>Feature sequence01 846 1496 gene locus_tag LOCUS_00010 846 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 6207 1630 gene locus_tag LOCUS_00020 gene gltB 6207 1630 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_00020 6644 9073 gene locus_tag LOCUS_00030 6644 9073 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682327.1 protein_id gnl|my_center|LOCUS_00030 9782 9429 gene locus_tag LOCUS_00040 9782 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 10053 12191 gene locus_tag LOCUS_00050 10053 12191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 12303 14012 gene locus_tag LOCUS_00060 gene ptsP 12303 14012 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_00060 14093 15664 gene locus_tag LOCUS_00070 gene der 14093 15664 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680939.1 protein_id gnl|my_center|LOCUS_00070 15661 15990 gene locus_tag LOCUS_00080 15661 15990 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680938.1 protein_id gnl|my_center|LOCUS_00080 15983 17401 gene locus_tag LOCUS_00090 15983 17401 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680936.1 protein_id gnl|my_center|LOCUS_00090 17978 17409 gene locus_tag LOCUS_00100 gene efp 17978 17409 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_00100 19314 18049 gene locus_tag LOCUS_00110 gene earP 19314 18049 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072321.1 protein_id gnl|my_center|LOCUS_00110 19662 19321 gene locus_tag LOCUS_00120 19662 19321 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886618.1 protein_id gnl|my_center|LOCUS_00120 20681 19848 gene locus_tag LOCUS_00130 20681 19848 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_00130 21674 20700 gene locus_tag LOCUS_00140 21674 20700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 22051 22956 gene locus_tag LOCUS_00150 22051 22956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_00150 22967 23218 gene locus_tag LOCUS_00160 22967 23218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 23635 23297 gene locus_tag LOCUS_00170 23635 23297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23845 24474 gene locus_tag LOCUS_00180 23845 24474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24461 25300 gene locus_tag LOCUS_00190 24461 25300 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669381.1 protein_id gnl|my_center|LOCUS_00190 25638 27068 gene locus_tag LOCUS_00200 25638 27068 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_00200 27082 28611 gene locus_tag LOCUS_00210 27082 28611 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_00210 28767 30890 gene locus_tag LOCUS_00220 28767 30890 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_00220 30987 32555 gene locus_tag LOCUS_00230 30987 32555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 34127 32574 gene locus_tag LOCUS_00240 34127 32574 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680967.1 protein_id gnl|my_center|LOCUS_00240 34560 34156 gene locus_tag LOCUS_00250 34560 34156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 35396 34599 gene locus_tag LOCUS_00260 35396 34599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 36049 35411 gene locus_tag LOCUS_00270 36049 35411 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666681.1 protein_id gnl|my_center|LOCUS_00270 37149 36049 gene locus_tag LOCUS_00280 37149 36049 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956680.1 protein_id gnl|my_center|LOCUS_00280 37299 38087 gene locus_tag LOCUS_00290 37299 38087 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680775.1 protein_id gnl|my_center|LOCUS_00290 38305 39117 gene locus_tag LOCUS_00300 38305 39117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 39191 40042 gene locus_tag LOCUS_00310 39191 40042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 40035 40748 gene locus_tag LOCUS_00320 gene rsmG 40035 40748 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957250.1 protein_id gnl|my_center|LOCUS_00320 41316 42101 gene locus_tag LOCUS_00330 gene proC 41316 42101 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966526.1 protein_id gnl|my_center|LOCUS_00330 42300 42800 gene locus_tag LOCUS_00340 42300 42800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 42835 43101 gene locus_tag LOCUS_00350 42835 43101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 43098 45428 gene locus_tag LOCUS_00360 gene clpA 43098 45428 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213323.1 protein_id gnl|my_center|LOCUS_00360 45433 45702 gene locus_tag LOCUS_00370 45433 45702 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963800.1 protein_id gnl|my_center|LOCUS_00370 47694 45958 gene locus_tag LOCUS_00380 gene ettA 47694 45958 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_00380 49923 47839 gene locus_tag LOCUS_00390 49923 47839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 50225 49998 gene locus_tag LOCUS_00400 50225 49998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 50794 52002 gene locus_tag LOCUS_00410 50794 52002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 52029 53045 gene locus_tag LOCUS_00420 gene tsaD 52029 53045 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680472.1 protein_id gnl|my_center|LOCUS_00420 54561 53641 gene locus_tag LOCUS_00430 gene ricT 54561 53641 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680971.1 protein_id gnl|my_center|LOCUS_00430 55402 54824 gene locus_tag LOCUS_00440 55402 54824 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666717.1 protein_id gnl|my_center|LOCUS_00440 55812 55399 gene locus_tag LOCUS_00450 55812 55399 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680969.1 protein_id gnl|my_center|LOCUS_00450 56836 55814 gene locus_tag LOCUS_00460 56836 55814 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666722.1 protein_id gnl|my_center|LOCUS_00460 57092 57871 gene locus_tag LOCUS_00470 57092 57871 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680785.1 protein_id gnl|my_center|LOCUS_00470 57881 58861 gene locus_tag LOCUS_00480 gene dusB 57881 58861 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680788.1 protein_id gnl|my_center|LOCUS_00480 59097 59822 gene locus_tag LOCUS_00490 59097 59822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 59854 60543 gene locus_tag LOCUS_00500 59854 60543 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942574.1 protein_id gnl|my_center|LOCUS_00500 60658 62229 gene locus_tag LOCUS_00510 60658 62229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 62178 62381 gene locus_tag LOCUS_00520 62178 62381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 62908 62426 gene locus_tag LOCUS_00530 62908 62426 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_00530 64474 63119 gene locus_tag LOCUS_00540 64474 63119 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667136.1 protein_id gnl|my_center|LOCUS_00540 65684 64509 gene locus_tag LOCUS_00550 65684 64509 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 protein_id gnl|my_center|LOCUS_00550 66232 65747 gene locus_tag LOCUS_00560 66232 65747 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_00560 66398 66225 gene locus_tag LOCUS_00570 66398 66225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 66438 66782 gene locus_tag LOCUS_00580 66438 66782 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256312.1 protein_id gnl|my_center|LOCUS_00580 66963 67934 gene locus_tag LOCUS_00590 66963 67934 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_00590 68105 68857 gene locus_tag LOCUS_00600 68105 68857 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102804.1 protein_id gnl|my_center|LOCUS_00600 68880 70943 gene locus_tag LOCUS_00610 68880 70943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 71442 72350 gene locus_tag LOCUS_00620 71442 72350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 72641 73477 gene locus_tag LOCUS_00630 72641 73477 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669815.1 protein_id gnl|my_center|LOCUS_00630 73667 74122 gene locus_tag LOCUS_00640 73667 74122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 74243 75622 gene locus_tag LOCUS_00650 gene mnmE 74243 75622 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680027.1 protein_id gnl|my_center|LOCUS_00650 75815 76849 gene locus_tag LOCUS_00660 gene hydE 75815 76849 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433972.1 protein_id gnl|my_center|LOCUS_00660 77762 76977 gene locus_tag LOCUS_00670 77762 76977 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682172.1 protein_id gnl|my_center|LOCUS_00670 78710 77964 gene locus_tag LOCUS_00680 78710 77964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 79546 78737 gene locus_tag LOCUS_00690 79546 78737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 79907 79527 gene locus_tag LOCUS_00700 79907 79527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 80565 79891 gene locus_tag LOCUS_00710 80565 79891 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_00710 80912 83212 gene locus_tag LOCUS_00720 80912 83212 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593905.1 protein_id gnl|my_center|LOCUS_00720 83245 84336 gene locus_tag LOCUS_00730 gene rpsA 83245 84336 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_00730 84362 84601 gene locus_tag LOCUS_00740 84362 84601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 85573 84800 gene locus_tag LOCUS_00750 85573 84800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 85698 85847 gene locus_tag LOCUS_00760 85698 85847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 88175 86043 gene locus_tag LOCUS_00770 88175 86043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 88455 89081 gene locus_tag LOCUS_00780 88455 89081 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963654.1 protein_id gnl|my_center|LOCUS_00780 89083 90525 gene locus_tag LOCUS_00790 gene trkA 89083 90525 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676352.1 protein_id gnl|my_center|LOCUS_00790 90531 91979 gene locus_tag LOCUS_00800 90531 91979 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680943.1 protein_id gnl|my_center|LOCUS_00800 93240 92062 gene locus_tag LOCUS_00810 gene mnmA 93240 92062 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256566.1 protein_id gnl|my_center|LOCUS_00810 94591 93284 gene locus_tag LOCUS_00820 gene carA 94591 93284 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597281.1 protein_id gnl|my_center|LOCUS_00820 96822 95101 gene locus_tag LOCUS_00830 gene pheT 96822 95101 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957104.1 protein_id gnl|my_center|LOCUS_00830 98639 97371 gene locus_tag LOCUS_00840 98639 97371 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583659.1 protein_id gnl|my_center|LOCUS_00840 99221 98652 gene locus_tag LOCUS_00850 99221 98652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666906.1 protein_id gnl|my_center|LOCUS_00850 100417 99227 gene locus_tag LOCUS_00860 100417 99227 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680885.1 protein_id gnl|my_center|LOCUS_00860 101882 100428 gene locus_tag LOCUS_00870 101882 100428 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682308.1 protein_id gnl|my_center|LOCUS_00870 102035 103804 gene locus_tag LOCUS_00880 102035 103804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682311.1 protein_id gnl|my_center|LOCUS_00880 104608 103805 gene locus_tag LOCUS_00890 gene rlmB 104608 103805 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679077.1 protein_id gnl|my_center|LOCUS_00890 105124 104624 gene locus_tag LOCUS_00900 105124 104624 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_00900 105614 107182 gene locus_tag LOCUS_00910 105614 107182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 107258 110275 gene locus_tag LOCUS_00920 107258 110275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 111238 110615 gene locus_tag LOCUS_00930 gene hisB 111238 110615 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674505.1 protein_id gnl|my_center|LOCUS_00930 112188 111313 gene locus_tag LOCUS_00940 gene hisG 112188 111313 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_00940 112413 113909 gene locus_tag LOCUS_00950 112413 113909 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_00950 113911 115026 gene locus_tag LOCUS_00960 gene ribD 113911 115026 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975998.1 protein_id gnl|my_center|LOCUS_00960 115193 116887 gene locus_tag LOCUS_00970 115193 116887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680819.1 protein_id gnl|my_center|LOCUS_00970 117668 117036 gene locus_tag LOCUS_00980 gene nth 117668 117036 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973867.1 protein_id gnl|my_center|LOCUS_00980 118882 117665 gene locus_tag LOCUS_00990 gene metK 118882 117665 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680429.1 protein_id gnl|my_center|LOCUS_00990 119108 119872 gene locus_tag LOCUS_01000 119108 119872 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679809.1 protein_id gnl|my_center|LOCUS_01000 121418 119901 gene locus_tag LOCUS_01010 121418 119901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 124953 121504 gene locus_tag LOCUS_01020 124953 121504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 126108 125425 gene locus_tag LOCUS_01030 126108 125425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 129332 126111 gene locus_tag LOCUS_01040 129332 126111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 129478 130413 gene locus_tag LOCUS_01050 129478 130413 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965945.1 protein_id gnl|my_center|LOCUS_01050 >Feature sequence02 2090 519 gene locus_tag LOCUS_01060 2090 519 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208352.1 protein_id gnl|my_center|LOCUS_01060 4441 2474 gene locus_tag LOCUS_01070 gene htpG 4441 2474 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957241.1 protein_id gnl|my_center|LOCUS_01070 6244 4655 gene locus_tag LOCUS_01080 6244 4655 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682348.1 protein_id gnl|my_center|LOCUS_01080 8040 6424 gene locus_tag LOCUS_01090 8040 6424 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_01090 8629 8099 gene locus_tag LOCUS_01100 8629 8099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 8839 9291 gene locus_tag LOCUS_01110 8839 9291 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055942.1 protein_id gnl|my_center|LOCUS_01110 9855 10145 gene locus_tag LOCUS_01120 9855 10145 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399666.1 protein_id gnl|my_center|LOCUS_01120 10147 10518 gene locus_tag LOCUS_01130 10147 10518 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_01130 10663 10884 gene locus_tag LOCUS_01140 10663 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 11034 10962 gene locus_tag LOCUS_t00010 11034 10962 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13177 11135 gene locus_tag LOCUS_01150 13177 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 14353 13496 gene locus_tag LOCUS_01160 14353 13496 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703715.1 protein_id gnl|my_center|LOCUS_01160 14897 14325 gene locus_tag LOCUS_01170 14897 14325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 16162 15047 gene locus_tag LOCUS_01180 16162 15047 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261512.1 protein_id gnl|my_center|LOCUS_01180 16652 19432 gene locus_tag LOCUS_01190 16652 19432 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680747.1 protein_id gnl|my_center|LOCUS_01190 19605 20396 gene locus_tag LOCUS_01200 19605 20396 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_01200 20413 21957 gene locus_tag LOCUS_01210 20413 21957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 22640 22182 gene locus_tag LOCUS_01220 22640 22182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 23729 22650 gene locus_tag LOCUS_01230 23729 22650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 30735 23740 gene locus_tag LOCUS_01240 30735 23740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 31120 30692 gene locus_tag LOCUS_01250 31120 30692 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939431.1 protein_id gnl|my_center|LOCUS_01250 31572 31120 gene locus_tag LOCUS_01260 31572 31120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 31922 31569 gene locus_tag LOCUS_01270 31922 31569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 34485 31924 gene locus_tag LOCUS_01280 34485 31924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 34731 34486 gene locus_tag LOCUS_01290 34731 34486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 35231 34791 gene locus_tag LOCUS_01300 35231 34791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 35911 35231 gene locus_tag LOCUS_01310 35911 35231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 36324 35908 gene locus_tag LOCUS_01320 36324 35908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 36938 36321 gene locus_tag LOCUS_01330 36938 36321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 37360 36929 gene locus_tag LOCUS_01340 37360 36929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 38648 37476 gene locus_tag LOCUS_01350 38648 37476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 39025 38663 gene locus_tag LOCUS_01360 39025 38663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 39976 39041 gene locus_tag LOCUS_01370 39976 39041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 40367 40005 gene locus_tag LOCUS_01380 40367 40005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 40899 40657 gene locus_tag LOCUS_01390 40899 40657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 42164 40896 gene locus_tag LOCUS_01400 42164 40896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 43450 42248 gene locus_tag LOCUS_01410 43450 42248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 44922 43453 gene locus_tag LOCUS_01420 44922 43453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169542415.1 protein_id gnl|my_center|LOCUS_01420 45448 44906 gene locus_tag LOCUS_01430 45448 44906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 45743 45432 gene locus_tag LOCUS_01440 45743 45432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 46275 45847 gene locus_tag LOCUS_01450 46275 45847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 46511 46272 gene locus_tag LOCUS_01460 46511 46272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 47064 46522 gene locus_tag LOCUS_01470 47064 46522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 47465 47133 gene locus_tag LOCUS_01480 47465 47133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 47781 47476 gene locus_tag LOCUS_01490 47781 47476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 48470 47874 gene locus_tag LOCUS_01500 48470 47874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 48814 48578 gene locus_tag LOCUS_01510 48814 48578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 49190 48945 gene locus_tag LOCUS_01520 49190 48945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 49729 49256 gene locus_tag LOCUS_01530 49729 49256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 50134 50619 gene locus_tag LOCUS_01540 50134 50619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 50690 50842 gene locus_tag LOCUS_01550 50690 50842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 50839 51006 gene locus_tag LOCUS_01560 50839 51006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 50984 51145 gene locus_tag LOCUS_01570 50984 51145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 51162 51362 gene locus_tag LOCUS_01580 51162 51362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 51359 51556 gene locus_tag LOCUS_01590 51359 51556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 51567 51764 gene locus_tag LOCUS_01600 51567 51764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 51742 52254 gene locus_tag LOCUS_01610 51742 52254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 52322 53101 gene locus_tag LOCUS_01620 52322 53101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 53098 55101 gene locus_tag LOCUS_01630 53098 55101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 55103 55990 gene locus_tag LOCUS_01640 55103 55990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 56412 56774 gene locus_tag LOCUS_01650 56412 56774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 56771 57049 gene locus_tag LOCUS_01660 56771 57049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 57046 57258 gene locus_tag LOCUS_01670 57046 57258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 57222 57437 gene locus_tag LOCUS_01680 57222 57437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 57434 57601 gene locus_tag LOCUS_01690 57434 57601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 57645 57863 gene locus_tag LOCUS_01700 57645 57863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 57860 58243 gene locus_tag LOCUS_01710 57860 58243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 59481 58570 gene locus_tag LOCUS_01720 59481 58570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 59647 60024 gene locus_tag LOCUS_01730 59647 60024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 60422 61291 gene locus_tag LOCUS_01740 gene pfkB 60422 61291 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_01740 61411 61875 gene locus_tag LOCUS_01750 61411 61875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 62040 62684 gene locus_tag LOCUS_01760 62040 62684 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_01760 62805 64013 gene locus_tag LOCUS_01770 62805 64013 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905673.1 protein_id gnl|my_center|LOCUS_01770 64141 64605 gene locus_tag LOCUS_01780 gene ribE 64141 64605 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_01780 64620 65102 gene locus_tag LOCUS_01790 64620 65102 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671181.1 protein_id gnl|my_center|LOCUS_01790 69445 65255 gene locus_tag LOCUS_01800 gene carB 69445 65255 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_01800 70438 72177 gene locus_tag LOCUS_01810 gene asnB 70438 72177 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_01810 72293 73783 gene locus_tag LOCUS_01820 72293 73783 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_01820 74692 73928 gene locus_tag LOCUS_01830 74692 73928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 75335 74694 gene locus_tag LOCUS_01840 75335 74694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 77859 76018 gene locus_tag LOCUS_01850 gene aspS 77859 76018 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679265.1 protein_id gnl|my_center|LOCUS_01850 78508 78059 gene locus_tag LOCUS_01860 78508 78059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 79404 78763 gene locus_tag LOCUS_01870 79404 78763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 79901 79359 gene locus_tag LOCUS_01880 79901 79359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 80307 81029 gene locus_tag LOCUS_01890 80307 81029 CDS product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679167.1 protein_id gnl|my_center|LOCUS_01890 81830 83602 gene locus_tag LOCUS_01900 81830 83602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 83859 84542 gene locus_tag LOCUS_01910 gene pyrE 83859 84542 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_01910 84585 87791 gene locus_tag LOCUS_01920 84585 87791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 88171 87854 gene locus_tag LOCUS_01930 88171 87854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 88814 89659 gene locus_tag LOCUS_01940 gene rocF 88814 89659 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711563.1 protein_id gnl|my_center|LOCUS_01940 89884 90969 gene locus_tag LOCUS_01950 89884 90969 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_01950 90959 91918 gene locus_tag LOCUS_01960 90959 91918 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682131.1 protein_id gnl|my_center|LOCUS_01960 92291 98365 gene locus_tag LOCUS_01970 92291 98365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 98376 99494 gene locus_tag LOCUS_01980 98376 99494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 99481 100935 gene locus_tag LOCUS_01990 99481 100935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 101497 103830 gene locus_tag LOCUS_02000 101497 103830 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971495.1 protein_id gnl|my_center|LOCUS_02000 106342 103940 gene locus_tag LOCUS_02010 106342 103940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 107046 106447 gene locus_tag LOCUS_02020 107046 106447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 107719 108255 gene locus_tag LOCUS_02030 107719 108255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 108404 109873 gene locus_tag LOCUS_02040 108404 109873 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761968.1 protein_id gnl|my_center|LOCUS_02040 110152 111066 gene locus_tag LOCUS_02050 110152 111066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 111280 114681 gene locus_tag LOCUS_02060 111280 114681 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_02060 114678 114980 gene locus_tag LOCUS_02070 114678 114980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 115762 115169 gene locus_tag LOCUS_02080 115762 115169 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742222.1 protein_id gnl|my_center|LOCUS_02080 116951 115767 gene locus_tag LOCUS_02090 116951 115767 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682240.1 protein_id gnl|my_center|LOCUS_02090 119150 117354 gene locus_tag LOCUS_02100 119150 117354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence03 793 1002 gene locus_tag LOCUS_02110 793 1002 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666823.1 protein_id gnl|my_center|LOCUS_02110 1007 1954 gene locus_tag LOCUS_02120 gene miaA 1007 1954 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680912.1 protein_id gnl|my_center|LOCUS_02120 2199 4106 gene locus_tag LOCUS_02130 gene dxs 2199 4106 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957098.1 protein_id gnl|my_center|LOCUS_02130 4261 5076 gene locus_tag LOCUS_02140 4261 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 5103 5918 gene locus_tag LOCUS_02150 gene cdaA 5103 5918 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669723.1 protein_id gnl|my_center|LOCUS_02150 5896 6999 gene locus_tag LOCUS_02160 5896 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 6996 7370 gene locus_tag LOCUS_02170 6996 7370 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_02170 7403 8272 gene locus_tag LOCUS_02180 7403 8272 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667865.1 protein_id gnl|my_center|LOCUS_02180 8313 9104 gene locus_tag LOCUS_02190 gene truA 8313 9104 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667863.1 protein_id gnl|my_center|LOCUS_02190 9315 9776 gene locus_tag LOCUS_02200 9315 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 11254 9968 gene locus_tag LOCUS_02210 11254 9968 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674509.1 protein_id gnl|my_center|LOCUS_02210 12533 11235 gene locus_tag LOCUS_02220 12533 11235 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_02220 12675 13664 gene locus_tag LOCUS_02230 12675 13664 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666315.1 protein_id gnl|my_center|LOCUS_02230 13691 14587 gene locus_tag LOCUS_02240 13691 14587 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678741.1 protein_id gnl|my_center|LOCUS_02240 14584 15579 gene locus_tag LOCUS_02250 14584 15579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 15620 16621 gene locus_tag LOCUS_02260 15620 16621 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678753.1 protein_id gnl|my_center|LOCUS_02260 16632 18248 gene locus_tag LOCUS_02270 16632 18248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 18375 19718 gene locus_tag LOCUS_02280 18375 19718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 19759 20241 gene locus_tag LOCUS_02290 19759 20241 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678761.1 protein_id gnl|my_center|LOCUS_02290 20800 20357 gene locus_tag LOCUS_02300 20800 20357 CDS product Holliday junction resolvase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680619.1 protein_id gnl|my_center|LOCUS_02300 22129 20864 gene locus_tag LOCUS_02310 gene lysA 22129 20864 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_02310 22371 22299 gene locus_tag LOCUS_t00020 22371 22299 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22575 23039 gene locus_tag LOCUS_02320 gene rimP 22575 23039 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670663.1 protein_id gnl|my_center|LOCUS_02320 23060 24550 gene locus_tag LOCUS_02330 gene nusA 23060 24550 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682413.1 protein_id gnl|my_center|LOCUS_02330 24559 27261 gene locus_tag LOCUS_02340 gene infB 24559 27261 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682412.1 protein_id gnl|my_center|LOCUS_02340 27261 27659 gene locus_tag LOCUS_02350 gene rbfA 27261 27659 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670660.1 protein_id gnl|my_center|LOCUS_02350 27652 28701 gene locus_tag LOCUS_02360 gene truB 27652 28701 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682411.1 protein_id gnl|my_center|LOCUS_02360 29243 29857 gene locus_tag LOCUS_02370 gene ruvA 29243 29857 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679554.1 protein_id gnl|my_center|LOCUS_02370 29869 30930 gene locus_tag LOCUS_02380 gene ruvB 29869 30930 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679608.1 protein_id gnl|my_center|LOCUS_02380 30930 31970 gene locus_tag LOCUS_02390 gene queA 30930 31970 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957235.1 protein_id gnl|my_center|LOCUS_02390 32565 32104 gene locus_tag LOCUS_02400 32565 32104 CDS product DUF188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679987.1 protein_id gnl|my_center|LOCUS_02400 32864 32562 gene locus_tag LOCUS_02410 32864 32562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 33620 32877 gene locus_tag LOCUS_02420 33620 32877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 33983 33624 gene locus_tag LOCUS_02430 gene rplT 33983 33624 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668132.1 protein_id gnl|my_center|LOCUS_02430 34197 33997 gene locus_tag LOCUS_02440 gene rpmI 34197 33997 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679992.1 protein_id gnl|my_center|LOCUS_02440 34745 34215 gene locus_tag LOCUS_02450 gene infC 34745 34215 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668127.1 protein_id gnl|my_center|LOCUS_02450 34881 36056 gene locus_tag LOCUS_02460 gene thiI 34881 36056 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680552.1 protein_id gnl|my_center|LOCUS_02460 37566 36436 gene locus_tag LOCUS_02470 37566 36436 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459993.1 protein_id gnl|my_center|LOCUS_02470 39293 37566 gene locus_tag LOCUS_02480 39293 37566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668497.1 protein_id gnl|my_center|LOCUS_02480 39416 40273 gene locus_tag LOCUS_02490 39416 40273 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680465.1 protein_id gnl|my_center|LOCUS_02490 40270 42267 gene locus_tag LOCUS_02500 gene priA 40270 42267 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680463.1 protein_id gnl|my_center|LOCUS_02500 42745 44031 gene locus_tag LOCUS_02510 42745 44031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 44028 45407 gene locus_tag LOCUS_02520 44028 45407 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678974.1 protein_id gnl|my_center|LOCUS_02520 45411 46481 gene locus_tag LOCUS_02530 45411 46481 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678975.1 protein_id gnl|my_center|LOCUS_02530 46481 46954 gene locus_tag LOCUS_02540 46481 46954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 46954 47568 gene locus_tag LOCUS_02550 46954 47568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 47565 48128 gene locus_tag LOCUS_02560 47565 48128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 48125 48739 gene locus_tag LOCUS_02570 48125 48739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 48751 50748 gene locus_tag LOCUS_02580 48751 50748 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956965.1 protein_id gnl|my_center|LOCUS_02580 51031 53355 gene locus_tag LOCUS_02590 gene metG 51031 53355 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682373.1 protein_id gnl|my_center|LOCUS_02590 53959 53669 gene locus_tag LOCUS_02600 53959 53669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 56092 54260 gene locus_tag LOCUS_02610 56092 54260 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680731.1 protein_id gnl|my_center|LOCUS_02610 57283 56099 gene locus_tag LOCUS_02620 gene rlmD 57283 56099 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_02620 57398 58348 gene locus_tag LOCUS_02630 57398 58348 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_02630 58816 60492 gene locus_tag LOCUS_02640 58816 60492 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_02640 62142 60676 gene locus_tag LOCUS_02650 62142 60676 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_02650 62333 63187 gene locus_tag LOCUS_02660 62333 63187 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_02660 64234 63362 gene locus_tag LOCUS_02670 64234 63362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 64436 65134 gene locus_tag LOCUS_02680 gene deoD 64436 65134 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681557.1 protein_id gnl|my_center|LOCUS_02680 65202 66107 gene locus_tag LOCUS_02690 65202 66107 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681782.1 protein_id gnl|my_center|LOCUS_02690 66455 68965 gene locus_tag LOCUS_02700 gene thrA 66455 68965 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264698.1 protein_id gnl|my_center|LOCUS_02700 69075 69566 gene locus_tag LOCUS_02710 gene ilvN 69075 69566 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_02710 70126 69692 gene locus_tag LOCUS_02720 70126 69692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 70328 72199 gene locus_tag LOCUS_02730 70328 72199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 72844 72224 gene locus_tag LOCUS_02740 72844 72224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678723.1 protein_id gnl|my_center|LOCUS_02740 73547 72873 gene locus_tag LOCUS_02750 73547 72873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 75664 73661 gene locus_tag LOCUS_02760 gene mutL 75664 73661 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_02760 75936 75661 gene locus_tag LOCUS_02770 gene xseB 75936 75661 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674672.1 protein_id gnl|my_center|LOCUS_02770 77276 76038 gene locus_tag LOCUS_02780 gene xseA 77276 76038 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682333.1 protein_id gnl|my_center|LOCUS_02780 77374 79005 gene locus_tag LOCUS_02790 77374 79005 CDS product spiro-SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679625.1 protein_id gnl|my_center|LOCUS_02790 78980 79939 gene locus_tag LOCUS_02800 78980 79939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679623.1 protein_id gnl|my_center|LOCUS_02800 79936 82425 gene locus_tag LOCUS_02810 79936 82425 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679616.1 protein_id gnl|my_center|LOCUS_02810 82784 84415 gene locus_tag LOCUS_02820 82784 84415 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680053.1 protein_id gnl|my_center|LOCUS_02820 84461 85507 gene locus_tag LOCUS_02830 84461 85507 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679426.1 protein_id gnl|my_center|LOCUS_02830 85507 85971 gene locus_tag LOCUS_02840 85507 85971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 86227 87336 gene locus_tag LOCUS_02850 86227 87336 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670927.1 protein_id gnl|my_center|LOCUS_02850 87429 88793 gene locus_tag LOCUS_02860 87429 88793 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679418.1 protein_id gnl|my_center|LOCUS_02860 88806 90962 gene locus_tag LOCUS_02870 88806 90962 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679730.1 protein_id gnl|my_center|LOCUS_02870 91084 91845 gene locus_tag LOCUS_02880 91084 91845 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679729.1 protein_id gnl|my_center|LOCUS_02880 92104 91931 gene locus_tag LOCUS_02890 92104 91931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667639.1 protein_id gnl|my_center|LOCUS_02890 92292 92582 gene locus_tag LOCUS_02900 gene rpsT 92292 92582 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669392.1 protein_id gnl|my_center|LOCUS_02900 92732 93040 gene locus_tag LOCUS_02910 92732 93040 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669390.1 protein_id gnl|my_center|LOCUS_02910 93688 94563 gene locus_tag LOCUS_02920 93688 94563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 94694 95131 gene locus_tag LOCUS_02930 94694 95131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 95318 97108 gene locus_tag LOCUS_02940 95318 97108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 97316 97603 gene locus_tag LOCUS_02950 gene rpsF 97316 97603 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669351.1 protein_id gnl|my_center|LOCUS_02950 97627 98106 gene locus_tag LOCUS_02960 gene ssb 97627 98106 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669349.1 protein_id gnl|my_center|LOCUS_02960 98142 98474 gene locus_tag LOCUS_02970 98142 98474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 98570 99163 gene locus_tag LOCUS_02980 gene rplI 98570 99163 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679371.1 protein_id gnl|my_center|LOCUS_02980 99296 100633 gene locus_tag LOCUS_02990 gene dnaB 99296 100633 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669313.1 protein_id gnl|my_center|LOCUS_02990 100748 100675 gene locus_tag LOCUS_t00030 100748 100675 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 102276 100861 gene locus_tag LOCUS_03000 gene thrC 102276 100861 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680037.1 protein_id gnl|my_center|LOCUS_03000 103382 102366 gene locus_tag LOCUS_03010 103382 102366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 103756 103977 gene locus_tag LOCUS_03020 103756 103977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 104153 104857 gene locus_tag LOCUS_03030 104153 104857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 104847 106196 gene locus_tag LOCUS_03040 104847 106196 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_03040 106397 107767 gene locus_tag LOCUS_03050 gene rsxC 106397 107767 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682097.1 protein_id gnl|my_center|LOCUS_03050 107767 108786 gene locus_tag LOCUS_03060 107767 108786 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002685644.1 protein_id gnl|my_center|LOCUS_03060 108791 109393 gene locus_tag LOCUS_03070 108791 109393 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670122.1 protein_id gnl|my_center|LOCUS_03070 109534 110196 gene locus_tag LOCUS_03080 109534 110196 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670120.1 protein_id gnl|my_center|LOCUS_03080 110189 110767 gene locus_tag LOCUS_03090 110189 110767 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670118.1 protein_id gnl|my_center|LOCUS_03090 110888 111721 gene locus_tag LOCUS_03100 110888 111721 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669703.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence04 414 1208 gene locus_tag LOCUS_03110 414 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03110 1580 1209 gene locus_tag LOCUS_03120 1580 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 1695 2765 gene locus_tag LOCUS_03130 1695 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2767 3591 gene locus_tag LOCUS_03140 2767 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 4681 3608 gene locus_tag LOCUS_03150 4681 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 5166 4672 gene locus_tag LOCUS_03160 5166 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 5516 5325 gene locus_tag LOCUS_03170 5516 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 6277 5513 gene locus_tag LOCUS_03180 6277 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 6566 6267 gene locus_tag LOCUS_03190 6566 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6831 6589 gene locus_tag LOCUS_03200 6831 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 7051 6875 gene locus_tag LOCUS_03210 7051 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 7383 7051 gene locus_tag LOCUS_03220 7383 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 7828 11034 gene locus_tag LOCUS_03230 gene ileS 7828 11034 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_03230 11042 11989 gene locus_tag LOCUS_03240 11042 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 11998 12672 gene locus_tag LOCUS_03250 11998 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 14203 12725 gene locus_tag LOCUS_03260 14203 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 15714 14200 gene locus_tag LOCUS_03270 15714 14200 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679114.1 protein_id gnl|my_center|LOCUS_03270 16723 15716 gene locus_tag LOCUS_03280 16723 15716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 20770 17327 gene locus_tag LOCUS_03290 20770 17327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 20950 21453 gene locus_tag LOCUS_03300 20950 21453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 21434 21988 gene locus_tag LOCUS_03310 21434 21988 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679118.1 protein_id gnl|my_center|LOCUS_03310 24132 22057 gene locus_tag LOCUS_03320 24132 22057 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044978168.1 protein_id gnl|my_center|LOCUS_03320 25391 24546 gene locus_tag LOCUS_03330 25391 24546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 26570 25605 gene locus_tag LOCUS_03340 26570 25605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 27031 26567 gene locus_tag LOCUS_03350 gene smpB 27031 26567 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668932.1 protein_id gnl|my_center|LOCUS_03350 27223 27918 gene locus_tag LOCUS_03360 gene lepB 27223 27918 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668934.1 protein_id gnl|my_center|LOCUS_03360 27955 29295 gene locus_tag LOCUS_03370 gene hemW 27955 29295 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679120.1 protein_id gnl|my_center|LOCUS_03370 29415 29615 gene locus_tag LOCUS_03380 29415 29615 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680829.1 protein_id gnl|my_center|LOCUS_03380 29615 30397 gene locus_tag LOCUS_03390 29615 30397 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666986.1 protein_id gnl|my_center|LOCUS_03390 30473 31201 gene locus_tag LOCUS_03400 gene motB 30473 31201 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666988.1 protein_id gnl|my_center|LOCUS_03400 31380 31925 gene locus_tag LOCUS_03410 31380 31925 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666989.1 protein_id gnl|my_center|LOCUS_03410 31949 32983 gene locus_tag LOCUS_03420 gene fliM 31949 32983 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666990.1 protein_id gnl|my_center|LOCUS_03420 32980 34191 gene locus_tag LOCUS_03430 32980 34191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 34308 34961 gene locus_tag LOCUS_03440 34308 34961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 34961 35800 gene locus_tag LOCUS_03450 gene fliP 34961 35800 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680826.1 protein_id gnl|my_center|LOCUS_03450 35892 36161 gene locus_tag LOCUS_03460 gene fliQ 35892 36161 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666830.1 protein_id gnl|my_center|LOCUS_03460 36164 36973 gene locus_tag LOCUS_03470 gene fliR 36164 36973 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673318.1 protein_id gnl|my_center|LOCUS_03470 36970 38079 gene locus_tag LOCUS_03480 gene flhB 36970 38079 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680909.1 protein_id gnl|my_center|LOCUS_03480 38188 40365 gene locus_tag LOCUS_03490 gene flhA 38188 40365 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684593.1 protein_id gnl|my_center|LOCUS_03490 40358 41629 gene locus_tag LOCUS_03500 gene flhF 40358 41629 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556869.1 protein_id gnl|my_center|LOCUS_03500 41856 42713 gene locus_tag LOCUS_03510 41856 42713 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680723.1 protein_id gnl|my_center|LOCUS_03510 42930 43850 gene locus_tag LOCUS_03520 42930 43850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 43879 44697 gene locus_tag LOCUS_03530 gene whiG 43879 44697 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_03530 45176 47140 gene locus_tag LOCUS_03540 45176 47140 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667114.1 protein_id gnl|my_center|LOCUS_03540 47142 47471 gene locus_tag LOCUS_03550 47142 47471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667116.1 protein_id gnl|my_center|LOCUS_03550 47474 48193 gene locus_tag LOCUS_03560 47474 48193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 48526 49146 gene locus_tag LOCUS_03570 48526 49146 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678965.1 protein_id gnl|my_center|LOCUS_03570 49147 49692 gene locus_tag LOCUS_03580 49147 49692 CDS product DUF2764 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678963.1 protein_id gnl|my_center|LOCUS_03580 49689 51458 gene locus_tag LOCUS_03590 49689 51458 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_03590 51458 52762 gene locus_tag LOCUS_03600 51458 52762 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_03600 52775 53386 gene locus_tag LOCUS_03610 52775 53386 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_03610 53389 55317 gene locus_tag LOCUS_03620 53389 55317 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_03620 55379 55801 gene locus_tag LOCUS_03630 55379 55801 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669353.1 protein_id gnl|my_center|LOCUS_03630 55994 57127 gene locus_tag LOCUS_03640 55994 57127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 57313 58401 gene locus_tag LOCUS_03650 gene ispG 57313 58401 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678768.1 protein_id gnl|my_center|LOCUS_03650 58405 59538 gene locus_tag LOCUS_03660 58405 59538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 61332 59695 gene locus_tag LOCUS_03670 61332 59695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681908.1 protein_id gnl|my_center|LOCUS_03670 62714 61332 gene locus_tag LOCUS_03680 62714 61332 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294624.1 protein_id gnl|my_center|LOCUS_03680 62899 65157 gene locus_tag LOCUS_03690 62899 65157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 67134 66007 gene locus_tag LOCUS_03700 67134 66007 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_03700 68210 67131 gene locus_tag LOCUS_03710 68210 67131 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966351.1 protein_id gnl|my_center|LOCUS_03710 70194 68359 gene locus_tag LOCUS_03720 70194 68359 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679016.1 protein_id gnl|my_center|LOCUS_03720 71352 70228 gene locus_tag LOCUS_03730 gene aepY 71352 70228 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679014.1 protein_id gnl|my_center|LOCUS_03730 72687 71389 gene locus_tag LOCUS_03740 gene aepX 72687 71389 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679012.1 protein_id gnl|my_center|LOCUS_03740 74130 72871 gene locus_tag LOCUS_03750 74130 72871 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_03750 76821 74143 gene locus_tag LOCUS_03760 76821 74143 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679058.1 protein_id gnl|my_center|LOCUS_03760 79668 76954 gene locus_tag LOCUS_03770 79668 76954 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679058.1 protein_id gnl|my_center|LOCUS_03770 81238 79904 gene locus_tag LOCUS_03780 81238 79904 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_03780 81465 82571 gene locus_tag LOCUS_03790 81465 82571 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107230.1 protein_id gnl|my_center|LOCUS_03790 83584 82574 gene locus_tag LOCUS_03800 83584 82574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 83735 83974 gene locus_tag LOCUS_03810 83735 83974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 83987 84145 gene locus_tag LOCUS_03820 83987 84145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 84247 85167 gene locus_tag LOCUS_03830 84247 85167 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438698.1 protein_id gnl|my_center|LOCUS_03830 85185 86018 gene locus_tag LOCUS_03840 85185 86018 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_03840 87358 86477 gene locus_tag LOCUS_03850 87358 86477 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_03850 88849 87938 gene locus_tag LOCUS_03860 88849 87938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 90476 88905 gene locus_tag LOCUS_03870 90476 88905 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_03870 90728 90507 gene locus_tag LOCUS_03880 90728 90507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 91953 90769 gene locus_tag LOCUS_03890 gene lysA 91953 90769 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316154.1 protein_id gnl|my_center|LOCUS_03890 93445 91943 gene locus_tag LOCUS_03900 93445 91943 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_03900 94509 93586 gene locus_tag LOCUS_03910 94509 93586 CDS product capsular polysaccharide synthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101280.1 protein_id gnl|my_center|LOCUS_03910 95436 94522 gene locus_tag LOCUS_03920 95436 94522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 96989 95433 gene locus_tag LOCUS_03930 96989 95433 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680484.1 protein_id gnl|my_center|LOCUS_03930 97179 98657 gene locus_tag LOCUS_03940 97179 98657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 98645 98836 gene locus_tag LOCUS_03950 98645 98836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 99973 98825 gene locus_tag LOCUS_03960 99973 98825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence05 <1 711 gene locus_tag LOCUS_03970 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906091.1:alpha-amylase family glycosyl hydrolase 2988 829 gene locus_tag LOCUS_03980 2988 829 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679969.1 protein_id gnl|my_center|LOCUS_03980 3524 7198 gene locus_tag LOCUS_03990 3524 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 8584 7436 gene locus_tag LOCUS_04000 8584 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 10482 8659 gene locus_tag LOCUS_04010 10482 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 11038 10484 gene locus_tag LOCUS_04020 11038 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 13909 11039 gene locus_tag LOCUS_04030 13909 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 14472 14131 gene locus_tag LOCUS_04040 14472 14131 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_04040 14753 15262 gene locus_tag LOCUS_04050 14753 15262 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082774.1 protein_id gnl|my_center|LOCUS_04050 15515 17257 gene locus_tag LOCUS_04060 15515 17257 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109303.1 protein_id gnl|my_center|LOCUS_04060 17652 18224 gene locus_tag LOCUS_04070 17652 18224 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_04070 19917 18472 gene locus_tag LOCUS_04080 19917 18472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 20333 20127 gene locus_tag LOCUS_04090 20333 20127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 20821 20321 gene locus_tag LOCUS_04100 20821 20321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 21033 20818 gene locus_tag LOCUS_04110 21033 20818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 21417 21148 gene locus_tag LOCUS_04120 21417 21148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 22513 21569 gene locus_tag LOCUS_04130 22513 21569 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015669.1 protein_id gnl|my_center|LOCUS_04130 23825 22500 gene locus_tag LOCUS_04140 23825 22500 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_04140 24130 24447 gene locus_tag LOCUS_04150 24130 24447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 26465 24375 gene locus_tag LOCUS_04160 26465 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 27285 27019 gene locus_tag LOCUS_04170 27285 27019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 28973 27297 gene locus_tag LOCUS_04180 28973 27297 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_04180 29818 28973 gene locus_tag LOCUS_04190 29818 28973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 30042 30635 gene locus_tag LOCUS_04200 30042 30635 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263037.1 protein_id gnl|my_center|LOCUS_04200 30605 33202 gene locus_tag LOCUS_04210 30605 33202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 34105 33425 gene locus_tag LOCUS_04220 34105 33425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 36399 34228 gene locus_tag LOCUS_04230 36399 34228 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948404.1 protein_id gnl|my_center|LOCUS_04230 38429 36669 gene locus_tag LOCUS_04240 gene ilvB 38429 36669 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094808.1 protein_id gnl|my_center|LOCUS_04240 39535 38675 gene locus_tag LOCUS_04250 39535 38675 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670454.1 protein_id gnl|my_center|LOCUS_04250 40615 39812 gene locus_tag LOCUS_04260 40615 39812 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681967.1 protein_id gnl|my_center|LOCUS_04260 41172 40684 gene locus_tag LOCUS_04270 41172 40684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 43601 41169 gene locus_tag LOCUS_04280 43601 41169 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681965.1 protein_id gnl|my_center|LOCUS_04280 44838 43594 gene locus_tag LOCUS_04290 44838 43594 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681964.1 protein_id gnl|my_center|LOCUS_04290 46398 44908 gene locus_tag LOCUS_04300 46398 44908 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681937.1 protein_id gnl|my_center|LOCUS_04300 47556 46417 gene locus_tag LOCUS_04310 gene rfbB 47556 46417 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679073.1 protein_id gnl|my_center|LOCUS_04310 48176 47592 gene locus_tag LOCUS_04320 gene rfbC 48176 47592 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_04320 49142 48267 gene locus_tag LOCUS_04330 gene rfbA 49142 48267 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679070.1 protein_id gnl|my_center|LOCUS_04330 50727 49198 gene locus_tag LOCUS_04340 50727 49198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 51752 50745 gene locus_tag LOCUS_04350 51752 50745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 53608 52013 gene locus_tag LOCUS_04360 53608 52013 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894984.1 protein_id gnl|my_center|LOCUS_04360 53973 53608 gene locus_tag LOCUS_04370 53973 53608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 55895 54255 gene locus_tag LOCUS_04380 55895 54255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 56493 55963 gene locus_tag LOCUS_04390 56493 55963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 56598 57830 gene locus_tag LOCUS_04400 56598 57830 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_04400 58153 59040 gene locus_tag LOCUS_04410 58153 59040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 62017 59312 gene locus_tag LOCUS_04420 62017 59312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 62190 62534 gene locus_tag LOCUS_04430 62190 62534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 63297 62599 gene locus_tag LOCUS_04440 63297 62599 CDS product tRNA 2-thiocytidine biosynthesis TtcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666040.1 protein_id gnl|my_center|LOCUS_04440 63893 63294 gene locus_tag LOCUS_04450 63893 63294 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263803.1 protein_id gnl|my_center|LOCUS_04450 64961 63936 gene locus_tag LOCUS_04460 64961 63936 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_04460 66325 65120 gene locus_tag LOCUS_04470 66325 65120 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_04470 66641 66569 gene locus_tag LOCUS_t00040 66641 66569 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 66741 66669 gene locus_tag LOCUS_t00050 66741 66669 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 67119 68009 gene locus_tag LOCUS_04480 67119 68009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 68021 68968 gene locus_tag LOCUS_04490 68021 68968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 70530 69103 gene locus_tag LOCUS_04500 gene rpoN 70530 69103 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546561.1 protein_id gnl|my_center|LOCUS_04500 74326 70913 gene locus_tag LOCUS_04510 74326 70913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 74562 75854 gene locus_tag LOCUS_04520 74562 75854 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674553.1 protein_id gnl|my_center|LOCUS_04520 76092 76598 gene locus_tag LOCUS_04530 76092 76598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 76595 77845 gene locus_tag LOCUS_04540 76595 77845 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074034.1 protein_id gnl|my_center|LOCUS_04540 78001 78504 gene locus_tag LOCUS_04550 78001 78504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 79003 78668 gene locus_tag LOCUS_04560 79003 78668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 79332 79114 gene locus_tag LOCUS_04570 79332 79114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04570 80400 79405 gene locus_tag LOCUS_04580 80400 79405 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_04580 81302 80820 gene locus_tag LOCUS_04590 81302 80820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 81776 81420 gene locus_tag LOCUS_04600 81776 81420 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_04600 82243 81773 gene locus_tag LOCUS_04610 82243 81773 CDS product DUF6194 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434115.1 protein_id gnl|my_center|LOCUS_04610 82724 82260 gene locus_tag LOCUS_04620 82724 82260 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439097.1 protein_id gnl|my_center|LOCUS_04620 83970 83071 gene locus_tag LOCUS_04630 83970 83071 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966760.1 protein_id gnl|my_center|LOCUS_04630 84377 84880 gene locus_tag LOCUS_04640 84377 84880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 85008 85892 gene locus_tag LOCUS_04650 85008 85892 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_04650 86546 86238 gene locus_tag LOCUS_04660 86546 86238 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681704.1 protein_id gnl|my_center|LOCUS_04660 86916 86704 gene locus_tag LOCUS_04670 86916 86704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 86937 87239 gene locus_tag LOCUS_04680 86937 87239 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 protein_id gnl|my_center|LOCUS_04680 87501 88445 gene locus_tag LOCUS_04690 gene argF 87501 88445 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080343.1 protein_id gnl|my_center|LOCUS_04690 88527 88967 gene locus_tag LOCUS_04700 88527 88967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 88977 89963 gene locus_tag LOCUS_04710 88977 89963 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679142.1 protein_id gnl|my_center|LOCUS_04710 90020 91804 gene locus_tag LOCUS_04720 90020 91804 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682136.1 protein_id gnl|my_center|LOCUS_04720 92423 92148 gene locus_tag LOCUS_04730 92423 92148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 93448 92528 gene locus_tag LOCUS_04740 93448 92528 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680621.1 protein_id gnl|my_center|LOCUS_04740 94359 93559 gene locus_tag LOCUS_04750 gene map 94359 93559 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670900.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence06 442 1011 gene locus_tag LOCUS_04760 442 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1855 2307 gene locus_tag LOCUS_04770 1855 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2304 3257 gene locus_tag LOCUS_04780 2304 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3263 3535 gene locus_tag LOCUS_04790 3263 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 3881 4678 gene locus_tag LOCUS_04800 3881 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4671 5087 gene locus_tag LOCUS_04810 4671 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 5680 6927 gene locus_tag LOCUS_04820 5680 6927 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_04820 6965 8491 gene locus_tag LOCUS_04830 6965 8491 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103238290.1 protein_id gnl|my_center|LOCUS_04830 9330 9752 gene locus_tag LOCUS_04840 9330 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 9749 10696 gene locus_tag LOCUS_04850 9749 10696 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_04850 10693 11814 gene locus_tag LOCUS_04860 10693 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 11822 12946 gene locus_tag LOCUS_04870 11822 12946 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930613.1 protein_id gnl|my_center|LOCUS_04870 12951 13769 gene locus_tag LOCUS_04880 12951 13769 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963421.1 protein_id gnl|my_center|LOCUS_04880 13953 14711 gene locus_tag LOCUS_04890 13953 14711 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706684.1 protein_id gnl|my_center|LOCUS_04890 14794 15594 gene locus_tag LOCUS_04900 14794 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 15655 16326 gene locus_tag LOCUS_04910 gene wlbG 15655 16326 CDS product O-antigen biosynthesis protein WlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807105.1 protein_id gnl|my_center|LOCUS_04910 16336 17487 gene locus_tag LOCUS_04920 16336 17487 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202419.1 protein_id gnl|my_center|LOCUS_04920 17547 18749 gene locus_tag LOCUS_04930 17547 18749 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459669.1 protein_id gnl|my_center|LOCUS_04930 19221 19502 gene locus_tag LOCUS_04940 19221 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 19499 21040 gene locus_tag LOCUS_04950 19499 21040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 24800 21978 gene locus_tag LOCUS_04960 24800 21978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 25023 24802 gene locus_tag LOCUS_04970 25023 24802 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_04970 25618 25409 gene locus_tag LOCUS_04980 25618 25409 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_04980 27442 25856 gene locus_tag LOCUS_04990 27442 25856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 29839 27491 gene locus_tag LOCUS_05000 29839 27491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 30836 29904 gene locus_tag LOCUS_05010 30836 29904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 31742 31008 gene locus_tag LOCUS_05020 31742 31008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 32103 32945 gene locus_tag LOCUS_05030 32103 32945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 33065 33952 gene locus_tag LOCUS_05040 33065 33952 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 protein_id gnl|my_center|LOCUS_05040 34018 34794 gene locus_tag LOCUS_05050 34018 34794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 35295 34942 gene locus_tag LOCUS_05060 35295 34942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 35582 37042 gene locus_tag LOCUS_05070 35582 37042 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679921.1 protein_id gnl|my_center|LOCUS_05070 37039 37935 gene locus_tag LOCUS_05080 37039 37935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 38633 38884 gene locus_tag LOCUS_05090 38633 38884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 38911 40206 gene locus_tag LOCUS_05100 38911 40206 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678853.1 protein_id gnl|my_center|LOCUS_05100 40239 41417 gene locus_tag LOCUS_05110 40239 41417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 41411 42703 gene locus_tag LOCUS_05120 41411 42703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 42733 43599 gene locus_tag LOCUS_05130 gene rsmA 42733 43599 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682389.1 protein_id gnl|my_center|LOCUS_05130 46627 43793 gene locus_tag LOCUS_05140 46627 43793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 47261 47998 gene locus_tag LOCUS_05150 47261 47998 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_05150 47995 48618 gene locus_tag LOCUS_05160 47995 48618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 48618 49619 gene locus_tag LOCUS_05170 48618 49619 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682393.1 protein_id gnl|my_center|LOCUS_05170 49601 50425 gene locus_tag LOCUS_05180 49601 50425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 50562 50479 gene locus_tag LOCUS_t00060 50562 50479 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 51311 50991 gene locus_tag LOCUS_05190 51311 50991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 52765 51380 gene locus_tag LOCUS_05200 gene fumC 52765 51380 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456610.1 protein_id gnl|my_center|LOCUS_05200 53750 52803 gene locus_tag LOCUS_05210 53750 52803 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_05210 54825 54016 gene locus_tag LOCUS_05220 54825 54016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 56342 55158 gene locus_tag LOCUS_05230 56342 55158 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013598.1 protein_id gnl|my_center|LOCUS_05230 58059 56371 gene locus_tag LOCUS_05240 58059 56371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 58308 59387 gene locus_tag LOCUS_05250 gene trpS 58308 59387 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804845.1 protein_id gnl|my_center|LOCUS_05250 60619 59594 gene locus_tag LOCUS_05260 60619 59594 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678971.1 protein_id gnl|my_center|LOCUS_05260 60771 61250 gene locus_tag LOCUS_05270 60771 61250 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678972.1 protein_id gnl|my_center|LOCUS_05270 61338 61410 gene locus_tag LOCUS_t00070 61338 61410 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 61416 61498 gene locus_tag LOCUS_t00080 61416 61498 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 61563 62492 gene locus_tag LOCUS_05280 61563 62492 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669065.1 protein_id gnl|my_center|LOCUS_05280 62495 63544 gene locus_tag LOCUS_05290 gene mltG 62495 63544 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671179.1 protein_id gnl|my_center|LOCUS_05290 63563 65353 gene locus_tag LOCUS_05300 gene dnaG 63563 65353 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678905.1 protein_id gnl|my_center|LOCUS_05300 65340 67184 gene locus_tag LOCUS_05310 gene rpoD 65340 67184 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678907.1 protein_id gnl|my_center|LOCUS_05310 67298 68164 gene locus_tag LOCUS_05320 67298 68164 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671470.1 protein_id gnl|my_center|LOCUS_05320 68563 69501 gene locus_tag LOCUS_05330 68563 69501 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678909.1 protein_id gnl|my_center|LOCUS_05330 69563 70600 gene locus_tag LOCUS_05340 69563 70600 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668696.1 protein_id gnl|my_center|LOCUS_05340 70613 71479 gene locus_tag LOCUS_05350 gene mreC 70613 71479 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668697.1 protein_id gnl|my_center|LOCUS_05350 71567 72079 gene locus_tag LOCUS_05360 71567 72079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 72079 73962 gene locus_tag LOCUS_05370 gene mrdA 72079 73962 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671463.1 protein_id gnl|my_center|LOCUS_05370 73991 75325 gene locus_tag LOCUS_05380 gene rodA 73991 75325 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677908.1 protein_id gnl|my_center|LOCUS_05380 79274 75777 gene locus_tag LOCUS_05390 gene mfd 79274 75777 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678792.1 protein_id gnl|my_center|LOCUS_05390 79496 80431 gene locus_tag LOCUS_05400 79496 80431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670623.1 protein_id gnl|my_center|LOCUS_05400 >Feature sequence07 <1 945 gene locus_tag LOCUS_05410 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082494.1:DUF362 domain-containing protein 1340 2755 gene locus_tag LOCUS_05420 gene hydG 1340 2755 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_05420 3314 2871 gene locus_tag LOCUS_05430 3314 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 4878 3385 gene locus_tag LOCUS_05440 4878 3385 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062419932.1 protein_id gnl|my_center|LOCUS_05440 6806 4881 gene locus_tag LOCUS_05450 6806 4881 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957030.1 protein_id gnl|my_center|LOCUS_05450 7321 8229 gene locus_tag LOCUS_05460 7321 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 8245 10380 gene locus_tag LOCUS_05470 8245 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 10468 10722 gene locus_tag LOCUS_05480 10468 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05480 12005 10866 gene locus_tag LOCUS_05490 12005 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 13471 12242 gene locus_tag LOCUS_05500 13471 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 18118 13736 gene locus_tag LOCUS_05510 18118 13736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 18417 18492 gene locus_tag LOCUS_t00090 18417 18492 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19703 18507 gene locus_tag LOCUS_05520 19703 18507 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680173.1 protein_id gnl|my_center|LOCUS_05520 20448 19723 gene locus_tag LOCUS_05530 20448 19723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681678.1 protein_id gnl|my_center|LOCUS_05530 21216 20545 gene locus_tag LOCUS_05540 21216 20545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 21869 21213 gene locus_tag LOCUS_05550 21869 21213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 23291 22254 gene locus_tag LOCUS_05560 23291 22254 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680174.1 protein_id gnl|my_center|LOCUS_05560 24745 23291 gene locus_tag LOCUS_05570 24745 23291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 24888 25340 gene locus_tag LOCUS_05580 24888 25340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 25371 26345 gene locus_tag LOCUS_05590 25371 26345 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680508.1 protein_id gnl|my_center|LOCUS_05590 27269 26541 gene locus_tag LOCUS_05600 27269 26541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 27473 28801 gene locus_tag LOCUS_05610 gene glnA 27473 28801 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024100.1 protein_id gnl|my_center|LOCUS_05610 28791 29390 gene locus_tag LOCUS_05620 28791 29390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 30789 29395 gene locus_tag LOCUS_05630 30789 29395 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_05630 32138 30912 gene locus_tag LOCUS_05640 gene hydF 32138 30912 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_05640 33019 32141 gene locus_tag LOCUS_05650 33019 32141 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_05650 33356 33123 gene locus_tag LOCUS_05660 33356 33123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 34233 33343 gene locus_tag LOCUS_05670 34233 33343 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014665.1 protein_id gnl|my_center|LOCUS_05670 34771 35289 gene locus_tag LOCUS_05680 34771 35289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 35453 36589 gene locus_tag LOCUS_05690 35453 36589 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681927.1 protein_id gnl|my_center|LOCUS_05690 36644 37873 gene locus_tag LOCUS_05700 36644 37873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 40735 37958 gene locus_tag LOCUS_05710 40735 37958 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957294.1 protein_id gnl|my_center|LOCUS_05710 42278 41115 gene locus_tag LOCUS_05720 42278 41115 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_05720 42522 43277 gene locus_tag LOCUS_05730 42522 43277 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_05730 43270 44205 gene locus_tag LOCUS_05740 43270 44205 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681789.1 protein_id gnl|my_center|LOCUS_05740 45034 44276 gene locus_tag LOCUS_05750 45034 44276 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_05750 45391 45059 gene locus_tag LOCUS_05760 45391 45059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 45521 46765 gene locus_tag LOCUS_05770 45521 46765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 47096 46782 gene locus_tag LOCUS_05780 47096 46782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 47179 48546 gene locus_tag LOCUS_05790 gene argA 47179 48546 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813237.1 protein_id gnl|my_center|LOCUS_05790 49523 48819 gene locus_tag LOCUS_05800 49523 48819 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_05800 50627 49587 gene locus_tag LOCUS_05810 50627 49587 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680321.1 protein_id gnl|my_center|LOCUS_05810 51446 50652 gene locus_tag LOCUS_05820 51446 50652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 52516 51821 gene locus_tag LOCUS_05830 52516 51821 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667657.1 protein_id gnl|my_center|LOCUS_05830 54372 52600 gene locus_tag LOCUS_05840 gene yidC 54372 52600 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680325.1 protein_id gnl|my_center|LOCUS_05840 54608 54387 gene locus_tag LOCUS_05850 gene yidD 54608 54387 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_05850 54964 54605 gene locus_tag LOCUS_05860 54964 54605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 55131 54976 gene locus_tag LOCUS_05870 gene rpmH 55131 54976 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557032.1 protein_id gnl|my_center|LOCUS_05870 55913 55401 gene locus_tag LOCUS_05880 55913 55401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 57010 55910 gene locus_tag LOCUS_05890 gene recF 57010 55910 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681135.1 protein_id gnl|my_center|LOCUS_05890 58150 57047 gene locus_tag LOCUS_05900 gene dnaN 58150 57047 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681136.1 protein_id gnl|my_center|LOCUS_05900 59812 58412 gene locus_tag LOCUS_05910 gene dnaA 59812 58412 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680852.1 protein_id gnl|my_center|LOCUS_05910 60154 62073 gene locus_tag LOCUS_05920 gene gyrB 60154 62073 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666949.1 protein_id gnl|my_center|LOCUS_05920 62152 64608 gene locus_tag LOCUS_05930 gene gyrA 62152 64608 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681235.1 protein_id gnl|my_center|LOCUS_05930 67579 66224 gene locus_tag LOCUS_05940 67579 66224 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_05940 67746 69011 gene locus_tag LOCUS_05950 67746 69011 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253435.1 protein_id gnl|my_center|LOCUS_05950 69875 69057 gene locus_tag LOCUS_05960 gene proB 69875 69057 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_05960 70051 69978 gene locus_tag LOCUS_t00100 70051 69978 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 70261 72963 gene locus_tag LOCUS_05970 gene ppdK 70261 72963 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_05970 74356 73079 gene locus_tag LOCUS_05980 74356 73079 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_05980 74530 75408 gene locus_tag LOCUS_05990 74530 75408 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_05990 76926 75445 gene locus_tag LOCUS_06000 76926 75445 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674379.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence08 2126 369 gene locus_tag LOCUS_06010 gene lepB 2126 369 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680071.1 protein_id gnl|my_center|LOCUS_06010 3360 2173 gene locus_tag LOCUS_06020 3360 2173 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062984.1 protein_id gnl|my_center|LOCUS_06020 4271 4190 gene locus_tag LOCUS_t00110 4271 4190 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5261 4539 gene locus_tag LOCUS_06030 5261 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 7412 5376 gene locus_tag LOCUS_06040 gene fusA 7412 5376 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681223.1 protein_id gnl|my_center|LOCUS_06040 8069 10129 gene locus_tag LOCUS_06050 8069 10129 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_06050 10258 11796 gene locus_tag LOCUS_06060 gene gatB 10258 11796 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681743.1 protein_id gnl|my_center|LOCUS_06060 14099 11823 gene locus_tag LOCUS_06070 14099 11823 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454973.1 protein_id gnl|my_center|LOCUS_06070 15454 14273 gene locus_tag LOCUS_06080 15454 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 15771 15544 gene locus_tag LOCUS_06090 15771 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 19012 15968 gene locus_tag LOCUS_06100 19012 15968 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679557.1 protein_id gnl|my_center|LOCUS_06100 20147 18993 gene locus_tag LOCUS_06110 20147 18993 CDS product FliG C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678791.1 protein_id gnl|my_center|LOCUS_06110 20402 21367 gene locus_tag LOCUS_06120 20402 21367 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_06120 21403 23055 gene locus_tag LOCUS_06130 21403 23055 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_06130 23087 23329 gene locus_tag LOCUS_06140 23087 23329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 24907 23627 gene locus_tag LOCUS_06150 24907 23627 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_06150 25344 25679 gene locus_tag LOCUS_06160 25344 25679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 25676 26971 gene locus_tag LOCUS_06170 25676 26971 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_06170 28254 27154 gene locus_tag LOCUS_06180 28254 27154 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_06180 28355 28579 gene locus_tag LOCUS_06190 28355 28579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 28647 29000 gene locus_tag LOCUS_06200 28647 29000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 28958 29248 gene locus_tag LOCUS_06210 28958 29248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 29249 29689 gene locus_tag LOCUS_06220 29249 29689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 30638 29823 gene locus_tag LOCUS_06230 30638 29823 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379605.1 protein_id gnl|my_center|LOCUS_06230 31030 30641 gene locus_tag LOCUS_06240 gene tagD 31030 30641 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 protein_id gnl|my_center|LOCUS_06240 32229 31027 gene locus_tag LOCUS_06250 32229 31027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 33031 33249 gene locus_tag LOCUS_06260 33031 33249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 34271 33291 gene locus_tag LOCUS_06270 34271 33291 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 protein_id gnl|my_center|LOCUS_06270 34930 34316 gene locus_tag LOCUS_06280 34930 34316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 35124 34927 gene locus_tag LOCUS_06290 35124 34927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 35428 35796 gene locus_tag LOCUS_06300 35428 35796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 38077 36785 gene locus_tag LOCUS_06310 38077 36785 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765264.1 protein_id gnl|my_center|LOCUS_06310 38536 38237 gene locus_tag LOCUS_06320 38536 38237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 38775 38587 gene locus_tag LOCUS_06330 38775 38587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 39400 40122 gene locus_tag LOCUS_06340 39400 40122 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_06340 40136 40600 gene locus_tag LOCUS_06350 gene rnhA 40136 40600 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680554.1 protein_id gnl|my_center|LOCUS_06350 43946 41328 gene locus_tag LOCUS_06360 43946 41328 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971578.1 protein_id gnl|my_center|LOCUS_06360 45175 43937 gene locus_tag LOCUS_06370 45175 43937 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679158.1 protein_id gnl|my_center|LOCUS_06370 46221 45190 gene locus_tag LOCUS_06380 gene pta 46221 45190 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_06380 46511 47092 gene locus_tag LOCUS_06390 46511 47092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 47100 47717 gene locus_tag LOCUS_06400 47100 47717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_06400 47714 49528 gene locus_tag LOCUS_06410 47714 49528 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508136.1 protein_id gnl|my_center|LOCUS_06410 50969 49509 gene locus_tag LOCUS_06420 50969 49509 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680143.1 protein_id gnl|my_center|LOCUS_06420 52062 50995 gene locus_tag LOCUS_06430 52062 50995 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680147.1 protein_id gnl|my_center|LOCUS_06430 52208 53137 gene locus_tag LOCUS_06440 gene metA 52208 53137 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121523.1 protein_id gnl|my_center|LOCUS_06440 54547 53528 gene locus_tag LOCUS_06450 54547 53528 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_06450 55960 54899 gene locus_tag LOCUS_06460 55960 54899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 57148 56018 gene locus_tag LOCUS_06470 57148 56018 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680715.1 protein_id gnl|my_center|LOCUS_06470 58506 57241 gene locus_tag LOCUS_06480 58506 57241 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_06480 60490 58631 gene locus_tag LOCUS_06490 60490 58631 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682335.1 protein_id gnl|my_center|LOCUS_06490 61515 60493 gene locus_tag LOCUS_06500 61515 60493 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266701.1 protein_id gnl|my_center|LOCUS_06500 62977 62129 gene locus_tag LOCUS_06510 62977 62129 CDS product TRAP transporter TatT component family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682338.1 protein_id gnl|my_center|LOCUS_06510 62988 63176 gene locus_tag LOCUS_06520 62988 63176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 63414 64772 gene locus_tag LOCUS_06530 63414 64772 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_06530 64769 65518 gene locus_tag LOCUS_06540 64769 65518 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 protein_id gnl|my_center|LOCUS_06540 66678 65485 gene locus_tag LOCUS_06550 66678 65485 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_06550 68666 67110 gene locus_tag LOCUS_06560 gene cls 68666 67110 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_06560 70686 68893 gene locus_tag LOCUS_06570 70686 68893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 72638 70893 gene locus_tag LOCUS_06580 72638 70893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 72832 73545 gene locus_tag LOCUS_06590 72832 73545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence09 146 337 gene locus_tag LOCUS_06600 146 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 411 1337 gene locus_tag LOCUS_06610 411 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 2073 1327 gene locus_tag LOCUS_06620 2073 1327 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681823.1 protein_id gnl|my_center|LOCUS_06620 2407 2198 gene locus_tag LOCUS_06630 gene rpsU 2407 2198 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673965.1 protein_id gnl|my_center|LOCUS_06630 3500 4840 gene locus_tag LOCUS_06640 3500 4840 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_06640 5266 5967 gene locus_tag LOCUS_06650 5266 5967 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_06650 5986 7026 gene locus_tag LOCUS_06660 5986 7026 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013616093.1 protein_id gnl|my_center|LOCUS_06660 7144 7614 gene locus_tag LOCUS_06670 7144 7614 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965786.1 protein_id gnl|my_center|LOCUS_06670 8567 7650 gene locus_tag LOCUS_06680 8567 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 8799 9404 gene locus_tag LOCUS_06690 8799 9404 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681814.1 protein_id gnl|my_center|LOCUS_06690 9433 11388 gene locus_tag LOCUS_06700 gene dnaK 9433 11388 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681815.1 protein_id gnl|my_center|LOCUS_06700 11617 13647 gene locus_tag LOCUS_06710 11617 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 14009 14692 gene locus_tag LOCUS_06720 14009 14692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 14917 15435 gene locus_tag LOCUS_06730 14917 15435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 15666 16805 gene locus_tag LOCUS_06740 gene dnaJ 15666 16805 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002686888.1 protein_id gnl|my_center|LOCUS_06740 16830 19457 gene locus_tag LOCUS_06750 16830 19457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 20463 19789 gene locus_tag LOCUS_06760 gene tenA 20463 19789 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_06760 23184 20521 gene locus_tag LOCUS_06770 gene lon 23184 20521 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681876.1 protein_id gnl|my_center|LOCUS_06770 25074 23449 gene locus_tag LOCUS_06780 25074 23449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 26160 25096 gene locus_tag LOCUS_06790 26160 25096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 26517 26170 gene locus_tag LOCUS_06800 26517 26170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 28549 26585 gene locus_tag LOCUS_06810 gene tkt 28549 26585 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678841.1 protein_id gnl|my_center|LOCUS_06810 29037 28570 gene locus_tag LOCUS_06820 29037 28570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 30446 29076 gene locus_tag LOCUS_06830 30446 29076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 31911 30616 gene locus_tag LOCUS_06840 31911 30616 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_06840 32531 32971 gene locus_tag LOCUS_06850 gene dut 32531 32971 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682351.1 protein_id gnl|my_center|LOCUS_06850 33116 34321 gene locus_tag LOCUS_06860 33116 34321 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670521.1 protein_id gnl|my_center|LOCUS_06860 34389 35468 gene locus_tag LOCUS_06870 34389 35468 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963702.1 protein_id gnl|my_center|LOCUS_06870 35596 36720 gene locus_tag LOCUS_06880 gene tgt 35596 36720 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681512.1 protein_id gnl|my_center|LOCUS_06880 37097 38734 gene locus_tag LOCUS_06890 37097 38734 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681511.1 protein_id gnl|my_center|LOCUS_06890 39198 40199 gene locus_tag LOCUS_06900 39198 40199 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690326.1 protein_id gnl|my_center|LOCUS_06900 40201 41154 gene locus_tag LOCUS_06910 40201 41154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 41185 43668 gene locus_tag LOCUS_06920 41185 43668 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108228.1 protein_id gnl|my_center|LOCUS_06920 44330 45553 gene locus_tag LOCUS_06930 44330 45553 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545033.1 protein_id gnl|my_center|LOCUS_06930 45887 48688 gene locus_tag LOCUS_06940 45887 48688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 48779 51082 gene locus_tag LOCUS_06950 48779 51082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 52582 51110 gene locus_tag LOCUS_06960 gene gatA 52582 51110 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956776.1 protein_id gnl|my_center|LOCUS_06960 52930 52610 gene locus_tag LOCUS_06970 gene gatC 52930 52610 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665812.1 protein_id gnl|my_center|LOCUS_06970 53787 53299 gene locus_tag LOCUS_06980 gene dfrA 53787 53299 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_06980 54270 53791 gene locus_tag LOCUS_06990 54270 53791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680977.1 protein_id gnl|my_center|LOCUS_06990 54790 54350 gene locus_tag LOCUS_07000 gene fliS 54790 54350 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080180.1 protein_id gnl|my_center|LOCUS_07000 55181 57223 gene locus_tag LOCUS_07010 gene ftsH 55181 57223 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666001.1 protein_id gnl|my_center|LOCUS_07010 57421 58176 gene locus_tag LOCUS_07020 gene pflA 57421 58176 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_07020 59162 58356 gene locus_tag LOCUS_07030 59162 58356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 60355 59213 gene locus_tag LOCUS_07040 gene pepQ 60355 59213 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146836.1 protein_id gnl|my_center|LOCUS_07040 62028 60352 gene locus_tag LOCUS_07050 gene murJ 62028 60352 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681318.1 protein_id gnl|my_center|LOCUS_07050 63277 62240 gene locus_tag LOCUS_07060 63277 62240 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613385.1 protein_id gnl|my_center|LOCUS_07060 65034 63340 gene locus_tag LOCUS_07070 gene leuA 65034 63340 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437098.1 protein_id gnl|my_center|LOCUS_07070 65375 65623 gene locus_tag LOCUS_07080 65375 65623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 65610 65918 gene locus_tag LOCUS_07090 65610 65918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 67214 66219 gene locus_tag LOCUS_07100 67214 66219 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_07100 67420 68541 gene locus_tag LOCUS_07110 gene ugpC 67420 68541 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_07110 70639 68741 gene locus_tag LOCUS_07120 70639 68741 CDS product ribonuclease catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678953.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence10 265 1017 gene locus_tag LOCUS_07130 gene sufC 265 1017 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_07130 1387 2805 gene locus_tag LOCUS_07140 gene sufB 1387 2805 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_07140 2981 3913 gene locus_tag LOCUS_07150 gene sufD 2981 3913 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_07150 4233 5453 gene locus_tag LOCUS_07160 4233 5453 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_07160 5468 5947 gene locus_tag LOCUS_07170 5468 5947 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_07170 6138 6590 gene locus_tag LOCUS_07180 6138 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 8967 6649 gene locus_tag LOCUS_07190 8967 6649 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680253.1 protein_id gnl|my_center|LOCUS_07190 10474 9026 gene locus_tag LOCUS_07200 gene rimO 10474 9026 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680609.1 protein_id gnl|my_center|LOCUS_07200 11618 10533 gene locus_tag LOCUS_07210 11618 10533 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680601.1 protein_id gnl|my_center|LOCUS_07210 12305 11625 gene locus_tag LOCUS_07220 12305 11625 CDS product outer-membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673641.1 protein_id gnl|my_center|LOCUS_07220 14206 12596 gene locus_tag LOCUS_07230 14206 12596 CDS product bifunctional anthranilate synthase component II/anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943371.1 protein_id gnl|my_center|LOCUS_07230 15409 14981 gene locus_tag LOCUS_07240 15409 14981 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264782.1 protein_id gnl|my_center|LOCUS_07240 16907 15414 gene locus_tag LOCUS_07250 gene trpE 16907 15414 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826697.1 protein_id gnl|my_center|LOCUS_07250 17077 17895 gene locus_tag LOCUS_07260 17077 17895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 18733 18098 gene locus_tag LOCUS_07270 18733 18098 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_07270 20258 18852 gene locus_tag LOCUS_07280 20258 18852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 21731 20283 gene locus_tag LOCUS_07290 21731 20283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 23556 21961 gene locus_tag LOCUS_07300 23556 21961 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679741.1 protein_id gnl|my_center|LOCUS_07300 24974 23946 gene locus_tag LOCUS_07310 24974 23946 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679323.1 protein_id gnl|my_center|LOCUS_07310 25240 26610 gene locus_tag LOCUS_07320 25240 26610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 27598 26687 gene locus_tag LOCUS_07330 gene mazG 27598 26687 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680184.1 protein_id gnl|my_center|LOCUS_07330 29476 27929 gene locus_tag LOCUS_07340 29476 27929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657803.1 protein_id gnl|my_center|LOCUS_07340 31363 29570 gene locus_tag LOCUS_07350 31363 29570 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989902.1 protein_id gnl|my_center|LOCUS_07350 31424 32017 gene locus_tag LOCUS_07360 31424 32017 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669797.1 protein_id gnl|my_center|LOCUS_07360 32029 33126 gene locus_tag LOCUS_07370 32029 33126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 34343 33228 gene locus_tag LOCUS_07380 34343 33228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 34598 35206 gene locus_tag LOCUS_07390 gene pth 34598 35206 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672368.1 protein_id gnl|my_center|LOCUS_07390 35844 35221 gene locus_tag LOCUS_07400 35844 35221 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680767.1 protein_id gnl|my_center|LOCUS_07400 39782 35844 gene locus_tag LOCUS_07410 39782 35844 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682402.1 protein_id gnl|my_center|LOCUS_07410 40049 40717 gene locus_tag LOCUS_07420 40049 40717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681839.1 protein_id gnl|my_center|LOCUS_07420 42158 40899 gene locus_tag LOCUS_07430 gene secF 42158 40899 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681892.1 protein_id gnl|my_center|LOCUS_07430 43899 42160 gene locus_tag LOCUS_07440 gene secD 43899 42160 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681894.1 protein_id gnl|my_center|LOCUS_07440 44356 43913 gene locus_tag LOCUS_07450 44356 43913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 44913 44840 gene locus_tag LOCUS_t00120 44913 44840 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 45560 45709 gene locus_tag LOCUS_07460 45560 45709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 45999 48356 gene locus_tag LOCUS_07470 45999 48356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 49446 51230 gene locus_tag LOCUS_07480 49446 51230 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679748.1 protein_id gnl|my_center|LOCUS_07480 51259 51837 gene locus_tag LOCUS_07490 51259 51837 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669823.1 protein_id gnl|my_center|LOCUS_07490 54417 51976 gene locus_tag LOCUS_07500 gene bamA 54417 51976 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667239.1 protein_id gnl|my_center|LOCUS_07500 58779 54493 gene locus_tag LOCUS_07510 58779 54493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680585.1 protein_id gnl|my_center|LOCUS_07510 58667 58948 gene locus_tag LOCUS_07520 58667 58948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 59026 59649 gene locus_tag LOCUS_07530 gene tmk 59026 59649 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957272.1 protein_id gnl|my_center|LOCUS_07530 59646 60281 gene locus_tag LOCUS_07540 59646 60281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680583.1 protein_id gnl|my_center|LOCUS_07540 60291 61553 gene locus_tag LOCUS_07550 60291 61553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 61553 62716 gene locus_tag LOCUS_07560 61553 62716 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680952.1 protein_id gnl|my_center|LOCUS_07560 63536 62754 gene locus_tag LOCUS_07570 gene thiD 63536 62754 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_07570 63945 63541 gene locus_tag LOCUS_07580 63945 63541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 64582 63926 gene locus_tag LOCUS_07590 64582 63926 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_07590 64779 65495 gene locus_tag LOCUS_07600 64779 65495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 66809 65631 gene locus_tag LOCUS_07610 66809 65631 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_07610 68136 67018 gene locus_tag LOCUS_07620 gene serC 68136 67018 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_07620 69394 68369 gene locus_tag LOCUS_07630 69394 68369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 69822 69397 gene locus_tag LOCUS_07640 69822 69397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence11 347 1537 gene locus_tag LOCUS_07650 347 1537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_07650 1534 2457 gene locus_tag LOCUS_07660 1534 2457 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_07660 2454 3344 gene locus_tag LOCUS_07670 2454 3344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627435.1 protein_id gnl|my_center|LOCUS_07670 3364 4392 gene locus_tag LOCUS_07680 3364 4392 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_07680 4448 6202 gene locus_tag LOCUS_07690 gene thrS 4448 6202 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682400.1 protein_id gnl|my_center|LOCUS_07690 6199 6333 gene locus_tag LOCUS_07700 6199 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 9207 6544 gene locus_tag LOCUS_07710 9207 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 10229 9468 gene locus_tag LOCUS_07720 10229 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 10937 10275 gene locus_tag LOCUS_07730 10937 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 11897 10953 gene locus_tag LOCUS_07740 11897 10953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 14271 11917 gene locus_tag LOCUS_07750 gene rpsA 14271 11917 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679883.1 protein_id gnl|my_center|LOCUS_07750 15077 14304 gene locus_tag LOCUS_07760 15077 14304 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682155.1 protein_id gnl|my_center|LOCUS_07760 15600 15061 gene locus_tag LOCUS_07770 gene scpB 15600 15061 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672067.1 protein_id gnl|my_center|LOCUS_07770 18716 15849 gene locus_tag LOCUS_07780 18716 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 20148 19390 gene locus_tag LOCUS_07790 20148 19390 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670199.1 protein_id gnl|my_center|LOCUS_07790 20784 20218 gene locus_tag LOCUS_07800 20784 20218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 21989 20784 gene locus_tag LOCUS_07810 gene recA 21989 20784 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682153.1 protein_id gnl|my_center|LOCUS_07810 23351 22245 gene locus_tag LOCUS_07820 23351 22245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667248.1 protein_id gnl|my_center|LOCUS_07820 24620 23355 gene locus_tag LOCUS_07830 24620 23355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 25539 24637 gene locus_tag LOCUS_07840 25539 24637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 26222 25602 gene locus_tag LOCUS_07850 gene rpe 26222 25602 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957271.1 protein_id gnl|my_center|LOCUS_07850 26888 27670 gene locus_tag LOCUS_07860 26888 27670 CDS product DNA repair protein RecO C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681503.1 protein_id gnl|my_center|LOCUS_07860 27667 29037 gene locus_tag LOCUS_07870 27667 29037 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680036.1 protein_id gnl|my_center|LOCUS_07870 29040 31196 gene locus_tag LOCUS_07880 gene recJ 29040 31196 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680035.1 protein_id gnl|my_center|LOCUS_07880 31574 31849 gene locus_tag LOCUS_07890 31574 31849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 32413 31961 gene locus_tag LOCUS_07900 32413 31961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 33152 32808 gene locus_tag LOCUS_07910 33152 32808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 33262 34428 gene locus_tag LOCUS_07920 33262 34428 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202468.1 protein_id gnl|my_center|LOCUS_07920 34409 34660 gene locus_tag LOCUS_07930 34409 34660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 34932 34720 gene locus_tag LOCUS_07940 34932 34720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07940 35102 34929 gene locus_tag LOCUS_07950 35102 34929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 35779 35531 gene locus_tag LOCUS_07960 35779 35531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 36244 35861 gene locus_tag LOCUS_07970 36244 35861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 36386 36688 gene locus_tag LOCUS_07980 36386 36688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 37435 36905 gene locus_tag LOCUS_07990 37435 36905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 37790 37437 gene locus_tag LOCUS_08000 37790 37437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 38526 37801 gene locus_tag LOCUS_08010 38526 37801 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928717.1 protein_id gnl|my_center|LOCUS_08010 38992 40911 gene locus_tag LOCUS_08020 gene malZ 38992 40911 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257409.1 protein_id gnl|my_center|LOCUS_08020 42757 41144 gene locus_tag LOCUS_08030 42757 41144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 43523 42765 gene locus_tag LOCUS_08040 43523 42765 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 protein_id gnl|my_center|LOCUS_08040 44190 43540 gene locus_tag LOCUS_08050 44190 43540 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966882.1 protein_id gnl|my_center|LOCUS_08050 45109 44306 gene locus_tag LOCUS_08060 45109 44306 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_08060 45355 45152 gene locus_tag LOCUS_08070 45355 45152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 47637 45436 gene locus_tag LOCUS_08080 47637 45436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 49589 47790 gene locus_tag LOCUS_08090 gene lepA 49589 47790 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_08090 51327 49672 gene locus_tag LOCUS_08100 51327 49672 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678901.1 protein_id gnl|my_center|LOCUS_08100 53524 51350 gene locus_tag LOCUS_08110 53524 51350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 54931 53546 gene locus_tag LOCUS_08120 gene tilS 54931 53546 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678896.1 protein_id gnl|my_center|LOCUS_08120 55542 54991 gene locus_tag LOCUS_08130 55542 54991 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678895.1 protein_id gnl|my_center|LOCUS_08130 55649 55576 gene locus_tag LOCUS_t00130 55649 55576 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 56036 55755 gene locus_tag LOCUS_08140 gene spoVG 56036 55755 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_08140 56949 56080 gene locus_tag LOCUS_08150 gene ispE 56949 56080 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678892.1 protein_id gnl|my_center|LOCUS_08150 57372 56995 gene locus_tag LOCUS_08160 57372 56995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 57935 59344 gene locus_tag LOCUS_08170 57935 59344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679821.1 protein_id gnl|my_center|LOCUS_08170 59382 60968 gene locus_tag LOCUS_08180 59382 60968 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957136.1 protein_id gnl|my_center|LOCUS_08180 62394 61069 gene locus_tag LOCUS_08190 62394 61069 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_08190 63685 62867 gene locus_tag LOCUS_08200 gene murI 63685 62867 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679098.1 protein_id gnl|my_center|LOCUS_08200 64472 63939 gene locus_tag LOCUS_08210 64472 63939 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682322.1 protein_id gnl|my_center|LOCUS_08210 65309 64515 gene locus_tag LOCUS_08220 gene flgG 65309 64515 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670463.1 protein_id gnl|my_center|LOCUS_08220 66158 65361 gene locus_tag LOCUS_08230 gene flgF 66158 65361 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_08230 66365 68242 gene locus_tag LOCUS_08240 gene guaA 66365 68242 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234667.1 protein_id gnl|my_center|LOCUS_08240 68921 68391 gene locus_tag LOCUS_08250 68921 68391 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682399.1 protein_id gnl|my_center|LOCUS_08250 69864 68998 gene locus_tag LOCUS_08260 69864 68998 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682397.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence12 137 385 gene locus_tag LOCUS_08270 137 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 609 1862 gene locus_tag LOCUS_08280 gene trpB 609 1862 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_08280 1876 2625 gene locus_tag LOCUS_08290 gene trpA 1876 2625 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_08290 3231 2743 gene locus_tag LOCUS_08300 3231 2743 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963397.1 protein_id gnl|my_center|LOCUS_08300 4152 3553 gene locus_tag LOCUS_08310 gene pgsA 4152 3553 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667297.1 protein_id gnl|my_center|LOCUS_08310 4999 4178 gene locus_tag LOCUS_08320 4999 4178 CDS product cytidylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956669.1 protein_id gnl|my_center|LOCUS_08320 5526 5023 gene locus_tag LOCUS_08330 5526 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 8204 5526 gene locus_tag LOCUS_08340 8204 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 8667 9059 gene locus_tag LOCUS_08350 8667 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 10267 9188 gene locus_tag LOCUS_08360 10267 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679444.1 protein_id gnl|my_center|LOCUS_08360 11061 11633 gene locus_tag LOCUS_08370 11061 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 12261 12668 gene locus_tag LOCUS_08380 12261 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 13161 14084 gene locus_tag LOCUS_08390 gene pyrB 13161 14084 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_08390 14206 14652 gene locus_tag LOCUS_08400 14206 14652 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_08400 14670 16106 gene locus_tag LOCUS_08410 14670 16106 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357412.1 protein_id gnl|my_center|LOCUS_08410 16594 17496 gene locus_tag LOCUS_08420 16594 17496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 17708 19681 gene locus_tag LOCUS_08430 17708 19681 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_08430 19681 20547 gene locus_tag LOCUS_08440 19681 20547 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703746.1 protein_id gnl|my_center|LOCUS_08440 20647 21069 gene locus_tag LOCUS_08450 20647 21069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 21780 21097 gene locus_tag LOCUS_08460 21780 21097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 22214 23785 gene locus_tag LOCUS_08470 gene gltX 22214 23785 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681104.1 protein_id gnl|my_center|LOCUS_08470 23816 25144 gene locus_tag LOCUS_08480 23816 25144 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068584.1 protein_id gnl|my_center|LOCUS_08480 25669 28527 gene locus_tag LOCUS_08490 25669 28527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 28524 29828 gene locus_tag LOCUS_08500 28524 29828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 32251 29879 gene locus_tag LOCUS_08510 32251 29879 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479011.1 protein_id gnl|my_center|LOCUS_08510 32840 32220 gene locus_tag LOCUS_08520 32840 32220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 33860 33210 gene locus_tag LOCUS_08530 33860 33210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 35735 34371 gene locus_tag LOCUS_08540 gene hisD 35735 34371 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868789.1 protein_id gnl|my_center|LOCUS_08540 37353 35989 gene locus_tag LOCUS_08550 37353 35989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 39369 37741 gene locus_tag LOCUS_08560 gene groL 39369 37741 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670719.1 protein_id gnl|my_center|LOCUS_08560 40474 39824 gene locus_tag LOCUS_08570 40474 39824 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673829.1 protein_id gnl|my_center|LOCUS_08570 40965 41585 gene locus_tag LOCUS_08580 40965 41585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 41588 42307 gene locus_tag LOCUS_08590 41588 42307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 42594 44360 gene locus_tag LOCUS_08600 42594 44360 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 protein_id gnl|my_center|LOCUS_08600 44357 45259 gene locus_tag LOCUS_08610 44357 45259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546359.1 protein_id gnl|my_center|LOCUS_08610 45263 45607 gene locus_tag LOCUS_08620 45263 45607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 45522 46523 gene locus_tag LOCUS_08630 45522 46523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08630 46523 47065 gene locus_tag LOCUS_08640 46523 47065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 47079 48875 gene locus_tag LOCUS_08650 47079 48875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 49622 48951 gene locus_tag LOCUS_08660 49622 48951 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818830.1 protein_id gnl|my_center|LOCUS_08660 49719 50429 gene locus_tag LOCUS_08670 49719 50429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 51961 50570 gene locus_tag LOCUS_08680 51961 50570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 52856 51972 gene locus_tag LOCUS_08690 52856 51972 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861338.1 protein_id gnl|my_center|LOCUS_08690 53671 54654 gene locus_tag LOCUS_08700 53671 54654 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303627.1 protein_id gnl|my_center|LOCUS_08700 55061 55228 gene locus_tag LOCUS_08710 55061 55228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 55555 56853 gene locus_tag LOCUS_08720 55555 56853 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_08720 57138 57638 gene locus_tag LOCUS_08730 57138 57638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 57711 58559 gene locus_tag LOCUS_08740 57711 58559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 58786 59430 gene locus_tag LOCUS_08750 58786 59430 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305518.1 protein_id gnl|my_center|LOCUS_08750 59550 61331 gene locus_tag LOCUS_08760 59550 61331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173276.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence13 714 2237 gene locus_tag LOCUS_08770 714 2237 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_08770 4487 2388 gene locus_tag LOCUS_08780 4487 2388 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957030.1 protein_id gnl|my_center|LOCUS_08780 5197 6027 gene locus_tag LOCUS_08790 5197 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 7345 6290 gene locus_tag LOCUS_08800 7345 6290 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_08800 8505 7453 gene locus_tag LOCUS_08810 8505 7453 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533549.1 protein_id gnl|my_center|LOCUS_08810 8828 8532 gene locus_tag LOCUS_08820 8828 8532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 9207 10160 gene locus_tag LOCUS_08830 9207 10160 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681776.1 protein_id gnl|my_center|LOCUS_08830 10154 10894 gene locus_tag LOCUS_08840 gene fabG 10154 10894 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681771.1 protein_id gnl|my_center|LOCUS_08840 10955 11167 gene locus_tag LOCUS_08850 10955 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 11204 12460 gene locus_tag LOCUS_08860 gene fabF 11204 12460 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673329.1 protein_id gnl|my_center|LOCUS_08860 12479 12913 gene locus_tag LOCUS_08870 gene fabZ 12479 12913 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_08870 13313 14065 gene locus_tag LOCUS_08880 13313 14065 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_08880 14104 15060 gene locus_tag LOCUS_08890 14104 15060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 15294 15950 gene locus_tag LOCUS_08900 15294 15950 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 protein_id gnl|my_center|LOCUS_08900 15928 16662 gene locus_tag LOCUS_08910 15928 16662 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_08910 16714 18816 gene locus_tag LOCUS_08920 16714 18816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 19781 18837 gene locus_tag LOCUS_08930 19781 18837 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519085.1 protein_id gnl|my_center|LOCUS_08930 20285 21661 gene locus_tag LOCUS_08940 20285 21661 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 protein_id gnl|my_center|LOCUS_08940 23617 22229 gene locus_tag LOCUS_08950 23617 22229 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_08950 27949 23807 gene locus_tag LOCUS_08960 27949 23807 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680941.1 protein_id gnl|my_center|LOCUS_08960 31098 27958 gene locus_tag LOCUS_08970 31098 27958 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680942.1 protein_id gnl|my_center|LOCUS_08970 33389 31098 gene locus_tag LOCUS_08980 gene metE 33389 31098 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918370.1 protein_id gnl|my_center|LOCUS_08980 33875 33507 gene locus_tag LOCUS_08990 33875 33507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 36243 34582 gene locus_tag LOCUS_09000 gene gpmI 36243 34582 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_09000 37748 36315 gene locus_tag LOCUS_09010 37748 36315 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417780.1 protein_id gnl|my_center|LOCUS_09010 40001 37899 gene locus_tag LOCUS_09020 gene oadA 40001 37899 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_09020 40400 40119 gene locus_tag LOCUS_09030 40400 40119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 40861 42393 gene locus_tag LOCUS_09040 gene rny 40861 42393 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681149.1 protein_id gnl|my_center|LOCUS_09040 42551 43432 gene locus_tag LOCUS_09050 42551 43432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 43500 44249 gene locus_tag LOCUS_09060 43500 44249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 44262 44963 gene locus_tag LOCUS_09070 44262 44963 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679247.1 protein_id gnl|my_center|LOCUS_09070 45781 45050 gene locus_tag LOCUS_09080 45781 45050 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680333.1 protein_id gnl|my_center|LOCUS_09080 46544 45798 gene locus_tag LOCUS_09090 46544 45798 CDS product DbpA RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680577.1 protein_id gnl|my_center|LOCUS_09090 47484 46573 gene locus_tag LOCUS_09100 47484 46573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 48129 47512 gene locus_tag LOCUS_09110 48129 47512 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667667.1 protein_id gnl|my_center|LOCUS_09110 48644 49255 gene locus_tag LOCUS_09120 gene thrH 48644 49255 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_09120 49378 50670 gene locus_tag LOCUS_09130 gene argJ 49378 50670 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_09130 50667 51569 gene locus_tag LOCUS_09140 gene argB 50667 51569 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_09140 51673 52017 gene locus_tag LOCUS_09150 51673 52017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 52019 53062 gene locus_tag LOCUS_09160 52019 53062 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_09160 53330 53863 gene locus_tag LOCUS_09170 53330 53863 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678446.1 protein_id gnl|my_center|LOCUS_09170 53879 54901 gene locus_tag LOCUS_09180 gene asnA 53879 54901 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_09180 54924 55913 gene locus_tag LOCUS_09190 54924 55913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 55924 56925 gene locus_tag LOCUS_09200 55924 56925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 57083 58069 gene locus_tag LOCUS_09210 57083 58069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 58026 58577 gene locus_tag LOCUS_09220 58026 58577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 58765 59325 gene locus_tag LOCUS_09230 58765 59325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence14 137 1621 gene locus_tag LOCUS_09240 137 1621 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440276.1 protein_id gnl|my_center|LOCUS_09240 1766 2002 gene locus_tag LOCUS_09250 1766 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2002 2607 gene locus_tag LOCUS_09260 2002 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3378 2917 gene locus_tag LOCUS_09270 3378 2917 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666989.1 protein_id gnl|my_center|LOCUS_09270 3579 4838 gene locus_tag LOCUS_09280 gene fabF 3579 4838 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673329.1 protein_id gnl|my_center|LOCUS_09280 4869 6116 gene locus_tag LOCUS_09290 4869 6116 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681770.1 protein_id gnl|my_center|LOCUS_09290 6142 7596 gene locus_tag LOCUS_09300 6142 7596 CDS product lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679156.1 protein_id gnl|my_center|LOCUS_09300 7633 8982 gene locus_tag LOCUS_09310 gene rhbA 7633 8982 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968201.1 protein_id gnl|my_center|LOCUS_09310 9089 10897 gene locus_tag LOCUS_09320 9089 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 10913 12592 gene locus_tag LOCUS_09330 10913 12592 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_09330 12592 13272 gene locus_tag LOCUS_09340 12592 13272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 14202 13417 gene locus_tag LOCUS_09350 14202 13417 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_09350 15009 14224 gene locus_tag LOCUS_09360 15009 14224 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679455.1 protein_id gnl|my_center|LOCUS_09360 16270 15095 gene locus_tag LOCUS_09370 16270 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 17984 16506 gene locus_tag LOCUS_09380 gene ilvC 17984 16506 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 protein_id gnl|my_center|LOCUS_09380 18995 18396 gene locus_tag LOCUS_09390 18995 18396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 19402 19049 gene locus_tag LOCUS_09400 19402 19049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 19908 19441 gene locus_tag LOCUS_09410 19908 19441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 20537 19920 gene locus_tag LOCUS_09420 20537 19920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 21673 21035 gene locus_tag LOCUS_09430 21673 21035 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_09430 24286 21809 gene locus_tag LOCUS_09440 24286 21809 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492290.1 protein_id gnl|my_center|LOCUS_09440 25830 24289 gene locus_tag LOCUS_09450 25830 24289 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_09450 26473 25823 gene locus_tag LOCUS_09460 26473 25823 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_09460 26593 26895 gene locus_tag LOCUS_09470 26593 26895 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391827.1 protein_id gnl|my_center|LOCUS_09470 27645 26935 gene locus_tag LOCUS_09480 27645 26935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 28906 27629 gene locus_tag LOCUS_09490 28906 27629 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_09490 29223 30710 gene locus_tag LOCUS_09500 29223 30710 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211877.1 protein_id gnl|my_center|LOCUS_09500 30876 32282 gene locus_tag LOCUS_09510 gene purF 30876 32282 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_09510 33534 32494 gene locus_tag LOCUS_09520 33534 32494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 33645 34007 gene locus_tag LOCUS_09530 33645 34007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 34811 34053 gene locus_tag LOCUS_09540 34811 34053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 35629 34937 gene locus_tag LOCUS_09550 35629 34937 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680496.1 protein_id gnl|my_center|LOCUS_09550 36237 35629 gene locus_tag LOCUS_09560 36237 35629 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_09560 36612 37688 gene locus_tag LOCUS_09570 gene gap 36612 37688 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_09570 40337 37791 gene locus_tag LOCUS_09580 40337 37791 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492290.1 protein_id gnl|my_center|LOCUS_09580 40597 40914 gene locus_tag LOCUS_09590 40597 40914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 40908 41207 gene locus_tag LOCUS_09600 40908 41207 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_09600 42739 41231 gene locus_tag LOCUS_09610 42739 41231 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_09610 43427 42732 gene locus_tag LOCUS_09620 43427 42732 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_09620 43538 43837 gene locus_tag LOCUS_09630 43538 43837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 44051 44374 gene locus_tag LOCUS_09640 44051 44374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 45104 44496 gene locus_tag LOCUS_09650 45104 44496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 45959 45513 gene locus_tag LOCUS_09660 45959 45513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 48224 46323 gene locus_tag LOCUS_09670 48224 46323 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_09670 49192 48221 gene locus_tag LOCUS_09680 49192 48221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 50755 49490 gene locus_tag LOCUS_09690 50755 49490 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261528.1 protein_id gnl|my_center|LOCUS_09690 51504 50755 gene locus_tag LOCUS_09700 gene fabG 51504 50755 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460603.1 protein_id gnl|my_center|LOCUS_09700 53054 52170 gene locus_tag LOCUS_09710 53054 52170 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_09710 53125 53943 gene locus_tag LOCUS_09720 gene larE 53125 53943 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896918.1 protein_id gnl|my_center|LOCUS_09720 54266 54979 gene locus_tag LOCUS_09730 54266 54979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 56146 55367 gene locus_tag LOCUS_09740 56146 55367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 56998 56429 gene locus_tag LOCUS_09750 56998 56429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 57529 57083 gene locus_tag LOCUS_09760 57529 57083 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666808.1 protein_id gnl|my_center|LOCUS_09760 58113 57685 gene locus_tag LOCUS_09770 58113 57685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence15 287 487 gene locus_tag LOCUS_09780 287 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 685 891 gene locus_tag LOCUS_09790 685 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 888 1265 gene locus_tag LOCUS_09800 888 1265 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770889.1 protein_id gnl|my_center|LOCUS_09800 1360 3891 gene locus_tag LOCUS_09810 1360 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3904 4743 gene locus_tag LOCUS_09820 3904 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4860 5258 gene locus_tag LOCUS_09830 4860 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 5381 6931 gene locus_tag LOCUS_09840 5381 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 7112 7579 gene locus_tag LOCUS_09850 7112 7579 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_09850 7685 9376 gene locus_tag LOCUS_09860 gene ilvD 7685 9376 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_09860 9546 9962 gene locus_tag LOCUS_09870 gene flgB 9546 9962 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668460.1 protein_id gnl|my_center|LOCUS_09870 10043 10501 gene locus_tag LOCUS_09880 gene flgC 10043 10501 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671661.1 protein_id gnl|my_center|LOCUS_09880 10547 10969 gene locus_tag LOCUS_09890 10547 10969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 11214 12929 gene locus_tag LOCUS_09900 gene fliF 11214 12929 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678706.1 protein_id gnl|my_center|LOCUS_09900 13085 13495 gene locus_tag LOCUS_09910 13085 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 13550 14647 gene locus_tag LOCUS_09920 gene fliG 13550 14647 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668469.1 protein_id gnl|my_center|LOCUS_09920 14670 15608 gene locus_tag LOCUS_09930 gene fliH 14670 15608 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668471.1 protein_id gnl|my_center|LOCUS_09930 15692 17122 gene locus_tag LOCUS_09940 gene fliI 15692 17122 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678707.1 protein_id gnl|my_center|LOCUS_09940 17239 17658 gene locus_tag LOCUS_09950 17239 17658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 18772 17846 gene locus_tag LOCUS_09960 18772 17846 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_09960 19823 18861 gene locus_tag LOCUS_09970 19823 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 22618 19823 gene locus_tag LOCUS_09980 22618 19823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 23742 22630 gene locus_tag LOCUS_09990 23742 22630 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_09990 24277 23726 gene locus_tag LOCUS_10000 24277 23726 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_10000 25604 24282 gene locus_tag LOCUS_10010 25604 24282 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679814.1 protein_id gnl|my_center|LOCUS_10010 26305 25601 gene locus_tag LOCUS_10020 26305 25601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668339.1 protein_id gnl|my_center|LOCUS_10020 27611 26298 gene locus_tag LOCUS_10030 27611 26298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679815.1 protein_id gnl|my_center|LOCUS_10030 29169 27604 gene locus_tag LOCUS_10040 29169 27604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 30049 29177 gene locus_tag LOCUS_10050 gene ftsY 30049 29177 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668333.1 protein_id gnl|my_center|LOCUS_10050 31889 30075 gene locus_tag LOCUS_10060 31889 30075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 32955 31873 gene locus_tag LOCUS_10070 gene prfB 32955 31873 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014540570.1 protein_id gnl|my_center|LOCUS_10070 33912 35180 gene locus_tag LOCUS_10080 33912 35180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 35305 37419 gene locus_tag LOCUS_10090 35305 37419 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682106.1 protein_id gnl|my_center|LOCUS_10090 37440 37919 gene locus_tag LOCUS_10100 37440 37919 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_10100 37967 38713 gene locus_tag LOCUS_10110 37967 38713 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_10110 38886 39050 gene locus_tag LOCUS_10120 38886 39050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 39076 39636 gene locus_tag LOCUS_10130 39076 39636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 39633 39977 gene locus_tag LOCUS_10140 39633 39977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 40372 41766 gene locus_tag LOCUS_10150 40372 41766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 41871 45107 gene locus_tag LOCUS_10160 41871 45107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 45279 48143 gene locus_tag LOCUS_10170 45279 48143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 48507 51677 gene locus_tag LOCUS_10180 48507 51677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 53405 51759 gene locus_tag LOCUS_10190 53405 51759 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674349.1 protein_id gnl|my_center|LOCUS_10190 53569 53644 gene locus_tag LOCUS_t00140 53569 53644 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 53598 54989 gene locus_tag LOCUS_10200 53598 54989 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678712.1 protein_id gnl|my_center|LOCUS_10200 55310 56164 gene locus_tag LOCUS_10210 55310 56164 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679999.1 protein_id gnl|my_center|LOCUS_10210 56255 57748 gene locus_tag LOCUS_10220 gene murC 56255 57748 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956876.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence16 362 216 gene locus_tag LOCUS_10230 362 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 769 440 gene locus_tag LOCUS_10240 769 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 2820 910 gene locus_tag LOCUS_10250 2820 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3130 3058 gene locus_tag LOCUS_t00150 3130 3058 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3236 3162 gene locus_tag LOCUS_t00160 3236 3162 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3832 4110 gene locus_tag LOCUS_10260 3832 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 4491 4132 gene locus_tag LOCUS_10270 gene rsfS 4491 4132 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679464.1 protein_id gnl|my_center|LOCUS_10270 5814 4582 gene locus_tag LOCUS_10280 5814 4582 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669467.1 protein_id gnl|my_center|LOCUS_10280 6418 5795 gene locus_tag LOCUS_10290 6418 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10290 7098 6421 gene locus_tag LOCUS_10300 7098 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10300 8204 7095 gene locus_tag LOCUS_10310 gene obgE 8204 7095 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679468.1 protein_id gnl|my_center|LOCUS_10310 8543 8286 gene locus_tag LOCUS_10320 gene rpmA 8543 8286 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669471.1 protein_id gnl|my_center|LOCUS_10320 8963 8625 gene locus_tag LOCUS_10330 8963 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 9286 8972 gene locus_tag LOCUS_10340 gene rplU 9286 8972 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669481.1 protein_id gnl|my_center|LOCUS_10340 11110 9623 gene locus_tag LOCUS_10350 11110 9623 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674333.1 protein_id gnl|my_center|LOCUS_10350 12132 11500 gene locus_tag LOCUS_10360 gene purN 12132 11500 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_10360 13292 12195 gene locus_tag LOCUS_10370 gene purM 13292 12195 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964702.1 protein_id gnl|my_center|LOCUS_10370 13866 13372 gene locus_tag LOCUS_10380 gene purE 13866 13372 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964699.1 protein_id gnl|my_center|LOCUS_10380 14935 14147 gene locus_tag LOCUS_10390 14935 14147 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_10390 15970 14939 gene locus_tag LOCUS_10400 15970 14939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 16724 18178 gene locus_tag LOCUS_10410 16724 18178 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668533.1 protein_id gnl|my_center|LOCUS_10410 18947 18186 gene locus_tag LOCUS_10420 18947 18186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 20426 18948 gene locus_tag LOCUS_10430 20426 18948 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_10430 22392 20614 gene locus_tag LOCUS_10440 22392 20614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 23096 22563 gene locus_tag LOCUS_10450 23096 22563 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_10450 24655 23423 gene locus_tag LOCUS_10460 24655 23423 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681086.1 protein_id gnl|my_center|LOCUS_10460 24908 25474 gene locus_tag LOCUS_10470 24908 25474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 25480 27168 gene locus_tag LOCUS_10480 25480 27168 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678947.1 protein_id gnl|my_center|LOCUS_10480 28735 27380 gene locus_tag LOCUS_10490 gene purD 28735 27380 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964705.1 protein_id gnl|my_center|LOCUS_10490 29956 28985 gene locus_tag LOCUS_10500 gene prmC 29956 28985 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680454.1 protein_id gnl|my_center|LOCUS_10500 30093 30380 gene locus_tag LOCUS_10510 30093 30380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 31722 30673 gene locus_tag LOCUS_10520 gene prfA 31722 30673 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680455.1 protein_id gnl|my_center|LOCUS_10520 31989 32303 gene locus_tag LOCUS_10530 31989 32303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 32554 32309 gene locus_tag LOCUS_10540 32554 32309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 33490 32579 gene locus_tag LOCUS_10550 33490 32579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10550 33666 34073 gene locus_tag LOCUS_10560 33666 34073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 34012 34719 gene locus_tag LOCUS_10570 34012 34719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 34725 35213 gene locus_tag LOCUS_10580 34725 35213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 35308 35499 gene locus_tag LOCUS_10590 35308 35499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 36119 35631 gene locus_tag LOCUS_10600 36119 35631 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_10600 36397 36116 gene locus_tag LOCUS_10610 36397 36116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 36636 37028 gene locus_tag LOCUS_10620 36636 37028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 37581 37132 gene locus_tag LOCUS_10630 37581 37132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 38941 38177 gene locus_tag LOCUS_10640 38941 38177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 40062 38938 gene locus_tag LOCUS_10650 40062 38938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 43387 40070 gene locus_tag LOCUS_10660 43387 40070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 46957 43406 gene locus_tag LOCUS_10670 46957 43406 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109349.1 protein_id gnl|my_center|LOCUS_10670 47297 48229 gene locus_tag LOCUS_10680 47297 48229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 48597 49037 gene locus_tag LOCUS_10690 48597 49037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 49250 50161 gene locus_tag LOCUS_10700 49250 50161 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258797.1 protein_id gnl|my_center|LOCUS_10700 50358 54284 gene locus_tag LOCUS_10710 50358 54284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 54563 54805 gene locus_tag LOCUS_10720 54563 54805 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_10720 55125 55709 gene locus_tag LOCUS_10730 55125 55709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence17 3 836 gene locus_tag LOCUS_10740 3 836 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044978750.1 protein_id gnl|my_center|LOCUS_10740 1232 2389 gene locus_tag LOCUS_10750 gene alr 1232 2389 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682404.1 protein_id gnl|my_center|LOCUS_10750 4331 2646 gene locus_tag LOCUS_10760 4331 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 6310 4466 gene locus_tag LOCUS_10770 6310 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 6458 6793 gene locus_tag LOCUS_10780 6458 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 8232 6904 gene locus_tag LOCUS_10790 8232 6904 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682395.1 protein_id gnl|my_center|LOCUS_10790 8702 10057 gene locus_tag LOCUS_10800 8702 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 10681 10043 gene locus_tag LOCUS_10810 10681 10043 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965038.1 protein_id gnl|my_center|LOCUS_10810 12123 10945 gene locus_tag LOCUS_10820 12123 10945 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658082.1 protein_id gnl|my_center|LOCUS_10820 12763 12185 gene locus_tag LOCUS_10830 gene rsmD 12763 12185 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669684.1 protein_id gnl|my_center|LOCUS_10830 14330 12831 gene locus_tag LOCUS_10840 14330 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 14563 14901 gene locus_tag LOCUS_10850 14563 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668283.1 protein_id gnl|my_center|LOCUS_10850 14894 15949 gene locus_tag LOCUS_10860 gene rlmN 14894 15949 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679871.1 protein_id gnl|my_center|LOCUS_10860 16036 16248 gene locus_tag LOCUS_10870 16036 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 16263 17213 gene locus_tag LOCUS_10880 16263 17213 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_10880 17266 18552 gene locus_tag LOCUS_10890 17266 18552 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_10890 18567 19100 gene locus_tag LOCUS_10900 18567 19100 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942547.1 protein_id gnl|my_center|LOCUS_10900 19156 20280 gene locus_tag LOCUS_10910 19156 20280 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679607.1 protein_id gnl|my_center|LOCUS_10910 20558 20349 gene locus_tag LOCUS_10920 gene rpmE 20558 20349 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_10920 21096 21467 gene locus_tag LOCUS_10930 21096 21467 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_10930 21823 24393 gene locus_tag LOCUS_10940 21823 24393 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679459.1 protein_id gnl|my_center|LOCUS_10940 24408 24812 gene locus_tag LOCUS_10950 24408 24812 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668053.1 protein_id gnl|my_center|LOCUS_10950 26177 24942 gene locus_tag LOCUS_10960 gene tyrS 26177 24942 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263430.1 protein_id gnl|my_center|LOCUS_10960 26314 27210 gene locus_tag LOCUS_10970 26314 27210 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681114.1 protein_id gnl|my_center|LOCUS_10970 27221 28372 gene locus_tag LOCUS_10980 27221 28372 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681112.1 protein_id gnl|my_center|LOCUS_10980 28863 28417 gene locus_tag LOCUS_10990 28863 28417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 29404 28865 gene locus_tag LOCUS_11000 29404 28865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680920.1 protein_id gnl|my_center|LOCUS_11000 30607 29417 gene locus_tag LOCUS_11010 30607 29417 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673293.1 protein_id gnl|my_center|LOCUS_11010 30769 31761 gene locus_tag LOCUS_11020 gene murB 30769 31761 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680945.1 protein_id gnl|my_center|LOCUS_11020 42875 32004 gene locus_tag LOCUS_11030 42875 32004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 43114 42806 gene locus_tag LOCUS_11040 43114 42806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 43562 43873 gene locus_tag LOCUS_11050 43562 43873 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356887.1 protein_id gnl|my_center|LOCUS_11050 43884 45314 gene locus_tag LOCUS_11060 43884 45314 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679249.1 protein_id gnl|my_center|LOCUS_11060 45858 46772 gene locus_tag LOCUS_11070 45858 46772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 47696 46914 gene locus_tag LOCUS_11080 47696 46914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 48052 47825 gene locus_tag LOCUS_11090 48052 47825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 48423 48235 gene locus_tag LOCUS_11100 48423 48235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 48824 48501 gene locus_tag LOCUS_11110 48824 48501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 49708 49253 gene locus_tag LOCUS_11120 49708 49253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 49919 49716 gene locus_tag LOCUS_11130 49919 49716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 49948 50139 gene locus_tag LOCUS_11140 49948 50139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 50764 50183 gene locus_tag LOCUS_11150 50764 50183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 52074 51013 gene locus_tag LOCUS_11160 52074 51013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 52426 52136 gene locus_tag LOCUS_11170 52426 52136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 53694 53356 gene locus_tag LOCUS_11180 53694 53356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11180 54295 53783 gene locus_tag LOCUS_11190 54295 53783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence18 1071 2267 gene locus_tag LOCUS_11200 1071 2267 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766018.1 protein_id gnl|my_center|LOCUS_11200 2264 3367 gene locus_tag LOCUS_11210 2264 3367 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 protein_id gnl|my_center|LOCUS_11210 4585 5658 gene locus_tag LOCUS_11220 4585 5658 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141176.1 protein_id gnl|my_center|LOCUS_11220 5655 6191 gene locus_tag LOCUS_11230 5655 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 6877 6578 gene locus_tag LOCUS_11240 6877 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 7045 8199 gene locus_tag LOCUS_11250 7045 8199 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922332.1 protein_id gnl|my_center|LOCUS_11250 8192 8743 gene locus_tag LOCUS_11260 8192 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11260 8736 9323 gene locus_tag LOCUS_11270 8736 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11270 9511 10869 gene locus_tag LOCUS_11280 9511 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 11356 11084 gene locus_tag LOCUS_11290 11356 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002689021.1 protein_id gnl|my_center|LOCUS_11290 11727 11422 gene locus_tag LOCUS_11300 11727 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11300 11936 12406 gene locus_tag LOCUS_11310 11936 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 12536 13102 gene locus_tag LOCUS_11320 12536 13102 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679290.1 protein_id gnl|my_center|LOCUS_11320 13636 13112 gene locus_tag LOCUS_11330 13636 13112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 16901 14202 gene locus_tag LOCUS_11340 gene leuS 16901 14202 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680258.1 protein_id gnl|my_center|LOCUS_11340 18202 17273 gene locus_tag LOCUS_11350 gene lptB 18202 17273 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681841.1 protein_id gnl|my_center|LOCUS_11350 19113 18199 gene locus_tag LOCUS_11360 19113 18199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 19710 19117 gene locus_tag LOCUS_11370 19710 19117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 21042 19822 gene locus_tag LOCUS_11380 21042 19822 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677016.1 protein_id gnl|my_center|LOCUS_11380 21873 21058 gene locus_tag LOCUS_11390 21873 21058 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669892.1 protein_id gnl|my_center|LOCUS_11390 22744 21974 gene locus_tag LOCUS_11400 22744 21974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 22668 22916 gene locus_tag LOCUS_11410 22668 22916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 24005 23250 gene locus_tag LOCUS_11420 24005 23250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 24705 24214 gene locus_tag LOCUS_11430 24705 24214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 24994 26118 gene locus_tag LOCUS_11440 24994 26118 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_11440 26290 27006 gene locus_tag LOCUS_11450 26290 27006 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361291.1 protein_id gnl|my_center|LOCUS_11450 27345 27764 gene locus_tag LOCUS_11460 27345 27764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 27792 28268 gene locus_tag LOCUS_11470 27792 28268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 28501 28812 gene locus_tag LOCUS_11480 28501 28812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 28821 29852 gene locus_tag LOCUS_11490 28821 29852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 30219 32204 gene locus_tag LOCUS_11500 30219 32204 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_11500 32241 32582 gene locus_tag LOCUS_11510 32241 32582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 32598 32930 gene locus_tag LOCUS_11520 32598 32930 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_11520 32939 33571 gene locus_tag LOCUS_11530 32939 33571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 33568 35340 gene locus_tag LOCUS_11540 33568 35340 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496424.1 protein_id gnl|my_center|LOCUS_11540 35337 36722 gene locus_tag LOCUS_11550 35337 36722 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_11550 36795 37412 gene locus_tag LOCUS_11560 36795 37412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 37434 37937 gene locus_tag LOCUS_11570 37434 37937 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_11570 37934 38680 gene locus_tag LOCUS_11580 37934 38680 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679454.1 protein_id gnl|my_center|LOCUS_11580 38690 38875 gene locus_tag LOCUS_11590 38690 38875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 38872 39267 gene locus_tag LOCUS_11600 38872 39267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 39785 39342 gene locus_tag LOCUS_11610 39785 39342 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_11610 40084 41364 gene locus_tag LOCUS_11620 40084 41364 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667047.1 protein_id gnl|my_center|LOCUS_11620 41377 43302 gene locus_tag LOCUS_11630 41377 43302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 43402 44001 gene locus_tag LOCUS_11640 43402 44001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 44014 45489 gene locus_tag LOCUS_11650 44014 45489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 45480 46505 gene locus_tag LOCUS_11660 45480 46505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 46836 47834 gene locus_tag LOCUS_11670 46836 47834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679631.1 protein_id gnl|my_center|LOCUS_11670 47856 48728 gene locus_tag LOCUS_11680 47856 48728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679630.1 protein_id gnl|my_center|LOCUS_11680 48733 49500 gene locus_tag LOCUS_11690 48733 49500 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667426.1 protein_id gnl|my_center|LOCUS_11690 50052 49570 gene locus_tag LOCUS_11700 50052 49570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 50975 50127 gene locus_tag LOCUS_11710 50975 50127 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680625.1 protein_id gnl|my_center|LOCUS_11710 51202 51274 gene locus_tag LOCUS_t00170 51202 51274 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence19 192 1718 gene locus_tag LOCUS_11720 192 1718 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_11720 2846 2067 gene locus_tag LOCUS_11730 gene dapB 2846 2067 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_11730 4492 3167 gene locus_tag LOCUS_11740 4492 3167 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888006.1 protein_id gnl|my_center|LOCUS_11740 4624 5751 gene locus_tag LOCUS_11750 gene pcnB 4624 5751 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669419.1 protein_id gnl|my_center|LOCUS_11750 6858 5971 gene locus_tag LOCUS_11760 6858 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_11760 8441 7047 gene locus_tag LOCUS_11770 8441 7047 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_11770 8498 8689 gene locus_tag LOCUS_11780 8498 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 8923 9738 gene locus_tag LOCUS_11790 8923 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 9742 10140 gene locus_tag LOCUS_11800 gene aroH 9742 10140 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679161.1 protein_id gnl|my_center|LOCUS_11800 10137 11753 gene locus_tag LOCUS_11810 gene glgA 10137 11753 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437158.1 protein_id gnl|my_center|LOCUS_11810 11915 13495 gene locus_tag LOCUS_11820 11915 13495 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680556.1 protein_id gnl|my_center|LOCUS_11820 13742 13826 gene locus_tag LOCUS_t00180 13742 13826 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14604 13870 gene locus_tag LOCUS_11830 14604 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679004.1 protein_id gnl|my_center|LOCUS_11830 14742 15200 gene locus_tag LOCUS_11840 gene mraZ 14742 15200 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678680.1 protein_id gnl|my_center|LOCUS_11840 15216 16205 gene locus_tag LOCUS_11850 gene rsmH 15216 16205 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678681.1 protein_id gnl|my_center|LOCUS_11850 16205 16510 gene locus_tag LOCUS_11860 16205 16510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 16507 17964 gene locus_tag LOCUS_11870 gene murF 16507 17964 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678687.1 protein_id gnl|my_center|LOCUS_11870 17977 19167 gene locus_tag LOCUS_11880 gene ftsW 17977 19167 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677685.1 protein_id gnl|my_center|LOCUS_11880 19164 20003 gene locus_tag LOCUS_11890 19164 20003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 20041 21279 gene locus_tag LOCUS_11900 gene ftsA 20041 21279 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678694.1 protein_id gnl|my_center|LOCUS_11900 21381 22706 gene locus_tag LOCUS_11910 gene ftsZ 21381 22706 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656388.1 protein_id gnl|my_center|LOCUS_11910 22726 23634 gene locus_tag LOCUS_11920 22726 23634 CDS product site-specific tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044909847.1 protein_id gnl|my_center|LOCUS_11920 23899 24642 gene locus_tag LOCUS_11930 23899 24642 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678696.1 protein_id gnl|my_center|LOCUS_11930 24632 25666 gene locus_tag LOCUS_11940 24632 25666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 25733 27886 gene locus_tag LOCUS_11950 gene topA 25733 27886 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678704.1 protein_id gnl|my_center|LOCUS_11950 27876 28811 gene locus_tag LOCUS_11960 27876 28811 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678705.1 protein_id gnl|my_center|LOCUS_11960 28824 29363 gene locus_tag LOCUS_11970 gene hslV 28824 29363 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668456.1 protein_id gnl|my_center|LOCUS_11970 29367 30827 gene locus_tag LOCUS_11980 gene hslU 29367 30827 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677705.1 protein_id gnl|my_center|LOCUS_11980 31659 30910 gene locus_tag LOCUS_11990 31659 30910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 32458 31676 gene locus_tag LOCUS_12000 32458 31676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 32700 33173 gene locus_tag LOCUS_12010 32700 33173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 34475 33867 gene locus_tag LOCUS_12020 34475 33867 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_12020 34947 35519 gene locus_tag LOCUS_12030 34947 35519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 39039 35629 gene locus_tag LOCUS_12040 39039 35629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 40686 39607 gene locus_tag LOCUS_12050 40686 39607 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_12050 41200 40715 gene locus_tag LOCUS_12060 41200 40715 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681342.1 protein_id gnl|my_center|LOCUS_12060 41482 42366 gene locus_tag LOCUS_12070 41482 42366 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_12070 43306 42476 gene locus_tag LOCUS_12080 43306 42476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 44717 43338 gene locus_tag LOCUS_12090 44717 43338 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_12090 44863 45162 gene locus_tag LOCUS_12100 44863 45162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 45159 46061 gene locus_tag LOCUS_12110 45159 46061 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429183.1 protein_id gnl|my_center|LOCUS_12110 46215 46625 gene locus_tag LOCUS_12120 46215 46625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 48725 46710 gene locus_tag LOCUS_12130 48725 46710 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_12130 49252 49043 gene locus_tag LOCUS_12140 49252 49043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence20 756 1526 gene locus_tag LOCUS_12150 756 1526 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668794.1 protein_id gnl|my_center|LOCUS_12150 1526 2248 gene locus_tag LOCUS_12160 1526 2248 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668795.1 protein_id gnl|my_center|LOCUS_12160 2312 3268 gene locus_tag LOCUS_12170 2312 3268 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680667.1 protein_id gnl|my_center|LOCUS_12170 3276 3500 gene locus_tag LOCUS_12180 3276 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 5143 3557 gene locus_tag LOCUS_12190 5143 3557 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681501.1 protein_id gnl|my_center|LOCUS_12190 7255 5513 gene locus_tag LOCUS_12200 gene lnt 7255 5513 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680216.1 protein_id gnl|my_center|LOCUS_12200 7583 8776 gene locus_tag LOCUS_12210 7583 8776 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667821.1 protein_id gnl|my_center|LOCUS_12210 8886 9665 gene locus_tag LOCUS_12220 gene surE 8886 9665 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140447.1 protein_id gnl|my_center|LOCUS_12220 9675 10370 gene locus_tag LOCUS_12230 9675 10370 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680214.1 protein_id gnl|my_center|LOCUS_12230 10371 12434 gene locus_tag LOCUS_12240 10371 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680210.1 protein_id gnl|my_center|LOCUS_12240 14198 13134 gene locus_tag LOCUS_12250 14198 13134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 14570 16315 gene locus_tag LOCUS_12260 14570 16315 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_12260 16640 17728 gene locus_tag LOCUS_12270 16640 17728 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965672.1 protein_id gnl|my_center|LOCUS_12270 17748 19838 gene locus_tag LOCUS_12280 17748 19838 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975338.1 protein_id gnl|my_center|LOCUS_12280 19909 20544 gene locus_tag LOCUS_12290 19909 20544 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_12290 20899 22986 gene locus_tag LOCUS_12300 20899 22986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 23199 27008 gene locus_tag LOCUS_12310 23199 27008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 27577 30390 gene locus_tag LOCUS_12320 gene secA 27577 30390 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679596.1 protein_id gnl|my_center|LOCUS_12320 30399 31658 gene locus_tag LOCUS_12330 30399 31658 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682130.1 protein_id gnl|my_center|LOCUS_12330 31722 32300 gene locus_tag LOCUS_12340 31722 32300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 32302 32712 gene locus_tag LOCUS_12350 32302 32712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 32741 33145 gene locus_tag LOCUS_12360 gene mutT 32741 33145 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459573.1 protein_id gnl|my_center|LOCUS_12360 33142 33498 gene locus_tag LOCUS_12370 33142 33498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 33500 34621 gene locus_tag LOCUS_12380 33500 34621 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682269.1 protein_id gnl|my_center|LOCUS_12380 34614 35594 gene locus_tag LOCUS_12390 gene hflK 34614 35594 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_12390 35597 36595 gene locus_tag LOCUS_12400 gene hflC 35597 36595 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_12400 37392 37135 gene locus_tag LOCUS_12410 37392 37135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 37684 37460 gene locus_tag LOCUS_12420 37684 37460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 38036 38914 gene locus_tag LOCUS_12430 38036 38914 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044978750.1 protein_id gnl|my_center|LOCUS_12430 39240 39803 gene locus_tag LOCUS_12440 39240 39803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 40667 39822 gene locus_tag LOCUS_12450 40667 39822 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_12450 40751 42055 gene locus_tag LOCUS_12460 gene hisS 40751 42055 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679075.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence21 251 496 gene locus_tag LOCUS_12470 251 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 2018 861 gene locus_tag LOCUS_12480 gene dinB 2018 861 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956849.1 protein_id gnl|my_center|LOCUS_12480 4068 2074 gene locus_tag LOCUS_12490 4068 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 4140 5306 gene locus_tag LOCUS_12500 4140 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670701.1 protein_id gnl|my_center|LOCUS_12500 5368 5970 gene locus_tag LOCUS_12510 5368 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 5960 6655 gene locus_tag LOCUS_12520 gene trmB 5960 6655 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956879.1 protein_id gnl|my_center|LOCUS_12520 6734 8692 gene locus_tag LOCUS_12530 gene ligA 6734 8692 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679195.1 protein_id gnl|my_center|LOCUS_12530 8867 9481 gene locus_tag LOCUS_12540 8867 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 9453 9683 gene locus_tag LOCUS_12550 9453 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 9877 10626 gene locus_tag LOCUS_12560 9877 10626 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_12560 10663 11232 gene locus_tag LOCUS_12570 gene ruvC 10663 11232 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679556.1 protein_id gnl|my_center|LOCUS_12570 11507 11866 gene locus_tag LOCUS_12580 11507 11866 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669698.1 protein_id gnl|my_center|LOCUS_12580 11999 12631 gene locus_tag LOCUS_12590 11999 12631 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679583.1 protein_id gnl|my_center|LOCUS_12590 12641 14065 gene locus_tag LOCUS_12600 gene mtaB 12641 14065 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679581.1 protein_id gnl|my_center|LOCUS_12600 14168 15163 gene locus_tag LOCUS_12610 14168 15163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 15204 15935 gene locus_tag LOCUS_12620 gene deoC 15204 15935 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262220.1 protein_id gnl|my_center|LOCUS_12620 16976 16017 gene locus_tag LOCUS_12630 16976 16017 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941867.1 protein_id gnl|my_center|LOCUS_12630 19754 17040 gene locus_tag LOCUS_12640 gene greA 19754 17040 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673498.1 protein_id gnl|my_center|LOCUS_12640 20703 19771 gene locus_tag LOCUS_12650 20703 19771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667094.1 protein_id gnl|my_center|LOCUS_12650 23002 21071 gene locus_tag LOCUS_12660 gene uvrC 23002 21071 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680446.1 protein_id gnl|my_center|LOCUS_12660 23004 24554 gene locus_tag LOCUS_12670 23004 24554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920589.1 protein_id gnl|my_center|LOCUS_12670 24585 26204 gene locus_tag LOCUS_12680 24585 26204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 26314 27156 gene locus_tag LOCUS_12690 26314 27156 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_12690 27172 27897 gene locus_tag LOCUS_12700 27172 27897 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_12700 27894 28220 gene locus_tag LOCUS_12710 27894 28220 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065708.1 protein_id gnl|my_center|LOCUS_12710 30432 28861 gene locus_tag LOCUS_12720 30432 28861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 30515 30763 gene locus_tag LOCUS_12730 30515 30763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 31340 31705 gene locus_tag LOCUS_12740 31340 31705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 34352 31740 gene locus_tag LOCUS_12750 gene mutS 34352 31740 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920616.1 protein_id gnl|my_center|LOCUS_12750 35088 34543 gene locus_tag LOCUS_12760 35088 34543 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667237.1 protein_id gnl|my_center|LOCUS_12760 35877 36539 gene locus_tag LOCUS_12770 gene hisH 35877 36539 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_12770 36796 37581 gene locus_tag LOCUS_12780 gene hisF 36796 37581 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_12780 37578 38345 gene locus_tag LOCUS_12790 37578 38345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 38531 38959 gene locus_tag LOCUS_12800 gene queD 38531 38959 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938647.1 protein_id gnl|my_center|LOCUS_12800 39515 39078 gene locus_tag LOCUS_12810 39515 39078 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_12810 39806 39573 gene locus_tag LOCUS_12820 39806 39573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 40114 40187 gene locus_tag LOCUS_t00190 40114 40187 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 40551 41081 gene locus_tag LOCUS_12830 40551 41081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence22 291 1007 gene locus_tag LOCUS_12840 291 1007 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_12840 1057 1377 gene locus_tag LOCUS_12850 1057 1377 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722106.1 protein_id gnl|my_center|LOCUS_12850 1579 2583 gene locus_tag LOCUS_12860 1579 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 3534 3031 gene locus_tag LOCUS_12870 3534 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3809 3537 gene locus_tag LOCUS_12880 3809 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4398 3826 gene locus_tag LOCUS_12890 4398 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 6356 5202 gene locus_tag LOCUS_12900 6356 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 10900 6743 gene locus_tag LOCUS_12910 10900 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 11102 11263 gene locus_tag LOCUS_12920 11102 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 12207 12458 gene locus_tag LOCUS_12930 12207 12458 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_12930 12489 12719 gene locus_tag LOCUS_12940 12489 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 12960 14174 gene locus_tag LOCUS_12950 12960 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 14905 15798 gene locus_tag LOCUS_12960 14905 15798 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679808.1 protein_id gnl|my_center|LOCUS_12960 16773 16270 gene locus_tag LOCUS_12970 16773 16270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 17054 16860 gene locus_tag LOCUS_12980 17054 16860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 17428 17051 gene locus_tag LOCUS_12990 17428 17051 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675753.1 protein_id gnl|my_center|LOCUS_12990 17625 17422 gene locus_tag LOCUS_13000 17625 17422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 17906 17640 gene locus_tag LOCUS_13010 17906 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 19054 17903 gene locus_tag LOCUS_13020 19054 17903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 19516 19058 gene locus_tag LOCUS_13030 gene rplS 19516 19058 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670222.1 protein_id gnl|my_center|LOCUS_13030 20308 19526 gene locus_tag LOCUS_13040 gene trmD 20308 19526 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670221.1 protein_id gnl|my_center|LOCUS_13040 20897 20313 gene locus_tag LOCUS_13050 20897 20313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 21136 20903 gene locus_tag LOCUS_13060 21136 20903 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_13060 21406 21152 gene locus_tag LOCUS_13070 gene rpsP 21406 21152 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670213.1 protein_id gnl|my_center|LOCUS_13070 22232 21534 gene locus_tag LOCUS_13080 22232 21534 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_13080 22934 22305 gene locus_tag LOCUS_13090 22934 22305 CDS product CatA-like O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021707.1 protein_id gnl|my_center|LOCUS_13090 23556 24710 gene locus_tag LOCUS_13100 gene hisC 23556 24710 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966312.1 protein_id gnl|my_center|LOCUS_13100 24767 25459 gene locus_tag LOCUS_13110 24767 25459 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680480.1 protein_id gnl|my_center|LOCUS_13110 26607 25594 gene locus_tag LOCUS_13120 26607 25594 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_13120 26913 27359 gene locus_tag LOCUS_13130 26913 27359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 28927 27437 gene locus_tag LOCUS_13140 28927 27437 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_13140 29477 30751 gene locus_tag LOCUS_13150 29477 30751 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_13150 33311 31341 gene locus_tag LOCUS_13160 33311 31341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 33949 33437 gene locus_tag LOCUS_13170 33949 33437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 35784 33946 gene locus_tag LOCUS_13180 35784 33946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence23 124 714 gene locus_tag LOCUS_13190 124 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2890 1214 gene locus_tag LOCUS_13200 2890 1214 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_13200 4109 3891 gene locus_tag LOCUS_13210 4109 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 4331 4546 gene locus_tag LOCUS_13220 4331 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 5460 4582 gene locus_tag LOCUS_13230 5460 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 6635 5514 gene locus_tag LOCUS_13240 6635 5514 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_13240 7419 6724 gene locus_tag LOCUS_13250 7419 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 8202 8047 gene locus_tag LOCUS_13260 8202 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 9541 8156 gene locus_tag LOCUS_13270 9541 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 9681 9538 gene locus_tag LOCUS_13280 9681 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 10851 10102 gene locus_tag LOCUS_13290 10851 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 11379 11452 gene locus_tag LOCUS_t00200 11379 11452 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12148 11534 gene locus_tag LOCUS_13300 12148 11534 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964405.1 protein_id gnl|my_center|LOCUS_13300 12241 13197 gene locus_tag LOCUS_13310 gene argC 12241 13197 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_13310 14597 13248 gene locus_tag LOCUS_13320 14597 13248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 15047 14802 gene locus_tag LOCUS_13330 15047 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 15369 15076 gene locus_tag LOCUS_13340 15369 15076 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671537.1 protein_id gnl|my_center|LOCUS_13340 16301 15528 gene locus_tag LOCUS_13350 16301 15528 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016563.1 protein_id gnl|my_center|LOCUS_13350 17309 16656 gene locus_tag LOCUS_13360 17309 16656 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016564.1 protein_id gnl|my_center|LOCUS_13360 18155 17394 gene locus_tag LOCUS_13370 18155 17394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 18448 18376 gene locus_tag LOCUS_t00210 18448 18376 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19314 18871 gene locus_tag LOCUS_13380 19314 18871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 21254 19305 gene locus_tag LOCUS_13390 21254 19305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 21901 22224 gene locus_tag LOCUS_13400 21901 22224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 22383 25328 gene locus_tag LOCUS_13410 gene polA 22383 25328 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679321.1 protein_id gnl|my_center|LOCUS_13410 25298 25930 gene locus_tag LOCUS_13420 gene coaE 25298 25930 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679322.1 protein_id gnl|my_center|LOCUS_13420 29486 26145 gene locus_tag LOCUS_13430 29486 26145 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682325.1 protein_id gnl|my_center|LOCUS_13430 32369 29532 gene locus_tag LOCUS_13440 gene uvrA 32369 29532 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956862.1 protein_id gnl|my_center|LOCUS_13440 33600 32425 gene locus_tag LOCUS_13450 33600 32425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 34868 33588 gene locus_tag LOCUS_13460 gene larC 34868 33588 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_13460 35583 34885 gene locus_tag LOCUS_13470 gene larB 35583 34885 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence24 314 3049 gene locus_tag LOCUS_13480 314 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3087 3458 gene locus_tag LOCUS_13490 3087 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 3478 4761 gene locus_tag LOCUS_13500 3478 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 4954 5232 gene locus_tag LOCUS_13510 4954 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6491 5781 gene locus_tag LOCUS_13520 6491 5781 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_13520 7131 6469 gene locus_tag LOCUS_13530 7131 6469 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384085.1 protein_id gnl|my_center|LOCUS_13530 7921 9210 gene locus_tag LOCUS_13540 7921 9210 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_13540 9361 10818 gene locus_tag LOCUS_13550 9361 10818 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681057.1 protein_id gnl|my_center|LOCUS_13550 12194 10896 gene locus_tag LOCUS_13560 12194 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 12344 14725 gene locus_tag LOCUS_13570 12344 14725 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671244.1 protein_id gnl|my_center|LOCUS_13570 14745 16163 gene locus_tag LOCUS_13580 14745 16163 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671242.1 protein_id gnl|my_center|LOCUS_13580 16175 16657 gene locus_tag LOCUS_13590 16175 16657 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668974.1 protein_id gnl|my_center|LOCUS_13590 16671 17105 gene locus_tag LOCUS_13600 16671 17105 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668975.1 protein_id gnl|my_center|LOCUS_13600 17916 17278 gene locus_tag LOCUS_13610 17916 17278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 17949 19160 gene locus_tag LOCUS_13620 17949 19160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 19170 19940 gene locus_tag LOCUS_13630 19170 19940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 20067 21110 gene locus_tag LOCUS_13640 20067 21110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668143.1 protein_id gnl|my_center|LOCUS_13640 21158 22087 gene locus_tag LOCUS_13650 21158 22087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 22409 23929 gene locus_tag LOCUS_13660 22409 23929 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_13660 23984 24835 gene locus_tag LOCUS_13670 gene uppP 23984 24835 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_13670 24990 25850 gene locus_tag LOCUS_13680 24990 25850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 25956 26429 gene locus_tag LOCUS_13690 25956 26429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 26744 26499 gene locus_tag LOCUS_13700 26744 26499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 26945 26872 gene locus_tag LOCUS_t00220 26945 26872 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 29410 27158 gene locus_tag LOCUS_13710 29410 27158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 30702 29416 gene locus_tag LOCUS_13720 gene murA 30702 29416 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669886.1 protein_id gnl|my_center|LOCUS_13720 32162 30885 gene locus_tag LOCUS_13730 gene pepT 32162 30885 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002164459.1 protein_id gnl|my_center|LOCUS_13730 <33247 32558 gene locus_tag LOCUS_13740 <33247 32558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109382.1:type I pullulanase >Feature sequence25 289 359 gene locus_tag LOCUS_t00230 289 359 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1150 425 gene locus_tag LOCUS_13750 1150 425 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_13750 2128 3093 gene locus_tag LOCUS_13760 gene rsgA 2128 3093 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679106.1 protein_id gnl|my_center|LOCUS_13760 3118 5634 gene locus_tag LOCUS_13770 3118 5634 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679109.1 protein_id gnl|my_center|LOCUS_13770 6924 5650 gene locus_tag LOCUS_13780 6924 5650 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681866.1 protein_id gnl|my_center|LOCUS_13780 7230 8681 gene locus_tag LOCUS_13790 gene asnS 7230 8681 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682293.1 protein_id gnl|my_center|LOCUS_13790 8715 9980 gene locus_tag LOCUS_13800 8715 9980 CDS product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681017.1 protein_id gnl|my_center|LOCUS_13800 10919 9999 gene locus_tag LOCUS_13810 10919 9999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 12703 11153 gene locus_tag LOCUS_13820 gene murD 12703 11153 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956725.1 protein_id gnl|my_center|LOCUS_13820 13942 12815 gene locus_tag LOCUS_13830 13942 12815 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680316.1 protein_id gnl|my_center|LOCUS_13830 15998 14196 gene locus_tag LOCUS_13840 15998 14196 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682087.1 protein_id gnl|my_center|LOCUS_13840 17033 16230 gene locus_tag LOCUS_13850 17033 16230 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039647756.1 protein_id gnl|my_center|LOCUS_13850 17964 17020 gene locus_tag LOCUS_13860 17964 17020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940886.1 protein_id gnl|my_center|LOCUS_13860 19047 18058 gene locus_tag LOCUS_13870 19047 18058 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940885.1 protein_id gnl|my_center|LOCUS_13870 19734 21050 gene locus_tag LOCUS_13880 19734 21050 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_13880 21317 24955 gene locus_tag LOCUS_13890 gene dnaE 21317 24955 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957315.1 protein_id gnl|my_center|LOCUS_13890 25291 25022 gene locus_tag LOCUS_13900 25291 25022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 25600 27762 gene locus_tag LOCUS_13910 gene recG 25600 27762 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680562.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence26 1841 333 gene locus_tag LOCUS_13920 gene gltA 1841 333 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681438.1 protein_id gnl|my_center|LOCUS_13920 2699 1851 gene locus_tag LOCUS_13930 2699 1851 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_13930 3170 4141 gene locus_tag LOCUS_13940 gene galE 3170 4141 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931718.1 protein_id gnl|my_center|LOCUS_13940 4197 4478 gene locus_tag LOCUS_13950 4197 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 4636 6045 gene locus_tag LOCUS_13960 4636 6045 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666804.1 protein_id gnl|my_center|LOCUS_13960 6042 7682 gene locus_tag LOCUS_13970 6042 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 7983 8549 gene locus_tag LOCUS_13980 7983 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 8757 10037 gene locus_tag LOCUS_13990 8757 10037 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679693.1 protein_id gnl|my_center|LOCUS_13990 10121 11104 gene locus_tag LOCUS_14000 10121 11104 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_14000 11114 12100 gene locus_tag LOCUS_14010 11114 12100 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_14010 12112 12906 gene locus_tag LOCUS_14020 12112 12906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_14020 13132 14064 gene locus_tag LOCUS_14030 gene trxB 13132 14064 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288072.1 protein_id gnl|my_center|LOCUS_14030 14077 15780 gene locus_tag LOCUS_14040 14077 15780 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680883.1 protein_id gnl|my_center|LOCUS_14040 15973 17712 gene locus_tag LOCUS_14050 15973 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 17776 17967 gene locus_tag LOCUS_14060 17776 17967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 18158 20095 gene locus_tag LOCUS_14070 18158 20095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 21428 20121 gene locus_tag LOCUS_14080 21428 20121 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582926.1 protein_id gnl|my_center|LOCUS_14080 22052 21465 gene locus_tag LOCUS_14090 22052 21465 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_14090 22729 22049 gene locus_tag LOCUS_14100 22729 22049 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_14100 24365 23001 gene locus_tag LOCUS_14110 24365 23001 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992247.1 protein_id gnl|my_center|LOCUS_14110 25455 24517 gene locus_tag LOCUS_14120 25455 24517 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_14120 27008 25455 gene locus_tag LOCUS_14130 27008 25455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 28408 27146 gene locus_tag LOCUS_14140 28408 27146 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061490.1 protein_id gnl|my_center|LOCUS_14140 30260 28692 gene locus_tag LOCUS_14150 gene malQ 30260 28692 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680318.1 protein_id gnl|my_center|LOCUS_14150 30414 >31128 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atctacaacagtagaaattttgtattggtttcaaac >Feature sequence27 621 1487 gene locus_tag LOCUS_14160 621 1487 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817328.1 protein_id gnl|my_center|LOCUS_14160 1650 2288 gene locus_tag LOCUS_14170 gene thiE 1650 2288 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_14170 3212 2454 gene locus_tag LOCUS_14180 3212 2454 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680208.1 protein_id gnl|my_center|LOCUS_14180 3544 5286 gene locus_tag LOCUS_14190 3544 5286 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_14190 5371 5961 gene locus_tag LOCUS_14200 5371 5961 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_14200 5967 6911 gene locus_tag LOCUS_14210 5967 6911 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_14210 7546 8130 gene locus_tag LOCUS_14220 gene def 7546 8130 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669259.1 protein_id gnl|my_center|LOCUS_14220 8202 9188 gene locus_tag LOCUS_14230 gene fmt 8202 9188 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679327.1 protein_id gnl|my_center|LOCUS_14230 9469 9239 gene locus_tag LOCUS_14240 9469 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 9422 11518 gene locus_tag LOCUS_14250 gene fusA 9422 11518 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_14250 11918 12595 gene locus_tag LOCUS_14260 11918 12595 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670541.1 protein_id gnl|my_center|LOCUS_14260 12734 13576 gene locus_tag LOCUS_14270 12734 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 13581 15749 gene locus_tag LOCUS_14280 13581 15749 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886474.1 protein_id gnl|my_center|LOCUS_14280 15764 16354 gene locus_tag LOCUS_14290 15764 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 16366 16896 gene locus_tag LOCUS_14300 16366 16896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 17072 17143 gene locus_tag LOCUS_t00240 17072 17143 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 17631 17323 gene locus_tag LOCUS_14310 gene trxA 17631 17323 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_14310 19659 17965 gene locus_tag LOCUS_14320 19659 17965 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680894.1 protein_id gnl|my_center|LOCUS_14320 20137 21996 gene locus_tag LOCUS_14330 gene dnaX 20137 21996 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957269.1 protein_id gnl|my_center|LOCUS_14330 22048 22374 gene locus_tag LOCUS_14340 22048 22374 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669078.1 protein_id gnl|my_center|LOCUS_14340 22388 22978 gene locus_tag LOCUS_14350 gene recR 22388 22978 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956990.1 protein_id gnl|my_center|LOCUS_14350 22997 23659 gene locus_tag LOCUS_14360 22997 23659 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681594.1 protein_id gnl|my_center|LOCUS_14360 23694 25691 gene locus_tag LOCUS_14370 gene uvrB 23694 25691 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678935.1 protein_id gnl|my_center|LOCUS_14370 25917 26735 gene locus_tag LOCUS_14380 25917 26735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 26906 29017 gene locus_tag LOCUS_14390 26906 29017 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680161.1 protein_id gnl|my_center|LOCUS_14390 <30131 29322 gene locus_tag LOCUS_14400 <30131 29322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020424.1:DUF362 domain-containing protein >Feature sequence28 1321 251 gene locus_tag LOCUS_14410 1321 251 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_14410 2978 1353 gene locus_tag LOCUS_14420 gene purH 2978 1353 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385254.1 protein_id gnl|my_center|LOCUS_14420 4412 3054 gene locus_tag LOCUS_14430 gene aroA 4412 3054 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 protein_id gnl|my_center|LOCUS_14430 5063 4979 gene locus_tag LOCUS_t00250 5063 4979 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5141 7018 gene locus_tag LOCUS_14440 gene recQ 5141 7018 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681287.1 protein_id gnl|my_center|LOCUS_14440 8368 7040 gene locus_tag LOCUS_14450 8368 7040 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_14450 8742 9509 gene locus_tag LOCUS_14460 gene folE2 8742 9509 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_14460 9609 11339 gene locus_tag LOCUS_14470 gene ilvB 9609 11339 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_14470 11400 12455 gene locus_tag LOCUS_14480 11400 12455 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861644.1 protein_id gnl|my_center|LOCUS_14480 12523 12888 gene locus_tag LOCUS_14490 12523 12888 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_14490 12983 14479 gene locus_tag LOCUS_14500 12983 14479 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680713.1 protein_id gnl|my_center|LOCUS_14500 14684 15913 gene locus_tag LOCUS_14510 14684 15913 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680921.1 protein_id gnl|my_center|LOCUS_14510 16455 15961 gene locus_tag LOCUS_14520 16455 15961 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_14520 17020 16469 gene locus_tag LOCUS_14530 17020 16469 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_14530 17256 18899 gene locus_tag LOCUS_14540 gene cimA 17256 18899 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_14540 18992 20359 gene locus_tag LOCUS_14550 18992 20359 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_14550 21341 20670 gene locus_tag LOCUS_14560 21341 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 22450 21428 gene locus_tag LOCUS_14570 22450 21428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 23558 22575 gene locus_tag LOCUS_14580 23558 22575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 24774 23797 gene locus_tag LOCUS_14590 24774 23797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 24939 25250 gene locus_tag LOCUS_14600 24939 25250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 26286 25408 gene locus_tag LOCUS_14610 gene folD 26286 25408 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_14610 26384 26980 gene locus_tag LOCUS_14620 26384 26980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 26991 28457 gene locus_tag LOCUS_14630 26991 28457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence29 175 501 gene locus_tag LOCUS_14640 175 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 3123 1264 gene locus_tag LOCUS_14650 3123 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 3619 3266 gene locus_tag LOCUS_14660 3619 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 4324 3818 gene locus_tag LOCUS_14670 4324 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 5476 4643 gene locus_tag LOCUS_14680 5476 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 5783 7054 gene locus_tag LOCUS_14690 5783 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 7276 9540 gene locus_tag LOCUS_14700 7276 9540 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957228.1 protein_id gnl|my_center|LOCUS_14700 9552 10271 gene locus_tag LOCUS_14710 9552 10271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 10977 10327 gene locus_tag LOCUS_14720 10977 10327 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682388.1 protein_id gnl|my_center|LOCUS_14720 11322 11513 gene locus_tag LOCUS_14730 11322 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 12095 11478 gene locus_tag LOCUS_14740 12095 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 12167 13243 gene locus_tag LOCUS_14750 12167 13243 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920597.1 protein_id gnl|my_center|LOCUS_14750 13575 14096 gene locus_tag LOCUS_14760 13575 14096 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671188.1 protein_id gnl|my_center|LOCUS_14760 14110 14544 gene locus_tag LOCUS_14770 14110 14544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 14890 14675 gene locus_tag LOCUS_14780 14890 14675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 16065 14893 gene locus_tag LOCUS_14790 16065 14893 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14790 16493 17701 gene locus_tag LOCUS_14800 gene aroC 16493 17701 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_14800 17688 19136 gene locus_tag LOCUS_14810 17688 19136 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682292.1 protein_id gnl|my_center|LOCUS_14810 19821 19492 gene locus_tag LOCUS_14820 19821 19492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 19983 20573 gene locus_tag LOCUS_14830 19983 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 20626 21291 gene locus_tag LOCUS_14840 20626 21291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 21753 22874 gene locus_tag LOCUS_14850 21753 22874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 23228 23070 gene locus_tag LOCUS_14860 23228 23070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 23254 23583 gene locus_tag LOCUS_14870 23254 23583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 23806 24405 gene locus_tag LOCUS_14880 23806 24405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 24444 25187 gene locus_tag LOCUS_14890 24444 25187 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254619.1 protein_id gnl|my_center|LOCUS_14890 25342 26301 gene locus_tag LOCUS_14900 gene sppA 25342 26301 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 protein_id gnl|my_center|LOCUS_14900 26983 26411 gene locus_tag LOCUS_14910 26983 26411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 27442 27050 gene locus_tag LOCUS_14920 gene rpsI 27442 27050 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682117.1 protein_id gnl|my_center|LOCUS_14920 27890 27459 gene locus_tag LOCUS_14930 gene rplM 27890 27459 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682116.1 protein_id gnl|my_center|LOCUS_14930 28288 28052 gene locus_tag LOCUS_14940 28288 28052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence30 883 161 gene locus_tag LOCUS_14950 883 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1787 1044 gene locus_tag LOCUS_14960 1787 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2722 1982 gene locus_tag LOCUS_14970 2722 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5878 2837 gene locus_tag LOCUS_14980 5878 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 10169 6063 gene locus_tag LOCUS_14990 10169 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14990 10787 10182 gene locus_tag LOCUS_15000 10787 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15000 13469 10800 gene locus_tag LOCUS_15010 13469 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15010 14118 13765 gene locus_tag LOCUS_15020 14118 13765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 14627 14115 gene locus_tag LOCUS_15030 14627 14115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 16167 14653 gene locus_tag LOCUS_15040 16167 14653 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837651.1 protein_id gnl|my_center|LOCUS_15040 17168 16170 gene locus_tag LOCUS_15050 17168 16170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 17952 17209 gene locus_tag LOCUS_15060 17952 17209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 18825 18106 gene locus_tag LOCUS_15070 18825 18106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 19831 22542 gene locus_tag LOCUS_15080 19831 22542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 23213 23917 gene locus_tag LOCUS_15090 23213 23917 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 protein_id gnl|my_center|LOCUS_15090 24462 24184 gene locus_tag LOCUS_15100 24462 24184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 24862 25044 gene locus_tag LOCUS_15110 24862 25044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 25234 26169 gene locus_tag LOCUS_15120 25234 26169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence31 1857 1027 gene locus_tag LOCUS_15130 1857 1027 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460948.1 protein_id gnl|my_center|LOCUS_15130 2088 1870 gene locus_tag LOCUS_15140 2088 1870 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903516.1 protein_id gnl|my_center|LOCUS_15140 2555 2208 gene locus_tag LOCUS_15150 2555 2208 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_15150 2850 2771 gene locus_tag LOCUS_t00260 2850 2771 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2972 2886 gene locus_tag LOCUS_t00270 2972 2886 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3069 2981 gene locus_tag LOCUS_t00280 3069 2981 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3386 3667 gene locus_tag LOCUS_15160 3386 3667 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681558.1 protein_id gnl|my_center|LOCUS_15160 3691 4260 gene locus_tag LOCUS_15170 3691 4260 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 protein_id gnl|my_center|LOCUS_15170 4875 4309 gene locus_tag LOCUS_15180 4875 4309 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_15180 5118 4927 gene locus_tag LOCUS_15190 5118 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 6806 5676 gene locus_tag LOCUS_15200 6806 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 8640 6799 gene locus_tag LOCUS_15210 8640 6799 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957184.1 protein_id gnl|my_center|LOCUS_15210 9476 8973 gene locus_tag LOCUS_15220 gene nrdG 9476 8973 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287943.1 protein_id gnl|my_center|LOCUS_15220 11659 9494 gene locus_tag LOCUS_15230 gene nrdD 11659 9494 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263171.1 protein_id gnl|my_center|LOCUS_15230 12909 11779 gene locus_tag LOCUS_15240 gene ychF 12909 11779 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666350.1 protein_id gnl|my_center|LOCUS_15240 13747 14433 gene locus_tag LOCUS_15250 13747 14433 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680200.1 protein_id gnl|my_center|LOCUS_15250 14423 15616 gene locus_tag LOCUS_15260 14423 15616 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_15260 16778 15684 gene locus_tag LOCUS_15270 gene leuB 16778 15684 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_15270 16994 18280 gene locus_tag LOCUS_15280 16994 18280 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_15280 18400 18813 gene locus_tag LOCUS_15290 18400 18813 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356138.1 protein_id gnl|my_center|LOCUS_15290 18868 19800 gene locus_tag LOCUS_15300 gene cysK 18868 19800 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_15300 20137 19865 gene locus_tag LOCUS_15310 20137 19865 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670325.1 protein_id gnl|my_center|LOCUS_15310 20494 21330 gene locus_tag LOCUS_15320 20494 21330 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670326.1 protein_id gnl|my_center|LOCUS_15320 21651 22811 gene locus_tag LOCUS_15330 21651 22811 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_15330 24562 22907 gene locus_tag LOCUS_15340 24562 22907 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943604.1 protein_id gnl|my_center|LOCUS_15340 25962 24637 gene locus_tag LOCUS_15350 25962 24637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence32 1705 305 gene locus_tag LOCUS_15360 gene miaB 1705 305 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679246.1 protein_id gnl|my_center|LOCUS_15360 2763 1768 gene locus_tag LOCUS_15370 2763 1768 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_15370 4881 2995 gene locus_tag LOCUS_15380 4881 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 5858 4878 gene locus_tag LOCUS_15390 5858 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 6855 5872 gene locus_tag LOCUS_15400 6855 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 8013 6856 gene locus_tag LOCUS_15410 8013 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 8468 8010 gene locus_tag LOCUS_15420 8468 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 9415 8504 gene locus_tag LOCUS_15430 9415 8504 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680076.1 protein_id gnl|my_center|LOCUS_15430 10004 11362 gene locus_tag LOCUS_15440 gene gdhA 10004 11362 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_15440 12322 11567 gene locus_tag LOCUS_15450 12322 11567 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 protein_id gnl|my_center|LOCUS_15450 13045 12368 gene locus_tag LOCUS_15460 13045 12368 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940990.1 protein_id gnl|my_center|LOCUS_15460 14252 13362 gene locus_tag LOCUS_15470 14252 13362 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_15470 15750 14320 gene locus_tag LOCUS_15480 gene argH 15750 14320 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_15480 16958 15891 gene locus_tag LOCUS_15490 16958 15891 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_15490 17943 19256 gene locus_tag LOCUS_15500 17943 19256 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_15500 19626 20099 gene locus_tag LOCUS_15510 19626 20099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 20341 21660 gene locus_tag LOCUS_15520 20341 21660 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582595.1 protein_id gnl|my_center|LOCUS_15520 23293 21689 gene locus_tag LOCUS_15530 gene modF 23293 21689 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096900.1 protein_id gnl|my_center|LOCUS_15530 24841 23306 gene locus_tag LOCUS_15540 gene putP 24841 23306 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_15540 25055 25684 gene locus_tag LOCUS_15550 25055 25684 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599739.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence33 2062 3264 gene locus_tag LOCUS_15560 2062 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 3414 5414 gene locus_tag LOCUS_15570 3414 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 5497 5766 gene locus_tag LOCUS_15580 5497 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 5766 6746 gene locus_tag LOCUS_15590 5766 6746 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675533.1 protein_id gnl|my_center|LOCUS_15590 7033 7863 gene locus_tag LOCUS_15600 7033 7863 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673320.1 protein_id gnl|my_center|LOCUS_15600 8120 8536 gene locus_tag LOCUS_15610 8120 8536 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764905.1 protein_id gnl|my_center|LOCUS_15610 8727 12761 gene locus_tag LOCUS_15620 8727 12761 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_15620 12904 14028 gene locus_tag LOCUS_15630 12904 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 14032 15303 gene locus_tag LOCUS_15640 14032 15303 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_15640 15296 16564 gene locus_tag LOCUS_15650 15296 16564 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681279.1 protein_id gnl|my_center|LOCUS_15650 17976 16597 gene locus_tag LOCUS_15660 17976 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 18701 17982 gene locus_tag LOCUS_15670 gene rpiA 18701 17982 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679325.1 protein_id gnl|my_center|LOCUS_15670 20404 18863 gene locus_tag LOCUS_15680 20404 18863 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679324.1 protein_id gnl|my_center|LOCUS_15680 21847 20672 gene locus_tag LOCUS_15690 21847 20672 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678383.1 protein_id gnl|my_center|LOCUS_15690 23603 22140 gene locus_tag LOCUS_15700 23603 22140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 <25494 24648 gene locus_tag LOCUS_15710 <25494 24648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000921725.1:type I pullulanase >Feature sequence34 2664 652 gene locus_tag LOCUS_15720 2664 652 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682194.1 protein_id gnl|my_center|LOCUS_15720 3282 4793 gene locus_tag LOCUS_15730 3282 4793 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_15730 5230 6294 gene locus_tag LOCUS_15740 5230 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 6472 9735 gene locus_tag LOCUS_15750 6472 9735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 9758 9946 gene locus_tag LOCUS_15760 9758 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 10111 10302 gene locus_tag LOCUS_15770 10111 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 10352 10424 gene locus_tag LOCUS_t00290 10352 10424 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10848 11690 gene locus_tag LOCUS_15780 10848 11690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 11703 12848 gene locus_tag LOCUS_15790 11703 12848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957140.1 protein_id gnl|my_center|LOCUS_15790 13514 14185 gene locus_tag LOCUS_15800 13514 14185 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670630.1 protein_id gnl|my_center|LOCUS_15800 14211 15815 gene locus_tag LOCUS_15810 14211 15815 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682403.1 protein_id gnl|my_center|LOCUS_15810 15838 16368 gene locus_tag LOCUS_15820 15838 16368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 16443 16670 gene locus_tag LOCUS_15830 gene rpmB 16443 16670 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670427.1 protein_id gnl|my_center|LOCUS_15830 17538 16738 gene locus_tag LOCUS_15840 17538 16738 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_15840 19452 17656 gene locus_tag LOCUS_15850 gene pyk 19452 17656 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869581.1 protein_id gnl|my_center|LOCUS_15850 21333 19501 gene locus_tag LOCUS_15860 21333 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 22020 21406 gene locus_tag LOCUS_15870 gene radC 22020 21406 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682286.1 protein_id gnl|my_center|LOCUS_15870 23412 22318 gene locus_tag LOCUS_15880 23412 22318 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804254.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence35 2155 3765 gene locus_tag LOCUS_15890 2155 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 3916 5991 gene locus_tag LOCUS_15900 3916 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 6067 6816 gene locus_tag LOCUS_15910 6067 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 6833 9547 gene locus_tag LOCUS_15920 6833 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 10818 9655 gene locus_tag LOCUS_15930 10818 9655 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_15930 11124 11129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12655 11261 gene locus_tag LOCUS_15940 12655 11261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 12859 12784 gene locus_tag LOCUS_t00300 12859 12784 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12986 13990 gene locus_tag LOCUS_15950 12986 13990 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047796704.1 protein_id gnl|my_center|LOCUS_15950 13990 14754 gene locus_tag LOCUS_15960 13990 14754 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213908.1 protein_id gnl|my_center|LOCUS_15960 14751 15569 gene locus_tag LOCUS_15970 14751 15569 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_15970 16317 15544 gene locus_tag LOCUS_15980 16317 15544 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957298.1 protein_id gnl|my_center|LOCUS_15980 16837 17592 gene locus_tag LOCUS_15990 16837 17592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681806.1 protein_id gnl|my_center|LOCUS_15990 18376 17609 gene locus_tag LOCUS_16000 18376 17609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 20190 18478 gene locus_tag LOCUS_16010 20190 18478 CDS product DUF5312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680846.1 protein_id gnl|my_center|LOCUS_16010 21299 20307 gene locus_tag LOCUS_16020 21299 20307 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680474.1 protein_id gnl|my_center|LOCUS_16020 21694 21299 gene locus_tag LOCUS_16030 21694 21299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence36 849 430 gene locus_tag LOCUS_16040 849 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1786 956 gene locus_tag LOCUS_16050 1786 956 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_16050 2230 2919 gene locus_tag LOCUS_16060 2230 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 3324 3004 gene locus_tag LOCUS_16070 3324 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 3608 3360 gene locus_tag LOCUS_16080 3608 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 4009 3605 gene locus_tag LOCUS_16090 4009 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 5012 4041 gene locus_tag LOCUS_16100 5012 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 6118 5009 gene locus_tag LOCUS_16110 6118 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 7335 6571 gene locus_tag LOCUS_16120 7335 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 8176 7355 gene locus_tag LOCUS_16130 8176 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 8821 8228 gene locus_tag LOCUS_16140 8821 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 9543 8887 gene locus_tag LOCUS_16150 9543 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 11135 9540 gene locus_tag LOCUS_16160 11135 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 11246 11566 gene locus_tag LOCUS_16170 11246 11566 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667543.1 protein_id gnl|my_center|LOCUS_16170 12204 12001 gene locus_tag LOCUS_16180 12204 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 12307 13074 gene locus_tag LOCUS_16190 12307 13074 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005000.1 protein_id gnl|my_center|LOCUS_16190 13255 14082 gene locus_tag LOCUS_16200 13255 14082 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765262.1 protein_id gnl|my_center|LOCUS_16200 14746 15948 gene locus_tag LOCUS_16210 14746 15948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 16101 17063 gene locus_tag LOCUS_16220 16101 17063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 17060 20182 gene locus_tag LOCUS_16230 17060 20182 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_16230 20318 20593 gene locus_tag LOCUS_16240 20318 20593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence37 104 175 gene locus_tag LOCUS_t00310 104 175 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 237 1595 gene locus_tag LOCUS_16250 gene tig 237 1595 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679366.1 protein_id gnl|my_center|LOCUS_16250 1631 2230 gene locus_tag LOCUS_16260 gene clpP 1631 2230 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679367.1 protein_id gnl|my_center|LOCUS_16260 2227 3492 gene locus_tag LOCUS_16270 gene clpX 2227 3492 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679368.1 protein_id gnl|my_center|LOCUS_16270 4674 3556 gene locus_tag LOCUS_16280 4674 3556 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956987.1 protein_id gnl|my_center|LOCUS_16280 4724 5896 gene locus_tag LOCUS_16290 4724 5896 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986366.1 protein_id gnl|my_center|LOCUS_16290 7232 6297 gene locus_tag LOCUS_16300 7232 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 7968 7246 gene locus_tag LOCUS_16310 7968 7246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 8893 7973 gene locus_tag LOCUS_16320 8893 7973 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379732.1 protein_id gnl|my_center|LOCUS_16320 10584 9010 gene locus_tag LOCUS_16330 10584 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 12484 10619 gene locus_tag LOCUS_16340 12484 10619 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678847.1 protein_id gnl|my_center|LOCUS_16340 12975 12481 gene locus_tag LOCUS_16350 gene lepB 12975 12481 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956947.1 protein_id gnl|my_center|LOCUS_16350 13509 13123 gene locus_tag LOCUS_16360 13509 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 13628 15109 gene locus_tag LOCUS_16370 13628 15109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 15132 16772 gene locus_tag LOCUS_16380 15132 16772 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680487.1 protein_id gnl|my_center|LOCUS_16380 17105 16845 gene locus_tag LOCUS_16390 17105 16845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 18675 17395 gene locus_tag LOCUS_16400 18675 17395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 18803 19168 gene locus_tag LOCUS_16410 18803 19168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence38 504 193 gene locus_tag LOCUS_16420 504 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1394 636 gene locus_tag LOCUS_16430 1394 636 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811567.1 protein_id gnl|my_center|LOCUS_16430 1446 2000 gene locus_tag LOCUS_16440 1446 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2039 4222 gene locus_tag LOCUS_16450 2039 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 4225 7788 gene locus_tag LOCUS_16460 4225 7788 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957290.1 protein_id gnl|my_center|LOCUS_16460 8168 8566 gene locus_tag LOCUS_16470 8168 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 10456 8672 gene locus_tag LOCUS_16480 10456 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 10506 11294 gene locus_tag LOCUS_16490 10506 11294 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793718.1 protein_id gnl|my_center|LOCUS_16490 11984 12292 gene locus_tag LOCUS_16500 gene csoR 11984 12292 CDS product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228404.1 protein_id gnl|my_center|LOCUS_16500 12310 14886 gene locus_tag LOCUS_16510 12310 14886 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_16510 14961 15938 gene locus_tag LOCUS_16520 gene hprK 14961 15938 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_16520 15922 16239 gene locus_tag LOCUS_16530 15922 16239 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668605.1 protein_id gnl|my_center|LOCUS_16530 16321 16932 gene locus_tag LOCUS_16540 gene lexA 16321 16932 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654116.1 protein_id gnl|my_center|LOCUS_16540 16941 17954 gene locus_tag LOCUS_16550 gene holA 16941 17954 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681969.1 protein_id gnl|my_center|LOCUS_16550 18277 18050 gene locus_tag LOCUS_16560 18277 18050 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986552.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence39 998 1210 gene locus_tag LOCUS_16570 998 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1203 1460 gene locus_tag LOCUS_16580 1203 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 3847 2075 gene locus_tag LOCUS_16590 3847 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 6155 4068 gene locus_tag LOCUS_16600 6155 4068 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_16600 6691 7920 gene locus_tag LOCUS_16610 6691 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 8146 9036 gene locus_tag LOCUS_16620 8146 9036 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_16620 9152 10330 gene locus_tag LOCUS_16630 9152 10330 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_16630 11662 10679 gene locus_tag LOCUS_16640 gene lgt 11662 10679 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678985.1 protein_id gnl|my_center|LOCUS_16640 13048 11903 gene locus_tag LOCUS_16650 13048 11903 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678981.1 protein_id gnl|my_center|LOCUS_16650 15729 13393 gene locus_tag LOCUS_16660 gene pflB 15729 13393 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_16660 16815 15922 gene locus_tag LOCUS_16670 16815 15922 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920615.1 protein_id gnl|my_center|LOCUS_16670 <17855 17314 gene locus_tag LOCUS_16680 <17855 17314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000921725.1:type I pullulanase >Feature sequence40 324 1418 gene locus_tag LOCUS_16690 324 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1433 7294 gene locus_tag LOCUS_16700 1433 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 7285 9153 gene locus_tag LOCUS_16710 7285 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 9602 9889 gene locus_tag LOCUS_16720 9602 9889 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812262.1 protein_id gnl|my_center|LOCUS_16720 9886 10152 gene locus_tag LOCUS_16730 9886 10152 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681864.1 protein_id gnl|my_center|LOCUS_16730 11694 10480 gene locus_tag LOCUS_16740 11694 10480 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_16740 13285 12359 gene locus_tag LOCUS_16750 13285 12359 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_16750 13869 13291 gene locus_tag LOCUS_16760 13869 13291 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966820.1 protein_id gnl|my_center|LOCUS_16760 14490 13879 gene locus_tag LOCUS_16770 14490 13879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 15520 14492 gene locus_tag LOCUS_16780 15520 14492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 15739 15584 gene locus_tag LOCUS_16790 15739 15584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence41 52 291 gene locus_tag LOCUS_16800 52 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 702 14642 gene locus_tag LOCUS_16810 702 14642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence42 788 144 gene locus_tag LOCUS_16820 788 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 2236 1733 gene locus_tag LOCUS_16830 2236 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 3001 2675 gene locus_tag LOCUS_16840 3001 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 3153 4025 gene locus_tag LOCUS_16850 3153 4025 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_16850 4315 4644 gene locus_tag LOCUS_16860 4315 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 4961 5152 gene locus_tag LOCUS_16870 4961 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 5163 5897 gene locus_tag LOCUS_16880 5163 5897 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064761.1 protein_id gnl|my_center|LOCUS_16880 5938 6957 gene locus_tag LOCUS_16890 5938 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 7376 8212 gene locus_tag LOCUS_16900 7376 8212 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679885.1 protein_id gnl|my_center|LOCUS_16900 8277 9767 gene locus_tag LOCUS_16910 8277 9767 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003289.1 protein_id gnl|my_center|LOCUS_16910 9767 10615 gene locus_tag LOCUS_16920 9767 10615 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679573.1 protein_id gnl|my_center|LOCUS_16920 10596 11333 gene locus_tag LOCUS_16930 10596 11333 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675248.1 protein_id gnl|my_center|LOCUS_16930 11338 12510 gene locus_tag LOCUS_16940 11338 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 12649 13209 gene locus_tag LOCUS_16950 12649 13209 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668265.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence43 317 1177 gene locus_tag LOCUS_16960 317 1177 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_16960 1937 1206 gene locus_tag LOCUS_16970 1937 1206 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016732.1 protein_id gnl|my_center|LOCUS_16970 4219 2129 gene locus_tag LOCUS_16980 gene pnp 4219 2129 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682350.1 protein_id gnl|my_center|LOCUS_16980 4738 4469 gene locus_tag LOCUS_16990 gene rpsO 4738 4469 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671840.1 protein_id gnl|my_center|LOCUS_16990 6142 5444 gene locus_tag LOCUS_17000 gene pyrH 6142 5444 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668261.1 protein_id gnl|my_center|LOCUS_17000 8163 6472 gene locus_tag LOCUS_17010 8163 6472 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680944.1 protein_id gnl|my_center|LOCUS_17010 8839 8156 gene locus_tag LOCUS_17020 8839 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 9374 8820 gene locus_tag LOCUS_17030 9374 8820 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666766.1 protein_id gnl|my_center|LOCUS_17030 11635 9833 gene locus_tag LOCUS_17040 gene pepF 11635 9833 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971600.1 protein_id gnl|my_center|LOCUS_17040 13432 11894 gene locus_tag LOCUS_17050 13432 11894 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682360.1 protein_id gnl|my_center|LOCUS_17050 13422 13733 gene locus_tag LOCUS_17060 13422 13733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 14247 13642 gene locus_tag LOCUS_17070 14247 13642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence44 2489 201 gene locus_tag LOCUS_17080 2489 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3791 2571 gene locus_tag LOCUS_17090 3791 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 4241 3834 gene locus_tag LOCUS_17100 4241 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 5156 4323 gene locus_tag LOCUS_17110 5156 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 6244 5153 gene locus_tag LOCUS_17120 6244 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 7669 6929 gene locus_tag LOCUS_17130 7669 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 8200 7781 gene locus_tag LOCUS_17140 8200 7781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 9371 8403 gene locus_tag LOCUS_17150 9371 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 10359 9379 gene locus_tag LOCUS_17160 10359 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence45 265 582 gene locus_tag LOCUS_17170 265 582 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_17170 785 1657 gene locus_tag LOCUS_17180 gene pdxS 785 1657 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_17180 1664 2230 gene locus_tag LOCUS_17190 gene pdxT 1664 2230 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689963.1 protein_id gnl|my_center|LOCUS_17190 3379 2558 gene locus_tag LOCUS_17200 3379 2558 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_17200 3850 3416 gene locus_tag LOCUS_17210 3850 3416 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348730.1 protein_id gnl|my_center|LOCUS_17210 5412 4135 gene locus_tag LOCUS_17220 5412 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 6955 5870 gene locus_tag LOCUS_17230 6955 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 8112 7030 gene locus_tag LOCUS_17240 8112 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 8537 8674 gene locus_tag LOCUS_17250 8537 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 9066 9419 gene locus_tag LOCUS_17260 9066 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 9439 10419 gene locus_tag LOCUS_17270 9439 10419 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence46 2490 445 gene locus_tag LOCUS_17280 2490 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 5220 2674 gene locus_tag LOCUS_17290 gene clpB 5220 2674 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680241.1 protein_id gnl|my_center|LOCUS_17290 5544 6704 gene locus_tag LOCUS_17300 5544 6704 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_17300 7138 6893 gene locus_tag LOCUS_17310 7138 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 7639 7205 gene locus_tag LOCUS_17320 7639 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 8662 7646 gene locus_tag LOCUS_17330 8662 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 9500 8745 gene locus_tag LOCUS_17340 9500 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 10526 9522 gene locus_tag LOCUS_17350 10526 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence47 889 152 gene locus_tag LOCUS_17360 889 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2023 1076 gene locus_tag LOCUS_17370 2023 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3239 2091 gene locus_tag LOCUS_17380 3239 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 4121 3309 gene locus_tag LOCUS_17390 4121 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 6182 4632 gene locus_tag LOCUS_17400 6182 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 7042 6245 gene locus_tag LOCUS_17410 7042 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 8854 8060 gene locus_tag LOCUS_17420 8854 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 9875 8760 gene locus_tag LOCUS_17430 9875 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 10169 10026 gene locus_tag LOCUS_17440 10169 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence48 2118 3521 gene locus_tag LOCUS_17450 2118 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 3610 6420 gene locus_tag LOCUS_17460 3610 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 6720 8120 gene locus_tag LOCUS_17470 gene radA 6720 8120 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680482.1 protein_id gnl|my_center|LOCUS_17470 8380 8913 gene locus_tag LOCUS_17480 8380 8913 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_17480 9027 9935 gene locus_tag LOCUS_17490 gene era 9027 9935 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679589.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence49 266 2122 gene locus_tag LOCUS_17500 266 2122 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_17500 4012 3191 gene locus_tag LOCUS_17510 4012 3191 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_17510 5576 4413 gene locus_tag LOCUS_17520 5576 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 5699 7114 gene locus_tag LOCUS_17530 5699 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 9441 7762 gene locus_tag LOCUS_17540 9441 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence50 386 679 gene locus_tag LOCUS_17550 386 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 689 907 gene locus_tag LOCUS_17560 689 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1103 1528 gene locus_tag LOCUS_17570 1103 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1540 1941 gene locus_tag LOCUS_17580 1540 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 2514 5468 gene locus_tag LOCUS_17590 2514 5468 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679154.1 protein_id gnl|my_center|LOCUS_17590 5465 5836 gene locus_tag LOCUS_17600 5465 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 5833 7605 gene locus_tag LOCUS_17610 5833 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 7622 8242 gene locus_tag LOCUS_17620 7622 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 8271 9551 gene locus_tag LOCUS_17630 gene serS 8271 9551 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680220.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence51 549 716 gene locus_tag LOCUS_17640 549 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 758 5404 gene locus_tag LOCUS_17650 758 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 5631 5792 gene locus_tag LOCUS_17660 5631 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 5799 6554 gene locus_tag LOCUS_17670 5799 6554 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_17670 7403 6747 gene locus_tag LOCUS_17680 gene rdgB 7403 6747 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957197.1 protein_id gnl|my_center|LOCUS_17680 8474 7437 gene locus_tag LOCUS_17690 8474 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence52 <1 702 gene locus_tag LOCUS_17700 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906091.1:alpha-amylase family glycosyl hydrolase 1680 868 gene locus_tag LOCUS_17710 1680 868 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990045.1 protein_id gnl|my_center|LOCUS_17710 2613 1819 gene locus_tag LOCUS_17720 2613 1819 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890755.1 protein_id gnl|my_center|LOCUS_17720 3179 7294 gene locus_tag LOCUS_17730 3179 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4540 4546 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7437 7664 gene locus_tag LOCUS_17740 7437 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 7645 8031 gene locus_tag LOCUS_17750 7645 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 8115 8426 gene locus_tag LOCUS_17760 8115 8426 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence53 2206 4689 gene locus_tag LOCUS_17770 2206 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 5028 5777 gene locus_tag LOCUS_17780 5028 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence54 63 266 gene locus_tag LOCUS_17790 63 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2132 507 gene locus_tag LOCUS_17800 gene lysS 2132 507 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680521.1 protein_id gnl|my_center|LOCUS_17800 3821 2778 gene locus_tag LOCUS_17810 3821 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence55 164 454 gene locus_tag LOCUS_17820 164 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 617 432 gene locus_tag LOCUS_17830 617 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 898 1476 gene locus_tag LOCUS_17840 898 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2637 2482 gene locus_tag LOCUS_17850 2637 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2636 3802 gene locus_tag LOCUS_17860 2636 3802 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_17860 4301 3957 gene locus_tag LOCUS_17870 4301 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 4448 4654 gene locus_tag LOCUS_17880 4448 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4651 5067 gene locus_tag LOCUS_17890 4651 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890