1:protoporphyrinogen oxidase >Feature sequence1904 >Feature sequence1905 >Feature sequence1906 1088 159 gene locus_tag LOCUS_20760 1088 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence1907 >Feature sequence1908 >Feature sequence1909 >Feature sequence1910 >Feature sequence1911 >Feature sequence1912 >Feature sequence1913 34 900 gene locus_tag LOCUS_20770 34 900 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142464.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence1914 <1 760 gene locus_tag LOCUS_20780 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929078.1:Uma2 family endonuclease >Feature sequence1915 <1086 174 gene locus_tag LOCUS_20790 <1086 174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099797887.1:bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase >Feature sequence1916 >Feature sequence1917 >Feature sequence1918 >Feature sequence1919 63 776 gene locus_tag LOCUS_20800 gene ubiE 63 776 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140131.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence1920 >Feature sequence1921 >Feature sequence1922 2 442 gene locus_tag LOCUS_20810 2 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence1923 >Feature sequence1924 1082 9 gene locus_tag LOCUS_20820 1082 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence1925 93 239 gene locus_tag LOCUS_20830 93 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence1926 702 935 gene locus_tag LOCUS_20840 702 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence1927 839 426 gene locus_tag LOCUS_20850 839 426 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089903.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence1928 102 896 gene locus_tag LOCUS_20860 102 896 CDS product Mo-dependent nitrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920896.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence1929 >Feature sequence1930 <1081 389 gene locus_tag LOCUS_20870 <1081 389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037407.1:MBL fold metallo-hydrolase >Feature sequence1931 449 790 gene locus_tag LOCUS_20880 449 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence1932 >Feature sequence1933 562 80 gene locus_tag LOCUS_20890 gene petD 562 80 CDS product cytochrome b6-f complex subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056640.1 protein_id gnl|my_center|LOCUS_20890 1039 746 gene locus_tag LOCUS_20900 1039 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence1934 653 147 gene locus_tag LOCUS_20910 653 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 791 1033 gene locus_tag LOCUS_20920 791 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence1935 893 48 gene locus_tag LOCUS_20930 893 48 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence1936 >Feature sequence1937 >Feature sequence1938 833 432 gene locus_tag LOCUS_20940 833 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence1939 189 542 gene locus_tag LOCUS_20950 189 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence1940 >Feature sequence1941 >Feature sequence1942 <1078 237 gene locus_tag LOCUS_20960 <1078 237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142130.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence1943 308 580 gene locus_tag LOCUS_20970 308 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence1944 >Feature sequence1945 912 676 gene locus_tag LOCUS_20980 912 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence1946 125 583 gene locus_tag LOCUS_20990 125 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence1947 967 290 gene locus_tag LOCUS_21000 967 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence1948 <1 527 gene locus_tag LOCUS_21010 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056892.1:diguanylate cyclase >Feature sequence1949 <1 559 gene locus_tag LOCUS_21020 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056382.1:Holliday junction branch migration protein RuvA 648 821 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcacttttccccgcaaggggattgaaac >Feature sequence1950 >Feature sequence1951 >Feature sequence1952 >Feature sequence1953 >Feature sequence1954 877 182 gene locus_tag LOCUS_21030 877 182 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174178.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence1955 >Feature sequence1956 >Feature sequence1957 >Feature sequence1958 <1 884 gene locus_tag LOCUS_21040 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958618.1:HlyD family type I secretion periplasmic adaptor subunit >Feature sequence1959 >Feature sequence1960 <1072 78 gene locus_tag LOCUS_21050 <1072 78 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140346.1:PepSY-associated TM helix domain-containing protein >Feature sequence1961 <1 710 gene locus_tag LOCUS_21060 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969316.1:SpoIIE family protein phosphatase >Feature sequence1962 >Feature sequence1963 <1 552 gene locus_tag LOCUS_21070 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091910.1:FMNH2-dependent alkanesulfonate monooxygenase >Feature sequence1964 >Feature sequence1965 >Feature sequence1966 616 798 gene locus_tag LOCUS_21080 616 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence1967 >Feature sequence1968 <1070 141 gene locus_tag LOCUS_21090 <1070 141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124471.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence1969 >Feature sequence1970 <1 890 gene locus_tag LOCUS_21100 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_082901051.1:type I secretion system permease/ATPase >Feature sequence1971 >Feature sequence1972 694 239 gene locus_tag LOCUS_21110 gene rplM 694 239 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055963.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence1973 >Feature sequence1974 >Feature sequence1975 2 667 gene locus_tag LOCUS_21120 2 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence1976 <1 1051 gene locus_tag LOCUS_21130 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888694.1:sulfate/molybdate ABC transporter ATP-binding protein >Feature sequence1977 282 575 gene locus_tag LOCUS_21140 282 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence1978 1 423 gene locus_tag LOCUS_21150 1 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence1979 >Feature sequence1980 119 958 gene locus_tag LOCUS_21160 119 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 >Feature sequence1981 >Feature sequence1982 267 566 gene locus_tag LOCUS_21170 267 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence1983 411 923 gene locus_tag LOCUS_21180 411 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence1984 958 107 gene locus_tag LOCUS_21190 958 107 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884064.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence1985 >Feature sequence1986 331 1032 gene locus_tag LOCUS_21200 331 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence1987 >Feature sequence1988 >Feature sequence1989 <1060 223 gene locus_tag LOCUS_21210 <1060 223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056828.1:DUF3488 and DUF4129 domain-containing transglutaminase family protein >Feature sequence1990 387 100 gene locus_tag LOCUS_21220 387 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence1991 >Feature sequence1992 <1059 232 gene locus_tag LOCUS_21230 <1059 232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057305.1:alanine--glyoxylate aminotransferase family protein >Feature sequence1993 <1059 93 gene locus_tag LOCUS_21240 <1059 93 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390159.1:EAL domain-containing protein >Feature sequence1994 796 467 gene locus_tag LOCUS_21250 796 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057546.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence1995 >Feature sequence1996 <1 615 gene locus_tag LOCUS_21260 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057642.1:S-layer homology domain-containing protein >Feature sequence1997 >Feature sequence1998 415 966 gene locus_tag LOCUS_21270 415 966 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence1999 >Feature sequence2000 >Feature sequence2001 >Feature sequence2002 938 252 gene locus_tag LOCUS_21280 938 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21280 >Feature sequence2003 >Feature sequence2004 85 750 gene locus_tag LOCUS_21290 85 750 CDS product DUF4340 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056730.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence2005 >Feature sequence2006 >Feature sequence2007 660 508 gene locus_tag LOCUS_21300 660 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence2008 >Feature sequence2009 >Feature sequence2010 >Feature sequence2011 <1 573 gene locus_tag LOCUS_21310 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056701.1:NAD-dependent DNA ligase LigA >Feature sequence2012 245 508 gene locus_tag LOCUS_21320 245 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence2013 428 868 gene locus_tag LOCUS_21330 428 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920813.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence2014 >Feature sequence2015 >Feature sequence2016 >Feature sequence2017 >Feature sequence2018 120 449 gene locus_tag LOCUS_21340 120 449 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142103.1 protein_id gnl|my_center|LOCUS_21340 498 890 gene locus_tag LOCUS_21350 498 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence2019 260 634 gene locus_tag LOCUS_21360 260 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055877.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence2020 >Feature sequence2021 >Feature sequence2022 >Feature sequence2023 848 138 gene locus_tag LOCUS_21370 848 138 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence2024 271 933 gene locus_tag LOCUS_21380 271 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence2025 >Feature sequence2026 >Feature sequence2027 >Feature sequence2028 >Feature sequence2029 >Feature sequence2030 <1 677 gene locus_tag LOCUS_21390 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058242.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence2031 >Feature sequence2032 >Feature sequence2033 >Feature sequence2034 >Feature sequence2035 2 400 gene locus_tag LOCUS_21400 2 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 363 824 gene locus_tag LOCUS_21410 363 824 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence2036 >Feature sequence2037 >Feature sequence2038 >Feature sequence2039 <1041 6 gene locus_tag LOCUS_21420 <1041 6 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023171949.1:ribulose bisphosphate carboxylase small subunit >Feature sequence2040 >Feature sequence2041 607 993 gene locus_tag LOCUS_21430 607 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence2042 >Feature sequence2043 >Feature sequence2044 <1039 500 gene locus_tag LOCUS_21440 <1039 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141325.1:phosphoribosylformylglycinamidine synthase subunit PurQ >Feature sequence2045 826 140 gene locus_tag LOCUS_21450 826 140 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090769.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence2046 <1039 199 gene locus_tag LOCUS_21460 <1039 199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479721.1:mannose-1-phosphate guanylyltransferase >Feature sequence2047 >Feature sequence2048 >Feature sequence2049 43 969 gene locus_tag LOCUS_21470 43 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence2050 <1039 183 gene locus_tag LOCUS_21480 <1039 183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085076.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence2051 <1 751 gene locus_tag LOCUS_21490 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057801.1:M23 family metallopeptidase >Feature sequence2052 >Feature sequence2053 <1 780 gene locus_tag LOCUS_21500 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence2054 >Feature sequence2055 63 863 gene locus_tag LOCUS_21510 63 863 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524099.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence2056 815 270 gene locus_tag LOCUS_21520 815 270 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence2057 >Feature sequence2058 >Feature sequence2059 119 904 gene locus_tag LOCUS_21530 gene larB 119 904 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141462.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence2060 >Feature sequence2061 >Feature sequence2062 >Feature sequence2063 >Feature sequence2064 <1033 496 gene locus_tag LOCUS_21540 <1033 496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056204.1:response regulator >Feature sequence2065 138 938 gene locus_tag LOCUS_21550 138 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence2066 >Feature sequence2067 >Feature sequence2068 1033 71 gene locus_tag LOCUS_21560 1033 71 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence2069 >Feature sequence2070 >Feature sequence2071 <1 644 gene locus_tag LOCUS_21570 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142152.1:peroxiredoxin >Feature sequence2072 >Feature sequence2073 958 164 gene locus_tag LOCUS_21580 958 164 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence2074 <1 970 gene locus_tag LOCUS_21590 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203293.1:signal peptide peptidase SppA >Feature sequence2075 >Feature sequence2076 <1029 94 gene locus_tag LOCUS_21600 <1029 94 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056036.1:ATP phosphoribosyltransferase regulatory subunit >Feature sequence2077 983 36 gene locus_tag LOCUS_21610 983 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence2078 >Feature sequence2079 2 442 gene locus_tag LOCUS_21620 2 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence2080 >Feature sequence2081 >Feature sequence2082 810 169 gene locus_tag LOCUS_21630 810 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence2083 >Feature sequence2084 134 559 gene locus_tag LOCUS_21640 134 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21640 >Feature sequence2085 >Feature sequence2086 >Feature sequence2087 <1027 77 gene locus_tag LOCUS_21650 <1027 77 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057190.1:CmpA/NrtA family ABC transporter substrate-binding protein >Feature sequence2088 >Feature sequence2089 >Feature sequence2090 225 848 gene locus_tag LOCUS_21660 225 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence2091 >Feature sequence2092 <1 752 gene locus_tag LOCUS_21670 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021891.1:pentapeptide repeat-containing protein >Feature sequence2093 >Feature sequence2094 869 87 gene locus_tag LOCUS_21680 869 87 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence2095 <1 681 gene locus_tag LOCUS_21690 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057139.1:dihydrolipoamide acetyltransferase family protein 793 957 gene locus_tag LOCUS_21700 793 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence2096 >Feature sequence2097 >Feature sequence2098 >Feature sequence2099 527 724 gene locus_tag LOCUS_21710 527 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence2100 865 11 gene locus_tag LOCUS_21720 865 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence2101 221 69 gene locus_tag LOCUS_21730 221 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence2102 435 511 gene locus_tag LOCUS_t00230 435 511 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 642 716 gene locus_tag LOCUS_t00240 642 716 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 717 791 gene locus_tag LOCUS_t00250 717 791 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2103 >Feature sequence2104 >Feature sequence2105 <1022 436 gene locus_tag LOCUS_21740 <1022 436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799131.1:EAL domain-containing protein >Feature sequence2106 104 391 gene locus_tag LOCUS_21750 104 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21750 412 921 gene locus_tag LOCUS_21760 412 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21760 >Feature sequence2107 >Feature sequence2108 >Feature sequence2109 294 620 gene locus_tag LOCUS_21770 294 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence2110 >Feature sequence2111 >Feature sequence2112 >Feature sequence2113 >Feature sequence2114 1020 145 gene locus_tag LOCUS_21780 1020 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence2115 <1 884 gene locus_tag LOCUS_21790 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057539.1:ComEC/Rec2 family competence protein >Feature sequence2116 >Feature sequence2117 >Feature sequence2118 >Feature sequence2119 <1 544 gene locus_tag LOCUS_21800 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259087.1:adenylate/guanylate cyclase domain-containing protein 526 987 gene locus_tag LOCUS_21810 526 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence2120 <1 795 gene locus_tag LOCUS_21820 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056847.1:DUF697 domain-containing protein >Feature sequence2121 >Feature sequence2122 380 814 gene locus_tag LOCUS_21830 380 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence2123 >Feature sequence2124 >Feature sequence2125 >Feature sequence2126 <1016 6 gene locus_tag LOCUS_21840 <1016 6 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331491.1:calcium-binding protein >Feature sequence2127 >Feature sequence2128 369 43 gene locus_tag LOCUS_21850 369 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence2129 391 546 gene locus_tag LOCUS_21860 391 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence2130 <1 539 gene locus_tag LOCUS_21870 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140609.1:TldD/PmbA family protein >Feature sequence2131 <1 611 gene locus_tag LOCUS_21880 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125025.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence2132 991 797 gene locus_tag LOCUS_21890 991 797 CDS product DUF2862 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence2133 >Feature sequence2134 546 4 gene locus_tag LOCUS_21900 gene rsmD 546 4 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence2135 >Feature sequence2136 501 79 gene locus_tag LOCUS_21910 501 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797542.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence2137 <1 834 gene locus_tag LOCUS_21920 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143741.1:aldo/keto reductase >Feature sequence2138 >Feature sequence2139 >Feature sequence2140 510 794 gene locus_tag LOCUS_21930 510 794 CDS product DUF3143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence2141 >Feature sequence2142 >Feature sequence2143 >Feature sequence2144 >Feature sequence2145 519 100 gene locus_tag LOCUS_21940 gene queF 519 100 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056073.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence2146 >Feature sequence2147 <1010 432 gene locus_tag LOCUS_21950 <1010 432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879993.1:EAL domain-containing protein >Feature sequence2148 785 870 gene locus_tag LOCUS_t00260 785 870 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2149 290 865 gene locus_tag LOCUS_21960 gene cobU 290 865 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence2150 <1009 164 gene locus_tag LOCUS_21970 <1009 164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762583.1:cation:proton antiporter >Feature sequence2151 >Feature sequence2152 496 140 gene locus_tag LOCUS_21980 496 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence2153 <1008 6 gene locus_tag LOCUS_21990 <1008 6 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057237.1:2-isopropylmalate synthase >Feature sequence2154 3 308 gene locus_tag LOCUS_22000 3 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence2155 529 801 gene locus_tag LOCUS_22010 529 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence2156 97 762 gene locus_tag LOCUS_22020 97 762 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence2157 >Feature sequence2158 >Feature sequence2159 <1 869 gene locus_tag LOCUS_22030 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877983.1:GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase >Feature sequence2160 >Feature sequence2161 <1 924 gene locus_tag LOCUS_22040 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143160.1:dihydroxy-acid dehydratase >Feature sequence2162 >Feature sequence2163 >Feature sequence2164 >Feature sequence2165 780 124 gene locus_tag LOCUS_22050 780 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence2166 >Feature sequence2167 >Feature sequence2168 >Feature sequence2169 >Feature sequence2170 >Feature sequence2171 >Feature sequence2172 246 806 gene locus_tag LOCUS_22060 246 806 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence2173 <1 995 gene locus_tag LOCUS_22070 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141800.1:family 10 glycosylhydrolase >Feature sequence2174 <1000 112 gene locus_tag LOCUS_22080 <1000 112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057439.1:3-isopropylmalate dehydrogenase >Feature sequence2175 <1000 250 gene locus_tag LOCUS_22090 <1000 250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920713.1:circadian clock KaiB family protein >Feature sequence2176 <1 508 gene locus_tag LOCUS_22100 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058225.1:citrate synthase >Feature sequence2177